HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Lachnoanaerobaculum umeaense (GCA_003254255.1)

Select a Genome:
BAKTA Annotations for GCA_003254255.1
Genome Selected: Lachnoanaerobaculum umeaense
ContigsBases CDSrRNA tmRNAtRNA
78 2705257 2496 3 1 45
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 5114 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:2]    |    Number of Records Found: 5114 [11 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
501 QKZH01000002.1 GCA003254255_00214 tRNA open 68038-68111 trnM tRNA-Met(cat)
502 QKZH01000003.1 GCA003254255_00251 CDS open 161-1204 _na     347_aa Fic family protein
503 QKZH01000003.1 GCA003254255_00252 CDS open 1526-1846 _na     106_aa hypothetical protein
504 QKZH01000003.1 GCA003254255_00253 CDS open 1954-2130 _na     58_aa rpsU 30S ribosomal protein S21
505 QKZH01000003.1 GCA003254255_00254 CDS open 2202-3194 _na     330_aa phoH PhoH-like protein
506 QKZH01000003.1 GCA003254255_00255 CDS open 3234-3728 _na     164_aa ybeY rRNA maturation RNase YbeY
507 QKZH01000003.1 GCA003254255_00256 CDS open 3728-5383 _na     551_aa spoVB Polysaccharide biosynthesis protein
508 QKZH01000003.1 GCA003254255_00257 CDS open 5380-6594 _na     404_aa yhiN Flavoprotein family protein
509 QKZH01000003.1 GCA003254255_00258 CDS open 6605-8221 _na     538_aa FAD-dependent oxidoreductase
510 QKZH01000003.1 GCA003254255_00259 CDS open 8223-9059 _na     278_aa proB Glutamate 5-kinase
511 QKZH01000003.1 GCA003254255_00260 CDS open 9067-9285 _na     72_aa ynzC UPF0291 protein HMPREF1135_00460
512 QKZH01000003.1 GCA003254255_00261 CDS open 9278-9844 _na     188_aa fAU1 5-formyltetrahydrofolate cyclo-ligase
513 QKZH01000003.1 GCA003254255_00262 CDS open 9899-11326 _na     475_aa miaB tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB
514 QKZH01000003.1 GCA003254255_00263 CDS open 11327-13975 _na     882_aa mutS DNA mismatch repair protein MutS
515 QKZH01000003.1 GCA003254255_00264 CDS open 13980-15965 _na     661_aa mutL DNA mismatch repair endonuclease MutL
516 QKZH01000003.1 GCA003254255_00265 CDS open 15962-16912 _na     316_aa miaA tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA
517 QKZH01000003.1 GCA003254255_00266 CDS open 16905-18185 _na     426_aa ynbB Aluminum resistance protein
518 QKZH01000003.1 GCA003254255_00267 CDS open 18333-19022 _na     229_aa radC DNA repair protein RadC
519 QKZH01000003.1 GCA003254255_00268 CDS open 19022-19852 _na     276_aa mreC rod shape-determining protein MreC
520 QKZH01000003.1 GCA003254255_00269 CDS open 19853-20362 _na     169_aa mreD rod shape-determining protein MreD
521 QKZH01000003.1 GCA003254255_00270 CDS open 20362-23235 _na     957_aa ftsI Penicillin-binding protein transpeptidase domain-containing protein
522 QKZH01000003.1 GCA003254255_00271 CDS open 23313-24434 _na     373_aa ftsW Rod shape-determining protein RodA
523 QKZH01000003.1 GCA003254255_00272 CDS open 24450-24845 _na     131_aa mgsA methylglyoxal synthase
524 QKZH01000003.1 GCA003254255_00273 CDS open 24851-25837 _na     328_aa dacC D-alanyl-D-alanine carboxypeptidase
525 QKZH01000003.1 GCA003254255_00274 CDS open 25910-26329 _na     139_aa pilT Twitching motility protein PilT
526 QKZH01000003.1 GCA003254255_00275 CDS open 26522-27910 _na     462_aa hlyD Secretion protein HlyD
527 QKZH01000003.1 GCA003254255_00276 CDS open 27922-28602 _na     226_aa yggS Pyridoxal phosphate homeostasis protein
528 QKZH01000003.1 GCA003254255_00277 CDS open 28621-29121 _na     166_aa sepF Cell division protein SepF
529 QKZH01000003.1 GCA003254255_00278 CDS open 29075-29881 _na     268_aa ylmH YlmH family RNA-binding protein
530 QKZH01000003.1 GCA003254255_00279 CDS open 29891-30979 _na     362_aa aroB 3-dehydroquinate synthase
531 QKZH01000003.1 GCA003254255_00280 CDS open 30964-31464 _na     166_aa lspA signal peptidase II
532 QKZH01000003.1 GCA003254255_00281 CDS open 31482-32396 _na     304_aa rluA Pseudouridine synthase
533 QKZH01000003.1 GCA003254255_00282 CDS open 32561-33187 _na     208_aa cmkB Cytidylate kinase
534 QKZH01000003.1 GCA003254255_00283 CDS open 33184-34248 _na     354_aa amiC N-acetylmuramoyl-L-alanine amidase
535 QKZH01000003.1 GCA003254255_00284 CDS open 34280-36259 _na     659_aa Zinc ribbon domain-containing protein
536 QKZH01000003.1 GCA003254255_00285 CDS open 36275-37237 _na     320_aa Zinc ribbon domain-containing protein
537 QKZH01000003.1 GCA003254255_00286 CDS open 37377-39101 _na     574_aa cps2a LytR family transcriptional regulator
538 QKZH01000003.1 GCA003254255_00287 CDS open 39115-39822 _na     235_aa ompR Stage 0 sporulation A-like protein
539 QKZH01000003.1 GCA003254255_00288 CDS open 39812-40945 _na     377_aa hAMP histidine kinase
540 QKZH01000003.1 GCA003254255_00289 CDS open 40914-43352 _na     812_aa Membrane-associated protein
541 QKZH01000003.1 GCA003254255_00290 CDS open 43353-44303 _na     316_aa rbbA ABC transporter ATP-binding protein
542 QKZH01000003.1 GCA003254255_00291 CDS open 44293-45168 _na     291_aa ABC transporter
543 QKZH01000003.1 GCA003254255_00292 CDS open 45149-46417 _na     422_aa rPC10 Zinc ribbon domain-containing protein
544 QKZH01000003.1 GCA003254255_00293 CDS open 46520-48019 _na     499_aa thrC threonine synthase
545 QKZH01000003.1 GCA003254255_00294 CDS open 48022-48885 _na     287_aa fba class II fructose-1%2C6-bisphosphate aldolase
546 QKZH01000003.1 GCA003254255_00295 CDS open 49039-50364 _na     441_aa rarA Replication-associated recombination protein A
547 QKZH01000003.1 GCA003254255_00296 CDS open 50371-52074 _na     567_aa rho transcription termination factor Rho
548 QKZH01000003.1 GCA003254255_00297 CDS open 52144-54057 _na     637_aa gyrB DNA topoisomerase (ATP-hydrolyzing)
