HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Patescibacteria [C1 O1 F1 G1] bacterium HMT-872 (GCA_003260325.1)

Select a Genome:
BAKTA Annotations for GCA_003260325.1
Genome Selected: Patescibacteria [C1 O1 F1 G1] bacterium HMT-872
ContigsBases CDSrRNA tmRNAtRNA
11 1,044,027 1032 1 0 30
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 2134 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:2]    |    Number of Records Found: 2134 [5 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
501 MOLU01000001.1 GCA003260325_00245 gene open 257459-257782
502 MOLU01000001.1 GCA003260325_00246 gene open 257795-257938 rplW
503 MOLU01000001.1 GCA003260325_00247 gene open 258646-258765
504 MOLU01000001.1 GCA003260325_00248 gene open 260729-260938 rpmC
505 MOLU01000001.1 GCA003260325_00249 gene open 260969-261124 rpsQ
506 MOLU01000001.1 GCA003260325_00250 gene open 261214-261375
507 MOLU01000001.1 GCA003260325_00251 gene open 261597-261746
508 MOLU01000001.1 GCA003260325_00252 gene open 262551-262685
509 MOLU01000001.1 GCA003260325_00253 gene open 262810-262971 rpsH
510 MOLU01000001.1 GCA003260325_00254 gene open 263962-264129
511 MOLU01000001.1 GCA003260325_00255 gene open 264490-264684 rpsE
512 MOLU01000001.1 GCA003260325_00256 gene open 264891-265061
513 MOLU01000001.1 GCA003260325_00257 gene open 267506-267649
514 MOLU01000001.1 GCA003260325_00258 gene open 267881-267991
515 MOLU01000001.1 GCA003260325_00259 gene open 268028-268228
516 MOLU01000001.1 GCA003260325_00260 gene open 268672-268890 rpsR
517 MOLU01000001.1 GCA003260325_00261 gene open 268971-269066
518 MOLU01000001.1 GCA003260325_00262 gene open 269190-269366
519 MOLU01000001.1 GCA003260325_00263 gene open 269549-269680 rpsF
520 MOLU01000001.1 GCA003260325_00265 gene open 270840-271001
521 MOLU01000001.1 GCA003260325_00266 gene open 273497-273670
522 MOLU01000001.1 GCA003260325_00267 gene open 273818-273931
523 MOLU01000001.1 GCA003260325_00268 gene open 276203-276352 arsR
524 MOLU01000001.1 GCA003260325_00269 gene open 276545-276904
525 MOLU01000001.1 GCA003260325_00270 gene open 279037-279216
526 MOLU01000001.1 GCA003260325_00271 gene open 279807-280013
527 MOLU01000001.1 GCA003260325_00023 gene open 18757-18832 trnK
528 MOLU01000001.1 GCA003260325_00171 gene open 178836-178910 trnfM
529 MOLU01000001.1 GCA003260325_00172 gene open 178977-179051 trnE
530 MOLU01000001.1 GCA003260325_00178 gene open 184052-184137 trnL
531 MOLU01000001.1 GCA003260325_00181 gene open 186519-186595 trnA
532 MOLU01000001.1 GCA003260325_00182 gene open 186704-186782 trnD
533 MOLU01000001.1 GCA003260325_00217 gene open 227567-227641 trnR
534 MOLU01000001.1 GCA003260325_00264 gene open 269844-269920 trnM
535 MOLU01000001.1 GCA003260325_00272 gene open 282536-282610 trnN
536 MOLU01000001.1 GCA003260325_00273 gene open 282654-282743 trnS
537 MOLU01000001.1 GCA003260325_00274 gene open 282756-282845 trnS
538 MOLU01000001.1 GCA003260325_00275 gene open 282949-283024 trnI
539 MOLU01000001.1 GCA003260325_00023 tRNA open 18757-18832 trnK tRNA-Lys(ttt)
540 MOLU01000001.1 GCA003260325_00171 tRNA open 178836-178910 trnfM tRNA-fMet(cat)
541 MOLU01000001.1 GCA003260325_00172 tRNA open 178977-179051 trnE tRNA-Glu(ttc)
542 MOLU01000001.1 GCA003260325_00178 tRNA open 184052-184137 trnL tRNA-Leu(taa)
543 MOLU01000001.1 GCA003260325_00181 tRNA open 186519-186595 trnA tRNA-Ala(tgc)
544 MOLU01000001.1 GCA003260325_00182 tRNA open 186704-186782 trnD tRNA-Asp(gtc)
545 MOLU01000001.1 GCA003260325_00217 tRNA open 227567-227641 trnR tRNA-Arg(cct)
546 MOLU01000001.1 GCA003260325_00264 tRNA open 269844-269920 trnM tRNA-Met(cat)
547 MOLU01000001.1 GCA003260325_00272 tRNA open 282536-282610 trnN tRNA-Asn(gtt)
548 MOLU01000001.1 GCA003260325_00273 tRNA open 282654-282743 trnS tRNA-Ser(tga)
549 MOLU01000001.1 GCA003260325_00274 tRNA open 282756-282845 trnS tRNA-Ser(gct)
550 MOLU01000001.1 GCA003260325_00275 tRNA open 282949-283024 trnI tRNA-Ile2(cat)
551 MOLU01000002.1 GCA003260325_00276 CDS open 694-1098 _na     134_aa hypothetical protein
552 MOLU01000002.1 GCA003260325_00277 CDS open 1915-2085 _na     56_aa hypothetical protein
553 MOLU01000002.1 GCA003260325_00278 CDS open 2499-2732 _na     77_aa Type II secretion system protein
554 MOLU01000002.1 GCA003260325_00279 CDS open 2762-2980 _na     72_aa hypothetical protein
555 MOLU01000002.1 GCA003260325_00280 CDS open 3246-3518 _na     90_aa AMMECR1 domain-containing protein
556 MOLU01000002.1 GCA003260325_00281 CDS open 4959-5177 _na     72_aa Hydrogenase maturation protease
557 MOLU01000002.1 GCA003260325_00283 CDS open 8467-8640 _na     57_aa hypothetical protein
558 MOLU01000002.1 GCA003260325_00284 CDS open 10543-10761 _na     72_aa hypothetical protein
559 MOLU01000002.1 GCA003260325_00285 CDS open 12653-12829 _na     58_aa secA SecA family profile domain-containing protein
560 MOLU01000002.1 GCA003260325_00286 CDS open 13907-14098 _na     63_aa hypothetical protein
561 MOLU01000002.1 GCA003260325_00287 CDS open 14207-14341 _na     44_aa secA SecA Wing/Scaffold domain-containing protein
562 MOLU01000002.1 GCA003260325_00288 CDS open 14363-14602 _na     79_aa hypothetical protein
