BAKTAGenome Explorer: Fusobacterium polymorphum (GCA_003516445.1)
Select a Genome:
|
BAKTA Annotations for GCA_003516445.1
|
Search & Sort all 4708 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 2001 | DPCP01000031.1 | GCA003516445_01748 | CDS | open | 109919-112474 | _na 851_aa | ppdK | pyruvate%2C phosphate dikinase |
| 2002 | DPCP01000031.1 | GCA003516445_01749 | CDS | open | 112628-114565 | _na 645_aa | fbp | Fructose-1%2C6-bisphosphatase class 3 |
| 2003 | DPCP01000031.1 | GCA003516445_01750 | CDS | open | 114634-116571 | _na 645_aa | pulA | Isoamylase |
| 2004 | DPCP01000031.1 | GCA003516445_01751 | CDS | open | 116693-117421 | _na 242_aa | hisJ | Basic amino acid ABC transporter substrate-binding protein |
| 2005 | DPCP01000031.1 | GCA003516445_01752 | CDS | open | 117451-118179 | _na 242_aa | glnQ | ABC transporter domain-containing protein |
| 2006 | DPCP01000031.1 | GCA003516445_01753 | CDS | open | 118172-118882 | _na 236_aa | Amino acid ABC transporter permease | |
| 2007 | DPCP01000031.1 | GCA003516445_01754 | CDS | open | 119173-120684 | _na 503_aa | msrB | bifunctional peptide-methionine (S)-S-oxide reductase MsrA/peptide-methionine (R)-S-oxide reductase MsrB |
| 2008 | DPCP01000031.1 | GCA003516445_01755 | CDS | open | 120708-121364 | _na 218_aa | Cytochrome C biogenesis protein transmembrane domain-containing protein | |
| 2009 | DPCP01000031.1 | GCA003516445_01756 | CDS | open | 121643-122356 | _na 237_aa | energy-coupling factor ABC transporter permease | |
| 2010 | DPCP01000031.1 | GCA003516445_01757 | CDS | open | 122368-122685 | _na 105_aa | energy-coupling factor ABC transporter substrate-binding protein | |
| 2011 | DPCP01000031.1 | GCA003516445_01758 | CDS | open | 122688-123467 | _na 259_aa | cbiQ | cobalt ECF transporter T component CbiQ |
| 2012 | DPCP01000031.1 | GCA003516445_01759 | CDS | open | 123889-124401 | _na 170_aa | ABC transporter domain-containing protein | |
| 2013 | DPCP01000031.1 | GCA003516445_01760 | CDS | open | 124426-125169 | _na 247_aa | putative DNA alkylation repair enzyme | |
| 2014 | DPCP01000031.1 | GCA003516445_01761 | CDS | open | 125182-126780 | _na 532_aa | spoIID | Sporulation stage II protein D amidase enhancer LytB N-terminal domain-containing protein |
| 2015 | DPCP01000031.1 | GCA003516445_01762 | CDS | open | 126781-127518 | _na 245_aa | kdsB | 3-deoxy-manno-octulosonate cytidylyltransferase |
| 2016 | DPCP01000031.1 | GCA003516445_01763 | CDS | open | 127629-128249 | _na 206_aa | Histidine phosphatase family protein | |
| 2017 | DPCP01000031.1 | GCA003516445_01764 | CDS | open | 128249-128701 | _na 150_aa | trmL | tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL |
| 2018 | DPCP01000031.1 | GCA003516445_01765 | CDS | open | 129838-130791 | _na 317_aa | DUF4299 domain-containing protein | |
| 2019 | DPCP01000031.1 | GCA003516445_01766 | CDS | open | 130835-131110 | _na 91_aa | hupA | DNA-binding protein HU |
| 2020 | DPCP01000031.1 | GCA003516445_01767 | CDS | open | 132189-133451 | _na 420_aa | hypothetical protein | |
| 2021 | DPCP01000031.1 | GCA003516445_01768 | CDS | open | 133476-134513 | _na 345_aa | HDOD domain protein | |
| 2022 | DPCP01000031.1 | GCA003516445_01638 | gene | open | 88-381 | |||
| 2023 | DPCP01000031.1 | GCA003516445_01639 | gene | open | 381-1061 | rsuA | ||
| 2024 | DPCP01000031.1 | GCA003516445_01640 | gene | open | 1083-1433 | |||
| 2025 | DPCP01000031.1 | GCA003516445_01641 | gene | open | 1433-2485 | earP | ||
| 2026 | DPCP01000031.1 | GCA003516445_01642 | gene | open | 2485-3048 | efp | ||
| 2027 | DPCP01000031.1 | GCA003516445_01643 | gene | open | 3099-3818 | |||
| 2028 | DPCP01000031.1 | GCA003516445_01644 | gene | open | 3978-7034 | |||
| 2029 | DPCP01000031.1 | GCA003516445_01645 | gene | open | 7038-8894 | |||
| 2030 | DPCP01000031.1 | GCA003516445_01646 | gene | open | 9162-9305 | |||
| 2031 | DPCP01000031.1 | GCA003516445_01647 | gene | open | 9382-9765 | |||
| 2032 | DPCP01000031.1 | GCA003516445_01648 | gene | open | 9789-9947 | |||
| 2033 | DPCP01000031.1 | GCA003516445_01649 | gene | open | 9966-10115 | |||
| 2034 | DPCP01000031.1 | GCA003516445_01650 | gene | open | 10195-10698 | |||
| 2035 | DPCP01000031.1 | GCA003516445_01651 | gene | open | 10712-11416 | tcdA | ||
| 2036 | DPCP01000031.1 | GCA003516445_01652 | gene | open | 11501-12553 | |||
| 2037 | DPCP01000031.1 | GCA003516445_01653 | gene | open | 12650-13381 | |||
| 2038 | DPCP01000031.1 | GCA003516445_01654 | gene | open | 13396-13983 | |||
| 2039 | DPCP01000031.1 | GCA003516445_01655 | gene | open | 13983-14159 | |||
| 2040 | DPCP01000031.1 | GCA003516445_01656 | gene | open | 14178-14897 | |||
| 2041 | DPCP01000031.1 | GCA003516445_01657 | gene | open | 15027-15713 | gpmA | ||
| 2042 | DPCP01000031.1 | GCA003516445_01658 | gene | open | 15730-16263 | |||
| 2043 | DPCP01000031.1 | GCA003516445_01659 | gene | open | 16279-17466 | tmcAL | ||
| 2044 | DPCP01000031.1 | GCA003516445_01660 | gene | open | 17512-18327 | |||
| 2045 | DPCP01000031.1 | GCA003516445_01661 | gene | open | 18519-19757 | pepT | ||
| 2046 | DPCP01000031.1 | GCA003516445_01662 | gene | open | 19764-21464 | ygiQ | ||
| 2047 | DPCP01000031.1 | GCA003516445_01663 | gene | open | 21703-22032 | |||
| 2048 | DPCP01000031.1 | GCA003516445_01664 | gene | open | 22164-22391 | |||
| 2049 | DPCP01000031.1 | GCA003516445_01665 | gene | open | 22458-23528 | asd | ||
| 2050 | DPCP01000031.1 | GCA003516445_01666 | gene | open | 23530-24414 | thrB | ||
| 2051 | DPCP01000031.1 | GCA003516445_01667 | gene | open | 24402-25859 | thrC | ||
| 2052 | DPCP01000031.1 | GCA003516445_01669 | gene | open | 26323-27624 | |||
| 2053 | DPCP01000031.1 | GCA003516445_01670 | gene | open | 27957-29882 | |||
| 2054 | DPCP01000031.1 | GCA003516445_01671 | gene | open | 29884-32850 | |||
| 2055 | DPCP01000031.1 | GCA003516445_01672 | gene | open | 32858-33988 | |||
| 2056 | DPCP01000031.1 | GCA003516445_01673 | gene | open | 33988-35304 | |||
| 2057 | DPCP01000031.1 | GCA003516445_01674 | gene | open | 35317-36408 | ywqK | ||
| 2058 | DPCP01000031.1 | GCA003516445_01675 | gene | open | 36417-37277 | |||
| 2059 | DPCP01000031.1 | GCA003516445_01676 | gene | open | 37324-37962 | ftcD | ||
| 2060 | DPCP01000031.1 | GCA003516445_01677 | gene | open | 37986-38300 | |||