549 QKZH01000003.1 GCA003254255_00298 CDS open 54066-56303 _na     745_aa gyrA DNA topoisomerase (ATP-hydrolyzing)
550 QKZH01000003.1 GCA003254255_00299 CDS open 56540-57625 _na     361_aa asd aspartate-semialdehyde dehydrogenase
551 QKZH01000003.1 GCA003254255_00300 CDS open 57841-58905 _na     354_aa galM Aldose 1-epimerase
552 QKZH01000003.1 GCA003254255_00301 CDS open 58905-60899 _na     664_aa topA DNA topoisomerase
553 QKZH01000003.1 GCA003254255_00302 CDS open 60903-61601 _na     232_aa glmU UDP-N-acetylglucosamine pyrophosphorylase
554 QKZH01000003.1 GCA003254255_00303 CDS open 61618-62499 _na     293_aa yciV PHP domain-containing protein
555 QKZH01000003.1 GCA003254255_00304 CDS open 62692-64473 _na     593_aa yoaR Vancomycin resistance protein
556 QKZH01000003.1 GCA003254255_00305 CDS open 64676-66553 _na     625_aa fbpC Fructose-1%2C6-bisphosphatase class 3
557 QKZH01000003.1 GCA003254255_00306 CDS open 66747-67721 _na     324_aa ypfJ putative metalloprotease
558 QKZH01000003.1 GCA003254255_00307 CDS open 67801-68901 _na     366_aa nolL Acyltransferase
559 QKZH01000003.1 GCA003254255_00308 CDS open 69171-72698 _na     1175_aa nifJ pyruvate:ferredoxin (flavodoxin) oxidoreductase
560 QKZH01000003.1 GCA003254255_00309 CDS open 72880-74472 _na     530_aa cedB Helicase HerA-like C-terminal domain-containing protein
561 QKZH01000003.1 GCA003254255_00310 CDS open 74475-75485 _na     336_aa dgt deoxyguanosinetriphosphate triphosphohydrolase
562 QKZH01000003.1 GCA003254255_00311 CDS open 75496-77235 _na     579_aa dnaG DNA primase
563 QKZH01000003.1 GCA003254255_00312 CDS open 77246-78403 _na     385_aa rpoD RNA polymerase sigma factor SigA
564 QKZH01000003.1 GCA003254255_00313 CDS open 78412-79092 _na     226_aa trmK SAM-dependent methyltransferase
565 QKZH01000003.1 GCA003254255_00314 CDS open 79079-79867 _na     262_aa nIF3 Nif3-like dinuclear metal center hexameric protein
566 QKZH01000003.1 GCA003254255_00315 CDS open 79871-80968 _na     365_aa yesN Stage 0 sporulation A-like protein
567 QKZH01000003.1 GCA003254255_00316 CDS open 80958-82385 _na     475_aa yesM histidine kinase
568 QKZH01000003.1 GCA003254255_00317 CDS open 82580-83647 _na     355_aa rbsB Periplasmic binding protein domain-containing protein
569 QKZH01000003.1 GCA003254255_00318 CDS open 83715-85217 _na     500_aa ccmA heme ABC exporter ATP-binding protein CcmA
570 QKZH01000003.1 GCA003254255_00319 CDS open 85214-86266 _na     350_aa araH Inner membrane ABC transporter permease protein YtfT
571 QKZH01000003.1 GCA003254255_00320 CDS open 86256-87275 _na     339_aa araH Sugar ABC transporter permease YjfF
572 QKZH01000003.1 GCA003254255_00321 CDS open 87488-89947 _na     819_aa VWA domain-containing protein
573 QKZH01000003.1 GCA003254255_00322 CDS open 90111-90548 _na     145_aa lepB signal peptidase I
574 QKZH01000003.1 GCA003254255_00323 CDS open 90545-91798 _na     417_aa Pilin isopeptide linkage domain-containing protein
575 QKZH01000003.1 GCA003254255_00324 CDS open 91801-92538 _na     245_aa srtB class B sortase
576 QKZH01000003.1 GCA003254255_00325 CDS open 92540-93385 _na     281_aa Sortase
577 QKZH01000003.1 GCA003254255_00326 CDS open 93478-94155 _na     225_aa cutC Copper homeostasis cutC-like protein
578 QKZH01000003.1 GCA003254255_00327 CDS open 94386-95264 _na     292_aa yicC TIGR00255 family protein
579 QKZH01000003.1 GCA003254255_00328 CDS open 95272-95904 _na     210_aa gmk guanylate kinase
580 QKZH01000003.1 GCA003254255_00329 CDS open 95905-96150 _na     81_aa rpoZ DNA-directed RNA polymerase subunit omega
581 QKZH01000003.1 GCA003254255_00330 CDS open 96223-97545 _na     440_aa rimO 30S ribosomal protein S12 methylthiotransferase RimO
582 QKZH01000003.1 GCA003254255_00331 CDS open 97542-98081 _na     179_aa pgsA CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase
583 QKZH01000003.1 GCA003254255_00332 CDS open 98128-98856 _na     242_aa pncC Nicotinamide-nucleotide amidohydrolase family protein
584 QKZH01000003.1 GCA003254255_00333 CDS open 98869-99180 _na     103_aa Nitroreductase TM1586 domain-containing protein
585 QKZH01000003.1 GCA003254255_00334 CDS open 99177-100034 _na     285_aa DUF2953 domain-containing protein
586 QKZH01000003.1 GCA003254255_00335 CDS open 100072-100413 _na     113_aa arsC Arsenate reductase
587 QKZH01000003.1 GCA003254255_00336 CDS open 100413-101042 _na     209_aa ftcD Sugar ABC transporter substrate-binding protein
588 QKZH01000003.1 GCA003254255_00337 CDS open 101039-101878 _na     279_aa folD Bifunctional protein FolD
589 QKZH01000003.1 GCA003254255_00338 CDS open 101964-102539 _na     191_aa comEA Competence protein ComEA
590 QKZH01000003.1 GCA003254255_00339 CDS open 102549-103244 _na     231_aa ompR Stage 0 sporulation A-like protein
591 QKZH01000003.1 GCA003254255_00340 CDS open 103249-103725 _na     158_aa rlmH 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH
592 QKZH01000003.1 GCA003254255_00341 CDS open 103821-106130 _na     769_aa acnA hydratase
593 QKZH01000003.1 GCA003254255_00342 CDS open 106182-108056 _na     624_aa ftsH ATP-dependent zinc metalloprotease FtsH
594 QKZH01000003.1 GCA003254255_00343 CDS open 108186-109664 _na     492_aa lsa Lsa family ABC-F type ribosomal protection protein
595 QKZH01000003.1 GCA003254255_00344 CDS open 109712-110146 _na     144_aa pyrI aspartate carbamoyltransferase regulatory subunit
596 QKZH01000003.1 GCA003254255_00345 CDS open 110146-111060 _na     304_aa pyrB aspartate carbamoyltransferase
597 QKZH01000003.1 GCA003254255_00251 gene open 161-1204
598 QKZH01000003.1 GCA003254255_00252 gene open 1526-1846
599 QKZH01000003.1 GCA003254255_00253 gene open 1954-2130 rpsU
600 QKZH01000003.1 GCA003254255_00254 gene open 2202-3194 phoH
601 QKZH01000003.1 GCA003254255_00255 gene open 3234-3728 ybeY