563 MOLU01000002.1 GCA003260325_00289 CDS open 14685-14831 _na     48_aa hypothetical protein
564 MOLU01000002.1 GCA003260325_00290 CDS open 14945-15091 _na     48_aa hypothetical protein
565 MOLU01000002.1 GCA003260325_00291 CDS open 15328-15528 _na     66_aa hypothetical protein
566 MOLU01000002.1 GCA003260325_00292 CDS open 15772-15999 _na     75_aa hypothetical protein
567 MOLU01000002.1 GCA003260325_00293 CDS open 17859-18002 _na     47_aa hypothetical protein
568 MOLU01000002.1 GCA003260325_00294 CDS open 19053-19220 _na     55_aa hypothetical protein
569 MOLU01000002.1 GCA003260325_00295 CDS open 19941-20183 _na     80_aa hypothetical protein
570 MOLU01000002.1 GCA003260325_00296 CDS open 20483-21175 _na     230_aa Peptidase C39-like domain-containing protein
571 MOLU01000002.1 GCA003260325_00297 CDS open 22291-22539 _na     82_aa hypothetical protein
572 MOLU01000002.1 GCA003260325_00298 CDS open 24156-24374 _na     72_aa hypothetical protein
573 MOLU01000002.1 GCA003260325_00299 CDS open 25759-25917 _na     52_aa hypothetical protein
574 MOLU01000002.1 GCA003260325_00300 CDS open 26479-26673 _na     64_aa hypothetical protein
575 MOLU01000002.1 GCA003260325_00302 CDS open 27257-27424 _na     55_aa hypothetical protein
576 MOLU01000002.1 GCA003260325_00303 CDS open 28594-28719 _na     41_aa hypothetical protein
577 MOLU01000002.1 GCA003260325_00304 CDS open 29750-29848 _na     32_aa hypothetical protein
578 MOLU01000002.1 GCA003260325_00305 CDS open 32953-33153 _na     66_aa hypothetical protein
579 MOLU01000002.1 GCA003260325_00306 CDS open 33320-33451 _na     43_aa hypothetical protein
580 MOLU01000002.1 GCA003260325_00307 CDS open 33529-33648 _na     39_aa hypothetical protein
581 MOLU01000002.1 GCA003260325_00308 CDS open 33912-34169 _na     85_aa hypothetical protein
582 MOLU01000002.1 GCA003260325_00309 CDS open 35693-35815 _na     40_aa hypothetical protein
583 MOLU01000002.1 GCA003260325_00310 CDS open 35837-36007 _na     56_aa hypothetical protein
584 MOLU01000002.1 GCA003260325_00311 CDS open 37291-37557 _na     88_aa Guanylate kinase-like domain-containing protein
585 MOLU01000002.1 GCA003260325_00312 CDS open 37560-37733 _na     57_aa hypothetical protein
586 MOLU01000002.1 GCA003260325_00313 CDS open 38227-38730 _na     167_aa Cardiolipin synthase N-terminal domain-containing protein
587 MOLU01000002.1 GCA003260325_00314 CDS open 38975-39085 _na     36_aa hypothetical protein
588 MOLU01000002.1 GCA003260325_00315 CDS open 39420-39695 _na     91_aa hypothetical protein
589 MOLU01000002.1 GCA003260325_00316 CDS open 39926-40054 _na     42_aa hypothetical protein
590 MOLU01000002.1 GCA003260325_00317 CDS open 41049-41264 _na     71_aa hypothetical protein
591 MOLU01000002.1 GCA003260325_00318 CDS open 41903-42613 _na     236_aa hypothetical protein
592 MOLU01000002.1 GCA003260325_00319 CDS open 42526-42972 _na     148_aa hypothetical protein
593 MOLU01000002.1 GCA003260325_00320 CDS open 43724-43864 _na     46_aa hypothetical protein
594 MOLU01000002.1 GCA003260325_00321 CDS open 46085-46225 _na     46_aa hypothetical protein
595 MOLU01000002.1 GCA003260325_00322 CDS open 46325-46510 _na     61_aa hypothetical protein
596 MOLU01000002.1 GCA003260325_00323 CDS open 46970-47107 _na     45_aa hypothetical protein
597 MOLU01000002.1 GCA003260325_00324 CDS open 48253-48489 _na     78_aa hypothetical protein
598 MOLU01000002.1 GCA003260325_00325 CDS open 48533-48628 _na     31_aa hypothetical protein
599 MOLU01000002.1 GCA003260325_00326 CDS open 48716-48868 _na     50_aa hypothetical protein
600 MOLU01000002.1 GCA003260325_00327 CDS open 49097-49423 _na     108_aa rplQ 50S ribosomal protein L17
601 MOLU01000002.1 GCA003260325_00328 CDS open 49486-49641 _na     51_aa hypothetical protein
602 MOLU01000002.1 GCA003260325_00329 CDS open 49904-50041 _na     45_aa hypothetical protein
603 MOLU01000002.1 GCA003260325_00330 CDS open 50883-51080 _na     65_aa rpsG 30S ribosomal protein S7
604 MOLU01000002.1 GCA003260325_00331 CDS open 51108-51311 _na     67_aa rpsG 30S ribosomal protein S7
605 MOLU01000002.1 GCA003260325_00332 CDS open 51766-51939 _na     57_aa hypothetical protein
606 MOLU01000002.1 GCA003260325_00333 CDS open 53562-53792 _na     76_aa hypothetical protein
607 MOLU01000002.1 GCA003260325_00334 CDS open 55596-55844 _na     82_aa hypothetical protein
608 MOLU01000002.1 GCA003260325_00335 CDS open 55841-56041 _na     66_aa hypothetical protein
609 MOLU01000002.1 GCA003260325_00336 CDS open 56885-57127 _na     80_aa hypothetical protein
610 MOLU01000002.1 GCA003260325_00337 CDS open 59496-59762 _na     88_aa hypothetical protein
611 MOLU01000002.1 GCA003260325_00338 CDS open 61017-61175 _na     52_aa hypothetical protein
612 MOLU01000002.1 GCA003260325_00339 CDS open 62886-63026 _na     46_aa hypothetical protein
613 MOLU01000002.1 GCA003260325_00340 CDS open 63510-63710 _na     66_aa hypothetical protein
614 MOLU01000002.1 GCA003260325_00341 CDS open 63940-64098 _na     52_aa hypothetical protein
615 MOLU01000002.1 GCA003260325_00342 CDS open 64111-64269 _na     52_aa hypothetical protein
616 MOLU01000002.1 GCA003260325_00343 CDS open 64379-64507 _na     42_aa hypothetical protein
