HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Cutibacterium acnes (GCA_003384415.1)

Select a Genome:
BAKTA Annotations for GCA_003384415.1
Genome Selected: Cutibacterium acnes
ContigsBases CDSrRNA tmRNAtRNA
4 2,480,333 2311 3 1 45
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4742 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 4742 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer
Range
(bp)
Show Sequences
(length) NA / AA
BAKTA
Gene
BAKTA
GeneProduct
1 PCNK01000001.1 rep_origin open 604699-605058
2 PCNK01000001.1 GCA003384415_00364 gene open 354657-354753 Bacteria_small_SRP
3 PCNK01000001.1 GCA003384415_00364 ncRNA open 354657-354753 Bacterial small signal recognition particle RNA
4 PCNK01000001.1 regulatory_region open 29421-29530 TPP riboswitch aptamer (THI element)
5 PCNK01000001.1 regulatory_region open 132434-132609 Cobalamin riboswitch aptamer
6 PCNK01000001.1 regulatory_region open 163785-163843 msiK RNA
7 PCNK01000001.1 regulatory_region open 216982-217155 Cobalamin riboswitch aptamer
8 PCNK01000001.1 regulatory_region open 415339-415442 TPP riboswitch aptamer (THI element)
9 PCNK01000001.1 regulatory_region open 470343-470437 TPP riboswitch aptamer (THI element)
10 PCNK01000001.1 regulatory_region open 581993-582057 Guanidine-III riboswitch aptamer (yKKC-III)
11 PCNK01000001.1 regulatory_region open 855375-855568 Cobalamin riboswitch aptamer
12 PCNK01000001.1 regulatory_region open 878342-878541 Cobalamin riboswitch aptamer
13 PCNK01000001.1 regulatory_region open 1093731-1093861 FMN riboswitch aptamer (RFN element)
14 PCNK01000001.1 repeat_region open 810525-810807 CRISPR array with 5 repeats of length 29%2C consensus sequence GGGCTCACCCCCGCATAGGCGGGGAATAC and spacer length 32
15 PCNK01000001.1 GCA003384415_00001 CDS open 467-1306 _na     279_aa Lipoprotein
16 PCNK01000001.1 GCA003384415_00002 CDS open 1383-2078 _na     231_aa yjhB Nudix hydrolase domain-containing protein
17 PCNK01000001.1 GCA003384415_00003 CDS open 2149-2982 _na     277_aa Bax inhibitor-1/YccA family protein
18 PCNK01000001.1 GCA003384415_00005 CDS open 3212-4144 _na     310_aa gppA Exopolyphosphatase
19 PCNK01000001.1 GCA003384415_00006 CDS open 4141-4683 _na     180_aa PF04417 family protein
20 PCNK01000001.1 GCA003384415_00007 CDS open 4691-5131 _na     146_aa ezrA Septation ring formation regulator EzrA
21 PCNK01000001.1 GCA003384415_00008 CDS open 5431-6711 _na     426_aa eno phosphopyruvate hydratase
22 PCNK01000001.1 GCA003384415_00009 CDS open 6799-7329 _na     176_aa Lipoprotein
23 PCNK01000001.1 GCA003384415_00010 CDS open 7445-8083 _na     212_aa yabN MazG nucleotide pyrophosphohydrolase domain protein
24 PCNK01000001.1 GCA003384415_00011 CDS open 8092-8607 _na     171_aa Lipoprotein
25 PCNK01000001.1 GCA003384415_00012 CDS open 8669-12292 _na     1207_aa mfd transcription-repair coupling factor
26 PCNK01000001.1 GCA003384415_00013 CDS open 12360-13499 _na     379_aa prsW PrsW family intramembrane metalloprotease
27 PCNK01000001.1 GCA003384415_00014 CDS open 13503-14105 _na     200_aa pth aminoacyl-tRNA hydrolase
28 PCNK01000001.1 GCA003384415_00015 CDS open 14102-14704 _na     200_aa rplY 50S ribosomal protein L25/general stress protein Ctc
29 PCNK01000001.1 GCA003384415_00016 CDS open 14883-15479 _na     198_aa Secreted protein
30 PCNK01000001.1 GCA003384415_00017 CDS open 15499-16068 _na     189_aa Secreted protein
31 PCNK01000001.1 GCA003384415_00018 CDS open 16104-17381 _na     425_aa Secreted protein
32 PCNK01000001.1 GCA003384415_00019 CDS open 17529-18497 _na     322_aa prsA ribose-phosphate diphosphokinase
33 PCNK01000001.1 GCA003384415_00020 CDS open 18494-19792 _na     432_aa glmU bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU
34 PCNK01000001.1 GCA003384415_00022 CDS open 20093-20725 _na     210_aa acrR TetR-family transcriptional regulator
35 PCNK01000001.1 GCA003384415_00023 CDS open 20707-21246 _na     179_aa marR MarR family transcriptional regulator
36 PCNK01000001.1 GCA003384415_00024 CDS open 21243-22214 _na     323_aa ispE 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase
37 PCNK01000001.1 GCA003384415_00025 CDS open 22238-23134 _na     298_aa rsmA 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA
38 PCNK01000001.1 GCA003384415_00026 CDS open 23131-24039 _na     302_aa tatD Hydrolase%2C TatD family
39 PCNK01000001.1 GCA003384415_00027 CDS open 24036-24896 _na     286_aa rsmI 16S rRNA (cytidine(1402)-2'-O)-methyltransferase
40 PCNK01000001.1 GCA003384415_00028 CDS open 24978-26540 _na     520_aa pMT1 dolichyl-phosphate-mannose--protein mannosyltransferase
41 PCNK01000001.1 GCA003384415_00029 CDS open 26624-28108 _na     494_aa uraA NCS2 family nucleotide:cation symporter-2
42 PCNK01000001.1 GCA003384415_00030 CDS open 28142-29230 _na     362_aa corA MIT family metal ion transporter CorA
43 PCNK01000001.1 GCA003384415_00031 CDS open 29523-30770 _na     415_aa thiO glycine oxidase ThiO
44 PCNK01000001.1 GCA003384415_00032 CDS open 30779-31045 _na     88_aa thiS sulfur carrier protein ThiS
45 PCNK01000001.1 GCA003384415_00033 CDS open 31045-31920 _na     291_aa thiG Thiazole synthase
46 PCNK01000001.1 GCA003384415_00034 CDS open 31917-32762 _na     281_aa thiF Molybdopterin biosynthesis protein MoeB
47 PCNK01000001.1 GCA003384415_00035 CDS open 33217-35778 _na     853_aa bisC Anaerobic dimethyl sulfoxide reductase chain A
48 PCNK01000001.1 GCA003384415_00036 CDS open 35945-36586 _na     213_aa hybA DMSO/selenate family reductase complex B subunit
49 PCNK01000001.1 GCA003384415_00037 CDS open 36586-37596 _na     336_aa dmsC Dimethyl sulfoxide reductase
50 PCNK01000001.1 GCA003384415_00038 CDS open 37660-37935 _na     91_aa DUF6457 domain-containing protein
51 PCNK01000001.1 GCA003384415_00039 CDS open 38104-38604 _na     166_aa moaB Molybdenum cofactor biosynthesis protein
52 PCNK01000001.1 GCA003384415_00040 CDS open 38712-38957 _na     81_aa hypothetical protein
53 PCNK01000001.1 GCA003384415_00041 CDS open 38902-39576 _na     224_aa mobA MobA-like NTP transferase domain-containing protein
54 PCNK01000001.1 GCA003384415_00042 CDS open 39763-41079 _na     438_aa narK Nitrate/nitrite transporter
55 PCNK01000001.1 GCA003384415_00043 CDS open 41138-44875 _na     1245_aa narG nitrate reductase subunit alpha
56 PCNK01000001.1 GCA003384415_00044 CDS open 44875-46398 _na     507_aa narH nitrate reductase subunit beta
57 PCNK01000001.1 GCA003384415_00045 CDS open 46400-47071 _na     223_aa narJ nitrate reductase molybdenum cofactor assembly chaperone
58 PCNK01000001.1 GCA003384415_00046 CDS open 47068-47781 _na     237_aa narI respiratory nitrate reductase subunit gamma
59 PCNK01000001.1 GCA003384415_00047 CDS open 47783-48502 _na     239_aa arsR putative transcriptional regulator%2C ArsR family
60 PCNK01000001.1 GCA003384415_00048 CDS open 48436-50289 _na     617_aa modB ATP-binding cassette domain-containing protein
61 PCNK01000001.1 GCA003384415_00049 CDS open 50374-51144 _na     256_aa modA molybdate ABC transporter substrate-binding protein
