HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Phocaeicola massiliensis (GCA_003462285.1)

Select a Genome:
BAKTA Annotations for GCA_003462285.1
Genome Selected: Phocaeicola massiliensis
ContigsBases CDSrRNA tmRNAtRNA
71 4177369 3591 3 2 66
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 7355 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:13]    |    Number of Records Found: 7355 [15 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
6001 QTYS01000029.1 GCA003462285_02013 CDS open 44516-45829 _na     437_aa traM conjugative transposon protein TraM
6002 QTYS01000029.1 GCA003462285_02014 CDS open 45863-46798 _na     311_aa traN conjugative transposon protein TraN
6003 QTYS01000029.1 GCA003462285_02015 CDS open 46802-47383 _na     193_aa Conjugal transfer protein
6004 QTYS01000029.1 GCA003462285_02016 CDS open 47403-47855 _na     150_aa DUF3872 domain-containing protein
6005 QTYS01000029.1 GCA003462285_02017 CDS open 47868-48188 _na     106_aa ASCH domain-containing protein
6006 QTYS01000029.1 GCA003462285_02018 CDS open 48392-48874 _na     160_aa DUF6956 domain-containing protein
6007 QTYS01000029.1 GCA003462285_02019 CDS open 48886-49107 _na     73_aa DUF3873 domain-containing protein
6008 QTYS01000029.1 GCA003462285_02020 CDS open 49395-49928 _na     177_aa ardA Antirestriction protein ArdA
6009 QTYS01000029.1 GCA003462285_02021 CDS open 50563-51093 _na     176_aa KilA-N DNA-binding domain-containing protein
6010 QTYS01000029.1 GCA003462285_02022 CDS open 51178-52407 _na     409_aa xerD Tyr recombinase domain-containing protein
6011 QTYS01000029.1 GCA003462285_02024 CDS open 52920-55442 _na     840_aa mutS2 endonuclease MutS2
6012 QTYS01000029.1 GCA003462285_02025 CDS open 55599-56807 _na     402_aa L-serine ammonia-lyase
6013 QTYS01000029.1 GCA003462285_02026 CDS open 56849-56959 _na     36_aa hypothetical protein
6014 QTYS01000029.1 GCA003462285_02027 CDS open 57062-57187 _na     41_aa hypothetical protein
6015 QTYS01000029.1 GCA003462285_02028 CDS open 57289-57729 _na     146_aa Putative beta-lactamase-inhibitor-like PepSY-like domain-containing protein
6016 QTYS01000029.1 GCA003462285_02029 CDS open 57823-58392 _na     189_aa DUF4738 domain-containing protein
6017 QTYS01000029.1 GCA003462285_02030 CDS open 58598-59284 _na     228_aa RCK N-terminal domain-containing protein
6018 QTYS01000029.1 GCA003462285_02031 CDS open 59289-61118 _na     609_aa trkH TrkH family potassium uptake protein
6019 QTYS01000029.1 GCA003462285_02032 CDS open 61326-62690 _na     454_aa TrpB-like pyridoxal phosphate-dependent enzyme
6020 QTYS01000029.1 GCA003462285_02033 CDS open 62752-64020 _na     422_aa Porin subfamily protein
6021 QTYS01000029.1 GCA003462285_01965 gene open 145-1953 ltrA
6022 QTYS01000029.1 GCA003462285_01966 gene open 1958-2854
6023 QTYS01000029.1 GCA003462285_01967 gene open 3137-4540
6024 QTYS01000029.1 GCA003462285_01968 gene open 4687-5562
6025 QTYS01000029.1 GCA003462285_01969 gene open 5559-6227
6026 QTYS01000029.1 GCA003462285_01970 gene open 6251-6715
6027 QTYS01000029.1 GCA003462285_01971 gene open 6749-7528
6028 QTYS01000029.1 GCA003462285_01972 gene open 7632-8564 araC
6029 QTYS01000029.1 GCA003462285_01973 gene open 9126-9737
6030 QTYS01000029.1 GCA003462285_01974 gene open 9861-10967
6031 QTYS01000029.1 GCA003462285_01975 gene open 11046-11438
6032 QTYS01000029.1 GCA003462285_01976 gene open 11523-12527
6033 QTYS01000029.1 GCA003462285_01977 gene open 12572-12916
6034 QTYS01000029.1 GCA003462285_01978 gene open 13059-13595
6035 QTYS01000029.1 GCA003462285_01979 gene open 13794-14519
6036 QTYS01000029.1 GCA003462285_01980 gene open 14599-15144
6037 QTYS01000029.1 GCA003462285_01981 gene open 15225-15614
6038 QTYS01000029.1 GCA003462285_01982 gene open 15893-16444
6039 QTYS01000029.1 GCA003462285_01983 gene open 16475-17317
6040 QTYS01000029.1 GCA003462285_01984 gene open 17349-18251 rteC
6041 QTYS01000029.1 GCA003462285_01985 gene open 18287-18715
6042 QTYS01000029.1 GCA003462285_01986 gene open 18678-20750
6043 QTYS01000029.1 GCA003462285_01987 gene open 21159-21677
6044 QTYS01000029.1 GCA003462285_01989 gene open 21775-23862
6045 QTYS01000029.1 GCA003462285_01990 gene open 23889-25205
6046 QTYS01000029.1 GCA003462285_01991 gene open 25910-26140
6047 QTYS01000029.1 GCA003462285_01992 gene open 26150-26776
6048 QTYS01000029.1 GCA003462285_01993 gene open 26932-27342
6049 QTYS01000029.1 GCA003462285_01994 gene open 27377-27577
6050 QTYS01000029.1 GCA003462285_01995 gene open 27615-27812
6051 QTYS01000029.1 GCA003462285_01996 gene open 28278-28979
6052 QTYS01000029.1 GCA003462285_01997 gene open 28989-30005
6053 QTYS01000029.1 GCA003462285_01998 gene open 30051-31502 traM
6054 QTYS01000029.1 GCA003462285_01999 gene open 31483-33180 ltrA
6055 QTYS01000029.1 GCA003462285_02000 gene open 33797-34486
6056 QTYS01000029.1 GCA003462285_02001 gene open 34505-35743
6057 QTYS01000029.1 GCA003462285_02002 gene open 35758-36180 mobA
6058 QTYS01000029.1 GCA003462285_02003 gene open 36761-37528
6059 QTYS01000029.1 GCA003462285_02004 gene open 37530-37958
6060 QTYS01000029.1 GCA003462285_02005 gene open 37961-38590 traD
6061 QTYS01000029.1 GCA003462285_02006 gene open 38761-39057
6062 QTYS01000029.1 GCA003462285_02007 gene open 39068-39430 traF
6063 QTYS01000029.1 GCA003462285_02008 gene open 39427-41940 traG
6064 QTYS01000029.1 GCA003462285_02009 gene open 41952-42578