617 MOLU01000002.1 GCA003260325_00344 CDS open 67478-67657 _na     59_aa hypothetical protein
618 MOLU01000002.1 GCA003260325_00345 CDS open 67836-68060 _na     74_aa hypothetical protein
619 MOLU01000002.1 GCA003260325_00346 CDS open 68536-68775 _na     79_aa hypothetical protein
620 MOLU01000002.1 GCA003260325_00347 CDS open 69785-69949 _na     54_aa hypothetical protein
621 MOLU01000002.1 GCA003260325_00348 CDS open 70488-70838 _na     116_aa hypothetical protein
622 MOLU01000002.1 GCA003260325_00349 CDS open 72516-72722 _na     68_aa hypothetical protein
623 MOLU01000002.1 GCA003260325_00350 CDS open 73412-73615 _na     67_aa hypothetical protein
624 MOLU01000002.1 GCA003260325_00351 CDS open 74383-74565 _na     60_aa hypothetical protein
625 MOLU01000002.1 GCA003260325_00352 CDS open 74616-74846 _na     76_aa hypothetical protein
626 MOLU01000002.1 GCA003260325_00353 CDS open 76808-76957 _na     49_aa Septum formation initiator family protein
627 MOLU01000002.1 GCA003260325_00354 CDS open 78021-78140 _na     39_aa hypothetical protein
628 MOLU01000002.1 GCA003260325_00355 CDS open 78815-79021 _na     68_aa hypothetical protein
629 MOLU01000002.1 GCA003260325_00356 CDS open 79206-79403 _na     65_aa hypothetical protein
630 MOLU01000002.1 GCA003260325_00357 CDS open 80233-80613 _na     126_aa hypothetical protein
631 MOLU01000002.1 GCA003260325_00358 CDS open 81760-81927 _na     55_aa hypothetical protein
632 MOLU01000002.1 GCA003260325_00359 CDS open 81948-82175 _na     75_aa hypothetical protein
633 MOLU01000002.1 GCA003260325_00360 CDS open 83519-83695 _na     58_aa nifU NIF system FeS cluster assembly NifU N-terminal domain-containing protein
634 MOLU01000002.1 GCA003260325_00361 CDS open 85358-85555 _na     65_aa hypothetical protein
635 MOLU01000002.1 GCA003260325_00362 CDS open 87630-87785 _na     51_aa hypothetical protein
636 MOLU01000002.1 GCA003260325_00363 CDS open 88013-88261 _na     82_aa rpsT 30S ribosomal protein S20
637 MOLU01000002.1 GCA003260325_00364 CDS open 88768-88932 _na     54_aa hypothetical protein
638 MOLU01000002.1 GCA003260325_00365 CDS open 89034-89243 _na     69_aa hypothetical protein
639 MOLU01000002.1 GCA003260325_00366 CDS open 89854-90090 _na     78_aa hypothetical protein
640 MOLU01000002.1 GCA003260325_00367 CDS open 90388-90528 _na     46_aa hypothetical protein
641 MOLU01000002.1 GCA003260325_00368 CDS open 91460-91594 _na     44_aa hypothetical protein
642 MOLU01000002.1 GCA003260325_00369 CDS open 92260-92577 _na     105_aa hypothetical protein
643 MOLU01000002.1 GCA003260325_00370 CDS open 92726-93121 _na     131_aa hypothetical protein
644 MOLU01000002.1 GCA003260325_00371 CDS open 94171-94431 _na     86_aa hypothetical protein
645 MOLU01000002.1 GCA003260325_00372 CDS open 96361-96570 _na     69_aa hypothetical protein
646 MOLU01000002.1 GCA003260325_00373 CDS open 97930-98259 _na     109_aa hypothetical protein
647 MOLU01000002.1 GCA003260325_00374 CDS open 99926-100123 _na     65_aa hypothetical protein
648 MOLU01000002.1 GCA003260325_00375 CDS open 100443-100634 _na     63_aa hypothetical protein
649 MOLU01000002.1 GCA003260325_00376 CDS open 100824-100922 _na     32_aa hypothetical protein
650 MOLU01000002.1 GCA003260325_00377 CDS open 101223-101384 _na     53_aa hypothetical protein
651 MOLU01000002.1 GCA003260325_00378 CDS open 102347-102616 _na     89_aa Four helix bundle protein
652 MOLU01000002.1 GCA003260325_00379 CDS open 102776-103057 _na     93_aa hypothetical protein
653 MOLU01000002.1 GCA003260325_00380 CDS open 103061-103246 _na     61_aa hypothetical protein
654 MOLU01000002.1 GCA003260325_00381 CDS open 103317-103478 _na     53_aa hypothetical protein
655 MOLU01000002.1 GCA003260325_00382 CDS open 104020-104223 _na     67_aa hypothetical protein
656 MOLU01000002.1 GCA003260325_00383 CDS open 104335-104556 _na     73_aa hypothetical protein
657 MOLU01000002.1 GCA003260325_00384 CDS open 104705-104815 _na     36_aa hypothetical protein
658 MOLU01000002.1 GCA003260325_00385 CDS open 104884-105000 _na     38_aa hypothetical protein
659 MOLU01000002.1 GCA003260325_00386 CDS open 105067-105336 _na     89_aa hypothetical protein
660 MOLU01000002.1 GCA003260325_00387 CDS open 105349-105483 _na     44_aa hypothetical protein
661 MOLU01000002.1 GCA003260325_00388 CDS open 105553-105777 _na     74_aa hypothetical protein
662 MOLU01000002.1 GCA003260325_00389 CDS open 105985-106125 _na     46_aa hypothetical protein
663 MOLU01000002.1 GCA003260325_00390 CDS open 106942-107262 _na     106_aa hypothetical protein
664 MOLU01000002.1 GCA003260325_00391 CDS open 107164-107538 _na     124_aa hypothetical protein
665 MOLU01000002.1 GCA003260325_00392 CDS open 108969-109187 _na     72_aa hypothetical protein
666 MOLU01000002.1 GCA003260325_00393 CDS open 109269-109445 _na     58_aa hypothetical protein
667 MOLU01000002.1 GCA003260325_00394 CDS open 109447-109563 _na     38_aa hypothetical protein
668 MOLU01000002.1 GCA003260325_00395 CDS open 109574-109933 _na     119_aa hypothetical protein
669 MOLU01000002.1 GCA003260325_00396 CDS open 111347-111490 _na     47_aa hypothetical protein
670 MOLU01000002.1 GCA003260325_00397 CDS open 112420-112563 _na     47_aa hypothetical protein