62 PCNK01000001.1 GCA003384415_00050 CDS open 51150-51578 _na     142_aa mopI Helix-turn-helix domain-containing protein
63 PCNK01000001.1 GCA003384415_00051 CDS open 51821-52861 _na     346_aa moaA GTP 3'%2C8-cyclase MoaA
64 PCNK01000001.1 GCA003384415_00052 CDS open 52864-53103 _na     79_aa moaD MoaD/ThiS family protein
65 PCNK01000001.1 GCA003384415_00053 CDS open 53104-53526 _na     140_aa moaE Molybdenum cofactor biosynthesis protein MoaE
66 PCNK01000001.1 GCA003384415_00054 CDS open 53523-54827 _na     434_aa glp gephyrin-like molybdotransferase Glp
67 PCNK01000001.1 GCA003384415_00055 CDS open 54824-55309 _na     161_aa moaC cyclic pyranopterin monophosphate synthase MoaC
68 PCNK01000001.1 GCA003384415_00056 CDS open 55306-55980 _na     224_aa torD Dehydrogenase
69 PCNK01000001.1 GCA003384415_00058 CDS open 56729-57523 _na     264_aa hypothetical protein
70 PCNK01000001.1 GCA003384415_00059 CDS open 57605-58279 _na     224_aa [ribosomal protein uS5]-alanine N-acetyltransferase
71 PCNK01000001.1 GCA003384415_00060 CDS open 58317-59624 _na     435_aa glp gephyrin-like molybdotransferase Glp
72 PCNK01000001.1 GCA003384415_00061 CDS open 59734-60321 _na     195_aa fAU1 5-formyltetrahydrofolate cyclo-ligase
73 PCNK01000001.1 GCA003384415_00062 CDS open 60399-60701 _na     100_aa Zinc ribbon domain-containing protein
74 PCNK01000001.1 GCA003384415_00063 CDS open 60865-61440 _na     191_aa SAF domain protein
75 PCNK01000001.1 GCA003384415_00064 CDS open 61552-61920 _na     122_aa mscL large conductance mechanosensitive channel protein MscL
76 PCNK01000001.1 GCA003384415_00065 CDS open 61943-62314 _na     123_aa Mycothiol-dependent maleylpyruvate isomerase metal-binding domain-containing protein
77 PCNK01000001.1 GCA003384415_00066 CDS open 62311-63708 _na     465_aa qRI1 UTP--glucose-1-phosphate uridylyltransferase
78 PCNK01000001.1 GCA003384415_00068 CDS open 64192-65808 _na     538_aa araJ Transporter%2C major facilitator family protein
79 PCNK01000001.1 GCA003384415_00069 CDS open 65979-66344 _na     121_aa trxA thioredoxin
80 PCNK01000001.1 GCA003384415_00070 CDS open 66466-67569 _na     367_aa hypothetical protein
81 PCNK01000001.1 GCA003384415_00071 CDS open 67566-68264 _na     232_aa Diphtheria toxin repressor
82 PCNK01000001.1 GCA003384415_00072 CDS open 68418-69548 _na     376_aa Putative N-acetylglucosamine-6-phosphate deacetylase
83 PCNK01000001.1 GCA003384415_00073 CDS open 69551-70759 _na     402_aa serC phosphoserine transaminase
84 PCNK01000001.1 GCA003384415_00074 CDS open 70756-71742 _na     328_aa WD40 repeat domain-containing protein
85 PCNK01000001.1 GCA003384415_00075 CDS open 71902-72612 _na     236_aa hypothetical protein
86 PCNK01000001.1 GCA003384415_00076 CDS open 72587-74098 _na     503_aa nCS2 Xanthine/uracil permease
87 PCNK01000001.1 GCA003384415_00077 CDS open 74114-74386 _na     90_aa DUF2530 domain-containing protein
88 PCNK01000001.1 GCA003384415_00078 CDS open 74424-75224 _na     266_aa PF11228 family protein
89 PCNK01000001.1 GCA003384415_00079 CDS open 75224-75607 _na     127_aa cspC Cold-shock domain family protein
90 PCNK01000001.1 GCA003384415_00080 CDS open 75754-76539 _na     261_aa nagB glucosamine-6-phosphate deaminase
91 PCNK01000001.1 GCA003384415_00081 CDS open 77094-77468 _na     124_aa Lipoprotein
92 PCNK01000001.1 GCA003384415_00082 CDS open 77465-79594 _na     709_aa Helicase XPB/Ssl2 N-terminal domain-containing protein
93 PCNK01000001.1 GCA003384415_00083 CDS open 79640-79795 _na     51_aa Thiol peroxidase
94 PCNK01000001.1 GCA003384415_00084 CDS open 80229-81887 _na     552_aa DNA repair helicase XPB
95 PCNK01000001.1 GCA003384415_00085 CDS open 81931-82935 _na     334_aa Conserved protein
96 PCNK01000001.1 GCA003384415_00086 CDS open 82949-83644 _na     231_aa cutC Copper homeostasis cutC-like protein
97 PCNK01000001.1 GCA003384415_00087 CDS open 83622-84683 _na     353_aa Conserved protein
98 PCNK01000001.1 GCA003384415_00088 CDS open 84637-85704 _na     355_aa iolG inositol 2-dehydrogenase
99 PCNK01000001.1 GCA003384415_00089 CDS open 85821-86684 _na     287_aa ycjR AP endonuclease%2C family 2
100 PCNK01000001.1 GCA003384415_00090 CDS open 86718-87017 _na     99_aa hypothetical protein
101 PCNK01000001.1 GCA003384415_00091 CDS open 87304-88950 _na     548_aa araJ Metabolite transport protein YncC
102 PCNK01000001.1 GCA003384415_00092 CDS open 89060-90271 _na     403_aa mviM Myo-inositol 2-dehydrogenase
103 PCNK01000001.1 GCA003384415_00093 CDS open 90481-91347 _na     288_aa ycjR Sugar phosphate isomerase/epimerase
104 PCNK01000001.1 GCA003384415_00094 CDS open 91419-92417 _na     332_aa ycjR Sugar phosphate isomerase
105 PCNK01000001.1 GCA003384415_00095 CDS open 92462-93676 _na     404_aa mviM Dehydrogenase
106 PCNK01000001.1 GCA003384415_00096 CDS open 93814-94794 _na     326_aa purR Transcriptional regulator%2C LacI family
107 PCNK01000001.1 GCA003384415_00097 CDS open 94890-96383 _na     497_aa adhE Methylmalonate-semialdehyde dehydrogenase (CoA acylating)
108 PCNK01000001.1 GCA003384415_00098 CDS open 96748-96984 _na     78_aa hypothetical protein
109 PCNK01000001.1 GCA003384415_00099 CDS open 97129-99027 _na     632_aa iolD 3D-(3%2C5/4)-trihydroxycyclohexane-1%2C2-dione acylhydrolase (decyclizing)
110 PCNK01000001.1 GCA003384415_00100 CDS open 99030-99902 _na     290_aa iolB 5-deoxy-glucuronate isomerase
111 PCNK01000001.1 GCA003384415_00101 CDS open 99899-100786 _na     295_aa fbaB Conserved protein
112 PCNK01000001.1 GCA003384415_00102 CDS open 100783-101772 _na     329_aa rbsK 5-dehydro-2-deoxygluconokinase
113 PCNK01000001.1 GCA003384415_00103 CDS open 101987-102730 _na     247_aa mngR GntR family transcriptional regulator
114 PCNK01000001.1 GCA003384415_00104 CDS open 102832-103908 _na     358_aa talA Transaldolase
115 PCNK01000001.1 GCA003384415_00105 CDS open 104100-105734 _na     544_aa groL chaperonin GroEL
116 PCNK01000001.1 GCA003384415_00106 CDS open 106069-106353 _na     94_aa DUF3263 domain-containing protein
117 PCNK01000001.1 GCA003384415_00107 CDS open 106398-107579 _na     393_aa manA mannose-6-phosphate isomerase%2C class I
118 PCNK01000001.1 GCA003384415_00108 CDS open 107521-108099 _na     192_aa luxS S-ribosylhomocysteine lyase
119 PCNK01000001.1 GCA003384415_00109 CDS open 108249-108695 _na     148_aa hypothetical protein
120 PCNK01000001.1 GCA003384415_00110 CDS open 108704-109201 _na     165_aa hypothetical protein
121 PCNK01000001.1 GCA003384415_00111 CDS open 110200-111027 _na     275_aa sgaB Ascorbate-specific PTS system EIIA component
122 PCNK01000001.1 GCA003384415_00112 CDS open 111077-112666 _na     529_aa ulaA Ascorbate-specific PTS system EIIC component
123 PCNK01000001.1 GCA003384415_00113 CDS open 113020-113265 _na     81_aa hypothetical protein
124 PCNK01000001.1 GCA003384415_00114 CDS open 113316-114953 _na     545_aa hypothetical protein