| 2061 | DPCP01000031.1 | GCA003516445_01678 | gene | open | 40024-40989 | ftcD | ||
| 2062 | DPCP01000031.1 | GCA003516445_01679 | gene | open | 41204-41674 | yehS | ||
| 2063 | DPCP01000031.1 | GCA003516445_01680 | gene | open | 42544-44250 | |||
| 2064 | DPCP01000031.1 | GCA003516445_01681 | gene | open | 44247-46340 | pgpH | ||
| 2065 | DPCP01000031.1 | GCA003516445_01682 | gene | open | 46357-46845 | ybeY | ||
| 2066 | DPCP01000031.1 | GCA003516445_01683 | gene | open | 46867-47382 | mutT | ||
| 2067 | DPCP01000031.1 | GCA003516445_01684 | gene | open | 47379-48731 | |||
| 2068 | DPCP01000031.1 | GCA003516445_01685 | gene | open | 49450-49695 | |||
| 2069 | DPCP01000031.1 | GCA003516445_01686 | gene | open | 49685-49954 | |||
| 2070 | DPCP01000031.1 | GCA003516445_01687 | gene | open | 50826-51380 | |||
| 2071 | DPCP01000031.1 | GCA003516445_01688 | gene | open | 51523-51723 | |||
| 2072 | DPCP01000031.1 | GCA003516445_01689 | gene | open | 51887-52633 | |||
| 2073 | DPCP01000031.1 | GCA003516445_01690 | gene | open | 52652-53104 | |||
| 2074 | DPCP01000031.1 | GCA003516445_01691 | gene | open | 53131-53805 | |||
| 2075 | DPCP01000031.1 | GCA003516445_01692 | gene | open | 53971-54171 | |||
| 2076 | DPCP01000031.1 | GCA003516445_01693 | gene | open | 54208-54324 | |||
| 2077 | DPCP01000031.1 | GCA003516445_01694 | gene | open | 54594-54923 | |||
| 2078 | DPCP01000031.1 | GCA003516445_01695 | gene | open | 54920-55024 | |||
| 2079 | DPCP01000031.1 | GCA003516445_01696 | gene | open | 55014-55235 | |||
| 2080 | DPCP01000031.1 | GCA003516445_01697 | gene | open | 55562-55858 | |||
| 2081 | DPCP01000031.1 | GCA003516445_01698 | gene | open | 55862-56122 | |||
| 2082 | DPCP01000031.1 | GCA003516445_01699 | gene | open | 56112-58157 | |||
| 2083 | DPCP01000031.1 | GCA003516445_01700 | gene | open | 58699-59187 | |||
| 2084 | DPCP01000031.1 | GCA003516445_01701 | gene | open | 59218-59382 | |||
| 2085 | DPCP01000031.1 | GCA003516445_01702 | gene | open | 59385-60446 | |||
| 2086 | DPCP01000031.1 | GCA003516445_01703 | gene | open | 60643-61884 | ykuD | ||
| 2087 | DPCP01000031.1 | GCA003516445_01704 | gene | open | 61902-62624 | |||
| 2088 | DPCP01000031.1 | GCA003516445_01705 | gene | open | 62640-63650 | ansA | ||
| 2089 | DPCP01000031.1 | GCA003516445_01706 | gene | open | 63650-64621 | pip | ||
| 2090 | DPCP01000031.1 | GCA003516445_01707 | gene | open | 64875-66320 | gatB | ||
| 2091 | DPCP01000031.1 | GCA003516445_01708 | gene | open | 66334-67791 | gatA | ||
| 2092 | DPCP01000031.1 | GCA003516445_01709 | gene | open | 67809-68099 | gatC | ||
| 2093 | DPCP01000031.1 | GCA003516445_01710 | gene | open | 68108-68812 | rsuA | ||
| 2094 | DPCP01000031.1 | GCA003516445_01711 | gene | open | 68802-69347 | scpB | ||
| 2095 | DPCP01000031.1 | GCA003516445_01712 | gene | open | 69364-70410 | mreB | ||
| 2096 | DPCP01000031.1 | GCA003516445_01713 | gene | open | 70428-71006 | |||
| 2097 | DPCP01000031.1 | GCA003516445_01714 | gene | open | 71008-71820 | ftsK | ||
| 2098 | DPCP01000031.1 | GCA003516445_01715 | gene | open | 72078-72848 | |||
| 2099 | DPCP01000031.1 | GCA003516445_01716 | gene | open | 72895-73257 | arsR | ||
| 2100 | DPCP01000031.1 | GCA003516445_01717 | gene | open | 73380-74006 | lysE | ||
| 2101 | DPCP01000031.1 | GCA003516445_01718 | gene | open | 74019-75107 | mnmA | ||
| 2102 | DPCP01000031.1 | GCA003516445_01719 | gene | open | 75158-75568 | mscL | ||
| 2103 | DPCP01000031.1 | GCA003516445_01720 | gene | open | 75796-76686 | |||
| 2104 | DPCP01000031.1 | GCA003516445_01721 | gene | open | 76753-78921 | |||
| 2105 | DPCP01000031.1 | GCA003516445_01722 | gene | open | 78936-79901 | fepD | ||
| 2106 | DPCP01000031.1 | GCA003516445_01723 | gene | open | 79901-80677 | fepC | ||
| 2107 | DPCP01000031.1 | GCA003516445_01724 | gene | open | 80691-81926 | |||
| 2108 | DPCP01000031.1 | GCA003516445_01725 | gene | open | 81923-82432 | |||
| 2109 | DPCP01000031.1 | GCA003516445_01726 | gene | open | 82505-82729 | |||
| 2110 | DPCP01000031.1 | GCA003516445_01727 | gene | open | 82862-83677 | ywqK | ||
| 2111 | DPCP01000031.1 | GCA003516445_01728 | gene | open | 83800-85089 | lAP4 | ||
| 2112 | DPCP01000031.1 | GCA003516445_01729 | gene | open | 85177-86160 | asnA | ||
| 2113 | DPCP01000031.1 | GCA003516445_01730 | gene | open | 86198-88000 | lepA | ||
| 2114 | DPCP01000031.1 | GCA003516445_01731 | gene | open | 88029-89255 | |||
| 2115 | DPCP01000031.1 | GCA003516445_01732 | gene | open | 89264-90148 | yejR | ||
| 2116 | DPCP01000031.1 | GCA003516445_01733 | gene | open | 90167-90658 | thrE | ||
| 2117 | DPCP01000031.1 | GCA003516445_01734 | gene | open | 90680-91438 | yjjP | ||
| 2118 | DPCP01000031.1 | GCA003516445_01735 | gene | open | 91450-92181 | trmN6 | ||
| 2119 | DPCP01000031.1 | GCA003516445_01736 | gene | open | 92386-93531 | caiA | ||
| 2120 | DPCP01000031.1 | GCA003516445_01737 | gene | open | 93552-94340 | fixA | ||
| 2121 | DPCP01000031.1 | GCA003516445_01738 | gene | open | 94365-95540 | fixB | ||
| 2122 | DPCP01000031.1 | GCA003516445_01739 | gene | open | 95661-96080 | |||
| 2123 | DPCP01000031.1 | GCA003516445_01740 | gene | open | 96158-97000 | yitT | ||
| 2124 | DPCP01000031.1 | GCA003516445_01741 | gene | open | 97016-98134 | nagC | ||
| 2125 | DPCP01000031.1 | GCA003516445_01742 | gene | open | 98468-100018 | hutH | ||
| 2126 | DPCP01000031.1 | GCA003516445_01743 | gene | open | 100053-102074 | hutU | ||
| 2127 | DPCP01000031.1 | GCA003516445_01744 | gene | open | 102292-103491 | gltS | ||
| 2128 | DPCP01000031.1 | GCA003516445_01745 | gene | open | 103559-108616 | |||
| 2129 | DPCP01000031.1 | GCA003516445_01746 | gene | open | 108625-109038 | |||
| 2130 | DPCP01000031.1 | GCA003516445_01747 | gene | open | 109284-109907 | cBS | ||
| 2131 | DPCP01000031.1 | GCA003516445_01748 | gene | open | 109919-112474 | ppdK | ||
| 2132 | DPCP01000031.1 | GCA003516445_01749 | gene | open | 112628-114565 | fbp | ||
| 2133 | DPCP01000031.1 | GCA003516445_01750 | gene | open | 114634-116571 | pulA | ||
| 2134 | DPCP01000031.1 | GCA003516445_01751 | gene | open | 116693-117421 | hisJ | ||
| 2135 | DPCP01000031.1 | GCA003516445_01752 | gene | open | 117451-118179 | glnQ | ||
| 2136 | DPCP01000031.1 | GCA003516445_01753 | gene | open | 118172-118882 | |||
| 2137 | DPCP01000031.1 | GCA003516445_01754 | gene | open | 119173-120684 | msrB | ||