6065 QTYS01000029.1 GCA003462285_02010 gene open 42598-43593 traJ
6066 QTYS01000029.1 GCA003462285_02011 gene open 43614-44237 traK
6067 QTYS01000029.1 GCA003462285_02012 gene open 44242-44538
6068 QTYS01000029.1 GCA003462285_02013 gene open 44516-45829 traM
6069 QTYS01000029.1 GCA003462285_02014 gene open 45863-46798 traN
6070 QTYS01000029.1 GCA003462285_02015 gene open 46802-47383
6071 QTYS01000029.1 GCA003462285_02016 gene open 47403-47855
6072 QTYS01000029.1 GCA003462285_02017 gene open 47868-48188
6073 QTYS01000029.1 GCA003462285_02018 gene open 48392-48874
6074 QTYS01000029.1 GCA003462285_02019 gene open 48886-49107
6075 QTYS01000029.1 GCA003462285_02020 gene open 49395-49928 ardA
6076 QTYS01000029.1 GCA003462285_02021 gene open 50563-51093
6077 QTYS01000029.1 GCA003462285_02022 gene open 51178-52407 xerD
6078 QTYS01000029.1 GCA003462285_02024 gene open 52920-55442 mutS2
6079 QTYS01000029.1 GCA003462285_02025 gene open 55599-56807
6080 QTYS01000029.1 GCA003462285_02026 gene open 56849-56959
6081 QTYS01000029.1 GCA003462285_02027 gene open 57062-57187
6082 QTYS01000029.1 GCA003462285_02028 gene open 57289-57729
6083 QTYS01000029.1 GCA003462285_02029 gene open 57823-58392
6084 QTYS01000029.1 GCA003462285_02030 gene open 58598-59284
6085 QTYS01000029.1 GCA003462285_02031 gene open 59289-61118 trkH
6086 QTYS01000029.1 GCA003462285_02032 gene open 61326-62690
6087 QTYS01000029.1 GCA003462285_02033 gene open 62752-64020
6088 QTYS01000029.1 GCA003462285_02023 gene open 52681-52765 trnS
6089 QTYS01000029.1 GCA003462285_02034 gene open 64184-64258 trnE
6090 QTYS01000029.1 GCA003462285_02023 tRNA open 52681-52765 trnS tRNA-Ser(tga)
6091 QTYS01000029.1 GCA003462285_02034 tRNA open 64184-64258 trnE tRNA-Glu(ttc)
6092 QTYS01000030.1 GCA003462285_02213 CDS open 90-1157 _na     355_aa Alcohol dehydrogenase-like N-terminal domain-containing protein
6093 QTYS01000030.1 GCA003462285_02214 CDS open 1189-2004 _na     271_aa spoU tRNA/rRNA methyltransferase SpoU type domain-containing protein
6094 QTYS01000030.1 GCA003462285_02215 CDS open 2118-2585 _na     155_aa hypothetical protein
6095 QTYS01000030.1 GCA003462285_02216 CDS open 3376-3687 _na     103_aa DNA-binding protein
6096 QTYS01000030.1 GCA003462285_02217 CDS open 3696-4160 _na     154_aa DDE Tnp4 domain-containing protein
6097 QTYS01000030.1 GCA003462285_02218 CDS open 4337-4591 _na     84_aa hypothetical protein
6098 QTYS01000030.1 GCA003462285_02219 CDS open 4928-5026 _na     32_aa hypothetical protein
6099 QTYS01000030.1 GCA003462285_02220 CDS open 5106-5276 _na     56_aa Ppx/GppA phosphatase domain-containing protein
6100 QTYS01000030.1 GCA003462285_02221 CDS open 5744-6280 _na     178_aa mgsA methylglyoxal synthase
6101 QTYS01000030.1 GCA003462285_02222 CDS open 6335-7144 _na     269_aa speB Arginase
6102 QTYS01000030.1 GCA003462285_02223 CDS open 7161-9719 _na     852_aa glgP Alpha-glucan family phosphorylase
6103 QTYS01000030.1 GCA003462285_02224 CDS open 9741-11987 _na     748_aa trkA RCK C-terminal domain-containing protein
6104 QTYS01000030.1 GCA003462285_02225 CDS open 12001-12984 _na     327_aa pfkA 6-phosphofructokinase
6105 QTYS01000030.1 GCA003462285_02226 CDS open 13050-13505 _na     151_aa rpoE RNA polymerase ECF-type sigma factor
6106 QTYS01000030.1 GCA003462285_02227 CDS open 13591-14019 _na     142_aa ibpA Small heat shock protein
6107 QTYS01000030.1 GCA003462285_02228 CDS open 14087-14836 _na     249_aa gpmA 2%2C3-diphosphoglycerate-dependent phosphoglycerate mutase
6108 QTYS01000030.1 GCA003462285_02229 CDS open 14850-15899 _na     349_aa fbaB class I fructose-bisphosphate aldolase
6109 QTYS01000030.1 GCA003462285_02230 CDS open 15928-16410 _na     160_aa ftnA Ferritin
6110 QTYS01000030.1 GCA003462285_02231 CDS open 16461-17108 _na     215_aa marC UPF0056 membrane protein
6111 QTYS01000030.1 GCA003462285_02232 CDS open 17211-17639 _na     142_aa ftnA Ferritin A
6112 QTYS01000030.1 GCA003462285_02233 CDS open 19414-19536 _na     40_aa Integrase
6113 QTYS01000030.1 GCA003462285_02234 CDS open 19561-19986 _na     141_aa Transposase
6114 QTYS01000030.1 GCA003462285_02235 CDS open 20505-21044 _na     179_aa Flavodoxin
6115 QTYS01000030.1 GCA003462285_02236 CDS open 21087-22118 _na     343_aa AB hydrolase-1 domain-containing protein
6116 QTYS01000030.1 GCA003462285_02237 CDS open 22126-23298 _na     390_aa pdxI Aldo/keto reductase
6117 QTYS01000030.1 GCA003462285_02238 CDS open 23425-23982 _na     185_aa PPC domain-containing protein
6118 QTYS01000030.1 GCA003462285_02239 CDS open 24325-24927 _na     200_aa Cyclic nucleotide-binding domain-containing protein
6119 QTYS01000030.1 GCA003462285_02240 CDS open 24937-26553 _na     538_aa RagB/SusD domain-containing protein
6120 QTYS01000030.1 GCA003462285_02241 CDS open 26566-29262 _na     898_aa cirA TonB-dependent receptor SusC
6121 QTYS01000030.1 GCA003462285_02242 CDS open 30431-32038 _na     535_aa frsA Carboxymuconolactone decarboxylase
6122 QTYS01000030.1 GCA003462285_02243 CDS open 32063-32713 _na     216_aa pgl 6-phosphogluconolactonase
6123 QTYS01000030.1 GCA003462285_02244 CDS open 32652-33218 _na     188_aa pgl 6-phosphogluconolactonase
6124 QTYS01000030.1 GCA003462285_02245 CDS open 33498-33929 _na     143_aa araC HTH araC/xylS-type domain-containing protein
6125 QTYS01000030.1 GCA003462285_02246 CDS open 33995-34417 _na     140_aa Helix-turn-helix domain-containing protein