125 PCNK01000001.1 GCA003384415_00116 CDS open 115176-115940 _na     254_aa fepB Cobalamin-binding protein
126 PCNK01000001.1 GCA003384415_00117 CDS open 115937-116776 _na     279_aa cobS Adenosylcobinamide-GDP ribazoletransferase
127 PCNK01000001.1 GCA003384415_00118 CDS open 116773-118440 _na     555_aa cobT nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase
128 PCNK01000001.1 GCA003384415_00119 CDS open 118442-119419 _na     325_aa cobK cobalt-precorrin-6A reductase
129 PCNK01000001.1 GCA003384415_00120 CDS open 119439-120215 _na     258_aa cysG uroporphyrinogen-III C-methyltransferase
130 PCNK01000001.1 GCA003384415_00121 CDS open 120225-122651 _na     808_aa cobB cobyrinate a%2Cc-diamide synthase
131 PCNK01000001.1 GCA003384415_00122 CDS open 122648-123262 _na     204_aa cobO cob(I)yrinic acid a%2Cc-diamide adenosyltransferase
132 PCNK01000001.1 GCA003384415_00123 CDS open 123491-124087 _na     198_aa cobL Precorrin-6Y C5%2C15-methyltransferase (Decarboxylating) subunit CbiT
133 PCNK01000001.1 GCA003384415_00124 CDS open 124110-124799 _na     229_aa kdpD Sensor protein KdpD transmembrane domain-containing protein
134 PCNK01000001.1 GCA003384415_00125 CDS open 124852-125688 _na     278_aa ecfA2 ABC transporter ATP-binding protein
135 PCNK01000001.1 GCA003384415_00126 CDS open 125685-126530 _na     281_aa cbiQ cobalt ECF transporter T component CbiQ
136 PCNK01000001.1 GCA003384415_00127 CDS open 126527-126961 _na     144_aa cbiN energy-coupling factor ABC transporter substrate-binding protein
137 PCNK01000001.1 GCA003384415_00128 CDS open 126954-127637 _na     227_aa cbiM energy-coupling factor ABC transporter permease
138 PCNK01000001.1 GCA003384415_00129 CDS open 127942-128595 _na     217_aa cobH precorrin-8X methylmutase
139 PCNK01000001.1 GCA003384415_00130 CDS open 128756-129412 _na     218_aa AAA domain protein
140 PCNK01000001.1 GCA003384415_00131 CDS open 129465-130535 _na     356_aa fepB Periplasmic-binding protein
141 PCNK01000001.1 GCA003384415_00132 CDS open 130537-131328 _na     263_aa fepC ABC transporter%2C ATP-binding protein
142 PCNK01000001.1 GCA003384415_00133 CDS open 131325-132389 _na     354_aa fepD Iron chelate uptake ABC transporter%2C FeCT family%2C permease protein
143 PCNK01000001.1 GCA003384415_00134 CDS open 132419-132958 _na     179_aa hypothetical protein
144 PCNK01000001.1 GCA003384415_00135 CDS open 133279-134145 _na     288_aa hypothetical protein
145 PCNK01000001.1 GCA003384415_00136 CDS open 134187-135455 _na     422_aa sirB precorrin-2 dehydrogenase
146 PCNK01000001.1 GCA003384415_00137 CDS open 135452-138022 _na     856_aa cobL Precorrin-3B C(17)-methyltransferase
147 PCNK01000001.1 GCA003384415_00138 CDS open 138019-138990 _na     323_aa cobM precorrin-4 C(11)-methyltransferase
148 PCNK01000001.1 GCA003384415_00139 CDS open 138987-139742 _na     251_aa cobI precorrin-2 C(20)-methyltransferase
149 PCNK01000001.1 GCA003384415_00140 CDS open 140059-141513 _na     484_aa cobQ cobyric acid synthase
150 PCNK01000001.1 GCA003384415_00141 CDS open 141510-142559 _na     349_aa cobalamin biosynthesis protein
151 PCNK01000001.1 GCA003384415_00142 CDS open 142686-143201 _na     171_aa Histidine phosphatase family protein
152 PCNK01000001.1 GCA003384415_00143 CDS open 143206-143394 _na     62_aa hypothetical protein
153 PCNK01000001.1 GCA003384415_00144 CDS open 143497-144117 _na     206_aa citB DNA-binding response regulator
154 PCNK01000001.1 GCA003384415_00145 CDS open 144122-145249 _na     375_aa Two-component sensor histidine kinase
155 PCNK01000001.1 GCA003384415_00146 CDS open 145342-146091 _na     249_aa ABC transporter permease
156 PCNK01000001.1 GCA003384415_00147 CDS open 146088-147035 _na     315_aa ABC transporter ATP-binding protein
157 PCNK01000001.1 GCA003384415_00148 CDS open 147167-148183 _na     338_aa curA NADP-dependent oxidoreductase
158 PCNK01000001.1 GCA003384415_00149 CDS open 148300-148815 _na     171_aa O-acetyl-ADP-ribose deacetylase
159 PCNK01000001.1 GCA003384415_00150 CDS open 148846-149208 _na     120_aa yeaO DUF488 domain-containing protein
160 PCNK01000001.1 GCA003384415_00151 CDS open 149233-150087 _na     284_aa dedA VTT domain-containing protein
161 PCNK01000001.1 GCA003384415_00152 CDS open 150183-151019 _na     278_aa opuBA ABC transporter%2C ATP-binding protein
162 PCNK01000001.1 GCA003384415_00153 CDS open 151016-151663 _na     215_aa opuBB ABC transporter permease
163 PCNK01000001.1 GCA003384415_00154 CDS open 151660-152355 _na     231_aa opuBB ABC transporter%2C permease protein
164 PCNK01000001.1 GCA003384415_00155 CDS open 152377-153300 _na     307_aa osmF ABC transporter substrate-binding protein
165 PCNK01000001.1 GCA003384415_00156 CDS open 153317-154513 _na     398_aa bioF glycine C-acetyltransferase
166 PCNK01000001.1 GCA003384415_00157 CDS open 154539-155576 _na     345_aa tdh L-threonine 3-dehydrogenase
167 PCNK01000001.1 GCA003384415_00158 CDS open 155930-156820 _na     296_aa ugpE Transport system permease protein
168 PCNK01000001.1 GCA003384415_00159 CDS open 156813-157769 _na     318_aa ugpA Sugar ABC transporter permease
169 PCNK01000001.1 GCA003384415_00160 CDS open 157766-159058 _na     430_aa ugpB Sugar-binding protein
170 PCNK01000001.1 GCA003384415_00161 CDS open 159081-161390 _na     769_aa nagC Oxidoreductase
171 PCNK01000001.1 GCA003384415_00162 CDS open 161662-163185 _na     507_aa sdaA L-serine ammonia-lyase
172 PCNK01000001.1 GCA003384415_00163 CDS open 163847-164947 _na     366_aa malK Sugar ABC superfamily ATP binding cassette transporter%2C ABC protein
173 PCNK01000001.1 GCA003384415_00164 CDS open 165014-165367 _na     117_aa Asp23/Gls24 family envelope stress response protein
174 PCNK01000001.1 GCA003384415_00165 CDS open 165360-165869 _na     169_aa Asp23/Gls24 family envelope stress response protein
175 PCNK01000001.1 GCA003384415_00166 CDS open 165877-166452 _na     191_aa DNA-directed RNA polymerase sigma-70 factor
176 PCNK01000001.1 GCA003384415_00167 CDS open 166510-167226 _na     238_aa amaP alkaline shock response membrane anchor protein AmaP
177 PCNK01000001.1 GCA003384415_00168 CDS open 167223-167777 _na     184_aa DUF6286 domain-containing protein
178 PCNK01000001.1 GCA003384415_00169 CDS open 167779-168192 _na     137_aa yloU Asp23/Gls24 family envelope stress response protein
179 PCNK01000001.1 GCA003384415_00170 CDS open 168192-168377 _na     61_aa DUF2273 domain-containing protein
180 PCNK01000001.1 GCA003384415_00171 CDS open 168389-168925 _na     178_aa yloU Asp23/Gls24 family envelope stress response protein
181 PCNK01000001.1 GCA003384415_00172 CDS open 169075-169389 _na     104_aa Cystathionine gamma-synthase
182 PCNK01000001.1 GCA003384415_00173 CDS open 169501-170244 _na     247_aa Cystathionine gamma-synthase
183 PCNK01000001.1 GCA003384415_00174 CDS open 170192-171712 _na     506_aa DUF4032 domain-containing protein
184 PCNK01000001.1 GCA003384415_00175 CDS open 171723-171941 _na     72_aa hypothetical protein