602 QKZH01000003.1 GCA003254255_00256 gene open 3728-5383 spoVB
603 QKZH01000003.1 GCA003254255_00257 gene open 5380-6594 yhiN
604 QKZH01000003.1 GCA003254255_00258 gene open 6605-8221
605 QKZH01000003.1 GCA003254255_00259 gene open 8223-9059 proB
606 QKZH01000003.1 GCA003254255_00260 gene open 9067-9285 ynzC
607 QKZH01000003.1 GCA003254255_00261 gene open 9278-9844 fAU1
608 QKZH01000003.1 GCA003254255_00262 gene open 9899-11326 miaB
609 QKZH01000003.1 GCA003254255_00263 gene open 11327-13975 mutS
610 QKZH01000003.1 GCA003254255_00264 gene open 13980-15965 mutL
611 QKZH01000003.1 GCA003254255_00265 gene open 15962-16912 miaA
612 QKZH01000003.1 GCA003254255_00266 gene open 16905-18185 ynbB
613 QKZH01000003.1 GCA003254255_00267 gene open 18333-19022 radC
614 QKZH01000003.1 GCA003254255_00268 gene open 19022-19852 mreC
615 QKZH01000003.1 GCA003254255_00269 gene open 19853-20362 mreD
616 QKZH01000003.1 GCA003254255_00270 gene open 20362-23235 ftsI
617 QKZH01000003.1 GCA003254255_00271 gene open 23313-24434 ftsW
618 QKZH01000003.1 GCA003254255_00272 gene open 24450-24845 mgsA
619 QKZH01000003.1 GCA003254255_00273 gene open 24851-25837 dacC
620 QKZH01000003.1 GCA003254255_00274 gene open 25910-26329 pilT
621 QKZH01000003.1 GCA003254255_00275 gene open 26522-27910 hlyD
622 QKZH01000003.1 GCA003254255_00276 gene open 27922-28602 yggS
623 QKZH01000003.1 GCA003254255_00277 gene open 28621-29121 sepF
624 QKZH01000003.1 GCA003254255_00278 gene open 29075-29881 ylmH
625 QKZH01000003.1 GCA003254255_00279 gene open 29891-30979 aroB
626 QKZH01000003.1 GCA003254255_00280 gene open 30964-31464 lspA
627 QKZH01000003.1 GCA003254255_00281 gene open 31482-32396 rluA
628 QKZH01000003.1 GCA003254255_00282 gene open 32561-33187 cmkB
629 QKZH01000003.1 GCA003254255_00283 gene open 33184-34248 amiC
630 QKZH01000003.1 GCA003254255_00284 gene open 34280-36259
631 QKZH01000003.1 GCA003254255_00285 gene open 36275-37237
632 QKZH01000003.1 GCA003254255_00286 gene open 37377-39101 cps2a
633 QKZH01000003.1 GCA003254255_00287 gene open 39115-39822 ompR
634 QKZH01000003.1 GCA003254255_00288 gene open 39812-40945 hAMP
635 QKZH01000003.1 GCA003254255_00289 gene open 40914-43352
636 QKZH01000003.1 GCA003254255_00290 gene open 43353-44303 rbbA
637 QKZH01000003.1 GCA003254255_00291 gene open 44293-45168
638 QKZH01000003.1 GCA003254255_00292 gene open 45149-46417 rPC10
639 QKZH01000003.1 GCA003254255_00293 gene open 46520-48019 thrC
640 QKZH01000003.1 GCA003254255_00294 gene open 48022-48885 fba
641 QKZH01000003.1 GCA003254255_00295 gene open 49039-50364 rarA
642 QKZH01000003.1 GCA003254255_00296 gene open 50371-52074 rho
643 QKZH01000003.1 GCA003254255_00297 gene open 52144-54057 gyrB
644 QKZH01000003.1 GCA003254255_00298 gene open 54066-56303 gyrA
645 QKZH01000003.1 GCA003254255_00299 gene open 56540-57625 asd
646 QKZH01000003.1 GCA003254255_00300 gene open 57841-58905 galM
647 QKZH01000003.1 GCA003254255_00301 gene open 58905-60899 topA
648 QKZH01000003.1 GCA003254255_00302 gene open 60903-61601 glmU
649 QKZH01000003.1 GCA003254255_00303 gene open 61618-62499 yciV
650 QKZH01000003.1 GCA003254255_00304 gene open 62692-64473 yoaR
651 QKZH01000003.1 GCA003254255_00305 gene open 64676-66553 fbpC
652 QKZH01000003.1 GCA003254255_00306 gene open 66747-67721 ypfJ
653 QKZH01000003.1 GCA003254255_00307 gene open 67801-68901 nolL
654 QKZH01000003.1 GCA003254255_00308 gene open 69171-72698 nifJ
655 QKZH01000003.1 GCA003254255_00309 gene open 72880-74472 cedB
656 QKZH01000003.1 GCA003254255_00310 gene open 74475-75485 dgt
657 QKZH01000003.1 GCA003254255_00311 gene open 75496-77235 dnaG
658 QKZH01000003.1 GCA003254255_00312 gene open 77246-78403 rpoD
659 QKZH01000003.1 GCA003254255_00313 gene open 78412-79092 trmK
660 QKZH01000003.1 GCA003254255_00314 gene open 79079-79867 nIF3
661 QKZH01000003.1 GCA003254255_00315 gene open 79871-80968 yesN
662 QKZH01000003.1 GCA003254255_00316 gene open 80958-82385 yesM
663 QKZH01000003.1 GCA003254255_00317 gene open 82580-83647 rbsB
664 QKZH01000003.1 GCA003254255_00318 gene open 83715-85217 ccmA
665 QKZH01000003.1 GCA003254255_00319 gene open 85214-86266 araH
666 QKZH01000003.1 GCA003254255_00320 gene open 86256-87275 araH
667 QKZH01000003.1 GCA003254255_00321 gene open 87488-89947
668 QKZH01000003.1 GCA003254255_00322 gene open 90111-90548 lepB
669 QKZH01000003.1 GCA003254255_00323 gene open 90545-91798
670 QKZH01000003.1 GCA003254255_00324 gene open 91801-92538 srtB
671 QKZH01000003.1 GCA003254255_00325 gene open 92540-93385
672 QKZH01000003.1 GCA003254255_00326 gene open 93478-94155 cutC
673 QKZH01000003.1 GCA003254255_00327 gene open 94386-95264 yicC
674 QKZH01000003.1 GCA003254255_00328 gene open 95272-95904 gmk
675 QKZH01000003.1 GCA003254255_00329 gene open 95905-96150 rpoZ
676 QKZH01000003.1 GCA003254255_00330 gene open 96223-97545 rimO
677 QKZH01000003.1 GCA003254255_00331 gene open 97542-98081 pgsA
678 QKZH01000003.1 GCA003254255_00332 gene open 98128-98856 pncC
679 QKZH01000003.1 GCA003254255_00333 gene open 98869-99180
680 QKZH01000003.1 GCA003254255_00334 gene open 99177-100034
681 QKZH01000003.1 GCA003254255_00335 gene open 100072-100413 arsC
682 QKZH01000003.1 GCA003254255_00336 gene open 100413-101042 ftcD
683 QKZH01000003.1 GCA003254255_00337 gene open 101039-101878 folD
684 QKZH01000003.1 GCA003254255_00338 gene open 101964-102539 comEA
685 QKZH01000003.1 GCA003254255_00339 gene open 102549-103244 ompR
686 QKZH01000003.1 GCA003254255_00340 gene open 103249-103725 rlmH
687 QKZH01000003.1 GCA003254255_00341 gene open 103821-106130 acnA
688 QKZH01000003.1 GCA003254255_00342 gene open 106182-108056 ftsH
689 QKZH01000003.1 GCA003254255_00343 gene open 108186-109664 lsa
690 QKZH01000003.1 GCA003254255_00344 gene open 109712-110146 pyrI