671 MOLU01000002.1 GCA003260325_00398 CDS open 112699-112866 _na     55_aa hypothetical protein
672 MOLU01000002.1 GCA003260325_00399 CDS open 113266-113472 _na     68_aa hypothetical protein
673 MOLU01000002.1 GCA003260325_00400 CDS open 114630-114953 _na     107_aa hypothetical protein
674 MOLU01000002.1 GCA003260325_00401 CDS open 118522-118791 _na     89_aa hypothetical protein
675 MOLU01000002.1 GCA003260325_00402 CDS open 121027-121197 _na     56_aa hypothetical protein
676 MOLU01000002.1 GCA003260325_00403 CDS open 121927-122031 _na     34_aa hypothetical protein
677 MOLU01000002.1 GCA003260325_00404 CDS open 122522-122800 _na     92_aa hypothetical protein
678 MOLU01000002.1 GCA003260325_00405 CDS open 122775-123062 _na     95_aa hypothetical protein
679 MOLU01000002.1 GCA003260325_00406 CDS open 124375-124725 _na     116_aa hypothetical protein
680 MOLU01000002.1 GCA003260325_00407 CDS open 124995-125297 _na     100_aa hypothetical protein
681 MOLU01000002.1 GCA003260325_00408 CDS open 125719-125889 _na     56_aa hypothetical protein
682 MOLU01000002.1 GCA003260325_00409 CDS open 129189-129485 _na     98_aa hypothetical protein
683 MOLU01000002.1 GCA003260325_00410 CDS open 130032-130214 _na     60_aa hypothetical protein
684 MOLU01000002.1 GCA003260325_00411 CDS open 131367-131576 _na     69_aa Glutamate/phenylalanine/leucine/valine/L-tryptophan dehydrogenase C-terminal domain-containing protein
685 MOLU01000002.1 GCA003260325_00412 CDS open 131662-131940 _na     92_aa hypothetical protein
686 MOLU01000002.1 GCA003260325_00413 CDS open 133089-133235 _na     48_aa hypothetical protein
687 MOLU01000002.1 GCA003260325_00414 CDS open 133353-133523 _na     56_aa hypothetical protein
688 MOLU01000002.1 GCA003260325_00415 CDS open 133740-133919 _na     59_aa hypothetical protein
689 MOLU01000002.1 GCA003260325_00416 CDS open 134008-134334 _na     108_aa hypothetical protein
690 MOLU01000002.1 GCA003260325_00417 CDS open 135088-135237 _na     49_aa hypothetical protein
691 MOLU01000002.1 GCA003260325_00418 CDS open 136274-136513 _na     79_aa DUF721 domain-containing protein
692 MOLU01000002.1 GCA003260325_00419 CDS open 138371-138583 _na     70_aa hypothetical protein
693 MOLU01000002.1 GCA003260325_00420 CDS open 138860-139102 _na     80_aa hypothetical protein
694 MOLU01000002.1 GCA003260325_00421 CDS open 139967-140107 _na     46_aa hypothetical protein
695 MOLU01000002.1 GCA003260325_00422 CDS open 140204-140524 _na     106_aa hypothetical protein
696 MOLU01000002.1 GCA003260325_00423 CDS open 141140-141400 _na     86_aa hypothetical protein
697 MOLU01000002.1 GCA003260325_00424 CDS open 142258-142518 _na     86_aa hypothetical protein
698 MOLU01000002.1 GCA003260325_00425 CDS open 144023-144208 _na     61_aa hypothetical protein
699 MOLU01000002.1 GCA003260325_00426 CDS open 145898-146011 _na     37_aa hypothetical protein
700 MOLU01000002.1 GCA003260325_00427 CDS open 147220-147426 _na     68_aa hypothetical protein
701 MOLU01000002.1 GCA003260325_00428 CDS open 148550-148819 _na     89_aa hypothetical protein
702 MOLU01000002.1 GCA003260325_00429 CDS open 149327-149527 _na     66_aa hypothetical protein
703 MOLU01000002.1 GCA003260325_00276 gene open 694-1098
704 MOLU01000002.1 GCA003260325_00277 gene open 1915-2085
705 MOLU01000002.1 GCA003260325_00278 gene open 2499-2732
706 MOLU01000002.1 GCA003260325_00279 gene open 2762-2980
707 MOLU01000002.1 GCA003260325_00280 gene open 3246-3518
708 MOLU01000002.1 GCA003260325_00281 gene open 4959-5177
709 MOLU01000002.1 GCA003260325_00283 gene open 8467-8640
710 MOLU01000002.1 GCA003260325_00284 gene open 10543-10761
711 MOLU01000002.1 GCA003260325_00285 gene open 12653-12829 secA
712 MOLU01000002.1 GCA003260325_00286 gene open 13907-14098
713 MOLU01000002.1 GCA003260325_00287 gene open 14207-14341 secA
714 MOLU01000002.1 GCA003260325_00288 gene open 14363-14602
715 MOLU01000002.1 GCA003260325_00289 gene open 14685-14831
716 MOLU01000002.1 GCA003260325_00290 gene open 14945-15091
717 MOLU01000002.1 GCA003260325_00291 gene open 15328-15528
718 MOLU01000002.1 GCA003260325_00292 gene open 15772-15999
719 MOLU01000002.1 GCA003260325_00293 gene open 17859-18002
720 MOLU01000002.1 GCA003260325_00294 gene open 19053-19220
721 MOLU01000002.1 GCA003260325_00295 gene open 19941-20183
722 MOLU01000002.1 GCA003260325_00296 gene open 20483-21175
723 MOLU01000002.1 GCA003260325_00297 gene open 22291-22539
724 MOLU01000002.1 GCA003260325_00298 gene open 24156-24374
725 MOLU01000002.1 GCA003260325_00299 gene open 25759-25917
726 MOLU01000002.1 GCA003260325_00300 gene open 26479-26673
727 MOLU01000002.1 GCA003260325_00302 gene open 27257-27424
728 MOLU01000002.1 GCA003260325_00303 gene open 28594-28719
729 MOLU01000002.1 GCA003260325_00304 gene open 29750-29848
730 MOLU01000002.1 GCA003260325_00305 gene open 32953-33153
731 MOLU01000002.1 GCA003260325_00306 gene open 33320-33451
732 MOLU01000002.1 GCA003260325_00307 gene open 33529-33648
733 MOLU01000002.1 GCA003260325_00308 gene open 33912-34169
734 MOLU01000002.1 GCA003260325_00309 gene open 35693-35815
735 MOLU01000002.1 GCA003260325_00310 gene open 35837-36007