6126 QTYS01000030.1 GCA003462285_02247 CDS open 34486-35412 _na     308_aa Core-binding (CB) domain-containing protein
6127 QTYS01000030.1 GCA003462285_02248 CDS open 35420-36181 _na     253_aa hypothetical protein
6128 QTYS01000030.1 GCA003462285_02249 CDS open 36211-37131 _na     306_aa Relaxase/mobilization nuclease domain-containing protein
6129 QTYS01000030.1 GCA003462285_02250 CDS open 37136-37507 _na     123_aa bmgB Mobilization protein BmgB
6130 QTYS01000030.1 GCA003462285_02251 CDS open 37737-38240 _na     167_aa DUF3408 domain-containing protein
6131 QTYS01000030.1 GCA003462285_02252 CDS open 38718-39029 _na     103_aa Helix-turn-helix domain-containing protein
6132 QTYS01000030.1 GCA003462285_02253 CDS open 39073-39396 _na     107_aa Helix-turn-helix domain-containing protein
6133 QTYS01000030.1 GCA003462285_02254 CDS open 39921-40313 _na     130_aa hypothetical protein
6134 QTYS01000030.1 GCA003462285_02255 CDS open 40352-40912 _na     186_aa Sigma-70 family RNA polymerase sigma factor
6135 QTYS01000030.1 GCA003462285_02256 CDS open 41182-41496 _na     104_aa hypothetical protein
6136 QTYS01000030.1 GCA003462285_02257 CDS open 41620-42423 _na     267_aa KilA-N domain-containing protein
6137 QTYS01000030.1 GCA003462285_02258 CDS open 42390-42902 _na     170_aa hypothetical protein
6138 QTYS01000030.1 GCA003462285_02259 CDS open 42916-44163 _na     415_aa xerD Tyr recombinase domain-containing protein
6139 QTYS01000030.1 GCA003462285_02260 CDS open 44667-45287 _na     206_aa Redoxin domain-containing protein
6140 QTYS01000030.1 GCA003462285_02261 CDS open 45298-46509 _na     403_aa 6-bladed beta-propeller
6141 QTYS01000030.1 GCA003462285_02262 CDS open 46662-46877 _na     71_aa NVEALA domain-containing protein
6142 QTYS01000030.1 GCA003462285_02263 CDS open 47417-47668 _na     83_aa hypothetical protein
6143 QTYS01000030.1 GCA003462285_02264 CDS open 47665-47796 _na     43_aa hypothetical protein
6144 QTYS01000030.1 GCA003462285_02265 CDS open 47772-48704 _na     310_aa IS982 family transposase
6145 QTYS01000030.1 GCA003462285_02266 CDS open 48872-49447 _na     191_aa DUF2007 domain-containing protein
6146 QTYS01000030.1 GCA003462285_02267 CDS open 49853-50716 _na     287_aa IS982 family transposase
6147 QTYS01000030.1 GCA003462285_02268 CDS open 50790-51167 _na     125_aa hypothetical protein
6148 QTYS01000030.1 GCA003462285_02269 CDS open 51433-51555 _na     40_aa hypothetical protein
6149 QTYS01000030.1 GCA003462285_02270 CDS open 51656-54829 _na     1057_aa TonB-dependent receptor
6150 QTYS01000030.1 GCA003462285_02271 CDS open 54848-56521 _na     557_aa RagB/SusD domain-containing protein
6151 QTYS01000030.1 GCA003462285_02272 CDS open 56700-57476 _na     258_aa Alpha-L-fucosidase
6152 QTYS01000030.1 GCA003462285_02273 CDS open 57476-58558 _na     360_aa F5/8 type C domain-containing protein
6153 QTYS01000030.1 GCA003462285_02213 gene open 90-1157
6154 QTYS01000030.1 GCA003462285_02214 gene open 1189-2004 spoU
6155 QTYS01000030.1 GCA003462285_02215 gene open 2118-2585
6156 QTYS01000030.1 GCA003462285_02216 gene open 3376-3687
6157 QTYS01000030.1 GCA003462285_02217 gene open 3696-4160
6158 QTYS01000030.1 GCA003462285_02218 gene open 4337-4591
6159 QTYS01000030.1 GCA003462285_02219 gene open 4928-5026
6160 QTYS01000030.1 GCA003462285_02220 gene open 5106-5276
6161 QTYS01000030.1 GCA003462285_02221 gene open 5744-6280 mgsA
6162 QTYS01000030.1 GCA003462285_02222 gene open 6335-7144 speB
6163 QTYS01000030.1 GCA003462285_02223 gene open 7161-9719 glgP
6164 QTYS01000030.1 GCA003462285_02224 gene open 9741-11987 trkA
6165 QTYS01000030.1 GCA003462285_02225 gene open 12001-12984 pfkA
6166 QTYS01000030.1 GCA003462285_02226 gene open 13050-13505 rpoE
6167 QTYS01000030.1 GCA003462285_02227 gene open 13591-14019 ibpA
6168 QTYS01000030.1 GCA003462285_02228 gene open 14087-14836 gpmA
6169 QTYS01000030.1 GCA003462285_02229 gene open 14850-15899 fbaB
6170 QTYS01000030.1 GCA003462285_02230 gene open 15928-16410 ftnA
6171 QTYS01000030.1 GCA003462285_02231 gene open 16461-17108 marC
6172 QTYS01000030.1 GCA003462285_02232 gene open 17211-17639 ftnA
6173 QTYS01000030.1 GCA003462285_02233 gene open 19414-19536
6174 QTYS01000030.1 GCA003462285_02234 gene open 19561-19986
6175 QTYS01000030.1 GCA003462285_02235 gene open 20505-21044
6176 QTYS01000030.1 GCA003462285_02236 gene open 21087-22118
6177 QTYS01000030.1 GCA003462285_02237 gene open 22126-23298 pdxI
6178 QTYS01000030.1 GCA003462285_02238 gene open 23425-23982
6179 QTYS01000030.1 GCA003462285_02239 gene open 24325-24927
6180 QTYS01000030.1 GCA003462285_02240 gene open 24937-26553
6181 QTYS01000030.1 GCA003462285_02241 gene open 26566-29262 cirA
6182 QTYS01000030.1 GCA003462285_02242 gene open 30431-32038 frsA
6183 QTYS01000030.1 GCA003462285_02243 gene open 32063-32713 pgl
6184 QTYS01000030.1 GCA003462285_02244 gene open 32652-33218 pgl
6185 QTYS01000030.1 GCA003462285_02245 gene open 33498-33929 araC
6186 QTYS01000030.1 GCA003462285_02246 gene open 33995-34417
6187 QTYS01000030.1 GCA003462285_02247 gene open 34486-35412
6188 QTYS01000030.1 GCA003462285_02248 gene open 35420-36181
6189 QTYS01000030.1 GCA003462285_02249 gene open 36211-37131
6190 QTYS01000030.1 GCA003462285_02250 gene open 37136-37507 bmgB
6191 QTYS01000030.1 GCA003462285_02251 gene open 37737-38240
6192 QTYS01000030.1 GCA003462285_02252 gene open 38718-39029