691 QKZH01000003.1 GCA003254255_00345 gene open 110146-111060 pyrB
692 QKZH01000004.1 regulatory_region open 1050-1180 Ribosomal protein L10 leader
693 QKZH01000004.1 regulatory_region open 55228-55332 TPP riboswitch aptamer (THI element)
694 QKZH01000004.1 repeat_region open 98475-99231 CRISPR array with 11 repeats of length 30%2C consensus sequence GTAAGTACCTTACCTATAAGGAATGGAAAC and spacer length 39
695 QKZH01000004.1 repeat_region open 103921-104482 CRISPR array with 8 repeats of length 30%2C consensus sequence GTAAGTACCTTACCTATAAGGAATGGAAAC and spacer length 44
696 QKZH01000004.1 GCA003254255_00346 CDS open 112-486 _na     124_aa rplL 50S ribosomal protein L7/L12
697 QKZH01000004.1 GCA003254255_00347 CDS open 513-1001 _na     162_aa rplJ 50S ribosomal protein L10
698 QKZH01000004.1 GCA003254255_00348 CDS open 1246-2241 _na     331_aa vanZ VanZ family protein
699 QKZH01000004.1 GCA003254255_00349 CDS open 2326-3117 _na     263_aa traX TraX protein
700 QKZH01000004.1 GCA003254255_00350 CDS open 3136-3768 _na     210_aa ycaP DUF421 domain-containing protein
701 QKZH01000004.1 GCA003254255_00351 CDS open 4014-4673 _na     219_aa Glucan-binding domain (YG repeat)
702 QKZH01000004.1 GCA003254255_00352 CDS open 4864-6159 _na     431_aa baeS histidine kinase
703 QKZH01000004.1 GCA003254255_00353 CDS open 6161-6832 _na     223_aa ompR Stage 0 sporulation A-like protein
704 QKZH01000004.1 GCA003254255_00354 CDS open 6813-7442 _na     209_aa yjbM GTP pyrophosphokinase family protein
705 QKZH01000004.1 GCA003254255_00355 CDS open 7552-8901 _na     449_aa mgtE magnesium transporter
706 QKZH01000004.1 GCA003254255_00356 CDS open 8932-11034 _na     700_aa pnp polyribonucleotide nucleotidyltransferase
707 QKZH01000004.1 GCA003254255_00357 CDS open 11324-11590 _na     88_aa rpsO 30S ribosomal protein S15
708 QKZH01000004.1 GCA003254255_00358 CDS open 11895-12251 _na     118_aa ABC transporter permease
709 QKZH01000004.1 GCA003254255_00359 CDS open 12569-13552 _na     327_aa diaminopimelate dehydrogenase
710 QKZH01000004.1 GCA003254255_00360 CDS open 13756-14070 _na     104_aa cbiN energy-coupling factor ABC transporter substrate-binding protein
711 QKZH01000004.1 GCA003254255_00361 CDS open 14070-14822 _na     250_aa cbiM energy-coupling factor ABC transporter permease
712 QKZH01000004.1 GCA003254255_00362 CDS open 14849-15694 _na     281_aa ecfA2 ABC transporter ATP-binding protein
713 QKZH01000004.1 GCA003254255_00363 CDS open 15711-16526 _na     271_aa cbiQ cobalt ECF transporter T component CbiQ
714 QKZH01000004.1 GCA003254255_00364 CDS open 17116-18456 _na     446_aa lpd Pyridine nucleotide-disulfide oxidoreductase
715 QKZH01000004.1 GCA003254255_00365 CDS open 18542-19000 _na     152_aa DUF4178 domain-containing protein
716 QKZH01000004.1 GCA003254255_00366 CDS open 19193-20122 _na     309_aa xerD Tyr recombinase domain-containing protein
717 QKZH01000004.1 GCA003254255_00367 CDS open 20183-23362 _na     1059_aa Type I restriction enzyme endonuclease subunit
718 QKZH01000004.1 GCA003254255_00368 CDS open 23391-24644 _na     417_aa ATP-binding protein
719 QKZH01000004.1 GCA003254255_00369 CDS open 24808-25884 _na     358_aa hsdS Restriction endonuclease subunit S
720 QKZH01000004.1 GCA003254255_00370 CDS open 26067-27311 _na     414_aa hsdS Restriction endonuclease subunit S
721 QKZH01000004.1 GCA003254255_00371 CDS open 27304-29886 _na     860_aa hsdM type I restriction-modification system subunit M
722 QKZH01000004.1 GCA003254255_00372 CDS open 30133-30723 _na     196_aa hypothetical protein
723 QKZH01000004.1 GCA003254255_00373 CDS open 31295-32143 _na     282_aa KilA-N domain-containing protein
724 QKZH01000004.1 GCA003254255_00374 CDS open 32452-32970 _na     172_aa yopX YopX protein domain-containing protein
725 QKZH01000004.1 GCA003254255_00375 CDS open 33145-34176 _na     343_aa DUF3137 domain-containing protein
726 QKZH01000004.1 GCA003254255_00376 CDS open 34316-34555 _na     79_aa DUF4176 domain-containing protein
727 QKZH01000004.1 GCA003254255_00377 CDS open 34676-35266 _na     196_aa Tox-PL domain-containing protein
728 QKZH01000004.1 GCA003254255_00378 CDS open 35236-35499 _na     87_aa hypothetical protein
729 QKZH01000004.1 GCA003254255_00379 CDS open 35539-36555 _na     338_aa hypothetical protein
730 QKZH01000004.1 GCA003254255_00380 CDS open 36615-36713 _na     32_aa hypothetical protein
731 QKZH01000004.1 GCA003254255_00381 CDS open 36714-37553 _na     279_aa ymfN Phage terminase-like protein%2C large subunit%2C contains N-terminal HTH domain
732 QKZH01000004.1 GCA003254255_00382 CDS open 37600-38055 _na     151_aa rimL N-acetyltransferase
733 QKZH01000004.1 GCA003254255_00383 CDS open 38074-38565 _na     163_aa Immunity protein 68
734 QKZH01000004.1 GCA003254255_00384 CDS open 38592-39080 _na     162_aa hypothetical protein
735 QKZH01000004.1 GCA003254255_00385 CDS open 39167-40633 _na     488_aa malQ 4-alpha-glucanotransferase
736 QKZH01000004.1 GCA003254255_00386 CDS open 40644-42902 _na     752_aa glgP Alpha-1%2C4 glucan phosphorylase
737 QKZH01000004.1 GCA003254255_00387 CDS open 42924-44678 _na     584_aa amyA Glycosyl hydrolase family 13 catalytic domain-containing protein
738 QKZH01000004.1 GCA003254255_00388 CDS open 44694-46622 _na     642_aa pulA type I pullulanase
739 QKZH01000004.1 GCA003254255_00389 CDS open 46625-47494 _na     289_aa malG ABC transmembrane type-1 domain-containing protein
740 QKZH01000004.1 GCA003254255_00390 CDS open 47497-48876 _na     459_aa ugpA Maltose/maltodextrin transport system permease protein
741 QKZH01000004.1 GCA003254255_00391 CDS open 48889-50127 _na     412_aa malE Extracellular solute-binding protein