185 PCNK01000001.1 GCA003384415_00176 CDS open 171989-173419 _na     476_aa cysS cysteine--tRNA ligase
186 PCNK01000001.1 GCA003384415_00177 CDS open 173433-174389 _na     318_aa rlmB 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
187 PCNK01000001.1 GCA003384415_00178 CDS open 174373-174564 _na     63_aa hypothetical protein
188 PCNK01000001.1 GCA003384415_00179 CDS open 174634-175278 _na     214_aa DUF2264 domain-containing protein
189 PCNK01000001.1 GCA003384415_00180 CDS open 175292-176164 _na     290_aa DUF2264 domain-containing protein
190 PCNK01000001.1 GCA003384415_00181 CDS open 176326-178767 _na     813_aa hylB Hyaluronate lyase HylB
191 PCNK01000001.1 GCA003384415_00182 CDS open 178796-179107 _na     103_aa Dehydrogenase
192 PCNK01000001.1 GCA003384415_00183 CDS open 179274-180089 _na     271_aa Oxidoreductase
193 PCNK01000001.1 GCA003384415_00184 CDS open 180086-180793 _na     235_aa ycjR Sugar phosphate isomerase
194 PCNK01000001.1 GCA003384415_00185 CDS open 180653-180982 _na     109_aa hypothetical protein
195 PCNK01000001.1 GCA003384415_00186 CDS open 180996-181652 _na     218_aa Glycosyl hydrolase
196 PCNK01000001.1 GCA003384415_00187 CDS open 181677-182600 _na     307_aa sdhA FAD-binding protein
197 PCNK01000001.1 GCA003384415_00188 CDS open 182588-183355 _na     255_aa nadB FAD-binding protein
198 PCNK01000001.1 GCA003384415_00189 CDS open 183339-183698 _na     119_aa Oxidoreductase
199 PCNK01000001.1 GCA003384415_00190 CDS open 183700-184476 _na     258_aa fabG 3-ketoacyl-ACP reductase
200 PCNK01000001.1 GCA003384415_00191 CDS open 184679-185326 _na     215_aa eda 2-dehydro-3-deoxy-phosphogluconate aldolase
201 PCNK01000001.1 GCA003384415_00192 CDS open 185323-186423 _na     366_aa rbsK Carbohydrate kinase%2C PfkB family
202 PCNK01000001.1 GCA003384415_00193 CDS open 186552-188021 _na     489_aa glyA glycine hydroxymethyltransferase
203 PCNK01000001.1 GCA003384415_00194 CDS open 188393-189841 _na     482_aa ansP L-asparagine permease
204 PCNK01000001.1 GCA003384415_00195 CDS open 189845-190837 _na     330_aa ansA L-asparaginase I
205 PCNK01000001.1 GCA003384415_00196 CDS open 191043-191336 _na     97_aa sgaB PTS system%2C Lactose/Cellobiose specific IIB subunit
206 PCNK01000001.1 GCA003384415_00197 CDS open 191580-192038 _na     152_aa ptsN PTS sugar transporter subunit IIA
207 PCNK01000001.1 GCA003384415_00198 CDS open 192163-192912 _na     249_aa gpmA phosphoglyceromutase
208 PCNK01000001.1 GCA003384415_00199 CDS open 193021-194091 _na     356_aa Polysaccharide deacetylase
209 PCNK01000001.1 GCA003384415_00200 CDS open 194237-194905 _na     222_aa phoU phosphate signaling complex protein PhoU
210 PCNK01000001.1 GCA003384415_00201 CDS open 195066-196247 _na     393_aa baeS Sensor-like histidine kinase SenX3
211 PCNK01000001.1 GCA003384415_00202 CDS open 196244-196924 _na     226_aa ompR Sensory transduction protein RegX3
212 PCNK01000001.1 GCA003384415_00203 CDS open 196977-197477 _na     166_aa lpqE Lipoprotein LpqE
213 PCNK01000001.1 GCA003384415_00204 CDS open 197722-198207 _na     161_aa cdnL RNA polymerase-binding transcription factor CarD
214 PCNK01000001.1 GCA003384415_00205 CDS open 198291-198584 _na     97_aa sgaB PTS system%2C Lactose/Cellobiose specific IIB subunit
215 PCNK01000001.1 GCA003384415_00206 CDS open 198782-199186 _na     134_aa srlB PTS sorbitol transporter subunit IIA
216 PCNK01000001.1 GCA003384415_00207 CDS open 199133-199639 _na     168_aa ispF 2-C-methyl-D-erythritol 2%2C4-cyclodiphosphate synthase
217 PCNK01000001.1 GCA003384415_00208 CDS open 199636-200439 _na     267_aa ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase
218 PCNK01000001.1 GCA003384415_00209 CDS open 200535-200801 _na     88_aa ptsH HPr family phosphocarrier protein
219 PCNK01000001.1 GCA003384415_00210 CDS open 200806-202479 _na     557_aa ptsA Phosphoenolpyruvate-protein phosphotransferase
220 PCNK01000001.1 GCA003384415_00211 CDS open 202554-203291 _na     245_aa ydfG Short-chain dehydrogenase/reductase family oxidoreductase
221 PCNK01000001.1 GCA003384415_00212 CDS open 203314-204699 _na     461_aa wcaJ Exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase
222 PCNK01000001.1 GCA003384415_00213 CDS open 204740-205681 _na     313_aa ygfZ Glycine cleavage T-protein C-terminal barrel domain protein
223 PCNK01000001.1 GCA003384415_00214 CDS open 205683-206183 _na     166_aa Ferric nitrobindin-like protein
224 PCNK01000001.1 GCA003384415_00215 CDS open 206379-206816 _na     145_aa dtd D-aminoacyl-tRNA deacylase
225 PCNK01000001.1 GCA003384415_00216 CDS open 206831-207838 _na     335_aa Discoidin domain-containing protein
226 PCNK01000001.1 GCA003384415_00217 CDS open 207843-208487 _na     214_aa ompR Transcriptional regulatory protein%2C C-terminal domain protein
227 PCNK01000001.1 GCA003384415_00218 CDS open 208609-210714 _na     701_aa ppk RNA degradosome polyphosphate kinase
228 PCNK01000001.1 GCA003384415_00219 CDS open 210722-211663 _na     313_aa sixA DNA mismatch repair protein MutT
229 PCNK01000001.1 GCA003384415_00220 CDS open 211836-212987 _na     383_aa pstS phosphate ABC transporter substrate-binding protein PstS
230 PCNK01000001.1 GCA003384415_00221 CDS open 213096-214100 _na     334_aa pstC phosphate ABC transporter permease subunit PstC
231 PCNK01000001.1 GCA003384415_00222 CDS open 214097-215023 _na     308_aa pstA phosphate ABC transporter permease PstA
232 PCNK01000001.1 GCA003384415_00223 CDS open 215042-215818 _na     258_aa pstB phosphate ABC transporter ATP-binding protein PstB
233 PCNK01000001.1 GCA003384415_00224 CDS open 216045-216932 _na     295_aa viuB Siderophore-interacting protein
234 PCNK01000001.1 GCA003384415_00225 CDS open 217183-218217 _na     344_aa fepD Permease%2C FecCD transport family protein
235 PCNK01000001.1 GCA003384415_00226 CDS open 218214-218972 _na     252_aa fepC ABC transporter%2C ATP-binding protein
236 PCNK01000001.1 GCA003384415_00227 CDS open 218984-220000 _na     338_aa fepB ABC-type transporter%2C periplasmic component
237 PCNK01000001.1 GCA003384415_00228 CDS open 220083-220451 _na     122_aa hypothetical protein
238 PCNK01000001.1 GCA003384415_00229 CDS open 220515-221483 _na     322_aa lpd mycothione reductase
239 PCNK01000001.1 GCA003384415_00230 CDS open 221608-222312 _na     234_aa DUF5134 domain-containing protein
240 PCNK01000001.1 GCA003384415_00231 CDS open 222362-222658 _na     98_aa hypothetical protein
241 PCNK01000001.1 GCA003384415_00232 CDS open 222695-223318 _na     207_aa Lipoprotein ABC transporter ATP-binding protein
242 PCNK01000001.1 GCA003384415_00233 CDS open 223357-225408 _na     683_aa ABC transporter permease
243 PCNK01000001.1 GCA003384415_00234 CDS open 225476-225820 _na     114_aa Peptidase inhibitor family I36
244 PCNK01000001.1 GCA003384415_00235 CDS open 226035-226829 _na     264_aa yqjQ KR domain protein
245 PCNK01000001.1 GCA003384415_00236 CDS open 226841-228289 _na     482_aa rpoE RNA polymerase subunit sigma-70