736 MOLU01000002.1 GCA003260325_00311 gene open 37291-37557
737 MOLU01000002.1 GCA003260325_00312 gene open 37560-37733
738 MOLU01000002.1 GCA003260325_00313 gene open 38227-38730
739 MOLU01000002.1 GCA003260325_00314 gene open 38975-39085
740 MOLU01000002.1 GCA003260325_00315 gene open 39420-39695
741 MOLU01000002.1 GCA003260325_00316 gene open 39926-40054
742 MOLU01000002.1 GCA003260325_00317 gene open 41049-41264
743 MOLU01000002.1 GCA003260325_00318 gene open 41903-42613
744 MOLU01000002.1 GCA003260325_00319 gene open 42526-42972
745 MOLU01000002.1 GCA003260325_00320 gene open 43724-43864
746 MOLU01000002.1 GCA003260325_00321 gene open 46085-46225
747 MOLU01000002.1 GCA003260325_00322 gene open 46325-46510
748 MOLU01000002.1 GCA003260325_00323 gene open 46970-47107
749 MOLU01000002.1 GCA003260325_00324 gene open 48253-48489
750 MOLU01000002.1 GCA003260325_00325 gene open 48533-48628
751 MOLU01000002.1 GCA003260325_00326 gene open 48716-48868
752 MOLU01000002.1 GCA003260325_00327 gene open 49097-49423 rplQ
753 MOLU01000002.1 GCA003260325_00328 gene open 49486-49641
754 MOLU01000002.1 GCA003260325_00329 gene open 49904-50041
755 MOLU01000002.1 GCA003260325_00330 gene open 50883-51080 rpsG
756 MOLU01000002.1 GCA003260325_00331 gene open 51108-51311 rpsG
757 MOLU01000002.1 GCA003260325_00332 gene open 51766-51939
758 MOLU01000002.1 GCA003260325_00333 gene open 53562-53792
759 MOLU01000002.1 GCA003260325_00334 gene open 55596-55844
760 MOLU01000002.1 GCA003260325_00335 gene open 55841-56041
761 MOLU01000002.1 GCA003260325_00336 gene open 56885-57127
762 MOLU01000002.1 GCA003260325_00337 gene open 59496-59762
763 MOLU01000002.1 GCA003260325_00338 gene open 61017-61175
764 MOLU01000002.1 GCA003260325_00339 gene open 62886-63026
765 MOLU01000002.1 GCA003260325_00340 gene open 63510-63710
766 MOLU01000002.1 GCA003260325_00341 gene open 63940-64098
767 MOLU01000002.1 GCA003260325_00342 gene open 64111-64269
768 MOLU01000002.1 GCA003260325_00343 gene open 64379-64507
769 MOLU01000002.1 GCA003260325_00344 gene open 67478-67657
770 MOLU01000002.1 GCA003260325_00345 gene open 67836-68060
771 MOLU01000002.1 GCA003260325_00346 gene open 68536-68775
772 MOLU01000002.1 GCA003260325_00347 gene open 69785-69949
773 MOLU01000002.1 GCA003260325_00348 gene open 70488-70838
774 MOLU01000002.1 GCA003260325_00349 gene open 72516-72722
775 MOLU01000002.1 GCA003260325_00350 gene open 73412-73615
776 MOLU01000002.1 GCA003260325_00351 gene open 74383-74565
777 MOLU01000002.1 GCA003260325_00352 gene open 74616-74846
778 MOLU01000002.1 GCA003260325_00353 gene open 76808-76957
779 MOLU01000002.1 GCA003260325_00354 gene open 78021-78140
780 MOLU01000002.1 GCA003260325_00355 gene open 78815-79021
781 MOLU01000002.1 GCA003260325_00356 gene open 79206-79403
782 MOLU01000002.1 GCA003260325_00357 gene open 80233-80613
783 MOLU01000002.1 GCA003260325_00358 gene open 81760-81927
784 MOLU01000002.1 GCA003260325_00359 gene open 81948-82175
785 MOLU01000002.1 GCA003260325_00360 gene open 83519-83695 nifU
786 MOLU01000002.1 GCA003260325_00361 gene open 85358-85555
787 MOLU01000002.1 GCA003260325_00362 gene open 87630-87785
788 MOLU01000002.1 GCA003260325_00363 gene open 88013-88261 rpsT
789 MOLU01000002.1 GCA003260325_00364 gene open 88768-88932
790 MOLU01000002.1 GCA003260325_00365 gene open 89034-89243
791 MOLU01000002.1 GCA003260325_00366 gene open 89854-90090
792 MOLU01000002.1 GCA003260325_00367 gene open 90388-90528
793 MOLU01000002.1 GCA003260325_00368 gene open 91460-91594
794 MOLU01000002.1 GCA003260325_00369 gene open 92260-92577
795 MOLU01000002.1 GCA003260325_00370 gene open 92726-93121
796 MOLU01000002.1 GCA003260325_00371 gene open 94171-94431
797 MOLU01000002.1 GCA003260325_00372 gene open 96361-96570
798 MOLU01000002.1 GCA003260325_00373 gene open 97930-98259
799 MOLU01000002.1 GCA003260325_00374 gene open 99926-100123
800 MOLU01000002.1 GCA003260325_00375 gene open 100443-100634
801 MOLU01000002.1 GCA003260325_00376 gene open 100824-100922
802 MOLU01000002.1 GCA003260325_00377 gene open 101223-101384
803 MOLU01000002.1 GCA003260325_00378 gene open 102347-102616
804 MOLU01000002.1 GCA003260325_00379 gene open 102776-103057
805 MOLU01000002.1 GCA003260325_00380 gene open 103061-103246
806 MOLU01000002.1 GCA003260325_00381 gene open 103317-103478
807 MOLU01000002.1 GCA003260325_00382 gene open 104020-104223
808 MOLU01000002.1 GCA003260325_00383 gene open 104335-104556
809 MOLU01000002.1 GCA003260325_00384 gene open 104705-104815
810 MOLU01000002.1 GCA003260325_00385 gene open 104884-105000
811 MOLU01000002.1 GCA003260325_00386 gene open 105067-105336
812 MOLU01000002.1 GCA003260325_00387 gene open 105349-105483
813 MOLU01000002.1 GCA003260325_00388 gene open 105553-105777
814 MOLU01000002.1 GCA003260325_00389 gene open 105985-106125
815 MOLU01000002.1 GCA003260325_00390 gene open 106942-107262
816 MOLU01000002.1 GCA003260325_00391 gene open 107164-107538
817 MOLU01000002.1 GCA003260325_00392 gene open 108969-109187
818 MOLU01000002.1 GCA003260325_00393 gene open 109269-109445
819 MOLU01000002.1 GCA003260325_00394 gene open 109447-109563
820 MOLU01000002.1 GCA003260325_00395 gene open 109574-109933