742 QKZH01000004.1 GCA003254255_00392 CDS open 50400-51422 _na     340_aa purR LacI family transcriptional regulator
743 QKZH01000004.1 GCA003254255_00393 CDS open 51449-52195 _na     248_aa pflA pyruvate formate-lyase-activating protein
744 QKZH01000004.1 GCA003254255_00394 CDS open 52263-54503 _na     746_aa pflB formate C-acetyltransferase
745 QKZH01000004.1 GCA003254255_00395 CDS open 54723-54821 _na     32_aa hypothetical protein
746 QKZH01000004.1 GCA003254255_00396 CDS open 54875-55000 _na     41_aa hypothetical protein
747 QKZH01000004.1 GCA003254255_00397 CDS open 55420-55713 _na     97_aa Stress-response A/B barrel domain-containing protein
748 QKZH01000004.1 GCA003254255_00398 CDS open 55751-57601 _na     616_aa uvrC excinuclease ABC subunit UvrC
749 QKZH01000004.1 GCA003254255_00399 CDS open 57605-58153 _na     182_aa DUF1653 domain-containing protein
750 QKZH01000004.1 GCA003254255_00400 CDS open 58156-58767 _na     203_aa sMI1 SMI1/KNR4 family protein
751 QKZH01000004.1 GCA003254255_00401 CDS open 58904-59626 _na     240_aa DUF6882 domain-containing protein
752 QKZH01000004.1 GCA003254255_00402 CDS open 59688-60641 _na     317_aa DUF4300 domain-containing protein
753 QKZH01000004.1 GCA003254255_00403 CDS open 60849-62321 _na     490_aa DUF1846 domain-containing protein
754 QKZH01000004.1 GCA003254255_00404 CDS open 62356-64140 _na     594_aa Cadherin
755 QKZH01000004.1 GCA003254255_00405 CDS open 64188-66119 _na     643_aa lytD Beta- N-acetylglucosaminidase
756 QKZH01000004.1 GCA003254255_00406 CDS open 66144-66554 _na     136_aa cdd cytidine deaminase
757 QKZH01000004.1 GCA003254255_00407 CDS open 66562-67503 _na     313_aa ycgQ GTPase
758 QKZH01000004.1 GCA003254255_00408 CDS open 67524-68735 _na     403_aa yejR GTP-binding protein
759 QKZH01000004.1 GCA003254255_00409 CDS open 68833-69336 _na     167_aa Gx transporter family protein
760 QKZH01000004.1 GCA003254255_00410 CDS open 69336-69731 _na     131_aa yloU Asp23/Gls24 family envelope stress response protein
761 QKZH01000004.1 GCA003254255_00411 CDS open 69883-71040 _na     385_aa xylH Xylose transport system permease protein XylH
762 QKZH01000004.1 GCA003254255_00412 CDS open 71051-72604 _na     517_aa mglA ABC transporter domain-containing protein
763 QKZH01000004.1 GCA003254255_00413 CDS open 72695-73891 _na     398_aa xylF Sugar ABC transporter substrate-binding protein
764 QKZH01000004.1 GCA003254255_00414 CDS open 74019-75338 _na     439_aa xylA xylose isomerase
765 QKZH01000004.1 GCA003254255_00415 CDS open 75659-76606 _na     315_aa araC HTH araC/xylS-type domain-containing protein
766 QKZH01000004.1 GCA003254255_00416 CDS open 76627-77472 _na     281_aa traX Conjugal transfer protein TraX
767 QKZH01000004.1 GCA003254255_00417 CDS open 77745-78074 _na     109_aa hypothetical protein
768 QKZH01000004.1 GCA003254255_00418 CDS open 78107-78634 _na     175_aa rpoE Sigma-70 family RNA polymerase sigma factor
769 QKZH01000004.1 GCA003254255_00419 CDS open 78624-78872 _na     82_aa hypothetical protein
770 QKZH01000004.1 GCA003254255_00420 CDS open 78873-79166 _na     97_aa DUF3784 domain-containing protein
771 QKZH01000004.1 GCA003254255_00421 CDS open 79417-79569 _na     50_aa hypothetical protein
772 QKZH01000004.1 GCA003254255_00422 CDS open 80108-81094 _na     328_aa mglC Beta-methylgalactoside transporter
773 QKZH01000004.1 GCA003254255_00423 CDS open 81106-82614 _na     502_aa mglA Ribose/galactose/methyl galactoside import ATP-binding protein
774 QKZH01000004.1 GCA003254255_00424 CDS open 82685-83797 _na     370_aa mglB D-galactose/methyl-galactoside binding periplasmic protein MglB
775 QKZH01000004.1 GCA003254255_00425 CDS open 84051-85412 _na     453_aa gltA Citrate synthase
776 QKZH01000004.1 GCA003254255_00426 CDS open 85454-86254 _na     266_aa sseB SseB family protein
777 QKZH01000004.1 GCA003254255_00427 CDS open 86331-87398 _na     355_aa apbE FAD:protein FMN transferase
778 QKZH01000004.1 GCA003254255_00428 CDS open 87411-89012 _na     533_aa ySH1 Metallo-beta-lactamase
779 QKZH01000004.1 GCA003254255_00429 CDS open 89408-90418 _na     336_aa cafA Ribonuclease G
780 QKZH01000004.1 GCA003254255_00430 CDS open 90393-91118 _na     241_aa TIGR03936 family radical SAM-associated protein
781 QKZH01000004.1 GCA003254255_00431 CDS open 91102-92967 _na     621_aa ygiQ Radical SAM core domain-containing protein
782 QKZH01000004.1 GCA003254255_00432 CDS open 92982-94712 _na     576_aa mdlB ABC transporter
783 QKZH01000004.1 GCA003254255_00433 CDS open 94702-96438 _na     578_aa mdlB ABC transporter ATP-binding protein
784 QKZH01000004.1 GCA003254255_00434 CDS open 96539-97378 _na     279_aa uppP undecaprenyl-diphosphate phosphatase
785 QKZH01000004.1 GCA003254255_00435 CDS open 97402-98097 _na     231_aa ung uracil-DNA glycosylase
786 QKZH01000004.1 GCA003254255_00436 CDS open 99326-99586 _na     86_aa cas2 CRISPR-associated endonuclease Cas2
787 QKZH01000004.1 GCA003254255_00437 CDS open 99595-101514 _na     639_aa cas1b type I-B CRISPR-associated endonuclease Cas1b
788 QKZH01000004.1 GCA003254255_00438 CDS open 101628-103190 _na     520_aa TIGR02221 family CRISPR-associated protein
789 QKZH01000004.1 GCA003254255_00346 gene open 112-486 rplL
790 QKZH01000004.1 GCA003254255_00347 gene open 513-1001 rplJ
791 QKZH01000004.1 GCA003254255_00348 gene open 1246-2241 vanZ
792 QKZH01000004.1 GCA003254255_00349 gene open 2326-3117 traX
793 QKZH01000004.1 GCA003254255_00350 gene open 3136-3768 ycaP
794 QKZH01000004.1 GCA003254255_00351 gene open 4014-4673
795 QKZH01000004.1 GCA003254255_00352 gene open 4864-6159 baeS
796 QKZH01000004.1 GCA003254255_00353 gene open 6161-6832 ompR
797 QKZH01000004.1 GCA003254255_00354 gene open 6813-7442 yjbM
798 QKZH01000004.1 GCA003254255_00355 gene open 7552-8901 mgtE