| 2138 | DPCP01000031.1 | GCA003516445_01755 | gene | open | 120708-121364 | |||
| 2139 | DPCP01000031.1 | GCA003516445_01756 | gene | open | 121643-122356 | |||
| 2140 | DPCP01000031.1 | GCA003516445_01757 | gene | open | 122368-122685 | |||
| 2141 | DPCP01000031.1 | GCA003516445_01758 | gene | open | 122688-123467 | cbiQ | ||
| 2142 | DPCP01000031.1 | GCA003516445_01759 | gene | open | 123889-124401 | |||
| 2143 | DPCP01000031.1 | GCA003516445_01760 | gene | open | 124426-125169 | |||
| 2144 | DPCP01000031.1 | GCA003516445_01761 | gene | open | 125182-126780 | spoIID | ||
| 2145 | DPCP01000031.1 | GCA003516445_01762 | gene | open | 126781-127518 | kdsB | ||
| 2146 | DPCP01000031.1 | GCA003516445_01763 | gene | open | 127629-128249 | |||
| 2147 | DPCP01000031.1 | GCA003516445_01764 | gene | open | 128249-128701 | trmL | ||
| 2148 | DPCP01000031.1 | GCA003516445_01765 | gene | open | 129838-130791 | |||
| 2149 | DPCP01000031.1 | GCA003516445_01766 | gene | open | 130835-131110 | hupA | ||
| 2150 | DPCP01000031.1 | GCA003516445_01767 | gene | open | 132189-133451 | |||
| 2151 | DPCP01000031.1 | GCA003516445_01768 | gene | open | 133476-134513 | |||
| 2152 | DPCP01000032.1 | regulatory_region | open | 53056-53202 | glmS glucosamine-6-phosphate activated ribozyme aptamer | |||
| 2153 | DPCP01000032.1 | repeat_region | open | 170372-171052 | CRISPR array with 9 repeats of length 37%2C consensus sequence AATAAGTGAGAATATAACTCCGATAGGAGACGGAAAT and spacer length 38 | |||
| 2154 | DPCP01000032.1 | GCA003516445_02172 | CDS | open | 91-804 | _na 237_aa | Glutaminase | |
| 2155 | DPCP01000032.1 | GCA003516445_02173 | CDS | open | 822-1529 | _na 235_aa | deoD | purine-nucleoside phosphorylase |
| 2156 | DPCP01000032.1 | GCA003516445_02174 | CDS | open | 1707-2318 | _na 203_aa | J domain-containing protein | |
| 2157 | DPCP01000032.1 | GCA003516445_02175 | CDS | open | 2427-3437 | _na 336_aa | pxpC | Carboxyltransferase domain-containing protein |
| 2158 | DPCP01000032.1 | GCA003516445_02176 | CDS | open | 3430-4179 | _na 249_aa | pxpB | 5-oxoprolinase subunit PxpB |
| 2159 | DPCP01000032.1 | GCA003516445_02177 | CDS | open | 4193-5380 | _na 395_aa | mntH | Transporter%2C branched chain amino acid:cation symporter (LIVCS) family protein |
| 2160 | DPCP01000032.1 | GCA003516445_02178 | CDS | open | 5395-6168 | _na 257_aa | pxpA | 5-oxoprolinase subunit A |
| 2161 | DPCP01000032.1 | GCA003516445_02182 | CDS | open | 6897-8096 | _na 399_aa | Recombinase | |
| 2162 | DPCP01000032.1 | GCA003516445_02183 | CDS | open | 8101-8316 | _na 71_aa | DNA-binding protein | |
| 2163 | DPCP01000032.1 | GCA003516445_02184 | CDS | open | 8348-8947 | _na 199_aa | Type IV secretory system Conjugative DNA transfer | |
| 2164 | DPCP01000032.1 | GCA003516445_02185 | CDS | open | 8969-9112 | _na 47_aa | hypothetical protein | |
| 2165 | DPCP01000032.1 | GCA003516445_02186 | CDS | open | 9220-9456 | _na 78_aa | hypothetical protein | |
| 2166 | DPCP01000032.1 | GCA003516445_02187 | CDS | open | 9467-10438 | _na 323_aa | Autotransporter domain-containing protein | |
| 2167 | DPCP01000032.1 | GCA003516445_02188 | CDS | open | 10447-11070 | _na 207_aa | traF | conjugative transfer signal peptidase TraF |
| 2168 | DPCP01000032.1 | GCA003516445_02189 | CDS | open | 11034-13505 | _na 823_aa | virB4 | VirB4 family type IV secretion/conjugal transfer ATPase |
| 2169 | DPCP01000032.1 | GCA003516445_02190 | CDS | open | 13517-13804 | _na 95_aa | Conjugal transfer protein | |
| 2170 | DPCP01000032.1 | GCA003516445_02191 | CDS | open | 13797-14783 | _na 328_aa | trbB | P-type conjugative transfer ATPase TrbB |
| 2171 | DPCP01000032.1 | GCA003516445_02192 | CDS | open | 14776-15207 | _na 143_aa | PF12958 family protein | |
| 2172 | DPCP01000032.1 | GCA003516445_02193 | CDS | open | 15177-17477 | _na 766_aa | traG | Conjugal transfer protein TraG |
| 2173 | DPCP01000032.1 | GCA003516445_02194 | CDS | open | 17480-18805 | _na 441_aa | trbL | Conjugal transfer protein TrbL |
| 2174 | DPCP01000032.1 | GCA003516445_02195 | CDS | open | 18814-18990 | _na 58_aa | hypothetical protein | |
| 2175 | DPCP01000032.1 | GCA003516445_02196 | CDS | open | 18999-19772 | _na 257_aa | trbJ | P-type conjugative transfer protein TrbJ |
| 2176 | DPCP01000032.1 | GCA003516445_02197 | CDS | open | 19819-21060 | _na 413_aa | trbI | Conjugal transfer protein TrbI |
| 2177 | DPCP01000032.1 | GCA003516445_02198 | CDS | open | 21070-21792 | _na 240_aa | trbG | Conjugal transfer protein TrbG |
| 2178 | DPCP01000032.1 | GCA003516445_02199 | CDS | open | 21859-22530 | _na 223_aa | virB8 | Bacterial virulence protein VirB8 domain-containing protein |
| 2179 | DPCP01000032.1 | GCA003516445_02200 | CDS | open | 22530-22862 | _na 110_aa | trbC | Conjugal transfer protein TrbC |
| 2180 | DPCP01000032.1 | GCA003516445_02201 | CDS | open | 22951-23568 | _na 205_aa | Tyr recombinase domain-containing protein | |
| 2181 | DPCP01000032.1 | GCA003516445_02202 | CDS | open | 24037-24153 | _na 38_aa | hypothetical protein | |
| 2182 | DPCP01000032.1 | GCA003516445_02203 | CDS | open | 24305-24604 | _na 99_aa | Phage protein | |
| 2183 | DPCP01000032.1 | GCA003516445_02204 | CDS | open | 24867-25979 | _na 370_aa | AAA domain-containing protein | |
| 2184 | DPCP01000032.1 | GCA003516445_02205 | CDS | open | 25972-26673 | _na 233_aa | DUF3102 domain-containing protein | |
| 2185 | DPCP01000032.1 | GCA003516445_02206 | CDS | open | 26686-26949 | _na 87_aa | Lipoprotein | |
| 2186 | DPCP01000032.1 | GCA003516445_02207 | CDS | open | 26999-27112 | _na 37_aa | hypothetical protein | |
| 2187 | DPCP01000032.1 | GCA003516445_02208 | CDS | open | 27160-27747 | _na 195_aa | Type II toxin-antitoxin system PemK/MazF family toxin | |
| 2188 | DPCP01000032.1 | GCA003516445_02209 | CDS | open | 27752-28642 | _na 296_aa | Zeta toxin domain-containing protein | |
| 2189 | DPCP01000032.1 | GCA003516445_02210 | CDS | open | 28642-28887 | _na 81_aa | hypothetical protein | |
| 2190 | DPCP01000032.1 | GCA003516445_02211 | CDS | open | 28922-29560 | _na 212_aa | Resolvase/invertase-type recombinase catalytic domain-containing protein | |
| 2191 | DPCP01000032.1 | GCA003516445_02212 | CDS | open | 29792-30664 | _na 290_aa | Apea-like HEPN domain-containing protein | |