821 MOLU01000002.1 GCA003260325_00396 gene open 111347-111490
822 MOLU01000002.1 GCA003260325_00397 gene open 112420-112563
823 MOLU01000002.1 GCA003260325_00398 gene open 112699-112866
824 MOLU01000002.1 GCA003260325_00399 gene open 113266-113472
825 MOLU01000002.1 GCA003260325_00400 gene open 114630-114953
826 MOLU01000002.1 GCA003260325_00401 gene open 118522-118791
827 MOLU01000002.1 GCA003260325_00402 gene open 121027-121197
828 MOLU01000002.1 GCA003260325_00403 gene open 121927-122031
829 MOLU01000002.1 GCA003260325_00404 gene open 122522-122800
830 MOLU01000002.1 GCA003260325_00405 gene open 122775-123062
831 MOLU01000002.1 GCA003260325_00406 gene open 124375-124725
832 MOLU01000002.1 GCA003260325_00407 gene open 124995-125297
833 MOLU01000002.1 GCA003260325_00408 gene open 125719-125889
834 MOLU01000002.1 GCA003260325_00409 gene open 129189-129485
835 MOLU01000002.1 GCA003260325_00410 gene open 130032-130214
836 MOLU01000002.1 GCA003260325_00411 gene open 131367-131576
837 MOLU01000002.1 GCA003260325_00412 gene open 131662-131940
838 MOLU01000002.1 GCA003260325_00413 gene open 133089-133235
839 MOLU01000002.1 GCA003260325_00414 gene open 133353-133523
840 MOLU01000002.1 GCA003260325_00415 gene open 133740-133919
841 MOLU01000002.1 GCA003260325_00416 gene open 134008-134334
842 MOLU01000002.1 GCA003260325_00417 gene open 135088-135237
843 MOLU01000002.1 GCA003260325_00418 gene open 136274-136513
844 MOLU01000002.1 GCA003260325_00419 gene open 138371-138583
845 MOLU01000002.1 GCA003260325_00420 gene open 138860-139102
846 MOLU01000002.1 GCA003260325_00421 gene open 139967-140107
847 MOLU01000002.1 GCA003260325_00422 gene open 140204-140524
848 MOLU01000002.1 GCA003260325_00423 gene open 141140-141400
849 MOLU01000002.1 GCA003260325_00424 gene open 142258-142518
850 MOLU01000002.1 GCA003260325_00425 gene open 144023-144208
851 MOLU01000002.1 GCA003260325_00426 gene open 145898-146011
852 MOLU01000002.1 GCA003260325_00427 gene open 147220-147426
853 MOLU01000002.1 GCA003260325_00428 gene open 148550-148819
854 MOLU01000002.1 GCA003260325_00429 gene open 149327-149527
855 MOLU01000002.1 GCA003260325_00282 gene open 6572-6646 trnQ
856 MOLU01000002.1 GCA003260325_00301 gene open 26970-27048
857 MOLU01000002.1 GCA003260325_00282 tRNA open 6572-6646 trnQ tRNA-Gln(ctg)
858 MOLU01000002.1 GCA003260325_00301 tRNA open 26970-27048 tRNA-Xxx
859 MOLU01000003.1 repeat_region open 55885-56243 CRISPR array with 6 repeats of length 36%2C consensus sequence GAATATGATAGTATATTTCTACTTTAATTTGTAGAT and spacer length 26
860 MOLU01000003.1 repeat_region open 62757-63834 CRISPR array with 4 repeats of length 36%2C consensus sequence GTTTAAACATAATATCTAATTTCTACTTTTGTAGAT and spacer length 27
861 MOLU01000003.1 repeat_region open 63011-63834 CRISPR array with 13 repeats of length 36%2C consensus sequence GTTTAAACATAATATCTAATTTCTACTTTTGTAGAT and spacer length 27
862 MOLU01000003.1 GCA003260325_00430 CDS open 2503-2700 _na     65_aa hypothetical protein
863 MOLU01000003.1 GCA003260325_00431 CDS open 3412-3552 _na     46_aa MTTase N-terminal domain-containing protein
864 MOLU01000003.1 GCA003260325_00432 CDS open 5210-5422 _na     70_aa hypothetical protein
865 MOLU01000003.1 GCA003260325_00433 CDS open 5618-5761 _na     47_aa hypothetical protein
866 MOLU01000003.1 GCA003260325_00434 CDS open 5786-6157 _na     123_aa hypothetical protein
867 MOLU01000003.1 GCA003260325_00435 CDS open 6580-6846 _na     88_aa hypothetical protein
868 MOLU01000003.1 GCA003260325_00436 CDS open 7829-7969 _na     46_aa hypothetical protein
869 MOLU01000003.1 GCA003260325_00437 CDS open 8226-8507 _na     93_aa hypothetical protein
870 MOLU01000003.1 GCA003260325_00438 CDS open 8682-8903 _na     73_aa hypothetical protein
871 MOLU01000003.1 GCA003260325_00439 CDS open 9560-9742 _na     60_aa hypothetical protein
872 MOLU01000003.1 GCA003260325_00440 CDS open 17386-17520 _na     44_aa hypothetical protein
873 MOLU01000003.1 GCA003260325_00441 CDS open 18491-18763 _na     90_aa hypothetical protein
874 MOLU01000003.1 GCA003260325_00442 CDS open 19363-19635 _na     90_aa valine--tRNA ligase
875 MOLU01000003.1 GCA003260325_00443 CDS open 20427-20723 _na     98_aa hypothetical protein
876 MOLU01000003.1 GCA003260325_00444 CDS open 21842-22036 _na     64_aa DUF6714 domain-containing protein
877 MOLU01000003.1 GCA003260325_00445 CDS open 22256-22360 _na     34_aa hypothetical protein
878 MOLU01000003.1 GCA003260325_00446 CDS open 23035-23433 _na     132_aa hypothetical protein
879 MOLU01000003.1 GCA003260325_00447 CDS open 24489-24701 _na     70_aa hypothetical protein
880 MOLU01000003.1 GCA003260325_00448 CDS open 25460-25780 _na     106_aa hypothetical protein
881 MOLU01000003.1 GCA003260325_00449 CDS open 28122-28271 _na     49_aa Putative large conductance mechanosensitive channel protein
882 MOLU01000003.1 GCA003260325_00450 CDS open 28329-28508 _na     59_aa mscL large conductance mechanosensitive channel protein MscL
883 MOLU01000003.1 GCA003260325_00451 CDS open 29446-29706 _na     86_aa hypothetical protein
884 MOLU01000003.1 GCA003260325_00452 CDS open 29976-30152 _na     58_aa hypothetical protein