6193 QTYS01000030.1 GCA003462285_02253 gene open 39073-39396
6194 QTYS01000030.1 GCA003462285_02254 gene open 39921-40313
6195 QTYS01000030.1 GCA003462285_02255 gene open 40352-40912
6196 QTYS01000030.1 GCA003462285_02256 gene open 41182-41496
6197 QTYS01000030.1 GCA003462285_02257 gene open 41620-42423
6198 QTYS01000030.1 GCA003462285_02258 gene open 42390-42902
6199 QTYS01000030.1 GCA003462285_02259 gene open 42916-44163 xerD
6200 QTYS01000030.1 GCA003462285_02260 gene open 44667-45287
6201 QTYS01000030.1 GCA003462285_02261 gene open 45298-46509
6202 QTYS01000030.1 GCA003462285_02262 gene open 46662-46877
6203 QTYS01000030.1 GCA003462285_02263 gene open 47417-47668
6204 QTYS01000030.1 GCA003462285_02264 gene open 47665-47796
6205 QTYS01000030.1 GCA003462285_02265 gene open 47772-48704
6206 QTYS01000030.1 GCA003462285_02266 gene open 48872-49447
6207 QTYS01000030.1 GCA003462285_02267 gene open 49853-50716
6208 QTYS01000030.1 GCA003462285_02268 gene open 50790-51167
6209 QTYS01000030.1 GCA003462285_02269 gene open 51433-51555
6210 QTYS01000030.1 GCA003462285_02270 gene open 51656-54829
6211 QTYS01000030.1 GCA003462285_02271 gene open 54848-56521
6212 QTYS01000030.1 GCA003462285_02272 gene open 56700-57476
6213 QTYS01000030.1 GCA003462285_02273 gene open 57476-58558
6214 QTYS01000031.1 GCA003462285_02275 CDS open 1235-2938 _na     567_aa serine protease
6215 QTYS01000031.1 GCA003462285_02276 CDS open 2955-3707 _na     250_aa rlmB 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
6216 QTYS01000031.1 GCA003462285_02277 CDS open 3713-5377 _na     554_aa recN DNA repair protein RecN
6217 QTYS01000031.1 GCA003462285_02278 CDS open 5387-6574 _na     395_aa coaBC bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC
6218 QTYS01000031.1 GCA003462285_02279 CDS open 6577-7356 _na     259_aa dnaQ 3'-5' exonuclease
6219 QTYS01000031.1 GCA003462285_02280 CDS open 7384-8508 _na     374_aa dnaN DNA polymerase III subunit beta
6220 QTYS01000031.1 GCA003462285_02281 CDS open 8663-9040 _na     125_aa DUF3127 domain-containing protein
6221 QTYS01000031.1 GCA003462285_02282 CDS open 9446-11533 _na     695_aa rho transcription termination factor Rho
6222 QTYS01000031.1 GCA003462285_02283 CDS open 11722-11910 _na     62_aa hypothetical protein
6223 QTYS01000031.1 GCA003462285_02284 CDS open 11858-12235 _na     125_aa ridA Enamine deaminase RidA/Endoribonuclease Rid7C%2C YjgF/YER057c/UK114 family
6224 QTYS01000031.1 GCA003462285_02285 CDS open 12354-13559 _na     401_aa Transglutaminase-like domain-containing protein
6225 QTYS01000031.1 GCA003462285_02286 CDS open 13576-14358 _na     260_aa Metallo-beta-lactamase domain-containing protein
6226 QTYS01000031.1 GCA003462285_02287 CDS open 14365-14742 _na     125_aa VOC domain-containing protein
6227 QTYS01000031.1 GCA003462285_02288 CDS open 14765-15595 _na     276_aa DUF3805 domain-containing protein
6228 QTYS01000031.1 GCA003462285_02289 CDS open 15604-17469 _na     621_aa abc-f ribosomal protection-like ABC-F family protein
6229 QTYS01000031.1 GCA003462285_02290 CDS open 17617-21561 _na     1314_aa histidine kinase
6230 QTYS01000031.1 GCA003462285_02291 CDS open 21625-21792 _na     55_aa hypothetical protein
6231 QTYS01000031.1 GCA003462285_02292 CDS open 21960-24308 _na     782_aa Macroglobulin domain-containing protein
6232 QTYS01000031.1 GCA003462285_02293 CDS open 24382-24687 _na     101_aa hypothetical protein
6233 QTYS01000031.1 GCA003462285_02297 CDS open 25573-26229 _na     218_aa AlgH-like
6234 QTYS01000031.1 GCA003462285_02298 CDS open 26226-26750 _na     174_aa N-acetyltransferase domain-containing protein
6235 QTYS01000031.1 GCA003462285_02299 CDS open 26750-27214 _na     154_aa Transmembrane protein
6236 QTYS01000031.1 GCA003462285_02300 CDS open 27237-27854 _na     205_aa recR recombination mediator RecR
6237 QTYS01000031.1 GCA003462285_02301 CDS open 27873-29402 _na     509_aa Solute:sodium symporter (SSS) family transporter
6238 QTYS01000031.1 GCA003462285_02302 CDS open 29383-29985 _na     200_aa yihA ribosome biogenesis GTP-binding protein YihA/YsxC
6239 QTYS01000031.1 GCA003462285_02303 CDS open 30197-30928 _na     243_aa NigD-like C-terminal beta sandwich domain-containing protein
6240 QTYS01000031.1 GCA003462285_02304 CDS open 31115-31792 _na     225_aa Response regulatory domain-containing protein
6241 QTYS01000031.1 GCA003462285_02305 CDS open 31792-33063 _na     423_aa histidine kinase
6242 QTYS01000031.1 GCA003462285_02306 CDS open 33263-33700 _na     145_aa Putative beta-lactamase-inhibitor-like PepSY-like domain-containing protein
6243 QTYS01000031.1 GCA003462285_02307 CDS open 33983-35110 _na     375_aa Glycosyltransferase
6244 QTYS01000031.1 GCA003462285_02308 CDS open 35305-36855 _na     516_aa Carboxypeptidase Q
6245 QTYS01000031.1 GCA003462285_02309 CDS open 37154-38689 _na     511_aa atpD F0F1 ATP synthase subunit beta
6246 QTYS01000031.1 GCA003462285_02310 CDS open 38696-38944 _na     82_aa ATP synthase F1 complex delta/epsilon subunit N-terminal domain-containing protein
6247 QTYS01000031.1 GCA003462285_02311 CDS open 38964-39389 _na     141_aa ATP synthase I
6248 QTYS01000031.1 GCA003462285_02312 CDS open 39382-40470 _na     362_aa atpB F0F1 ATP synthase subunit A
6249 QTYS01000031.1 GCA003462285_02313 CDS open 40498-40749 _na     83_aa atpE ATP synthase F0 subunit C