| 2192 | DPCP01000032.1 | GCA003516445_02213 | CDS | open | 30753-31367 | _na 204_aa | ParB/Sulfiredoxin domain-containing protein | |
| 2193 | DPCP01000032.1 | GCA003516445_02214 | CDS | open | 31465-32190 | _na 241_aa | Fido domain-containing protein | |
| 2194 | DPCP01000032.1 | GCA003516445_02215 | CDS | open | 32228-34921 | _na 897_aa | MobA/MobL protein domain-containing protein | |
| 2195 | DPCP01000032.1 | GCA003516445_02216 | CDS | open | 35289-35897 | _na 202_aa | hypothetical protein | |
| 2196 | DPCP01000032.1 | GCA003516445_02217 | CDS | open | 35912-36988 | _na 358_aa | Toprim domain-containing protein | |
| 2197 | DPCP01000032.1 | GCA003516445_02218 | CDS | open | 36998-37366 | _na 122_aa | hypothetical protein | |
| 2198 | DPCP01000032.1 | GCA003516445_02219 | CDS | open | 37378-37752 | _na 124_aa | hypothetical protein | |
| 2199 | DPCP01000032.1 | GCA003516445_02220 | CDS | open | 37752-38792 | _na 346_aa | Phosphatidylinositol-4-phosphate 5-kinase | |
| 2200 | DPCP01000032.1 | GCA003516445_02221 | CDS | open | 38888-39610 | _na 240_aa | Phage-Barnase-EndoU-ColicinE5/D-RelE like nuclease 4 domain-containing protein | |
| 2201 | DPCP01000032.1 | GCA003516445_02222 | CDS | open | 39937-41604 | _na 555_aa | MPN domain-containing protein | |
| 2202 | DPCP01000032.1 | GCA003516445_02223 | CDS | open | 41607-41762 | _na 51_aa | tfoX | TfoX C-terminal domain-containing protein |
| 2203 | DPCP01000032.1 | GCA003516445_02224 | CDS | open | 41891-42688 | _na 265_aa | hypothetical protein | |
| 2204 | DPCP01000032.1 | GCA003516445_02225 | CDS | open | 42869-45016 | _na 715_aa | DNA topoisomerase | |
| 2205 | DPCP01000032.1 | GCA003516445_02226 | CDS | open | 45026-45475 | _na 149_aa | hypothetical protein | |
| 2206 | DPCP01000032.1 | GCA003516445_02227 | CDS | open | 45481-45984 | _na 167_aa | hypothetical protein | |
| 2207 | DPCP01000032.1 | GCA003516445_02228 | CDS | open | 45989-46597 | _na 202_aa | t-SNARE coiled-coil-like y domain-containing protein | |
| 2208 | DPCP01000032.1 | GCA003516445_02229 | CDS | open | 46612-47403 | _na 263_aa | Phosphatidylinositol-4-phosphate 5-kinase | |
| 2209 | DPCP01000032.1 | GCA003516445_02230 | CDS | open | 47394-47807 | _na 137_aa | hypothetical protein | |
| 2210 | DPCP01000032.1 | GCA003516445_02231 | CDS | open | 47883-48080 | _na 65_aa | plpE | PlpE protein |
| 2211 | DPCP01000032.1 | GCA003516445_02232 | CDS | open | 48099-48443 | _na 114_aa | hypothetical protein | |
| 2212 | DPCP01000032.1 | GCA003516445_02233 | CDS | open | 48532-48798 | _na 88_aa | hypothetical protein | |
| 2213 | DPCP01000032.1 | GCA003516445_02234 | CDS | open | 49274-49810 | _na 178_aa | hypothetical protein | |
| 2214 | DPCP01000032.1 | GCA003516445_02235 | CDS | open | 49821-50474 | _na 217_aa | hypothetical protein | |
| 2215 | DPCP01000032.1 | GCA003516445_02236 | CDS | open | 50477-51835 | _na 452_aa | Phage replisome organiser N-terminal domain-containing protein | |
| 2216 | DPCP01000032.1 | GCA003516445_02237 | CDS | open | 51837-52550 | _na 237_aa | hypothetical protein | |
| 2217 | DPCP01000032.1 | GCA003516445_02239 | CDS | open | 53240-55063 | _na 607_aa | glmS | glutamine--fructose-6-phosphate transaminase (isomerizing) |
| 2218 | DPCP01000032.1 | GCA003516445_02240 | CDS | open | 55096-56850 | _na 584_aa | pepP | Peptidase M24 |
| 2219 | DPCP01000032.1 | GCA003516445_02241 | CDS | open | 56869-57429 | _na 186_aa | Flavin reductase like domain-containing protein | |
| 2220 | DPCP01000032.1 | GCA003516445_02242 | CDS | open | 57557-59032 | _na 491_aa | adhE | Aldehyde dehydrogenase domain-containing protein |
| 2221 | DPCP01000032.1 | GCA003516445_02243 | CDS | open | 59416-59955 | _na 179_aa | rbr | rubrerythrin |
| 2222 | DPCP01000032.1 | GCA003516445_02244 | CDS | open | 60076-61482 | _na 468_aa | DUF4015 domain-containing protein | |
| 2223 | DPCP01000032.1 | GCA003516445_02245 | CDS | open | 61502-61942 | _na 146_aa | CAAX prenyl protease 1 N-terminal domain-containing protein | |
| 2224 | DPCP01000032.1 | GCA003516445_02246 | CDS | open | 61954-62790 | _na 278_aa | MORN repeat protein | |
| 2225 | DPCP01000032.1 | GCA003516445_02247 | CDS | open | 62809-63651 | _na 280_aa | MORN repeat protein | |
| 2226 | DPCP01000032.1 | GCA003516445_02248 | CDS | open | 63667-64554 | _na 295_aa | MORN repeat protein | |
| 2227 | DPCP01000032.1 | GCA003516445_02249 | CDS | open | 64567-65535 | _na 322_aa | hemB | porphobilinogen synthase |
| 2228 | DPCP01000032.1 | GCA003516445_02250 | CDS | open | 65607-66152 | _na 181_aa | hpf | ribosome hibernation-promoting factor%2C HPF/YfiA family |
| 2229 | DPCP01000032.1 | GCA003516445_02251 | CDS | open | 66300-68246 | _na 648_aa | mutL | DNA mismatch repair endonuclease MutL |
| 2230 | DPCP01000032.1 | GCA003516445_02252 | CDS | open | 68257-68724 | _na 155_aa | rlmH | Ribosomal RNA large subunit methyltransferase H |
| 2231 | DPCP01000032.1 | GCA003516445_02253 | CDS | open | 69155-70432 | _na 425_aa | Lipoprotein | |
| 2232 | DPCP01000032.1 | GCA003516445_02254 | CDS | open | 70462-71943 | _na 493_aa | lysS | lysine--tRNA ligase |
| 2233 | DPCP01000032.1 | GCA003516445_02255 | CDS | open | 72010-72366 | _na 118_aa | yohJ | CidA/LrgA family protein |
| 2234 | DPCP01000032.1 | GCA003516445_02256 | CDS | open | 72366-73058 | _na 230_aa | lrgB | Murein hydrolase transporter LrgB |
| 2235 | DPCP01000032.1 | GCA003516445_02257 | CDS | open | 73072-73680 | _na 202_aa | cutC | PF03932 family protein CutC |
| 2236 | DPCP01000032.1 | GCA003516445_02258 | CDS | open | 73907-75445 | _na 512_aa | abgT | AbgT transporter |
| 2237 | DPCP01000032.1 | GCA003516445_02259 | CDS | open | 75590-76093 | _na 167_aa | fldA | flavodoxin |
| 2238 | DPCP01000032.1 | GCA003516445_02260 | CDS | open | 76387-77694 | _na 435_aa | miaB | tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB |
| 2239 | DPCP01000032.1 | GCA003516445_02261 | CDS | open | 77717-78958 | _na 413_aa | rho | transcription termination factor Rho |
| 2240 | DPCP01000032.1 | GCA003516445_02262 | CDS | open | 79009-80106 | _na 365_aa | lysM | LysM domain-containing protein |
| 2241 | DPCP01000032.1 | GCA003516445_02263 | CDS | open | 80152-81225 | _na 357_aa | ispG | flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase |
| 2242 | DPCP01000032.1 | GCA003516445_02264 | CDS | open | 81271-81720 | _na 149_aa | rpoE | DNA-directed RNA polymerase sigma subunit RpoE |