885 MOLU01000003.1 GCA003260325_00453 CDS open 32434-32655 _na     73_aa hypothetical protein
886 MOLU01000003.1 GCA003260325_00454 CDS open 32804-33220 _na     138_aa hypothetical protein
887 MOLU01000003.1 GCA003260325_00455 CDS open 33661-33852 _na     63_aa hypothetical protein
888 MOLU01000003.1 GCA003260325_00456 CDS open 34441-34584 _na     47_aa DNA helicase DnaB-like N-terminal domain-containing protein
889 MOLU01000003.1 GCA003260325_00457 CDS open 34977-35123 _na     48_aa hypothetical protein
890 MOLU01000003.1 GCA003260325_00458 CDS open 35639-35875 _na     78_aa hypothetical protein
891 MOLU01000003.1 GCA003260325_00459 CDS open 36380-36583 _na     67_aa hypothetical protein
892 MOLU01000003.1 GCA003260325_00460 CDS open 36815-37081 _na     88_aa hypothetical protein
893 MOLU01000003.1 GCA003260325_00461 CDS open 37369-37620 _na     83_aa hypothetical protein
894 MOLU01000003.1 GCA003260325_00462 CDS open 37669-37818 _na     49_aa hypothetical protein
895 MOLU01000003.1 GCA003260325_00463 CDS open 38680-39099 _na     139_aa hypothetical protein
896 MOLU01000003.1 GCA003260325_00464 CDS open 40239-40619 _na     126_aa hypothetical protein
897 MOLU01000003.1 GCA003260325_00465 CDS open 40538-40936 _na     132_aa hypothetical protein
898 MOLU01000003.1 GCA003260325_00466 CDS open 41189-41596 _na     135_aa hypothetical protein
899 MOLU01000003.1 GCA003260325_00467 CDS open 42257-42691 _na     144_aa htpX protease HtpX
900 MOLU01000003.1 GCA003260325_00468 CDS open 44286-44591 _na     101_aa hypothetical protein
901 MOLU01000003.1 GCA003260325_00469 CDS open 45425-45592 _na     55_aa hypothetical protein
902 MOLU01000003.1 GCA003260325_00470 CDS open 45664-45828 _na     54_aa hypothetical protein
903 MOLU01000003.1 GCA003260325_00471 CDS open 45934-46077 _na     47_aa hypothetical protein
904 MOLU01000003.1 GCA003260325_00472 CDS open 47441-47599 _na     52_aa hypothetical protein
905 MOLU01000003.1 GCA003260325_00473 CDS open 47738-47962 _na     74_aa hypothetical protein
906 MOLU01000003.1 GCA003260325_00474 CDS open 51156-51722 _na     188_aa tRNA(Ile)-lysidine synthase
907 MOLU01000003.1 GCA003260325_00475 CDS open 51845-52228 _na     127_aa hypothetical protein
908 MOLU01000003.1 GCA003260325_00476 CDS open 54158-54268 _na     36_aa hypothetical protein
909 MOLU01000003.1 GCA003260325_00477 CDS open 54972-55139 _na     55_aa hypothetical protein
910 MOLU01000003.1 GCA003260325_00478 CDS open 57790-57975 _na     61_aa hypothetical protein
911 MOLU01000003.1 GCA003260325_00479 CDS open 59557-59793 _na     78_aa hypothetical protein
912 MOLU01000003.1 GCA003260325_00480 CDS open 61150-61311 _na     53_aa hypothetical protein
913 MOLU01000003.1 GCA003260325_00481 CDS open 61471-61635 _na     54_aa hypothetical protein
914 MOLU01000003.1 GCA003260325_00482 CDS open 63941-64114 _na     57_aa hypothetical protein
915 MOLU01000003.1 GCA003260325_00483 CDS open 66345-66818 _na     157_aa hypothetical protein
916 MOLU01000003.1 GCA003260325_00484 CDS open 69399-69788 _na     129_aa hypothetical protein
917 MOLU01000003.1 GCA003260325_00485 CDS open 71239-71583 _na     114_aa hypothetical protein
918 MOLU01000003.1 GCA003260325_00486 CDS open 71630-71911 _na     93_aa hypothetical protein
919 MOLU01000003.1 GCA003260325_00487 CDS open 72404-72535 _na     43_aa hypothetical protein
920 MOLU01000003.1 GCA003260325_00488 CDS open 72794-73009 _na     71_aa hypothetical protein
921 MOLU01000003.1 GCA003260325_00489 CDS open 73561-73746 _na     61_aa Glycosyltransferase 2-like domain-containing protein
922 MOLU01000003.1 GCA003260325_00490 CDS open 74193-74435 _na     80_aa hypothetical protein
923 MOLU01000003.1 GCA003260325_00491 CDS open 75717-75836 _na     39_aa hypothetical protein
924 MOLU01000003.1 GCA003260325_00492 CDS open 76998-77117 _na     39_aa hypothetical protein
925 MOLU01000003.1 GCA003260325_00493 CDS open 77283-77921 _na     212_aa SLH domain-containing protein
926 MOLU01000003.1 GCA003260325_00494 CDS open 79284-79442 _na     52_aa hypothetical protein
927 MOLU01000003.1 GCA003260325_00495 CDS open 81238-81618 _na     126_aa grpE Protein GrpE
928 MOLU01000003.1 GCA003260325_00496 CDS open 82150-82395 _na     81_aa hypothetical protein
929 MOLU01000003.1 GCA003260325_00497 CDS open 83407-83592 _na     61_aa hypothetical protein
930 MOLU01000003.1 GCA003260325_00498 CDS open 84101-84337 _na     78_aa hypothetical protein
931 MOLU01000003.1 GCA003260325_00499 CDS open 84913-85080 _na     55_aa hypothetical protein
932 MOLU01000003.1 GCA003260325_00500 CDS open 85365-85505 _na     46_aa hypothetical protein
933 MOLU01000003.1 GCA003260325_00501 CDS open 86769-86933 _na     54_aa hypothetical protein
934 MOLU01000003.1 GCA003260325_00502 CDS open 86967-87158 _na     63_aa hypothetical protein
935 MOLU01000003.1 GCA003260325_00503 CDS open 88024-88287 _na     87_aa PRC-barrel domain-containing protein
936 MOLU01000003.1 GCA003260325_00504 CDS open 89033-89368 _na     111_aa hypothetical protein
937 MOLU01000003.1 GCA003260325_00505 CDS open 89626-89757 _na     43_aa hypothetical protein
938 MOLU01000003.1 GCA003260325_00506 CDS open 90671-90850 _na     59_aa hypothetical protein