6250 QTYS01000031.1 GCA003462285_02314 CDS open 40765-41265 _na     166_aa atpF F0F1 ATP synthase subunit B
6251 QTYS01000031.1 GCA003462285_02315 CDS open 41272-41826 _na     184_aa F0F1 ATP synthase subunit delta
6252 QTYS01000031.1 GCA003462285_02316 CDS open 41845-43434 _na     529_aa atpA F0F1 ATP synthase subunit alpha
6253 QTYS01000031.1 GCA003462285_02317 CDS open 43440-44303 _na     287_aa F0F1 ATP synthase subunit gamma
6254 QTYS01000031.1 GCA003462285_02318 CDS open 44351-45082 _na     243_aa Methyltransferase type 11 domain-containing protein
6255 QTYS01000031.1 GCA003462285_02319 CDS open 45097-46146 _na     349_aa Winged helix DNA-binding domain-containing protein
6256 QTYS01000031.1 GCA003462285_02320 CDS open 46268-47080 _na     270_aa DUF6624 domain-containing protein
6257 QTYS01000031.1 GCA003462285_02321 CDS open 47077-48693 _na     538_aa AAA+ ATPase domain-containing protein
6258 QTYS01000031.1 GCA003462285_02322 CDS open 48671-49984 _na     437_aa VWFA domain-containing protein
6259 QTYS01000031.1 GCA003462285_02323 CDS open 50650-51606 _na     318_aa phnW 2-aminoethylphosphonate--pyruvate transaminase
6260 QTYS01000031.1 GCA003462285_02324 CDS open 51603-51740 _na     45_aa hypothetical protein
6261 QTYS01000031.1 GCA003462285_02325 CDS open 51745-52533 _na     262_aa phnX phosphonoacetaldehyde hydrolase
6262 QTYS01000031.1 GCA003462285_02326 CDS open 52561-53913 _na     450_aa Major facilitator superfamily (MFS) profile domain-containing protein
6263 QTYS01000031.1 GCA003462285_02327 CDS open 54156-55034 _na     292_aa HTH cro/C1-type domain-containing protein
6264 QTYS01000031.1 GCA003462285_02328 CDS open 55048-55914 _na     288_aa NADP-dependent oxidoreductase domain-containing protein
6265 QTYS01000031.1 GCA003462285_02329 CDS open 56135-56485 _na     116_aa NADP-dependent oxidoreductase domain-containing protein
6266 QTYS01000031.1 GCA003462285_02330 CDS open 56614-57441 _na     275_aa HTH araC/xylS-type domain-containing protein
6267 QTYS01000031.1 GCA003462285_02331 CDS open 57506-57739 _na     77_aa hypothetical protein
6268 QTYS01000031.1 GCA003462285_02332 CDS open 57922-58089 _na     55_aa hypothetical protein
6269 QTYS01000031.1 GCA003462285_02275 gene open 1235-2938
6270 QTYS01000031.1 GCA003462285_02276 gene open 2955-3707 rlmB
6271 QTYS01000031.1 GCA003462285_02277 gene open 3713-5377 recN
6272 QTYS01000031.1 GCA003462285_02278 gene open 5387-6574 coaBC
6273 QTYS01000031.1 GCA003462285_02279 gene open 6577-7356 dnaQ
6274 QTYS01000031.1 GCA003462285_02280 gene open 7384-8508 dnaN
6275 QTYS01000031.1 GCA003462285_02281 gene open 8663-9040
6276 QTYS01000031.1 GCA003462285_02282 gene open 9446-11533 rho
6277 QTYS01000031.1 GCA003462285_02283 gene open 11722-11910
6278 QTYS01000031.1 GCA003462285_02284 gene open 11858-12235 ridA
6279 QTYS01000031.1 GCA003462285_02285 gene open 12354-13559
6280 QTYS01000031.1 GCA003462285_02286 gene open 13576-14358
6281 QTYS01000031.1 GCA003462285_02287 gene open 14365-14742
6282 QTYS01000031.1 GCA003462285_02288 gene open 14765-15595
6283 QTYS01000031.1 GCA003462285_02289 gene open 15604-17469 abc-f
6284 QTYS01000031.1 GCA003462285_02290 gene open 17617-21561
6285 QTYS01000031.1 GCA003462285_02291 gene open 21625-21792
6286 QTYS01000031.1 GCA003462285_02292 gene open 21960-24308
6287 QTYS01000031.1 GCA003462285_02293 gene open 24382-24687
6288 QTYS01000031.1 GCA003462285_02297 gene open 25573-26229
6289 QTYS01000031.1 GCA003462285_02298 gene open 26226-26750
6290 QTYS01000031.1 GCA003462285_02299 gene open 26750-27214
6291 QTYS01000031.1 GCA003462285_02300 gene open 27237-27854 recR
6292 QTYS01000031.1 GCA003462285_02301 gene open 27873-29402
6293 QTYS01000031.1 GCA003462285_02302 gene open 29383-29985 yihA
6294 QTYS01000031.1 GCA003462285_02303 gene open 30197-30928
6295 QTYS01000031.1 GCA003462285_02304 gene open 31115-31792
6296 QTYS01000031.1 GCA003462285_02305 gene open 31792-33063
6297 QTYS01000031.1 GCA003462285_02306 gene open 33263-33700
6298 QTYS01000031.1 GCA003462285_02307 gene open 33983-35110
6299 QTYS01000031.1 GCA003462285_02308 gene open 35305-36855
6300 QTYS01000031.1 GCA003462285_02309 gene open 37154-38689 atpD
6301 QTYS01000031.1 GCA003462285_02310 gene open 38696-38944
6302 QTYS01000031.1 GCA003462285_02311 gene open 38964-39389
6303 QTYS01000031.1 GCA003462285_02312 gene open 39382-40470 atpB
6304 QTYS01000031.1 GCA003462285_02313 gene open 40498-40749 atpE
6305 QTYS01000031.1 GCA003462285_02314 gene open 40765-41265 atpF
6306 QTYS01000031.1 GCA003462285_02315 gene open 41272-41826
6307 QTYS01000031.1 GCA003462285_02316 gene open 41845-43434 atpA
6308 QTYS01000031.1 GCA003462285_02317 gene open 43440-44303
6309 QTYS01000031.1 GCA003462285_02318 gene open 44351-45082
6310 QTYS01000031.1 GCA003462285_02319 gene open 45097-46146
6311 QTYS01000031.1 GCA003462285_02320 gene open 46268-47080
6312 QTYS01000031.1 GCA003462285_02321 gene open 47077-48693
6313 QTYS01000031.1 GCA003462285_02322 gene open 48671-49984
6314 QTYS01000031.1 GCA003462285_02323 gene open 50650-51606 phnW
6315 QTYS01000031.1 GCA003462285_02324 gene open 51603-51740
6316 QTYS01000031.1 GCA003462285_02325 gene open 51745-52533 phnX
6317 QTYS01000031.1 GCA003462285_02326 gene open 52561-53913
6318 QTYS01000031.1 GCA003462285_02327 gene open 54156-55034
6319 QTYS01000031.1 GCA003462285_02328 gene open 55048-55914
6320 QTYS01000031.1 GCA003462285_02329 gene open 56135-56485