| 2243 | DPCP01000032.1 | GCA003516445_02265 | CDS | open | 81722-82030 | _na 102_aa | Gram-positive signal peptide protein%2C YSIRK family | |
| 2244 | DPCP01000032.1 | GCA003516445_02266 | CDS | open | 82047-82445 | _na 132_aa | Adhesin | |
| 2245 | DPCP01000032.1 | GCA003516445_02267 | CDS | open | 82563-82808 | _na 81_aa | rpmE | type B 50S ribosomal protein L31 |
| 2246 | DPCP01000032.1 | GCA003516445_02268 | CDS | open | 82866-83489 | _na 207_aa | upp | uracil phosphoribosyltransferase |
| 2247 | DPCP01000032.1 | GCA003516445_02269 | CDS | open | 83746-84534 | _na 262_aa | Lipase | |
| 2248 | DPCP01000032.1 | GCA003516445_02270 | CDS | open | 84605-85615 | _na 336_aa | Lactate dehydrogenase | |
| 2249 | DPCP01000032.1 | GCA003516445_02271 | CDS | open | 85992-87269 | _na 425_aa | gdhA | Glutamate dehydrogenase |
| 2250 | DPCP01000032.1 | GCA003516445_02272 | CDS | open | 87382-88248 | _na 288_aa | lgt | prolipoprotein diacylglyceryl transferase |
| 2251 | DPCP01000032.1 | GCA003516445_02273 | CDS | open | 88275-89057 | _na 260_aa | undP | DUF368 domain-containing protein |
| 2252 | DPCP01000032.1 | GCA003516445_02274 | CDS | open | 89062-90141 | _na 359_aa | alr | Alanine racemase |
| 2253 | DPCP01000032.1 | GCA003516445_02275 | CDS | open | 90545-91012 | _na 155_aa | hypothetical protein | |
| 2254 | DPCP01000032.1 | GCA003516445_02276 | CDS | open | 91087-91239 | _na 50_aa | hypothetical protein | |
| 2255 | DPCP01000032.1 | GCA003516445_02277 | CDS | open | 91259-91489 | _na 76_aa | 50S rRNA methyltransferase | |
| 2256 | DPCP01000032.1 | GCA003516445_02278 | CDS | open | 91510-93369 | _na 619_aa | hypothetical protein | |
| 2257 | DPCP01000032.1 | GCA003516445_02279 | CDS | open | 93362-94780 | _na 472_aa | hypothetical protein | |
| 2258 | DPCP01000032.1 | GCA003516445_02280 | CDS | open | 94800-95771 | _na 323_aa | yobV | WYL domain-containing protein |
| 2259 | DPCP01000032.1 | GCA003516445_02281 | CDS | open | 96026-96745 | _na 239_aa | fabG | 3-oxoacyl-[acyl-carrier-protein] reductase |
| 2260 | DPCP01000032.1 | GCA003516445_02282 | CDS | open | 96796-98004 | _na 402_aa | paaJ | Acetyl-CoA C-acetyltransferase |
| 2261 | DPCP01000032.1 | GCA003516445_02283 | CDS | open | 98141-102730 | _na 1529_aa | Autotransporter subunit beta | |
| 2262 | DPCP01000032.1 | GCA003516445_02284 | CDS | open | 102757-105006 | _na 749_aa | TonB-dependent receptor | |
| 2263 | DPCP01000032.1 | GCA003516445_02285 | CDS | open | 105338-106195 | _na 285_aa | Glycoside-hydrolase family GH114 TIM-barrel domain-containing protein | |
| 2264 | DPCP01000032.1 | GCA003516445_02286 | CDS | open | 106266-107714 | _na 482_aa | Tyrosine phenol-lyase | |
| 2265 | DPCP01000032.1 | GCA003516445_02287 | CDS | open | 108083-110434 | _na 783_aa | ldcC | arginase |
| 2266 | DPCP01000032.1 | GCA003516445_02288 | CDS | open | 110581-111156 | _na 191_aa | hypothetical protein | |
| 2267 | DPCP01000032.1 | GCA003516445_02289 | CDS | open | 111123-111470 | _na 115_aa | hypothetical protein | |
| 2268 | DPCP01000032.1 | GCA003516445_02290 | CDS | open | 111484-112818 | _na 444_aa | hypothetical protein | |
| 2269 | DPCP01000032.1 | GCA003516445_02291 | CDS | open | 113157-113741 | _na 194_aa | gmhA | D-sedoheptulose 7-phosphate isomerase |
| 2270 | DPCP01000032.1 | GCA003516445_02292 | CDS | open | 113758-114645 | _na 295_aa | lysR | HTH lysR-type domain-containing protein |
| 2271 | DPCP01000032.1 | GCA003516445_02293 | CDS | open | 114742-116121 | _na 459_aa | Amino acid permease | |
| 2272 | DPCP01000032.1 | GCA003516445_02294 | CDS | open | 116137-116868 | _na 243_aa | Glutamine amidotransferase class-I domain protein | |
| 2273 | DPCP01000032.1 | GCA003516445_02295 | CDS | open | 116896-118605 | _na 569_aa | argS | arginine--tRNA ligase |
| 2274 | DPCP01000032.1 | GCA003516445_02296 | CDS | open | 118901-119746 | _na 281_aa | yjjU | Serine protease |
| 2275 | DPCP01000032.1 | GCA003516445_02297 | CDS | open | 119871-120875 | _na 334_aa | D-lactate dehydrogenase | |
| 2276 | DPCP01000032.1 | GCA003516445_02298 | CDS | open | 121032-122243 | _na 403_aa | norV | Flavodoxin-like domain-containing protein |
| 2277 | DPCP01000032.1 | GCA003516445_02299 | CDS | open | 122410-122838 | _na 142_aa | fldA | flavodoxin |
| 2278 | DPCP01000032.1 | GCA003516445_02300 | CDS | open | 123085-123525 | _na 146_aa | Lipoprotein | |
| 2279 | DPCP01000032.1 | GCA003516445_02301 | CDS | open | 123579-126647 | _na 1022_aa | acrB | SSD domain-containing protein |
| 2280 | DPCP01000032.1 | GCA003516445_02302 | CDS | open | 126635-127717 | _na 360_aa | acrA | Membrane fusion protein biotin-lipoyl like domain-containing protein |
| 2281 | DPCP01000032.1 | GCA003516445_02303 | CDS | open | 127732-129141 | _na 469_aa | tolC | TolC family protein |
| 2282 | DPCP01000032.1 | GCA003516445_02304 | CDS | open | 129271-130284 | _na 337_aa | MORN repeat protein | |
| 2283 | DPCP01000032.1 | GCA003516445_02305 | CDS | open | 130293-130910 | _na 205_aa | DUF2179 domain-containing protein | |
| 2284 | DPCP01000032.1 | GCA003516445_02306 | CDS | open | 130903-131571 | _na 222_aa | queH | Epoxyqueuosine reductase QueH |
| 2285 | DPCP01000032.1 | GCA003516445_02307 | CDS | open | 131580-134345 | _na 921_aa | sbcC | Exonuclease SBCC |
| 2286 | DPCP01000032.1 | GCA003516445_02308 | CDS | open | 134335-135501 | _na 388_aa | sbcD | Calcineurin-like phosphoesterase domain-containing protein |
| 2287 | DPCP01000032.1 | GCA003516445_02309 | CDS | open | 135492-138257 | _na 921_aa | cas4 | DNA 3'-5' helicase |
| 2288 | DPCP01000032.1 | GCA003516445_02310 | CDS | open | 138259-140514 | _na 751_aa | mrcB | peptidoglycan glycosyltransferase |
| 2289 | DPCP01000032.1 | GCA003516445_02311 | CDS | open | 140518-141594 | _na 358_aa | rlmN | 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN |
| 2290 | DPCP01000032.1 | GCA003516445_02312 | CDS | open | 141594-142715 | _na 373_aa | alaX | Alanyl-transfer RNA synthetases family profile domain-containing protein |
| 2291 | DPCP01000032.1 | GCA003516445_02313 | CDS | open | 142860-144194 | _na 444_aa | nox | H2O-forming NADH oxidase |
| 2292 | DPCP01000032.1 | GCA003516445_02314 | CDS | open | 144632-144832 | _na 66_aa | cspC | Cold shock protein |