799 QKZH01000004.1 GCA003254255_00356 gene open 8932-11034 pnp
800 QKZH01000004.1 GCA003254255_00357 gene open 11324-11590 rpsO
801 QKZH01000004.1 GCA003254255_00358 gene open 11895-12251
802 QKZH01000004.1 GCA003254255_00359 gene open 12569-13552
803 QKZH01000004.1 GCA003254255_00360 gene open 13756-14070 cbiN
804 QKZH01000004.1 GCA003254255_00361 gene open 14070-14822 cbiM
805 QKZH01000004.1 GCA003254255_00362 gene open 14849-15694 ecfA2
806 QKZH01000004.1 GCA003254255_00363 gene open 15711-16526 cbiQ
807 QKZH01000004.1 GCA003254255_00364 gene open 17116-18456 lpd
808 QKZH01000004.1 GCA003254255_00365 gene open 18542-19000
809 QKZH01000004.1 GCA003254255_00366 gene open 19193-20122 xerD
810 QKZH01000004.1 GCA003254255_00367 gene open 20183-23362
811 QKZH01000004.1 GCA003254255_00368 gene open 23391-24644
812 QKZH01000004.1 GCA003254255_00369 gene open 24808-25884 hsdS
813 QKZH01000004.1 GCA003254255_00370 gene open 26067-27311 hsdS
814 QKZH01000004.1 GCA003254255_00371 gene open 27304-29886 hsdM
815 QKZH01000004.1 GCA003254255_00372 gene open 30133-30723
816 QKZH01000004.1 GCA003254255_00373 gene open 31295-32143
817 QKZH01000004.1 GCA003254255_00374 gene open 32452-32970 yopX
818 QKZH01000004.1 GCA003254255_00375 gene open 33145-34176
819 QKZH01000004.1 GCA003254255_00376 gene open 34316-34555
820 QKZH01000004.1 GCA003254255_00377 gene open 34676-35266
821 QKZH01000004.1 GCA003254255_00378 gene open 35236-35499
822 QKZH01000004.1 GCA003254255_00379 gene open 35539-36555
823 QKZH01000004.1 GCA003254255_00380 gene open 36615-36713
824 QKZH01000004.1 GCA003254255_00381 gene open 36714-37553 ymfN
825 QKZH01000004.1 GCA003254255_00382 gene open 37600-38055 rimL
826 QKZH01000004.1 GCA003254255_00383 gene open 38074-38565
827 QKZH01000004.1 GCA003254255_00384 gene open 38592-39080
828 QKZH01000004.1 GCA003254255_00385 gene open 39167-40633 malQ
829 QKZH01000004.1 GCA003254255_00386 gene open 40644-42902 glgP
830 QKZH01000004.1 GCA003254255_00387 gene open 42924-44678 amyA
831 QKZH01000004.1 GCA003254255_00388 gene open 44694-46622 pulA
832 QKZH01000004.1 GCA003254255_00389 gene open 46625-47494 malG
833 QKZH01000004.1 GCA003254255_00390 gene open 47497-48876 ugpA
834 QKZH01000004.1 GCA003254255_00391 gene open 48889-50127 malE
835 QKZH01000004.1 GCA003254255_00392 gene open 50400-51422 purR
836 QKZH01000004.1 GCA003254255_00393 gene open 51449-52195 pflA
837 QKZH01000004.1 GCA003254255_00394 gene open 52263-54503 pflB
838 QKZH01000004.1 GCA003254255_00395 gene open 54723-54821
839 QKZH01000004.1 GCA003254255_00396 gene open 54875-55000
840 QKZH01000004.1 GCA003254255_00397 gene open 55420-55713
841 QKZH01000004.1 GCA003254255_00398 gene open 55751-57601 uvrC
842 QKZH01000004.1 GCA003254255_00399 gene open 57605-58153
843 QKZH01000004.1 GCA003254255_00400 gene open 58156-58767 sMI1
844 QKZH01000004.1 GCA003254255_00401 gene open 58904-59626
845 QKZH01000004.1 GCA003254255_00402 gene open 59688-60641
846 QKZH01000004.1 GCA003254255_00403 gene open 60849-62321
847 QKZH01000004.1 GCA003254255_00404 gene open 62356-64140
848 QKZH01000004.1 GCA003254255_00405 gene open 64188-66119 lytD
849 QKZH01000004.1 GCA003254255_00406 gene open 66144-66554 cdd
850 QKZH01000004.1 GCA003254255_00407 gene open 66562-67503 ycgQ
851 QKZH01000004.1 GCA003254255_00408 gene open 67524-68735 yejR
852 QKZH01000004.1 GCA003254255_00409 gene open 68833-69336
853 QKZH01000004.1 GCA003254255_00410 gene open 69336-69731 yloU
854 QKZH01000004.1 GCA003254255_00411 gene open 69883-71040 xylH
855 QKZH01000004.1 GCA003254255_00412 gene open 71051-72604 mglA
856 QKZH01000004.1 GCA003254255_00413 gene open 72695-73891 xylF
857 QKZH01000004.1 GCA003254255_00414 gene open 74019-75338 xylA
858 QKZH01000004.1 GCA003254255_00415 gene open 75659-76606 araC
859 QKZH01000004.1 GCA003254255_00416 gene open 76627-77472 traX
860 QKZH01000004.1 GCA003254255_00417 gene open 77745-78074
861 QKZH01000004.1 GCA003254255_00418 gene open 78107-78634 rpoE
862 QKZH01000004.1 GCA003254255_00419 gene open 78624-78872
863 QKZH01000004.1 GCA003254255_00420 gene open 78873-79166
864 QKZH01000004.1 GCA003254255_00421 gene open 79417-79569
865 QKZH01000004.1 GCA003254255_00422 gene open 80108-81094 mglC
866 QKZH01000004.1 GCA003254255_00423 gene open 81106-82614 mglA
867 QKZH01000004.1 GCA003254255_00424 gene open 82685-83797 mglB
868 QKZH01000004.1 GCA003254255_00425 gene open 84051-85412 gltA
869 QKZH01000004.1 GCA003254255_00426 gene open 85454-86254 sseB
870 QKZH01000004.1 GCA003254255_00427 gene open 86331-87398 apbE
871 QKZH01000004.1 GCA003254255_00428 gene open 87411-89012 ySH1
872 QKZH01000004.1 GCA003254255_00429 gene open 89408-90418 cafA
873 QKZH01000004.1 GCA003254255_00430 gene open 90393-91118
874 QKZH01000004.1 GCA003254255_00431 gene open 91102-92967 ygiQ
875 QKZH01000004.1 GCA003254255_00432 gene open 92982-94712 mdlB
876 QKZH01000004.1 GCA003254255_00433 gene open 94702-96438 mdlB
877 QKZH01000004.1 GCA003254255_00434 gene open 96539-97378 uppP
878 QKZH01000004.1 GCA003254255_00435 gene open 97402-98097 ung
879 QKZH01000004.1 GCA003254255_00436 gene open 99326-99586 cas2
880 QKZH01000004.1 GCA003254255_00437 gene open 99595-101514 cas1b
881 QKZH01000004.1 GCA003254255_00438 gene open 101628-103190
882 QKZH01000005.1 GCA003254255_00439 CDS open 28-750 _na     240_aa electron transfer flavoprotein subunit alpha/FixB family protein
883 QKZH01000005.1 GCA003254255_00440 CDS open 798-2498 _na     566_aa norD VWFA domain-containing protein
884 QKZH01000005.1 GCA003254255_00441 CDS open 2495-3412 _na     305_aa mMP0363 MoxR family ATPase
885 QKZH01000005.1 GCA003254255_00442 CDS open 3561-5102 _na     513_aa cstA Carbon starvation protein A
886 QKZH01000005.1 GCA003254255_00443 CDS open 5348-6298 _na     316_aa Succinylglutamate desuccinylase