246 PCNK01000001.1 GCA003384415_00237 CDS open 228291-229184 _na     297_aa ccsB c-type cytochrome biogenesis protein CcsB
247 PCNK01000001.1 GCA003384415_00238 CDS open 229181-230770 _na     529_aa resB Cytochrome c biogenesis protein ResB
248 PCNK01000001.1 GCA003384415_00239 CDS open 230770-231531 _na     253_aa ccdA Cytochrome c biogenesis protein
249 PCNK01000001.1 GCA003384415_00240 CDS open 231528-232097 _na     189_aa trxA Thioredoxin domain-containing protein
250 PCNK01000001.1 GCA003384415_00241 CDS open 232094-232810 _na     238_aa phoE Phosphoglycerate mutase
251 PCNK01000001.1 GCA003384415_00242 CDS open 232833-234548 _na     571_aa hemD uroporphyrinogen-III C-methyltransferase
252 PCNK01000001.1 GCA003384415_00243 CDS open 234672-234992 _na     106_aa Conserved protein
253 PCNK01000001.1 GCA003384415_00244 CDS open 235033-235134 _na     33_aa 30S ribosomal protein bS22
254 PCNK01000001.1 GCA003384415_00245 CDS open 235270-236061 _na     263_aa proC pyrroline-5-carboxylate reductase
255 PCNK01000001.1 GCA003384415_00246 CDS open 236058-237101 _na     347_aa aspartate-semialdehyde dehydrogenase
256 PCNK01000001.1 GCA003384415_00247 CDS open 237146-237982 _na     278_aa CPBP family intramembrane metalloprotease
257 PCNK01000001.1 GCA003384415_00248 CDS open 237982-238878 _na     298_aa putA Proline dehydrogenase
258 PCNK01000001.1 GCA003384415_00249 CDS open 238941-239828 _na     295_aa ycjR Xylose isomerase-like TIM barrel domain-containing protein
259 PCNK01000001.1 GCA003384415_00250 CDS open 239876-240619 _na     247_aa Glyoxalase-like domain-containing protein
260 PCNK01000001.1 GCA003384415_00251 CDS open 240704-242350 _na     548_aa Malate oxidoreductase
261 PCNK01000001.1 GCA003384415_00252 CDS open 242416-243813 _na     465_aa radA DNA repair protein RadA
262 PCNK01000001.1 GCA003384415_00253 CDS open 243866-244969 _na     367_aa disA DNA integrity scanning diadenylate cyclase DisA
263 PCNK01000001.1 GCA003384415_00254 CDS open 245005-245709 _na     234_aa DUF11 domain-containing protein
264 PCNK01000001.1 GCA003384415_00255 CDS open 245709-247760 _na     683_aa hemQ hydrogen peroxide-dependent heme synthase
265 PCNK01000001.1 GCA003384415_00256 CDS open 247757-248980 _na     407_aa glutamyl-tRNA reductase
266 PCNK01000001.1 GCA003384415_00257 CDS open 249002-250282 _na     426_aa hemE uroporphyrinogen decarboxylase
267 PCNK01000001.1 GCA003384415_00258 CDS open 250297-251727 _na     476_aa hemY Protoporphyrinogen oxidase%2C HemY
268 PCNK01000001.1 GCA003384415_00259 CDS open 251773-252777 _na     334_aa hemC hydroxymethylbilane synthase
269 PCNK01000001.1 GCA003384415_00260 CDS open 252774-253499 _na     241_aa Uroporphyrinogen-III synthase
270 PCNK01000001.1 GCA003384415_00261 CDS open 253529-254575 _na     348_aa hemB porphobilinogen synthase
271 PCNK01000001.1 GCA003384415_00262 CDS open 254622-255932 _na     436_aa hemL glutamate-1-semialdehyde 2%2C1-aminomutase
272 PCNK01000001.1 GCA003384415_00263 CDS open 255925-256800 _na     291_aa mutY Adenine DNA glycosylase
273 PCNK01000001.1 GCA003384415_00264 CDS open 256813-257742 _na     309_aa deoR Regulatory protein%2C DeoR family
274 PCNK01000001.1 GCA003384415_00265 CDS open 257976-259247 _na     423_aa otnK Four-carbon acid sugar kinase family protein
275 PCNK01000001.1 GCA003384415_00266 CDS open 259323-260363 _na     346_aa pdxA 4-hydroxythreonine-4-phosphate dehydrogenase PdxA
276 PCNK01000001.1 GCA003384415_00267 CDS open 260408-261727 _na     439_aa uhpC MFS transporter
277 PCNK01000001.1 GCA003384415_00268 CDS open 262257-262550 _na     97_aa nanE N-acetylmannosamine-6-phosphate 2-epimerase
278 PCNK01000001.1 GCA003384415_00269 CDS open 262552-264078 _na     508_aa ptsG2 PTS system sugar-specific EII component
279 PCNK01000001.1 GCA003384415_00270 CDS open 264090-264563 _na     157_aa nagE PTS glucose transporter subunit IIA
280 PCNK01000001.1 GCA003384415_00271 CDS open 264568-265479 _na     303_aa bglG Transcriptional antiterminator
281 PCNK01000001.1 GCA003384415_00272 CDS open 265661-266257 _na     198_aa DUF3426 domain-containing protein
282 PCNK01000001.1 GCA003384415_00273 CDS open 266408-267640 _na     410_aa comP histidine kinase
283 PCNK01000001.1 GCA003384415_00274 CDS open 267720-268376 _na     218_aa citB DNA-binding response regulator
284 PCNK01000001.1 GCA003384415_00275 CDS open 268487-269005 _na     172_aa udk ATP-binding protein
285 PCNK01000001.1 GCA003384415_00276 CDS open 269023-269931 _na     302_aa Rhomboid family intramembrane serine protease
286 PCNK01000001.1 GCA003384415_00277 CDS open 269928-270827 _na     299_aa yfcH Epimerase
287 PCNK01000001.1 GCA003384415_00278 CDS open 270895-272382 _na     495_aa araJ Drug resistance MFS transporter%2C drug:H+ antiporter-2 family
288 PCNK01000001.1 GCA003384415_00279 CDS open 272546-273415 _na     289_aa pxpC Carboxyltransferase domain-containing protein
289 PCNK01000001.1 GCA003384415_00280 CDS open 273412-274032 _na     206_aa pxpB Allophanate hydrolase subunit 1
290 PCNK01000001.1 GCA003384415_00281 CDS open 274029-274799 _na     256_aa pxpA 5-oxoprolinase subunit A
291 PCNK01000001.1 GCA003384415_00282 CDS open 274922-275686 _na     254_aa DUF969 domain-containing protein
292 PCNK01000001.1 GCA003384415_00283 CDS open 275683-276669 _na     328_aa DUF979 domain-containing protein
293 PCNK01000001.1 GCA003384415_00284 CDS open 276666-277673 _na     335_aa Multidrug transporter
294 PCNK01000001.1 GCA003384415_00285 CDS open 277726-280260 _na     844_aa clpC ATP-dependent Clp protease ATP-binding subunit ClpC
295 PCNK01000001.1 GCA003384415_00286 CDS open 280523-280840 _na     105_aa Lsr2 family protein
296 PCNK01000001.1 GCA003384415_00287 CDS open 280979-282169 _na     396_aa nuoD NADH dehydrogenase
297 PCNK01000001.1 GCA003384415_00288 CDS open 282248-282943 _na     231_aa minE Cell division topological specificity factor MinE
298 PCNK01000001.1 GCA003384415_00289 CDS open 283008-283544 _na     178_aa DUF3180 domain-containing protein
299 PCNK01000001.1 GCA003384415_00290 CDS open 283541-284098 _na     185_aa folK 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase
300 PCNK01000001.1 GCA003384415_00291 CDS open 284095-284457 _na     120_aa folB dihydroneopterin aldolase
301 PCNK01000001.1 GCA003384415_00292 CDS open 284518-285363 _na     281_aa folP dihydropteroate synthase
302 PCNK01000001.1 GCA003384415_00293 CDS open 285420-285662 _na     80_aa hypothetical protein
303 PCNK01000001.1 GCA003384415_00294 CDS open 285796-286764 _na     322_aa hypothetical protein
304 PCNK01000001.1 GCA003384415_00295 CDS open 286801-286977 _na     58_aa hypothetical protein
305 PCNK01000001.1 GCA003384415_00296 CDS open 287167-287619 _na     150_aa Cytochrome d ubiquinol oxidase subunit II
306 PCNK01000001.1 GCA003384415_00297 CDS open 287649-288170 _na     173_aa Tat pathway signal sequence
307 PCNK01000001.1 GCA003384415_00298 CDS open 288377-288853 _na     158_aa Iron transporter
308 PCNK01000001.1 GCA003384415_00299 CDS open 288853-289011 _na     52_aa hypothetical protein