| 2293 | DPCP01000032.1 | GCA003516445_02315 | CDS | open | 144887-145942 | _na 351_aa | abrB | Membrane protein AbrB duplication |
| 2294 | DPCP01000032.1 | GCA003516445_02316 | CDS | open | 145965-147005 | _na 346_aa | yeiH | UPF0324 membrane protein FN0533 |
| 2295 | DPCP01000032.1 | GCA003516445_02317 | CDS | open | 147164-147700 | _na 178_aa | VanZ-like domain-containing protein | |
| 2296 | DPCP01000032.1 | GCA003516445_02318 | CDS | open | 147765-148343 | _na 192_aa | ppnN | Cytokinin riboside 5'-monophosphate phosphoribohydrolase |
| 2297 | DPCP01000032.1 | GCA003516445_02319 | CDS | open | 148367-149512 | _na 381_aa | dnaN | DNA polymerase III subunit beta |
| 2298 | DPCP01000032.1 | GCA003516445_02320 | CDS | open | 149528-150112 | _na 194_aa | plsY | glycerol-3-phosphate 1-O-acyltransferase PlsY |
| 2299 | DPCP01000032.1 | GCA003516445_02321 | CDS | open | 150256-150480 | _na 74_aa | secG | preprotein translocase subunit SecG |
| 2300 | DPCP01000032.1 | GCA003516445_02322 | CDS | open | 150552-151010 | _na 152_aa | precorrin-2 dehydrogenase | |
| 2301 | DPCP01000032.1 | GCA003516445_02323 | CDS | open | 151000-152304 | _na 434_aa | hemL | glutamate-1-semialdehyde 2%2C1-aminomutase |
| 2302 | DPCP01000032.1 | GCA003516445_02324 | CDS | open | 152532-153626 | _na 364_aa | pgaB | NodB-like y domain-containing protein |
| 2303 | DPCP01000032.1 | GCA003516445_02325 | CDS | open | 153645-154424 | _na 259_aa | Glycosyltransferase 2-like domain-containing protein | |
| 2304 | DPCP01000032.1 | GCA003516445_02326 | CDS | open | 154414-155442 | _na 342_aa | rfaF | Lipopolysaccharide heptosyltransferase |
| 2305 | DPCP01000032.1 | GCA003516445_02327 | CDS | open | 155430-156458 | _na 342_aa | rfaF | ADP-heptose--LPS heptosyltransferase |
| 2306 | DPCP01000032.1 | GCA003516445_02328 | CDS | open | 156451-157053 | _na 200_aa | Lipopolysaccharide biosynthesis protein | |
| 2307 | DPCP01000032.1 | GCA003516445_02329 | CDS | open | 157055-158089 | _na 344_aa | rfaQ | Lipopolysaccharide core biosynthesis protein rfaQ |
| 2308 | DPCP01000032.1 | GCA003516445_02330 | CDS | open | 158070-159209 | _na 379_aa | recA | recombinase RecA |
| 2309 | DPCP01000032.1 | GCA003516445_02331 | CDS | open | 159181-159759 | _na 192_aa | recX | Regulatory protein RecX |
| 2310 | DPCP01000032.1 | GCA003516445_02332 | CDS | open | 159747-160772 | _na 341_aa | tsaD | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD |
| 2311 | DPCP01000032.1 | GCA003516445_02333 | CDS | open | 160987-163512 | _na 841_aa | cas10 | type III-A CRISPR-associated protein Cas10/Csm1 |
| 2312 | DPCP01000032.1 | GCA003516445_02334 | CDS | open | 163516-163881 | _na 121_aa | CRISPR system Cms protein Csm2 | |
| 2313 | DPCP01000032.1 | GCA003516445_02335 | CDS | open | 163919-164635 | _na 238_aa | csm3 | type III-A CRISPR-associated RAMP protein Csm3 |
| 2314 | DPCP01000032.1 | GCA003516445_02336 | CDS | open | 164635-165645 | _na 336_aa | csm4 | type III-A CRISPR-associated RAMP protein Csm4 |
| 2315 | DPCP01000032.1 | GCA003516445_02337 | CDS | open | 165633-166802 | _na 389_aa | csm5 | type III-A CRISPR-associated RAMP protein Csm5 |
| 2316 | DPCP01000032.1 | GCA003516445_02338 | CDS | open | 166786-167508 | _na 240_aa | CRISPR-associated protein Cas6 C-terminal domain-containing protein | |
| 2317 | DPCP01000032.1 | GCA003516445_02339 | CDS | open | 167501-168883 | _na 460_aa | csm6 | type III-A CRISPR-associated CARF protein Csm6 |
| 2318 | DPCP01000032.1 | GCA003516445_02340 | CDS | open | 168897-169907 | _na 336_aa | cas1 | CRISPR-associated endonuclease Cas1 |
| 2319 | DPCP01000032.1 | GCA003516445_02341 | CDS | open | 169910-170233 | _na 107_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 2320 | DPCP01000032.1 | GCA003516445_02172 | gene | open | 91-804 | |||
| 2321 | DPCP01000032.1 | GCA003516445_02173 | gene | open | 822-1529 | deoD | ||
| 2322 | DPCP01000032.1 | GCA003516445_02174 | gene | open | 1707-2318 | |||
| 2323 | DPCP01000032.1 | GCA003516445_02175 | gene | open | 2427-3437 | pxpC | ||
| 2324 | DPCP01000032.1 | GCA003516445_02176 | gene | open | 3430-4179 | pxpB | ||
| 2325 | DPCP01000032.1 | GCA003516445_02177 | gene | open | 4193-5380 | mntH | ||
| 2326 | DPCP01000032.1 | GCA003516445_02178 | gene | open | 5395-6168 | pxpA | ||
| 2327 | DPCP01000032.1 | GCA003516445_02182 | gene | open | 6897-8096 | |||
| 2328 | DPCP01000032.1 | GCA003516445_02183 | gene | open | 8101-8316 | |||
| 2329 | DPCP01000032.1 | GCA003516445_02184 | gene | open | 8348-8947 | |||
| 2330 | DPCP01000032.1 | GCA003516445_02185 | gene | open | 8969-9112 | |||
| 2331 | DPCP01000032.1 | GCA003516445_02186 | gene | open | 9220-9456 | |||
| 2332 | DPCP01000032.1 | GCA003516445_02187 | gene | open | 9467-10438 | |||
| 2333 | DPCP01000032.1 | GCA003516445_02188 | gene | open | 10447-11070 | traF | ||
| 2334 | DPCP01000032.1 | GCA003516445_02189 | gene | open | 11034-13505 | virB4 | ||
| 2335 | DPCP01000032.1 | GCA003516445_02190 | gene | open | 13517-13804 | |||
| 2336 | DPCP01000032.1 | GCA003516445_02191 | gene | open | 13797-14783 | trbB | ||
| 2337 | DPCP01000032.1 | GCA003516445_02192 | gene | open | 14776-15207 | |||
| 2338 | DPCP01000032.1 | GCA003516445_02193 | gene | open | 15177-17477 | traG | ||
| 2339 | DPCP01000032.1 | GCA003516445_02194 | gene | open | 17480-18805 | trbL | ||
| 2340 | DPCP01000032.1 | GCA003516445_02195 | gene | open | 18814-18990 | |||
| 2341 | DPCP01000032.1 | GCA003516445_02196 | gene | open | 18999-19772 | trbJ | ||
| 2342 | DPCP01000032.1 | GCA003516445_02197 | gene | open | 19819-21060 | trbI | ||
| 2343 | DPCP01000032.1 | GCA003516445_02198 | gene | open | 21070-21792 | trbG | ||
| 2344 | DPCP01000032.1 | GCA003516445_02199 | gene | open | 21859-22530 | virB8 | ||
| 2345 | DPCP01000032.1 | GCA003516445_02200 | gene | open | 22530-22862 | trbC | ||
| 2346 | DPCP01000032.1 | GCA003516445_02201 | gene | open | 22951-23568 | |||
| 2347 | DPCP01000032.1 | GCA003516445_02202 | gene | open | 24037-24153 | |||
| 2348 | DPCP01000032.1 | GCA003516445_02203 | gene | open | 24305-24604 | |||
| 2349 | DPCP01000032.1 | GCA003516445_02204 | gene | open | 24867-25979 | |||
| 2350 | DPCP01000032.1 | GCA003516445_02205 | gene | open | 25972-26673 | |||
| 2351 | DPCP01000032.1 | GCA003516445_02206 | gene | open | 26686-26949 | |||
| 2352 | DPCP01000032.1 | GCA003516445_02207 | gene | open | 26999-27112 | |||