887 QKZH01000005.1 GCA003254255_00444 CDS open 6373-7314 _na     313_aa fabH Beta-ketoacyl-[acyl-carrier-protein] synthase III
888 QKZH01000005.1 GCA003254255_00445 CDS open 7374-7610 _na     78_aa acpP acyl carrier protein
889 QKZH01000005.1 GCA003254255_00446 CDS open 7659-8597 _na     312_aa fabK enoyl-[acyl-carrier-protein] reductase FabK
890 QKZH01000005.1 GCA003254255_00447 CDS open 8600-9517 _na     305_aa fabD ACP S-malonyltransferase
891 QKZH01000005.1 GCA003254255_00448 CDS open 9514-10260 _na     248_aa fabG 3-oxoacyl-[acyl-carrier-protein] reductase
892 QKZH01000005.1 GCA003254255_00449 CDS open 10341-11576 _na     411_aa fabF beta-ketoacyl-ACP synthase II
893 QKZH01000005.1 GCA003254255_00450 CDS open 11581-12015 _na     144_aa accB acetyl-CoA carboxylase biotin carboxyl carrier protein
894 QKZH01000005.1 GCA003254255_00451 CDS open 12019-12444 _na     141_aa fabZ 3-hydroxyacyl-ACP dehydratase FabZ
895 QKZH01000005.1 GCA003254255_00452 CDS open 12445-13788 _na     447_aa pccA acetyl-CoA carboxylase biotin carboxylase subunit
896 QKZH01000005.1 GCA003254255_00453 CDS open 13813-15513 _na     566_aa accD acetyl-CoA carboxylase%2C carboxyltransferase subunit beta
897 QKZH01000005.1 GCA003254255_00454 CDS open 15533-16708 _na     391_aa yrpB Nitronate monooxygenase domain-containing protein
898 QKZH01000005.1 GCA003254255_00455 CDS open 16990-18312 _na     440_aa D-alanyl-D-alanine carboxypeptidase
899 QKZH01000005.1 GCA003254255_00456 CDS open 18320-19180 _na     286_aa yaeI Metallophosphoesterase
900 QKZH01000005.1 GCA003254255_00457 CDS open 19229-20023 _na     264_aa scpA Segregation and condensation protein A
901 QKZH01000005.1 GCA003254255_00458 CDS open 20016-20621 _na     201_aa scpB SMC-Scp complex subunit ScpB
902 QKZH01000005.1 GCA003254255_00459 CDS open 20625-21056 _na     143_aa dut dUTP diphosphatase
903 QKZH01000005.1 GCA003254255_00460 CDS open 21028-21873 _na     281_aa lapB Lipopolysaccharide biosynthesis regulator YciM/LapB%2C contains six TPR domains and a C-terminal metal-binding domain
904 QKZH01000005.1 GCA003254255_00461 CDS open 21881-23122 _na     413_aa hflX GTPase HflX
905 QKZH01000005.1 GCA003254255_00462 CDS open 23213-23908 _na     231_aa LRAT domain-containing protein
906 QKZH01000005.1 GCA003254255_00463 CDS open 23999-24667 _na     222_aa yIH1 YigZ family protein
907 QKZH01000005.1 GCA003254255_00464 CDS open 24727-25623 _na     298_aa corA CorA-like Mg2+ transporter
908 QKZH01000005.1 GCA003254255_00465 CDS open 25715-26830 _na     371_aa rbsK Carbohydrate kinase family protein
909 QKZH01000005.1 GCA003254255_00466 CDS open 26834-27682 _na     282_aa fba Class II fructose-bisphosphate aldolase
910 QKZH01000005.1 GCA003254255_00467 CDS open 27816-28811 _na     331_aa rbsB Periplasmic binding protein domain-containing protein
911 QKZH01000005.1 GCA003254255_00468 CDS open 28907-30391 _na     494_aa mglA Ribose/galactose/methyl galactoside import ATP-binding protein
912 QKZH01000005.1 GCA003254255_00469 CDS open 30404-31375 _na     323_aa rbsC Ribose transport system permease rbsC
913 QKZH01000005.1 GCA003254255_00470 CDS open 31375-32337 _na     320_aa rbsB Sugar ABC transporter substrate-binding protein
914 QKZH01000005.1 GCA003254255_00471 CDS open 32340-33671 _na     443_aa comP histidine kinase
915 QKZH01000005.1 GCA003254255_00472 CDS open 33664-34317 _na     217_aa citB Stage 0 sporulation A-like protein
916 QKZH01000005.1 GCA003254255_00473 CDS open 34314-35624 _na     436_aa ugpB Extracellular solute-binding protein
917 QKZH01000005.1 GCA003254255_00474 CDS open 35621-36304 _na     227_aa ydaE D-lyxose ketol-isomerase
918 QKZH01000005.1 GCA003254255_00475 CDS open 36342-37223 _na     293_aa araC AraC family transcriptional regulator
919 QKZH01000005.1 GCA003254255_00476 CDS open 37328-38899 _na     523_aa xynB2 Glycoside hydrolase family 43 protein
920 QKZH01000005.1 GCA003254255_00477 CDS open 38910-39260 _na     116_aa arsC Transcriptional regulator%2C Spx/MgsR family
921 QKZH01000005.1 GCA003254255_00478 CDS open 39251-41470 _na     739_aa bglX beta-glucosidase
922 QKZH01000005.1 GCA003254255_00479 CDS open 41639-42553 _na     304_aa dapA N-acetylneuraminate lyase
923 QKZH01000005.1 GCA003254255_00480 CDS open 42550-43500 _na     316_aa nagC ROK family protein
924 QKZH01000005.1 GCA003254255_00481 CDS open 43558-44922 _na     454_aa TrpB-like pyridoxal phosphate-dependent enzyme
925 QKZH01000005.1 GCA003254255_00482 CDS open 45270-46574 _na     434_aa ydjI SPFH domain-containing protein
926 QKZH01000005.1 GCA003254255_00483 CDS open 46586-47284 _na     232_aa hypothetical protein
927 QKZH01000005.1 GCA003254255_00484 CDS open 47307-47894 _na     195_aa hypothetical protein
928 QKZH01000005.1 GCA003254255_00485 CDS open 48084-48263 _na     59_aa hypothetical protein
929 QKZH01000005.1 GCA003254255_00486 CDS open 48597-49904 _na     435_aa Sugar ABC transporter substrate-binding protein
930 QKZH01000005.1 GCA003254255_00487 CDS open 49966-50346 _na     126_aa carbohydrate ABC transporter permease
931 QKZH01000005.1 GCA003254255_00488 CDS open 50353-50853 _na     166_aa carbohydrate ABC transporter permease
932 QKZH01000005.1 GCA003254255_00489 CDS open 50978-51688 _na     236_aa ugpE ABC transmembrane type-1 domain-containing protein
933 QKZH01000005.1 GCA003254255_00490 CDS open 51709-52230 _na     173_aa Oxidoreductase%2C NAD-binding domain protein
934 QKZH01000005.1 GCA003254255_00491 CDS open 52267-52815 _na     182_aa Gfo/Idh/MocA-like oxidoreductase C-terminal domain-containing protein
935 QKZH01000005.1 GCA003254255_00492 CDS open 53453-55624 _na     723_aa Transcriptional regulator