309 PCNK01000001.1 GCA003384415_00300 CDS open 289011-289484 _na     157_aa OmpA-like domain-containing protein
310 PCNK01000001.1 GCA003384415_00301 CDS open 289424-290101 _na     225_aa hypothetical protein
311 PCNK01000001.1 GCA003384415_00302 CDS open 290425-290757 _na     110_aa hypothetical protein
312 PCNK01000001.1 GCA003384415_00303 CDS open 290821-291396 _na     191_aa folE GTP cyclohydrolase I FolE
313 PCNK01000001.1 GCA003384415_00304 CDS open 291461-293614 _na     717_aa ftsH ATP-dependent zinc metalloprotease FtsH
314 PCNK01000001.1 GCA003384415_00305 CDS open 293756-294310 _na     184_aa hpt hypoxanthine phosphoribosyltransferase
315 PCNK01000001.1 GCA003384415_00306 CDS open 294338-295273 _na     311_aa tilS tRNA(Ile)-lysidine synthase
316 PCNK01000001.1 GCA003384415_00307 CDS open 295273-296703 _na     476_aa dacB D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase
317 PCNK01000001.1 GCA003384415_00308 CDS open 296774-297328 _na     184_aa ppa Inorganic pyrophosphatase
318 PCNK01000001.1 GCA003384415_00309 CDS open 297439-298452 _na     337_aa Site-specific DNA-methyltransferase
319 PCNK01000001.1 GCA003384415_00310 CDS open 298565-299224 _na     219_aa Acetylxylan esterase
320 PCNK01000001.1 GCA003384415_00311 CDS open 299243-299458 _na     71_aa hypothetical protein
321 PCNK01000001.1 GCA003384415_00312 CDS open 299506-299991 _na     161_aa sixA Phosphoglycerate mutase
322 PCNK01000001.1 GCA003384415_00313 CDS open 300009-301052 _na     347_aa Zinc ribbon domain-containing protein
323 PCNK01000001.1 GCA003384415_00314 CDS open 301356-302705 _na     449_aa yobN Monoamine oxidase
324 PCNK01000001.1 GCA003384415_00316 CDS open 303117-304793 _na     558_aa PF05960 family protein
325 PCNK01000001.1 GCA003384415_00317 CDS open 304827-305159 _na     110_aa Secreted protein
326 PCNK01000001.1 GCA003384415_00318 CDS open 305248-306930 _na     560_aa Hydrolase
327 PCNK01000001.1 GCA003384415_00319 CDS open 306947-307597 _na     216_aa yaaT PSP1 C-terminal domain-containing protein
328 PCNK01000001.1 GCA003384415_00320 CDS open 307684-308490 _na     268_aa doxX DoxX family protein
329 PCNK01000001.1 GCA003384415_00321 CDS open 308622-309830 _na     402_aa dnaX DNA polymerase III subunit delta'
330 PCNK01000001.1 GCA003384415_00322 CDS open 309877-310521 _na     214_aa tmk dTMP kinase
331 PCNK01000001.1 GCA003384415_00323 CDS open 310514-312001 _na     495_aa Transcriptional regulator
332 PCNK01000001.1 GCA003384415_00324 CDS open 312003-314795 _na     930_aa topA type I DNA topoisomerase
333 PCNK01000001.1 GCA003384415_00325 CDS open 315018-315305 _na     95_aa DUF2249 domain-containing protein
334 PCNK01000001.1 GCA003384415_00326 CDS open 315398-316915 _na     505_aa Transferase
335 PCNK01000001.1 GCA003384415_00327 CDS open 316939-319203 _na     754_aa yprA DEAH-box helicase
336 PCNK01000001.1 GCA003384415_00328 CDS open 319616-320023 _na     135_aa tadE Pilus assembly protein TadE
337 PCNK01000001.1 GCA003384415_00329 CDS open 320020-320430 _na     136_aa hypothetical protein
338 PCNK01000001.1 GCA003384415_00330 CDS open 320427-320714 _na     95_aa DUF4244 domain-containing protein
339 PCNK01000001.1 GCA003384415_00331 CDS open 320923-321672 _na     249_aa tadC Type II secretion system protein GspF domain-containing protein
340 PCNK01000001.1 GCA003384415_00332 CDS open 321669-322439 _na     256_aa tadB Type II secretion system F domain protein
341 PCNK01000001.1 GCA003384415_00333 CDS open 322436-323602 _na     388_aa tadA Helicase/secretion neighborhood ATPase
342 PCNK01000001.1 GCA003384415_00334 CDS open 323599-324435 _na     278_aa hypothetical protein
343 PCNK01000001.1 GCA003384415_00335 CDS open 324453-325544 _na     363_aa Methyltransferase
344 PCNK01000001.1 GCA003384415_00336 CDS open 325712-326974 _na     420_aa nhaA Na+/H+ antiporter NhaA
345 PCNK01000001.1 GCA003384415_00337 CDS open 327071-327607 _na     178_aa Phage holin family protein
346 PCNK01000001.1 GCA003384415_00338 CDS open 327689-328126 _na     145_aa Coenzyme A pyrophosphatase
347 PCNK01000001.1 GCA003384415_00339 CDS open 328123-328710 _na     195_aa trxA TlpA family protein disulfide reductase
348 PCNK01000001.1 GCA003384415_00340 CDS open 328707-329360 _na     217_aa nth endonuclease III
349 PCNK01000001.1 GCA003384415_00341 CDS open 329551-330252 _na     233_aa Crp/Fnr family transcriptional regulator
350 PCNK01000001.1 GCA003384415_00342 CDS open 330335-330790 _na     151_aa ridA Endoribonuclease L-PSP
351 PCNK01000001.1 GCA003384415_00343 CDS open 330787-330960 _na     57_aa DUF4177 domain-containing protein
352 PCNK01000001.1 GCA003384415_00344 CDS open 330957-331340 _na     127_aa whiB Transcriptional regulator WhiB
353 PCNK01000001.1 GCA003384415_00345 CDS open 331363-332373 _na     336_aa Oxidoreductase
354 PCNK01000001.1 GCA003384415_00346 CDS open 332529-332639 _na     36_aa Transporter
355 PCNK01000001.1 GCA003384415_00347 CDS open 332617-333912 _na     431_aa sdaC Serine transporter
356 PCNK01000001.1 GCA003384415_00348 CDS open 333934-335313 _na     459_aa UPF0597 protein APS60_01155
357 PCNK01000001.1 GCA003384415_00349 CDS open 335428-338772 _na     1114_aa ileS isoleucine--tRNA ligase
358 PCNK01000001.1 GCA003384415_00350 CDS open 339285-340055 _na     256_aa hypothetical protein
359 PCNK01000001.1 GCA003384415_00351 CDS open 340018-341223 _na     401_aa ABC transporter permease
360 PCNK01000001.1 GCA003384415_00352 CDS open 341220-341954 _na     244_aa rbbA ABC transporter
361 PCNK01000001.1 GCA003384415_00353 CDS open 341948-342388 _na     146_aa hypothetical protein
362 PCNK01000001.1 GCA003384415_00354 CDS open 342553-343362 _na     269_aa cof Cof-like hydrolase
363 PCNK01000001.1 GCA003384415_00355 CDS open 343372-344172 _na     266_aa cof HAD hydrolase%2C family IIB
364 PCNK01000001.1 GCA003384415_00356 CDS open 344283-346118 _na     611_aa yjjB Conserved membrane spanning protein
365 PCNK01000001.1 GCA003384415_00357 CDS open 346122-348761 _na     879_aa ybbP Permease
366 PCNK01000001.1 GCA003384415_00358 CDS open 348761-349543 _na     260_aa lolD Macrolide export ABC superfamily ATP binding cassette transporter%2C ABC protein
367 PCNK01000001.1 GCA003384415_00359 CDS open 349549-350124 _na     191_aa padR Transcriptional regulator%2C PadR family
368 PCNK01000001.1 GCA003384415_00360 CDS open 350232-350837 _na     201_aa recR recombination mediator RecR
369 PCNK01000001.1 GCA003384415_00361 CDS open 350868-351191 _na     107_aa ybaB YbaB/EbfC family nucleoid-associated protein
370 PCNK01000001.1 GCA003384415_00362 CDS open 351301-354174 _na     957_aa dnaX DNA polymerase III subunit gamma and tau
371 PCNK01000001.1 GCA003384415_00363 CDS open 354242-354598 _na     118_aa Lipoprotein
372 PCNK01000001.1 GCA003384415_00365 CDS open 354881-355246 _na     121_aa RNA-binding protein
373 PCNK01000001.1 GCA003384415_00367 CDS open 355615-356337 _na     240_aa Lipoprotein