6321 QTYS01000031.1 GCA003462285_02330 gene open 56614-57441
6322 QTYS01000031.1 GCA003462285_02331 gene open 57506-57739
6323 QTYS01000031.1 GCA003462285_02332 gene open 57922-58089
6324 QTYS01000031.1 GCA003462285_02274 gene open 587-659 trnE
6325 QTYS01000031.1 GCA003462285_02294 gene open 25098-25171 trnD
6326 QTYS01000031.1 GCA003462285_02295 gene open 25219-25292 trnD
6327 QTYS01000031.1 GCA003462285_02296 gene open 25322-25395 trnD
6328 QTYS01000031.1 GCA003462285_02274 tRNA open 587-659 trnE tRNA-Glu(ctc)
6329 QTYS01000031.1 GCA003462285_02294 tRNA open 25098-25171 trnD tRNA-Asp(gtc)
6330 QTYS01000031.1 GCA003462285_02295 tRNA open 25219-25292 trnD tRNA-Asp(gtc)
6331 QTYS01000031.1 GCA003462285_02296 tRNA open 25322-25395 trnD tRNA-Asp(gtc)
6332 QTYS01000032.1 GCA003462285_02333 CDS open 119-1579 _na     486_aa Aminoacyl-histidine dipeptidase
6333 QTYS01000032.1 GCA003462285_02334 CDS open 1576-2580 _na     334_aa Dolichol-P-glucose synthetase
6334 QTYS01000032.1 GCA003462285_02335 CDS open 2680-3525 _na     281_aa rsmA 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA
6335 QTYS01000032.1 GCA003462285_02336 CDS open 3560-4900 _na     446_aa mgtE magnesium transporter
6336 QTYS01000032.1 GCA003462285_02337 CDS open 5110-6918 _na     602_aa DUF349 domain-containing protein
6337 QTYS01000032.1 GCA003462285_02339 CDS open 7360-7569 _na     69_aa hypothetical protein
6338 QTYS01000032.1 GCA003462285_02340 CDS open 7769-8128 _na     119_aa rsfS ribosome silencing factor
6339 QTYS01000032.1 GCA003462285_02341 CDS open 8147-10141 _na     664_aa ftsH ATP-dependent zinc metalloprotease FtsH
6340 QTYS01000032.1 GCA003462285_02342 CDS open 10232-11071 _na     279_aa Phosphatidate cytidylyltransferase
6341 QTYS01000032.1 GCA003462285_02343 CDS open 11224-12363 _na     379_aa lpxB lipid-A-disaccharide synthase
6342 QTYS01000032.1 GCA003462285_02344 CDS open 12360-13139 _na     259_aa surE 5'/3'-nucleotidase SurE
6343 QTYS01000032.1 GCA003462285_02345 CDS open 13396-14163 _na     255_aa parA AAA domain-containing protein
6344 QTYS01000032.1 GCA003462285_02346 CDS open 14167-15063 _na     298_aa ParB/Sulfiredoxin domain-containing protein
6345 QTYS01000032.1 GCA003462285_02347 CDS open 15118-15876 _na     252_aa DUF5683 domain-containing protein
6346 QTYS01000032.1 GCA003462285_02348 CDS open 15858-17141 _na     427_aa lysM LysM domain-containing protein
6347 QTYS01000032.1 GCA003462285_02349 CDS open 17243-19510 _na     755_aa Bifunctional (P)ppGpp synthetase/guanosine-3'%2C5'-bis(Diphosphate) 3'-pyrophosphohydrolase
6348 QTYS01000032.1 GCA003462285_02350 CDS open 19610-19957 _na     115_aa HTH merR-type domain-containing protein
6349 QTYS01000032.1 GCA003462285_02351 CDS open 19998-20966 _na     322_aa Peptidase M23 domain-containing protein
6350 QTYS01000032.1 GCA003462285_02352 CDS open 21100-23718 _na     872_aa alaS alanine--tRNA ligase
6351 QTYS01000032.1 GCA003462285_02353 CDS open 23894-25873 _na     659_aa SusD-like N-terminal domain-containing protein
6352 QTYS01000032.1 GCA003462285_02354 CDS open 26002-27420 _na     472_aa UvrD-like helicase C-terminal domain-containing protein
6353 QTYS01000032.1 GCA003462285_02355 CDS open 27518-28204 _na     228_aa gspG Type II secretion system protein GspG C-terminal domain-containing protein
6354 QTYS01000032.1 GCA003462285_02356 CDS open 28207-29025 _na     272_aa DUF3822 domain-containing protein
6355 QTYS01000032.1 GCA003462285_02357 CDS open 29016-29573 _na     185_aa rsmD RsmD family RNA methyltransferase
6356 QTYS01000032.1 GCA003462285_02358 CDS open 29545-30981 _na     478_aa cls cardiolipin synthase
6357 QTYS01000032.1 GCA003462285_02359 CDS open 31068-33968 _na     966_aa Outer membrane protein beta-barrel domain-containing protein
6358 QTYS01000032.1 GCA003462285_02360 CDS open 34049-34495 _na     148_aa Transmembrane protein
6359 QTYS01000032.1 GCA003462285_02361 CDS open 34550-35605 _na     351_aa aroB 3-dehydroquinate synthase
6360 QTYS01000032.1 GCA003462285_02362 CDS open 35702-35938 _na     78_aa Transmembrane protein
6361 QTYS01000032.1 GCA003462285_02363 CDS open 36085-36480 _na     131_aa hypothetical protein
6362 QTYS01000032.1 GCA003462285_02364 CDS open 36630-37559 _na     309_aa ADP-ribosylglycohydrolase family protein
6363 QTYS01000032.1 GCA003462285_02365 CDS open 37790-38239 _na     149_aa PD(D/E)XK endonuclease domain-containing protein
6364 QTYS01000032.1 GCA003462285_02366 CDS open 38544-39530 _na     328_aa phage/plasmid replication protein
6365 QTYS01000032.1 GCA003462285_02367 CDS open 39570-39893 _na     107_aa helix-turn-helix domain-containing protein
6366 QTYS01000032.1 GCA003462285_02368 CDS open 40044-40823 _na     259_aa hypothetical protein
6367 QTYS01000032.1 GCA003462285_02369 CDS open 40820-42091 _na     423_aa Recombinase
6368 QTYS01000032.1 GCA003462285_02371 CDS open 42811-42996 _na     61_aa hypothetical protein
6369 QTYS01000032.1 GCA003462285_02372 CDS open 43036-43218 _na     60_aa Transmembrane protein
6370 QTYS01000032.1 GCA003462285_02373 CDS open 43289-44323 _na     344_aa hypothetical protein
6371 QTYS01000032.1 GCA003462285_02374 CDS open 44360-45517 _na     385_aa GIY-YIG nuclease family protein
6372 QTYS01000032.1 GCA003462285_02375 CDS open 45791-47194 _na     467_aa mobilization protein
6373 QTYS01000032.1 GCA003462285_02376 CDS open 47404-48360 _na     318_aa Zinc finger CHC2-type domain-containing protein