936 QKZH01000005.1 GCA003254255_00493 CDS open 55726-56151 _na     141_aa Membrane-associated protease 1
937 QKZH01000005.1 GCA003254255_00494 CDS open 56171-56599 _na     142_aa Membrane-associated protease 1
938 QKZH01000005.1 GCA003254255_00495 CDS open 56763-57290 _na     175_aa fHA FHA domain-containing protein
939 QKZH01000005.1 GCA003254255_00496 CDS open 57296-57787 _na     163_aa FHA domain-containing protein
940 QKZH01000005.1 GCA003254255_00497 CDS open 57810-58625 _na     271_aa PPM-type phosphatase domain-containing protein
941 QKZH01000005.1 GCA003254255_00498 CDS open 58635-60473 _na     612_aa pTC1 PPM-type phosphatase domain-containing protein
942 QKZH01000005.1 GCA003254255_00499 CDS open 60496-61776 _na     426_aa Normocyte-binding protein
943 QKZH01000005.1 GCA003254255_00500 CDS open 61799-62491 _na     230_aa hypothetical protein
944 QKZH01000005.1 GCA003254255_00501 CDS open 62531-65131 _na     866_aa dnaK Molecular chaperone
945 QKZH01000005.1 GCA003254255_00502 CDS open 65150-65926 _na     258_aa DNA and RNA helicase
946 QKZH01000005.1 GCA003254255_00503 CDS open 65946-66911 _na     321_aa FHA domain-containing protein
947 QKZH01000005.1 GCA003254255_00504 CDS open 66957-67433 _na     158_aa Initiator Rep protein domain-containing protein
948 QKZH01000005.1 GCA003254255_00505 CDS open 67430-68782 _na     450_aa Gp5/Type VI secretion system Vgr protein OB-fold domain-containing protein
949 QKZH01000005.1 GCA003254255_00506 CDS open 68821-70062 _na     413_aa Gp5/Type VI secretion system Vgr protein OB-fold domain-containing protein
950 QKZH01000005.1 GCA003254255_00507 CDS open 70110-71612 _na     500_aa DUF4280 domain-containing protein
951 QKZH01000005.1 GCA003254255_00508 CDS open 71643-73211 _na     522_aa Ig-like domain-containing protein
952 QKZH01000005.1 GCA003254255_00509 CDS open 73326-74618 _na     430_aa IS110 family transposase
953 QKZH01000005.1 GCA003254255_00510 CDS open 75135-76958 _na     607_aa Ig-like domain-containing protein
954 QKZH01000005.1 GCA003254255_00511 CDS open 76959-77537 _na     192_aa hypothetical protein
955 QKZH01000005.1 GCA003254255_00512 CDS open 77542-78087 _na     181_aa hypothetical protein
956 QKZH01000005.1 GCA003254255_00513 CDS open 78133-83343 _na     1736_aa rhsA DUF6531 domain-containing protein
957 QKZH01000005.1 GCA003254255_00514 CDS open 83356-84369 _na     337_aa Dipeptidylpeptidase IV N-terminal domain-containing protein
958 QKZH01000005.1 GCA003254255_00515 CDS open 84421-84525 _na     34_aa hypothetical protein
959 QKZH01000005.1 GCA003254255_00516 CDS open 84543-84845 _na     100_aa hypothetical protein
960 QKZH01000005.1 GCA003254255_00517 CDS open 84865-85443 _na     192_aa RHS repeat domain-containing protein
961 QKZH01000005.1 GCA003254255_00518 CDS open 86122-86616 _na     164_aa DUF1850 domain-containing protein
962 QKZH01000005.1 GCA003254255_00519 CDS open 86636-88573 _na     645_aa rhsA RHS repeat domain-containing protein
963 QKZH01000005.1 GCA003254255_00520 CDS open 88583-89080 _na     165_aa DUF4352 domain-containing protein
964 QKZH01000005.1 GCA003254255_00521 CDS open 89110-89259 _na     49_aa hypothetical protein
965 QKZH01000005.1 GCA003254255_00522 CDS open 89446-90198 _na     250_aa RHS repeat-associated core domain-containing protein
966 QKZH01000005.1 GCA003254255_00523 CDS open 90340-90963 _na     207_aa DUF5071 domain-containing protein
967 QKZH01000005.1 GCA003254255_00524 CDS open 91445-91831 _na     128_aa hypothetical protein
968 QKZH01000005.1 GCA003254255_00525 CDS open 91875-92657 _na     260_aa hypothetical protein
969 QKZH01000005.1 GCA003254255_00526 CDS open 92825-93115 _na     96_aa hypothetical protein
970 QKZH01000005.1 GCA003254255_00527 CDS open 93146-93514 _na     122_aa hypothetical protein
971 QKZH01000005.1 GCA003254255_00528 CDS open 93524-93943 _na     139_aa hypothetical protein
972 QKZH01000005.1 GCA003254255_00529 CDS open 93956-94963 _na     335_aa Lipoprotein
973 QKZH01000005.1 GCA003254255_00530 CDS open 95142-95288 _na     48_aa YD repeat protein (3 repeats)
974 QKZH01000005.1 GCA003254255_00439 gene open 28-750
975 QKZH01000005.1 GCA003254255_00440 gene open 798-2498 norD
976 QKZH01000005.1 GCA003254255_00441 gene open 2495-3412 mMP0363
977 QKZH01000005.1 GCA003254255_00442 gene open 3561-5102 cstA
978 QKZH01000005.1 GCA003254255_00443 gene open 5348-6298
979 QKZH01000005.1 GCA003254255_00444 gene open 6373-7314 fabH
980 QKZH01000005.1 GCA003254255_00445 gene open 7374-7610 acpP
981 QKZH01000005.1 GCA003254255_00446 gene open 7659-8597 fabK
982 QKZH01000005.1 GCA003254255_00447 gene open 8600-9517 fabD
983 QKZH01000005.1 GCA003254255_00448 gene open 9514-10260 fabG
984 QKZH01000005.1 GCA003254255_00449 gene open 10341-11576 fabF
985 QKZH01000005.1 GCA003254255_00450 gene open 11581-12015 accB
986 QKZH01000005.1 GCA003254255_00451 gene open 12019-12444 fabZ
987 QKZH01000005.1 GCA003254255_00452 gene open 12445-13788 pccA
988 QKZH01000005.1 GCA003254255_00453 gene open 13813-15513 accD
989 QKZH01000005.1 GCA003254255_00454 gene open 15533-16708 yrpB
990 QKZH01000005.1 GCA003254255_00455 gene open 16990-18312
991 QKZH01000005.1 GCA003254255_00456 gene open 18320-19180 yaeI
992 QKZH01000005.1 GCA003254255_00457 gene open 19229-20023 scpA
993 QKZH01000005.1 GCA003254255_00458 gene open 20016-20621 scpB
994 QKZH01000005.1 GCA003254255_00459 gene open 20625-21056 dut
995 QKZH01000005.1 GCA003254255_00460 gene open 21028-21873 lapB
996 QKZH01000005.1 GCA003254255_00461 gene open 21881-23122 hflX
997 QKZH01000005.1 GCA003254255_00462 gene open 23213-23908
998 QKZH01000005.1 GCA003254255_00463 gene open 23999-24667 yIH1
999 QKZH01000005.1 GCA003254255_00464 gene open 24727-25623 corA
1000 QKZH01000005.1 GCA003254255_00465 gene open 25715-26830 rbsK