939 MOLU01000003.1 GCA003260325_00507 CDS open 91990-92355 _na     121_aa histidine kinase
940 MOLU01000003.1 GCA003260325_00508 CDS open 93509-93724 _na     71_aa hypothetical protein
941 MOLU01000003.1 GCA003260325_00509 CDS open 93806-94018 _na     70_aa hypothetical protein
942 MOLU01000003.1 GCA003260325_00510 CDS open 94457-94639 _na     60_aa hypothetical protein
943 MOLU01000003.1 GCA003260325_00511 CDS open 94651-94818 _na     55_aa hypothetical protein
944 MOLU01000003.1 GCA003260325_00512 CDS open 94809-95033 _na     74_aa hypothetical protein
945 MOLU01000003.1 GCA003260325_00513 CDS open 96239-96496 _na     85_aa hypothetical protein
946 MOLU01000003.1 GCA003260325_00514 CDS open 96583-96768 _na     61_aa hypothetical protein
947 MOLU01000003.1 GCA003260325_00515 CDS open 96858-97109 _na     83_aa hypothetical protein
948 MOLU01000003.1 GCA003260325_00516 CDS open 97528-97761 _na     77_aa hypothetical protein
949 MOLU01000003.1 GCA003260325_00517 CDS open 98204-98491 _na     95_aa hypothetical protein
950 MOLU01000003.1 GCA003260325_00518 CDS open 98743-99060 _na     105_aa hypothetical protein
951 MOLU01000003.1 GCA003260325_00519 CDS open 99684-99863 _na     59_aa hypothetical protein
952 MOLU01000003.1 GCA003260325_00520 CDS open 100524-100667 _na     47_aa hypothetical protein
953 MOLU01000003.1 GCA003260325_00521 CDS open 101099-101287 _na     62_aa hypothetical protein
954 MOLU01000003.1 GCA003260325_00522 CDS open 102012-102227 _na     71_aa hypothetical protein
955 MOLU01000003.1 GCA003260325_00523 CDS open 102303-102455 _na     50_aa hypothetical protein
956 MOLU01000003.1 GCA003260325_00524 CDS open 103493-103756 _na     87_aa hypothetical protein
957 MOLU01000003.1 GCA003260325_00525 CDS open 104190-104375 _na     61_aa DUF4298 domain-containing protein
958 MOLU01000003.1 GCA003260325_00526 CDS open 104785-104979 _na     64_aa hypothetical protein
959 MOLU01000003.1 GCA003260325_00527 CDS open 105732-105932 _na     66_aa hypothetical protein
960 MOLU01000003.1 GCA003260325_00528 CDS open 106176-106319 _na     47_aa hypothetical protein
961 MOLU01000003.1 GCA003260325_00529 CDS open 107965-108081 _na     38_aa ClbS/DfsB family four-helix bundle protein
962 MOLU01000003.1 GCA003260325_00530 CDS open 108290-108412 _na     40_aa hypothetical protein
963 MOLU01000003.1 GCA003260325_00531 CDS open 108533-108724 _na     63_aa hypothetical protein
964 MOLU01000003.1 GCA003260325_00532 CDS open 109230-109493 _na     87_aa DNA alkylation repair enzyme
965 MOLU01000003.1 GCA003260325_00533 CDS open 109497-109790 _na     97_aa DNA alkylation repair protein
966 MOLU01000003.1 GCA003260325_00534 CDS open 110161-110430 _na     89_aa Flavodoxin-like fold domain-containing protein
967 MOLU01000003.1 GCA003260325_00535 CDS open 112355-112495 _na     46_aa hypothetical protein
968 MOLU01000003.1 GCA003260325_00536 CDS open 112709-112846 _na     45_aa hypothetical protein
969 MOLU01000003.1 GCA003260325_00537 CDS open 113388-113711 _na     107_aa hypothetical protein
970 MOLU01000003.1 GCA003260325_00538 CDS open 114399-114722 _na     107_aa SLH domain-containing protein
971 MOLU01000003.1 GCA003260325_00539 CDS open 115525-115713 _na     62_aa hypothetical protein
972 MOLU01000003.1 GCA003260325_00540 CDS open 116590-116742 _na     50_aa hypothetical protein
973 MOLU01000003.1 GCA003260325_00541 CDS open 117297-117449 _na     50_aa hypothetical protein
974 MOLU01000003.1 GCA003260325_00542 CDS open 117373-117567 _na     64_aa hypothetical protein
975 MOLU01000003.1 GCA003260325_00543 CDS open 118466-118612 _na     48_aa hypothetical protein
976 MOLU01000003.1 GCA003260325_00544 CDS open 119400-119585 _na     61_aa hypothetical protein
977 MOLU01000003.1 GCA003260325_00545 CDS open 120258-120467 _na     69_aa hypothetical protein
978 MOLU01000003.1 GCA003260325_00546 CDS open 121245-121481 _na     78_aa hypothetical protein
979 MOLU01000003.1 GCA003260325_00430 gene open 2503-2700
980 MOLU01000003.1 GCA003260325_00431 gene open 3412-3552
981 MOLU01000003.1 GCA003260325_00432 gene open 5210-5422
982 MOLU01000003.1 GCA003260325_00433 gene open 5618-5761
983 MOLU01000003.1 GCA003260325_00434 gene open 5786-6157
984 MOLU01000003.1 GCA003260325_00435 gene open 6580-6846
985 MOLU01000003.1 GCA003260325_00436 gene open 7829-7969
986 MOLU01000003.1 GCA003260325_00437 gene open 8226-8507
987 MOLU01000003.1 GCA003260325_00438 gene open 8682-8903
988 MOLU01000003.1 GCA003260325_00439 gene open 9560-9742
989 MOLU01000003.1 GCA003260325_00440 gene open 17386-17520
990 MOLU01000003.1 GCA003260325_00441 gene open 18491-18763
991 MOLU01000003.1 GCA003260325_00442 gene open 19363-19635
992 MOLU01000003.1 GCA003260325_00443 gene open 20427-20723
993 MOLU01000003.1 GCA003260325_00444 gene open 21842-22036
994 MOLU01000003.1 GCA003260325_00445 gene open 22256-22360
995 MOLU01000003.1 GCA003260325_00446 gene open 23035-23433
996 MOLU01000003.1 GCA003260325_00447 gene open 24489-24701
997 MOLU01000003.1 GCA003260325_00448 gene open 25460-25780
998 MOLU01000003.1 GCA003260325_00449 gene open 28122-28271
999 MOLU01000003.1 GCA003260325_00450 gene open 28329-28508 mscL
1000 MOLU01000003.1 GCA003260325_00451 gene open 29446-29706