| 2353 | DPCP01000032.1 | GCA003516445_02208 | gene | open | 27160-27747 | |||
| 2354 | DPCP01000032.1 | GCA003516445_02209 | gene | open | 27752-28642 | |||
| 2355 | DPCP01000032.1 | GCA003516445_02210 | gene | open | 28642-28887 | |||
| 2356 | DPCP01000032.1 | GCA003516445_02211 | gene | open | 28922-29560 | |||
| 2357 | DPCP01000032.1 | GCA003516445_02212 | gene | open | 29792-30664 | |||
| 2358 | DPCP01000032.1 | GCA003516445_02213 | gene | open | 30753-31367 | |||
| 2359 | DPCP01000032.1 | GCA003516445_02214 | gene | open | 31465-32190 | |||
| 2360 | DPCP01000032.1 | GCA003516445_02215 | gene | open | 32228-34921 | |||
| 2361 | DPCP01000032.1 | GCA003516445_02216 | gene | open | 35289-35897 | |||
| 2362 | DPCP01000032.1 | GCA003516445_02217 | gene | open | 35912-36988 | |||
| 2363 | DPCP01000032.1 | GCA003516445_02218 | gene | open | 36998-37366 | |||
| 2364 | DPCP01000032.1 | GCA003516445_02219 | gene | open | 37378-37752 | |||
| 2365 | DPCP01000032.1 | GCA003516445_02220 | gene | open | 37752-38792 | |||
| 2366 | DPCP01000032.1 | GCA003516445_02221 | gene | open | 38888-39610 | |||
| 2367 | DPCP01000032.1 | GCA003516445_02222 | gene | open | 39937-41604 | |||
| 2368 | DPCP01000032.1 | GCA003516445_02223 | gene | open | 41607-41762 | tfoX | ||
| 2369 | DPCP01000032.1 | GCA003516445_02224 | gene | open | 41891-42688 | |||
| 2370 | DPCP01000032.1 | GCA003516445_02225 | gene | open | 42869-45016 | |||
| 2371 | DPCP01000032.1 | GCA003516445_02226 | gene | open | 45026-45475 | |||
| 2372 | DPCP01000032.1 | GCA003516445_02227 | gene | open | 45481-45984 | |||
| 2373 | DPCP01000032.1 | GCA003516445_02228 | gene | open | 45989-46597 | |||
| 2374 | DPCP01000032.1 | GCA003516445_02229 | gene | open | 46612-47403 | |||
| 2375 | DPCP01000032.1 | GCA003516445_02230 | gene | open | 47394-47807 | |||
| 2376 | DPCP01000032.1 | GCA003516445_02231 | gene | open | 47883-48080 | plpE | ||
| 2377 | DPCP01000032.1 | GCA003516445_02232 | gene | open | 48099-48443 | |||
| 2378 | DPCP01000032.1 | GCA003516445_02233 | gene | open | 48532-48798 | |||
| 2379 | DPCP01000032.1 | GCA003516445_02234 | gene | open | 49274-49810 | |||
| 2380 | DPCP01000032.1 | GCA003516445_02235 | gene | open | 49821-50474 | |||
| 2381 | DPCP01000032.1 | GCA003516445_02236 | gene | open | 50477-51835 | |||
| 2382 | DPCP01000032.1 | GCA003516445_02237 | gene | open | 51837-52550 | |||
| 2383 | DPCP01000032.1 | GCA003516445_02239 | gene | open | 53240-55063 | glmS | ||
| 2384 | DPCP01000032.1 | GCA003516445_02240 | gene | open | 55096-56850 | pepP | ||
| 2385 | DPCP01000032.1 | GCA003516445_02241 | gene | open | 56869-57429 | |||
| 2386 | DPCP01000032.1 | GCA003516445_02242 | gene | open | 57557-59032 | adhE | ||
| 2387 | DPCP01000032.1 | GCA003516445_02243 | gene | open | 59416-59955 | rbr | ||
| 2388 | DPCP01000032.1 | GCA003516445_02244 | gene | open | 60076-61482 | |||
| 2389 | DPCP01000032.1 | GCA003516445_02245 | gene | open | 61502-61942 | |||
| 2390 | DPCP01000032.1 | GCA003516445_02246 | gene | open | 61954-62790 | |||
| 2391 | DPCP01000032.1 | GCA003516445_02247 | gene | open | 62809-63651 | |||
| 2392 | DPCP01000032.1 | GCA003516445_02248 | gene | open | 63667-64554 | |||
| 2393 | DPCP01000032.1 | GCA003516445_02249 | gene | open | 64567-65535 | hemB | ||
| 2394 | DPCP01000032.1 | GCA003516445_02250 | gene | open | 65607-66152 | hpf | ||
| 2395 | DPCP01000032.1 | GCA003516445_02251 | gene | open | 66300-68246 | mutL | ||
| 2396 | DPCP01000032.1 | GCA003516445_02252 | gene | open | 68257-68724 | rlmH | ||
| 2397 | DPCP01000032.1 | GCA003516445_02253 | gene | open | 69155-70432 | |||
| 2398 | DPCP01000032.1 | GCA003516445_02254 | gene | open | 70462-71943 | lysS | ||
| 2399 | DPCP01000032.1 | GCA003516445_02255 | gene | open | 72010-72366 | yohJ | ||
| 2400 | DPCP01000032.1 | GCA003516445_02256 | gene | open | 72366-73058 | lrgB | ||
| 2401 | DPCP01000032.1 | GCA003516445_02257 | gene | open | 73072-73680 | cutC | ||
| 2402 | DPCP01000032.1 | GCA003516445_02258 | gene | open | 73907-75445 | abgT | ||
| 2403 | DPCP01000032.1 | GCA003516445_02259 | gene | open | 75590-76093 | fldA | ||
| 2404 | DPCP01000032.1 | GCA003516445_02260 | gene | open | 76387-77694 | miaB | ||
| 2405 | DPCP01000032.1 | GCA003516445_02261 | gene | open | 77717-78958 | rho | ||
| 2406 | DPCP01000032.1 | GCA003516445_02262 | gene | open | 79009-80106 | lysM | ||
| 2407 | DPCP01000032.1 | GCA003516445_02263 | gene | open | 80152-81225 | ispG | ||
| 2408 | DPCP01000032.1 | GCA003516445_02264 | gene | open | 81271-81720 | rpoE | ||
| 2409 | DPCP01000032.1 | GCA003516445_02265 | gene | open | 81722-82030 | |||
| 2410 | DPCP01000032.1 | GCA003516445_02266 | gene | open | 82047-82445 | |||
| 2411 | DPCP01000032.1 | GCA003516445_02267 | gene | open | 82563-82808 | rpmE | ||
| 2412 | DPCP01000032.1 | GCA003516445_02268 | gene | open | 82866-83489 | upp | ||
| 2413 | DPCP01000032.1 | GCA003516445_02269 | gene | open | 83746-84534 | |||
| 2414 | DPCP01000032.1 | GCA003516445_02270 | gene | open | 84605-85615 | |||
| 2415 | DPCP01000032.1 | GCA003516445_02271 | gene | open | 85992-87269 | gdhA | ||
| 2416 | DPCP01000032.1 | GCA003516445_02272 | gene | open | 87382-88248 | lgt | ||
| 2417 | DPCP01000032.1 | GCA003516445_02273 | gene | open | 88275-89057 | undP | ||
| 2418 | DPCP01000032.1 | GCA003516445_02274 | gene | open | 89062-90141 | alr | ||
| 2419 | DPCP01000032.1 | GCA003516445_02275 | gene | open | 90545-91012 | |||
| 2420 | DPCP01000032.1 | GCA003516445_02276 | gene | open | 91087-91239 | |||
| 2421 | DPCP01000032.1 | GCA003516445_02277 | gene | open | 91259-91489 | |||
| 2422 | DPCP01000032.1 | GCA003516445_02278 | gene | open | 91510-93369 | |||
| 2423 | DPCP01000032.1 | GCA003516445_02279 | gene | open | 93362-94780 | |||
| 2424 | DPCP01000032.1 | GCA003516445_02280 | gene | open | 94800-95771 | yobV | ||
| 2425 | DPCP01000032.1 | GCA003516445_02281 | gene | open | 96026-96745 | fabG | ||
| 2426 | DPCP01000032.1 | GCA003516445_02282 | gene | open | 96796-98004 | paaJ | ||
| 2427 | DPCP01000032.1 | GCA003516445_02283 | gene | open | 98141-102730 | |||
| 2428 | DPCP01000032.1 | GCA003516445_02284 | gene | open | 102757-105006 | |||
| 2429 | DPCP01000032.1 | GCA003516445_02285 | gene | open | 105338-106195 | |||