6374 QTYS01000032.1 GCA003462285_02377 CDS open 48594-49805 _na     403_aa SF3 helicase domain-containing protein
6375 QTYS01000032.1 GCA003462285_02378 CDS open 49810-50160 _na     116_aa DNA-binding protein
6376 QTYS01000032.1 GCA003462285_02379 CDS open 50405-50812 _na     135_aa Helix-turn-helix domain-containing protein
6377 QTYS01000032.1 GCA003462285_02380 CDS open 50791-52350 _na     519_aa Schlafen AlbA-2 domain-containing protein
6378 QTYS01000032.1 GCA003462285_02381 CDS open 52361-53623 _na     420_aa Site-specific integrase
6379 QTYS01000032.1 GCA003462285_02333 gene open 119-1579
6380 QTYS01000032.1 GCA003462285_02334 gene open 1576-2580
6381 QTYS01000032.1 GCA003462285_02335 gene open 2680-3525 rsmA
6382 QTYS01000032.1 GCA003462285_02336 gene open 3560-4900 mgtE
6383 QTYS01000032.1 GCA003462285_02337 gene open 5110-6918
6384 QTYS01000032.1 GCA003462285_02339 gene open 7360-7569
6385 QTYS01000032.1 GCA003462285_02340 gene open 7769-8128 rsfS
6386 QTYS01000032.1 GCA003462285_02341 gene open 8147-10141 ftsH
6387 QTYS01000032.1 GCA003462285_02342 gene open 10232-11071
6388 QTYS01000032.1 GCA003462285_02343 gene open 11224-12363 lpxB
6389 QTYS01000032.1 GCA003462285_02344 gene open 12360-13139 surE
6390 QTYS01000032.1 GCA003462285_02345 gene open 13396-14163 parA
6391 QTYS01000032.1 GCA003462285_02346 gene open 14167-15063
6392 QTYS01000032.1 GCA003462285_02347 gene open 15118-15876
6393 QTYS01000032.1 GCA003462285_02348 gene open 15858-17141 lysM
6394 QTYS01000032.1 GCA003462285_02349 gene open 17243-19510
6395 QTYS01000032.1 GCA003462285_02350 gene open 19610-19957
6396 QTYS01000032.1 GCA003462285_02351 gene open 19998-20966
6397 QTYS01000032.1 GCA003462285_02352 gene open 21100-23718 alaS
6398 QTYS01000032.1 GCA003462285_02353 gene open 23894-25873
6399 QTYS01000032.1 GCA003462285_02354 gene open 26002-27420
6400 QTYS01000032.1 GCA003462285_02355 gene open 27518-28204 gspG
6401 QTYS01000032.1 GCA003462285_02356 gene open 28207-29025
6402 QTYS01000032.1 GCA003462285_02357 gene open 29016-29573 rsmD
6403 QTYS01000032.1 GCA003462285_02358 gene open 29545-30981 cls
6404 QTYS01000032.1 GCA003462285_02359 gene open 31068-33968
6405 QTYS01000032.1 GCA003462285_02360 gene open 34049-34495
6406 QTYS01000032.1 GCA003462285_02361 gene open 34550-35605 aroB
6407 QTYS01000032.1 GCA003462285_02362 gene open 35702-35938
6408 QTYS01000032.1 GCA003462285_02363 gene open 36085-36480
6409 QTYS01000032.1 GCA003462285_02364 gene open 36630-37559
6410 QTYS01000032.1 GCA003462285_02365 gene open 37790-38239
6411 QTYS01000032.1 GCA003462285_02366 gene open 38544-39530
6412 QTYS01000032.1 GCA003462285_02367 gene open 39570-39893
6413 QTYS01000032.1 GCA003462285_02368 gene open 40044-40823
6414 QTYS01000032.1 GCA003462285_02369 gene open 40820-42091
6415 QTYS01000032.1 GCA003462285_02371 gene open 42811-42996
6416 QTYS01000032.1 GCA003462285_02372 gene open 43036-43218
6417 QTYS01000032.1 GCA003462285_02373 gene open 43289-44323
6418 QTYS01000032.1 GCA003462285_02374 gene open 44360-45517
6419 QTYS01000032.1 GCA003462285_02375 gene open 45791-47194
6420 QTYS01000032.1 GCA003462285_02376 gene open 47404-48360
6421 QTYS01000032.1 GCA003462285_02377 gene open 48594-49805
6422 QTYS01000032.1 GCA003462285_02378 gene open 49810-50160
6423 QTYS01000032.1 GCA003462285_02379 gene open 50405-50812
6424 QTYS01000032.1 GCA003462285_02380 gene open 50791-52350
6425 QTYS01000032.1 GCA003462285_02381 gene open 52361-53623
6426 QTYS01000032.1 GCA003462285_02338 gene open 7182-7252 trnQ
6427 QTYS01000032.1 GCA003462285_02370 gene open 42418-42492 trnP
6428 QTYS01000032.1 GCA003462285_02338 tRNA open 7182-7252 trnQ tRNA-Gln(ctg)
6429 QTYS01000032.1 GCA003462285_02370 tRNA open 42418-42492 trnP tRNA-Pro(ggg)
6430 QTYS01000033.1 repeat_region open 43863-44102 CRISPR array with 4 repeats of length 32%2C consensus sequence GTTTCAATCCACACACCTACATGAGGTGTGAC and spacer length 34
6431 QTYS01000033.1 repeat_region open 44259-44434 CRISPR array with 3 repeats of length 33%2C consensus sequence GTTTCAATCCACACACCTACATGAGGTGTGACT and spacer length 33
6432 QTYS01000033.1 GCA003462285_02382 CDS open 80-529 _na     149_aa Type I restriction enzyme R protein N-terminal domain-containing protein
6433 QTYS01000033.1 GCA003462285_02383 CDS open 587-1363 _na     258_aa AMP nucleosidase
6434 QTYS01000033.1 GCA003462285_02384 CDS open 1375-2391 _na     338_aa holA DNA polymerase III subunit delta
6435 QTYS01000033.1 GCA003462285_02385 CDS open 3131-3253 _na     40_aa hypothetical protein
6436 QTYS01000033.1 GCA003462285_02386 CDS open 3510-3923 _na     137_aa HTH cro/C1-type domain-containing protein
6437 QTYS01000033.1 GCA003462285_02387 CDS open 4017-4796 _na     259_aa Dihydroorotate dehydrogenase B (NAD(+))%2C electron transfer subunit
6438 QTYS01000033.1 GCA003462285_02388 CDS open 4784-5695 _na     303_aa pyrD dihydroorotate dehydrogenase
6439 QTYS01000033.1 GCA003462285_02389 CDS open 6061-6735 _na     224_aa trmD tRNA (guanosine(37)-N1)-methyltransferase TrmD
6440 QTYS01000033.1 GCA003462285_02390 CDS open 6835-8832 _na     665_aa ligA NAD-dependent DNA ligase LigA
6441 QTYS01000033.1 GCA003462285_02391 CDS open 8958-9827 _na     289_aa dapA 4-hydroxy-tetrahydrodipicolinate synthase
6442 QTYS01000033.1 GCA003462285_02394 CDS open 10840-13092 _na     750_aa PNPLA domain-containing protein