374 PCNK01000001.1 GCA003384415_00368 CDS open 356457-357080 _na     207_aa Type IV secretion protein Rhs
375 PCNK01000001.1 GCA003384415_00369 CDS open 357077-358228 _na     383_aa hypothetical protein
376 PCNK01000001.1 GCA003384415_00370 CDS open 358644-358880 _na     78_aa hypothetical protein
377 PCNK01000001.1 GCA003384415_00371 CDS open 359329-359697 _na     122_aa lppM LppM domain-containing protein
378 PCNK01000001.1 GCA003384415_00372 CDS open 359703-360191 _na     162_aa lppM LppM family (lipo)protein
379 PCNK01000001.1 GCA003384415_00373 CDS open 360235-360420 _na     61_aa hypothetical protein
380 PCNK01000001.1 GCA003384415_00374 CDS open 360446-360631 _na     61_aa hypothetical protein
381 PCNK01000001.1 GCA003384415_00375 CDS open 360844-361722 _na     292_aa hypothetical protein
382 PCNK01000001.1 GCA003384415_00376 CDS open 361774-363819 _na     681_aa rhsA RHS-family protein
383 PCNK01000001.1 GCA003384415_00377 CDS open 363824-365089 _na     421_aa RHS-family protein
384 PCNK01000001.1 GCA003384415_00378 CDS open 365100-365588 _na     162_aa hypothetical protein
385 PCNK01000001.1 GCA003384415_00379 CDS open 365570-365860 _na     96_aa hypothetical protein
386 PCNK01000001.1 GCA003384415_00380 CDS open 366035-366316 _na     93_aa hypothetical protein
387 PCNK01000001.1 GCA003384415_00381 CDS open 367073-367702 _na     209_aa hypothetical protein
388 PCNK01000001.1 GCA003384415_00382 CDS open 367787-368896 _na     369_aa hypothetical protein
389 PCNK01000001.1 GCA003384415_00383 CDS open 369514-370476 _na     320_aa Aminoglycoside phosphotransferase domain-containing protein
390 PCNK01000001.1 GCA003384415_00384 CDS open 370552-371595 _na     347_aa Glycosyltransferase family 1 protein
391 PCNK01000001.1 GCA003384415_00385 CDS open 371767-372456 _na     229_aa fHA FHA domain-containing protein
392 PCNK01000001.1 GCA003384415_00386 CDS open 372459-372947 _na     162_aa fHA FHA domain-containing protein
393 PCNK01000001.1 GCA003384415_00387 CDS open 372951-374438 _na     495_aa pTC1 Protein phosphatase
394 PCNK01000001.1 GCA003384415_00388 CDS open 374435-375826 _na     463_aa ftsW Cell cycle protein%2C FtsW/RodA/SpoVE family
395 PCNK01000001.1 GCA003384415_00389 CDS open 375823-377250 _na     475_aa ftsI Cell division protein FtsI
396 PCNK01000001.1 GCA003384415_00390 CDS open 377297-379195 _na     632_aa pknB Stk1 family PASTA domain-containing Ser/Thr kinase
397 PCNK01000001.1 GCA003384415_00391 CDS open 379283-380113 _na     276_aa ylxW PF05949 family protein
398 PCNK01000001.1 GCA003384415_00392 CDS open 380235-380516 _na     93_aa crgA Cell division protein CrgA
399 PCNK01000001.1 GCA003384415_00393 CDS open 380556-382088 _na     510_aa lysS lysine--tRNA ligase
400 PCNK01000001.1 GCA003384415_00394 CDS open 382453-382626 _na     57_aa hypothetical protein
401 PCNK01000001.1 GCA003384415_00395 CDS open 382708-384444 _na     578_aa mdlB ABC transporter ATP-binding protein
402 PCNK01000001.1 GCA003384415_00396 CDS open 384441-386441 _na     666_aa mdlB ABC transporter
403 PCNK01000001.1 GCA003384415_00397 CDS open 386552-388057 _na     501_aa potE Amino acid permease
404 PCNK01000001.1 GCA003384415_00398 CDS open 388258-389778 _na     506_aa appC Cytochrome ubiquinol oxidase subunit I
405 PCNK01000001.1 GCA003384415_00399 CDS open 389791-390864 _na     357_aa cydB cytochrome d ubiquinol oxidase subunit II
406 PCNK01000001.1 GCA003384415_00400 CDS open 390868-392508 _na     546_aa cydD thiol reductant ABC exporter subunit CydD
407 PCNK01000001.1 GCA003384415_00401 CDS open 392505-394109 _na     534_aa cydC thiol reductant ABC exporter subunit CydC
408 PCNK01000001.1 GCA003384415_00402 CDS open 394164-394754 _na     196_aa Lipoprotein
409 PCNK01000001.1 GCA003384415_00403 CDS open 394751-395989 _na     412_aa ABC transporter permease
410 PCNK01000001.1 GCA003384415_00404 CDS open 395986-396702 _na     238_aa Phosphonate ABC transporter ATP-binding protein
411 PCNK01000001.1 GCA003384415_00405 CDS open 396717-397121 _na     134_aa hypothetical protein
412 PCNK01000001.1 GCA003384415_00406 CDS open 397337-398017 _na     226_aa lutC LUD domain-containing protein
413 PCNK01000001.1 GCA003384415_00407 CDS open 398014-399549 _na     511_aa lutB LutB/LldF family L-lactate oxidation iron-sulfur protein
414 PCNK01000001.1 GCA003384415_00408 CDS open 399553-400347 _na     264_aa glpC (S)-2-hydroxy-acid oxidase
415 PCNK01000001.1 GCA003384415_00409 CDS open 400402-402090 _na     562_aa lldP L-lactate permease
416 PCNK01000001.1 GCA003384415_00410 CDS open 402473-403246 _na     257_aa fadR HTH gntR-type domain-containing protein
417 PCNK01000001.1 GCA003384415_00411 CDS open 403268-403585 _na     105_aa Thiamine-binding protein domain-containing protein
418 PCNK01000001.1 GCA003384415_00412 CDS open 403864-405651 _na     595_aa porD Pyridine nucleotide-disulfide oxidoreductase
419 PCNK01000001.1 GCA003384415_00413 CDS open 405667-409281 _na     1204_aa nifJ pyruvate:ferredoxin (flavodoxin) oxidoreductase
420 PCNK01000001.1 GCA003384415_00414 CDS open 409305-410312 _na     335_aa pyrD Dihydroorotate oxidase
421 PCNK01000001.1 GCA003384415_00415 CDS open 410879-411298 _na     139_aa doxX DoxX protein
422 PCNK01000001.1 GCA003384415_00416 CDS open 411391-412566 _na     391_aa rfaB Glycosyltransferase%2C group 1 family protein
423 PCNK01000001.1 GCA003384415_00417 CDS open 412579-414678 _na     699_aa ABC transporter
424 PCNK01000001.1 GCA003384415_00418 CDS open 414675-415304 _na     209_aa ykoE ABC transporter permease
425 PCNK01000001.1 GCA003384415_00419 CDS open 415612-418128 _na     838_aa hrpB ATP-dependent helicase HrpB
426 PCNK01000001.1 GCA003384415_00420 CDS open 418110-418757 _na     215_aa mutT Nudix hydrolase domain-containing protein
427 PCNK01000001.1 GCA003384415_00421 CDS open 418885-420267 _na     460_aa ndh NADH:ubiquinone reductase (non-electrogenic)
428 PCNK01000001.1 GCA003384415_00422 CDS open 420272-420559 _na     95_aa hypothetical protein
429 PCNK01000001.1 GCA003384415_00423 CDS open 420909-421205 _na     98_aa hypothetical protein
430 PCNK01000001.1 GCA003384415_00424 CDS open 421162-421794 _na     210_aa DUF559 domain-containing protein
431 PCNK01000001.1 GCA003384415_00425 CDS open 422081-423202 _na     373_aa Glycosyltransferase%2C group 1 family protein
432 PCNK01000001.1 GCA003384415_00426 CDS open 423202-424275 _na     357_aa wecB non-hydrolyzing UDP-N-acetylglucosamine 2-epimerase
433 PCNK01000001.1 GCA003384415_00427 CDS open 424373-425488 _na     371_aa rfaB Glycosyl transferase
434 PCNK01000001.1 GCA003384415_00428 CDS open 425607-426866 _na     419_aa O-antigen ligase-related domain-containing protein
435 PCNK01000001.1 GCA003384415_00429 CDS open 426850-428148 _na     432_aa wecC Nucleotide sugar dehydrogenase
436 PCNK01000001.1 GCA003384415_00430 CDS open 428313-429074 _na     253_aa glpR DeoR family transcriptional regulator
437 PCNK01000001.1 GCA003384415_00431 CDS open 429402-430352 _na     316_aa pfkB 1-phosphofructokinase