| 2430 | DPCP01000032.1 | GCA003516445_02286 | gene | open | 106266-107714 | |||
| 2431 | DPCP01000032.1 | GCA003516445_02287 | gene | open | 108083-110434 | ldcC | ||
| 2432 | DPCP01000032.1 | GCA003516445_02288 | gene | open | 110581-111156 | |||
| 2433 | DPCP01000032.1 | GCA003516445_02289 | gene | open | 111123-111470 | |||
| 2434 | DPCP01000032.1 | GCA003516445_02290 | gene | open | 111484-112818 | |||
| 2435 | DPCP01000032.1 | GCA003516445_02291 | gene | open | 113157-113741 | gmhA | ||
| 2436 | DPCP01000032.1 | GCA003516445_02292 | gene | open | 113758-114645 | lysR | ||
| 2437 | DPCP01000032.1 | GCA003516445_02293 | gene | open | 114742-116121 | |||
| 2438 | DPCP01000032.1 | GCA003516445_02294 | gene | open | 116137-116868 | |||
| 2439 | DPCP01000032.1 | GCA003516445_02295 | gene | open | 116896-118605 | argS | ||
| 2440 | DPCP01000032.1 | GCA003516445_02296 | gene | open | 118901-119746 | yjjU | ||
| 2441 | DPCP01000032.1 | GCA003516445_02297 | gene | open | 119871-120875 | |||
| 2442 | DPCP01000032.1 | GCA003516445_02298 | gene | open | 121032-122243 | norV | ||
| 2443 | DPCP01000032.1 | GCA003516445_02299 | gene | open | 122410-122838 | fldA | ||
| 2444 | DPCP01000032.1 | GCA003516445_02300 | gene | open | 123085-123525 | |||
| 2445 | DPCP01000032.1 | GCA003516445_02301 | gene | open | 123579-126647 | acrB | ||
| 2446 | DPCP01000032.1 | GCA003516445_02302 | gene | open | 126635-127717 | acrA | ||
| 2447 | DPCP01000032.1 | GCA003516445_02303 | gene | open | 127732-129141 | tolC | ||
| 2448 | DPCP01000032.1 | GCA003516445_02304 | gene | open | 129271-130284 | |||
| 2449 | DPCP01000032.1 | GCA003516445_02305 | gene | open | 130293-130910 | |||
| 2450 | DPCP01000032.1 | GCA003516445_02306 | gene | open | 130903-131571 | queH | ||
| 2451 | DPCP01000032.1 | GCA003516445_02307 | gene | open | 131580-134345 | sbcC | ||
| 2452 | DPCP01000032.1 | GCA003516445_02308 | gene | open | 134335-135501 | sbcD | ||
| 2453 | DPCP01000032.1 | GCA003516445_02309 | gene | open | 135492-138257 | cas4 | ||
| 2454 | DPCP01000032.1 | GCA003516445_02310 | gene | open | 138259-140514 | mrcB | ||
| 2455 | DPCP01000032.1 | GCA003516445_02311 | gene | open | 140518-141594 | rlmN | ||
| 2456 | DPCP01000032.1 | GCA003516445_02312 | gene | open | 141594-142715 | alaX | ||
| 2457 | DPCP01000032.1 | GCA003516445_02313 | gene | open | 142860-144194 | nox | ||
| 2458 | DPCP01000032.1 | GCA003516445_02314 | gene | open | 144632-144832 | cspC | ||
| 2459 | DPCP01000032.1 | GCA003516445_02315 | gene | open | 144887-145942 | abrB | ||
| 2460 | DPCP01000032.1 | GCA003516445_02316 | gene | open | 145965-147005 | yeiH | ||
| 2461 | DPCP01000032.1 | GCA003516445_02317 | gene | open | 147164-147700 | |||
| 2462 | DPCP01000032.1 | GCA003516445_02318 | gene | open | 147765-148343 | ppnN | ||
| 2463 | DPCP01000032.1 | GCA003516445_02319 | gene | open | 148367-149512 | dnaN | ||
| 2464 | DPCP01000032.1 | GCA003516445_02320 | gene | open | 149528-150112 | plsY | ||
| 2465 | DPCP01000032.1 | GCA003516445_02321 | gene | open | 150256-150480 | secG | ||
| 2466 | DPCP01000032.1 | GCA003516445_02322 | gene | open | 150552-151010 | |||
| 2467 | DPCP01000032.1 | GCA003516445_02323 | gene | open | 151000-152304 | hemL | ||
| 2468 | DPCP01000032.1 | GCA003516445_02324 | gene | open | 152532-153626 | pgaB | ||
| 2469 | DPCP01000032.1 | GCA003516445_02325 | gene | open | 153645-154424 | |||
| 2470 | DPCP01000032.1 | GCA003516445_02326 | gene | open | 154414-155442 | rfaF | ||
| 2471 | DPCP01000032.1 | GCA003516445_02327 | gene | open | 155430-156458 | rfaF | ||
| 2472 | DPCP01000032.1 | GCA003516445_02328 | gene | open | 156451-157053 | |||
| 2473 | DPCP01000032.1 | GCA003516445_02329 | gene | open | 157055-158089 | rfaQ | ||
| 2474 | DPCP01000032.1 | GCA003516445_02330 | gene | open | 158070-159209 | recA | ||
| 2475 | DPCP01000032.1 | GCA003516445_02331 | gene | open | 159181-159759 | recX | ||
| 2476 | DPCP01000032.1 | GCA003516445_02332 | gene | open | 159747-160772 | tsaD | ||
| 2477 | DPCP01000032.1 | GCA003516445_02333 | gene | open | 160987-163512 | cas10 | ||
| 2478 | DPCP01000032.1 | GCA003516445_02334 | gene | open | 163516-163881 | |||
| 2479 | DPCP01000032.1 | GCA003516445_02335 | gene | open | 163919-164635 | csm3 | ||
| 2480 | DPCP01000032.1 | GCA003516445_02336 | gene | open | 164635-165645 | csm4 | ||
| 2481 | DPCP01000032.1 | GCA003516445_02337 | gene | open | 165633-166802 | csm5 | ||
| 2482 | DPCP01000032.1 | GCA003516445_02338 | gene | open | 166786-167508 | |||
| 2483 | DPCP01000032.1 | GCA003516445_02339 | gene | open | 167501-168883 | csm6 | ||
| 2484 | DPCP01000032.1 | GCA003516445_02340 | gene | open | 168897-169907 | cas1 | ||
| 2485 | DPCP01000032.1 | GCA003516445_02341 | gene | open | 169910-170233 | cas2 | ||
| 2486 | DPCP01000032.1 | GCA003516445_02179 | gene | open | 6387-6463 | trnR | ||
| 2487 | DPCP01000032.1 | GCA003516445_02180 | gene | open | 6524-6600 | trnR | ||
| 2488 | DPCP01000032.1 | GCA003516445_02181 | gene | open | 6755-6841 | trnL | ||
| 2489 | DPCP01000032.1 | GCA003516445_02238 | gene | open | 52865-52946 | trnL | ||
| 2490 | DPCP01000032.1 | GCA003516445_02179 | tRNA | open | 6387-6463 | trnR | tRNA-Arg(tcg) | |
| 2491 | DPCP01000032.1 | GCA003516445_02180 | tRNA | open | 6524-6600 | trnR | tRNA-Arg(acg) | |
| 2492 | DPCP01000032.1 | GCA003516445_02181 | tRNA | open | 6755-6841 | trnL | tRNA-Leu(caa) | |
| 2493 | DPCP01000032.1 | GCA003516445_02238 | tRNA | open | 52865-52946 | trnL | tRNA-Leu(caa) | |
| 2494 | DPCP01000033.1 | GCA003516445_01942 | CDS | open | 155-481 | _na 108_aa | AAA domain protein | |
| 2495 | DPCP01000033.1 | GCA003516445_01943 | CDS | open | 611-1399 | _na 262_aa | Serine/threonine protein kinase | |
| 2496 | DPCP01000033.1 | GCA003516445_01944 | CDS | open | 1443-2045 | _na 200_aa | Knr4/Smi1-like domain-containing protein | |
| 2497 | DPCP01000033.1 | GCA003516445_01945 | CDS | open | 2111-2815 | _na 234_aa | ABM domain-containing protein | |
| 2498 | DPCP01000033.1 | GCA003516445_01946 | CDS | open | 2928-3599 | _na 223_aa | lolD | ABC transporter domain-containing protein |
| 2499 | DPCP01000033.1 | GCA003516445_01947 | CDS | open | 3609-4814 | _na 401_aa | lolE | ABC transporter permease |
| 2500 | DPCP01000033.1 | GCA003516445_01948 | CDS | open | 4818-5255 | _na 145_aa | DUF4418 domain-containing protein |