6443 QTYS01000033.1 GCA003462285_02395 CDS open 13286-15331 _na     681_aa htpG molecular chaperone HtpG
6444 QTYS01000033.1 GCA003462285_02396 CDS open 15447-17975 _na     842_aa Clp R domain-containing protein
6445 QTYS01000033.1 GCA003462285_02397 CDS open 18087-18230 _na     47_aa hypothetical protein
6446 QTYS01000033.1 GCA003462285_02398 CDS open 18292-20847 _na     851_aa gyrA DNA gyrase subunit A
6447 QTYS01000033.1 GCA003462285_02399 CDS open 20889-22106 _na     405_aa Tetratricopeptide repeat protein
6448 QTYS01000033.1 GCA003462285_02400 CDS open 22428-23555 _na     375_aa uspA UspA domain-containing protein
6449 QTYS01000033.1 GCA003462285_02401 CDS open 23643-23915 _na     90_aa DNA-binding protein
6450 QTYS01000033.1 GCA003462285_02402 CDS open 24037-24744 _na     235_aa Phosphatidic acid phosphatase type 2/haloperoxidase domain-containing protein
6451 QTYS01000033.1 GCA003462285_02403 CDS open 24751-25533 _na     260_aa SH3b domain-containing protein
6452 QTYS01000033.1 GCA003462285_02404 CDS open 25552-27384 _na     610_aa batD Protein BatD
6453 QTYS01000033.1 GCA003462285_02405 CDS open 27423-28130 _na     235_aa Tetratricopeptide repeat protein
6454 QTYS01000033.1 GCA003462285_02406 CDS open 28137-29159 _na     340_aa VWFA domain-containing protein
6455 QTYS01000033.1 GCA003462285_02407 CDS open 29172-30170 _na     332_aa VWFA domain-containing protein
6456 QTYS01000033.1 GCA003462285_02408 CDS open 30190-31287 _na     365_aa batD Protein BatD
6457 QTYS01000033.1 GCA003462285_02409 CDS open 31293-32162 _na     289_aa DUF58 domain-containing protein
6458 QTYS01000033.1 GCA003462285_02410 CDS open 32364-33359 _na     331_aa mMP0363 AAA+ ATPase domain-containing protein
6459 QTYS01000033.1 GCA003462285_02411 CDS open 33548-34843 _na     431_aa lysM LysM domain-containing protein
6460 QTYS01000033.1 GCA003462285_02412 CDS open 34875-35147 _na     90_aa DNA-binding protein HU
6461 QTYS01000033.1 GCA003462285_02413 CDS open 35221-36519 _na     432_aa rimO 30S ribosomal protein S12 methylthiotransferase RimO
6462 QTYS01000033.1 GCA003462285_02414 CDS open 36520-37482 _na     320_aa ftsY signal recognition particle-docking protein FtsY
6463 QTYS01000033.1 GCA003462285_02415 CDS open 37656-37811 _na     51_aa DUF4295 domain-containing protein
6464 QTYS01000033.1 GCA003462285_02416 CDS open 37821-38009 _na     62_aa rpmG 50S ribosomal protein L33
6465 QTYS01000033.1 GCA003462285_02417 CDS open 38030-38290 _na     86_aa rpmB 50S ribosomal protein L28
6466 QTYS01000033.1 GCA003462285_02418 CDS open 38395-38895 _na     166_aa cinA Competence/damage-inducible protein CinA domain protain
6467 QTYS01000033.1 GCA003462285_02419 CDS open 38919-39938 _na     339_aa tsaD tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD
6468 QTYS01000033.1 GCA003462285_02420 CDS open 39963-40817 _na     284_aa map type I methionyl aminopeptidase
6469 QTYS01000033.1 GCA003462285_02421 CDS open 40971-42689 _na     572_aa vapE VapE domain-containing protein
6470 QTYS01000033.1 GCA003462285_02422 CDS open 43446-43808 _na     120_aa transposase family protein
6471 QTYS01000033.1 GCA003462285_02423 CDS open 44593-44883 _na     96_aa cas2 CRISPR-associated endonuclease Cas2
6472 QTYS01000033.1 GCA003462285_02424 CDS open 44893-45915 _na     340_aa cas1c type I-C CRISPR-associated endonuclease Cas1c
6473 QTYS01000033.1 GCA003462285_02425 CDS open 45912-46577 _na     221_aa cas4 CRISPR-associated protein Cas4
6474 QTYS01000033.1 GCA003462285_02426 CDS open 46589-47467 _na     292_aa cas7c type I-C CRISPR-associated protein Cas7/Csd2
6475 QTYS01000033.1 GCA003462285_02427 CDS open 47493-49244 _na     583_aa cas8c type I-C CRISPR-associated protein Cas8c/Csd1
6476 QTYS01000033.1 GCA003462285_02428 CDS open 49241-49942 _na     233_aa cas5c type I-C CRISPR-associated protein Cas5c
6477 QTYS01000033.1 GCA003462285_02429 CDS open 49987-52254 _na     755_aa CRISPR-associated helicase cas3
6478 QTYS01000033.1 GCA003462285_02382 gene open 80-529
6479 QTYS01000033.1 GCA003462285_02383 gene open 587-1363
6480 QTYS01000033.1 GCA003462285_02384 gene open 1375-2391 holA
6481 QTYS01000033.1 GCA003462285_02385 gene open 3131-3253
6482 QTYS01000033.1 GCA003462285_02386 gene open 3510-3923
6483 QTYS01000033.1 GCA003462285_02387 gene open 4017-4796
6484 QTYS01000033.1 GCA003462285_02388 gene open 4784-5695 pyrD
6485 QTYS01000033.1 GCA003462285_02389 gene open 6061-6735 trmD
6486 QTYS01000033.1 GCA003462285_02390 gene open 6835-8832 ligA
6487 QTYS01000033.1 GCA003462285_02391 gene open 8958-9827 dapA
6488 QTYS01000033.1 GCA003462285_02394 gene open 10840-13092
6489 QTYS01000033.1 GCA003462285_02395 gene open 13286-15331 htpG
6490 QTYS01000033.1 GCA003462285_02396 gene open 15447-17975
6491 QTYS01000033.1 GCA003462285_02397 gene open 18087-18230
6492 QTYS01000033.1 GCA003462285_02398 gene open 18292-20847 gyrA
6493 QTYS01000033.1 GCA003462285_02399 gene open 20889-22106
6494 QTYS01000033.1 GCA003462285_02400 gene open 22428-23555 uspA
6495 QTYS01000033.1 GCA003462285_02401 gene open 23643-23915
6496 QTYS01000033.1 GCA003462285_02402 gene open 24037-24744
6497 QTYS01000033.1 GCA003462285_02403 gene open 24751-25533
6498 QTYS01000033.1 GCA003462285_02404 gene open 25552-27384 batD
6499 QTYS01000033.1 GCA003462285_02405 gene open 27423-28130
6500 QTYS01000033.1 GCA003462285_02406 gene open 28137-29159