438 PCNK01000001.1 GCA003384415_00432 CDS open 430362-432374 _na     670_aa ptsN PTS fructose-specific enzyme IIABC
439 PCNK01000001.1 GCA003384415_00433 CDS open 432410-432667 _na     85_aa ptsH HPr family phosphocarrier protein
440 PCNK01000001.1 GCA003384415_00434 CDS open 432731-433531 _na     266_aa fabG 3-oxoacyl-[acyl-carrier-protein] reductase
441 PCNK01000001.1 GCA003384415_00435 CDS open 433547-434848 _na     433_aa nirB Pyridine nucleotide-disulfide oxidoreductase
442 PCNK01000001.1 GCA003384415_00436 CDS open 434975-436585 _na     536_aa pTR2 Amino acid/peptide transporter
443 PCNK01000001.1 GCA003384415_00437 CDS open 436757-438139 _na     460_aa O-antigen ligase family protein
444 PCNK01000001.1 GCA003384415_00438 CDS open 438241-439233 _na     330_aa mviM Inositol 2-dehydrogenase
445 PCNK01000001.1 GCA003384415_00439 CDS open 439233-440345 _na     370_aa wecE Pleiotropic regulatory protein DegT
446 PCNK01000001.1 GCA003384415_00440 CDS open 440429-441046 _na     205_aa glmU Acetylglucosamine-1-phosphate uridylyltransferase
447 PCNK01000001.1 GCA003384415_00441 CDS open 441220-441996 _na     258_aa yveK Chain-length determining protein
448 PCNK01000001.1 GCA003384415_00442 CDS open 441970-443292 _na     440_aa O-antigen ligase
449 PCNK01000001.1 GCA003384415_00443 CDS open 443289-444416 _na     375_aa rfaB Glycosyltransferase%2C group 1 family protein
450 PCNK01000001.1 GCA003384415_00444 CDS open 444684-445946 _na     420_aa rfaB Glycosyltransferase%2C group 1 family protein
451 PCNK01000001.1 GCA003384415_00445 CDS open 445907-447244 _na     445_aa O-antigen ligase-related domain-containing protein
452 PCNK01000001.1 GCA003384415_00446 CDS open 447241-448416 _na     391_aa Mannosyltransferase PIG-V
453 PCNK01000001.1 GCA003384415_00447 CDS open 448413-449960 _na     515_aa DUF2029 domain-containing protein
454 PCNK01000001.1 GCA003384415_00448 CDS open 449970-452309 _na     779_aa mrcB peptidoglycan glycosyltransferase
455 PCNK01000001.1 GCA003384415_00449 CDS open 452302-452721 _na     139_aa DUF5318 domain-containing protein
456 PCNK01000001.1 GCA003384415_00450 CDS open 452927-454198 _na     423_aa Zinc protease
457 PCNK01000001.1 GCA003384415_00451 CDS open 454198-455571 _na     457_aa pqqL Peptidase M16 inactive domain protein
458 PCNK01000001.1 GCA003384415_00453 CDS open 456147-456359 _na     70_aa AI-2E family transporter
459 PCNK01000001.1 GCA003384415_00454 CDS open 456534-456800 _na     88_aa hypothetical protein
460 PCNK01000001.1 GCA003384415_00455 CDS open 456887-457129 _na     80_aa hypothetical protein
461 PCNK01000001.1 GCA003384415_00456 CDS open 457757-458269 _na     170_aa EXLDI protein
462 PCNK01000001.1 GCA003384415_00457 CDS open 458285-458968 _na     227_aa kdpE KDP operon response regulator KdpE
463 PCNK01000001.1 GCA003384415_00458 CDS open 458965-461457 _na     830_aa kdpD histidine kinase
464 PCNK01000001.1 GCA003384415_00459 CDS open 461498-462103 _na     201_aa kdpC potassium-transporting ATPase subunit KdpC
465 PCNK01000001.1 GCA003384415_00460 CDS open 462116-464230 _na     704_aa kdpB potassium-transporting ATPase subunit KdpB
466 PCNK01000001.1 GCA003384415_00461 CDS open 464233-465903 _na     556_aa kdpA potassium-transporting ATPase subunit KdpA
467 PCNK01000001.1 GCA003384415_00462 CDS open 465903-465992 _na     29_aa K+-transporting ATPase subunit F
468 PCNK01000001.1 GCA003384415_00463 CDS open 465989-466216 _na     75_aa hypothetical protein
469 PCNK01000001.1 GCA003384415_00464 CDS open 466550-467509 _na     319_aa DUF559 domain-containing protein
470 PCNK01000001.1 GCA003384415_00465 CDS open 467767-468420 _na     217_aa thiE thiamine phosphate synthase
471 PCNK01000001.1 GCA003384415_00466 CDS open 468429-468605 _na     58_aa hypothetical protein
472 PCNK01000001.1 GCA003384415_00467 CDS open 468783-470492 _na     569_aa tenA bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase
473 PCNK01000001.1 GCA003384415_00468 CDS open 470611-472395 _na     594_aa oleate hydratase
474 PCNK01000001.1 GCA003384415_00469 CDS open 472435-473208 _na     257_aa Transcriptional regulator
475 PCNK01000001.1 GCA003384415_00470 CDS open 473178-473495 _na     105_aa hypothetical protein
476 PCNK01000001.1 GCA003384415_00471 CDS open 473492-474760 _na     422_aa fepB Periplasmic-binding protein
477 PCNK01000001.1 GCA003384415_00472 CDS open 474817-476061 _na     414_aa fepB ABC transporter substrate-binding protein
478 PCNK01000001.1 GCA003384415_00473 CDS open 476198-477283 _na     361_aa Iron ABC transporter permease
479 PCNK01000001.1 GCA003384415_00474 CDS open 477280-478281 _na     333_aa fepC ABC transporter
480 PCNK01000001.1 GCA003384415_00475 CDS open 478368-479372 _na     334_aa aslB Radical SAM/SPASM domain-containing protein
481 PCNK01000001.1 GCA003384415_00476 CDS open 479369-483274 _na     1301_aa cobN cobaltochelatase subunit CobN
482 PCNK01000001.1 GCA003384415_00477 CDS open 483274-485181 _na     635_aa chlD Cobaltochelatase subunit
483 PCNK01000001.1 GCA003384415_00478 CDS open 485183-486169 _na     328_aa chlI Mg-protoporphyrin IX chelatase
484 PCNK01000001.1 GCA003384415_00479 CDS open 486166-487932 _na     588_aa mdlB ABC transporter transmembrane region
485 PCNK01000001.1 GCA003384415_00480 CDS open 487929-489674 _na     581_aa mdlB ABC transporter transmembrane region
486 PCNK01000001.1 GCA003384415_00481 CDS open 489712-491163 _na     483_aa katE Catalase
487 PCNK01000001.1 GCA003384415_00482 CDS open 491188-491583 _na     131_aa N-acetyltransferase domain-containing protein
488 PCNK01000001.1 GCA003384415_00483 CDS open 491684-492982 _na     432_aa dcuA C4-dicarboxylate transporter DcuA
489 PCNK01000001.1 GCA003384415_00484 CDS open 492989-494461 _na     490_aa aspA aspartate ammonia-lyase
490 PCNK01000001.1 GCA003384415_00485 CDS open 494890-496023 _na     377_aa Brp/Blh family beta-carotene 15%2C15'-monooxygenase
491 PCNK01000001.1 GCA003384415_00486 CDS open 496016-498769 _na     917_aa sufI Nitrite reductase
492 PCNK01000001.1 GCA003384415_00487 CDS open 498766-499347 _na     193_aa Transcriptional regulator
493 PCNK01000001.1 GCA003384415_00488 CDS open 499385-500512 _na     375_aa pfkA ATP-dependent 6-phosphofructokinase
494 PCNK01000001.1 GCA003384415_00489 CDS open 501142-501513 _na     123_aa hypothetical protein
495 PCNK01000001.1 GCA003384415_00490 CDS open 501690-502568 _na     292_aa hypothetical protein
496 PCNK01000001.1 GCA003384415_00491 CDS open 502679-503164 _na     161_aa Ricin B lectin domain-containing protein
497 PCNK01000001.1 GCA003384415_00492 CDS open 503103-505313 _na     736_aa Glycosyl hydrolase family 95 N-terminal domain-containing protein
498 PCNK01000001.1 GCA003384415_00493 CDS open 505303-506319 _na     338_aa purR Transcriptional regulator
499 PCNK01000001.1 GCA003384415_00494 CDS open 506369-506545 _na     58_aa DUF6903 domain-containing protein
500 PCNK01000001.1 GCA003384415_00495 CDS open 506562-507443 _na     293_aa ugpE Permease protein