BAKTAGenome Explorer: Fusobacterium polymorphum (GCA_003516445.1)
Select a Genome:
|
BAKTA Annotations for GCA_003516445.1
|
Search & Sort all 4708 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 4001 | DPCP01000056.1 | GCA003516445_01868 | CDS | open | 839-2257 | _na 472_aa | Resolvase | |
| 4002 | DPCP01000056.1 | GCA003516445_01869 | CDS | open | 2258-2434 | _na 58_aa | hypothetical protein | |
| 4003 | DPCP01000056.1 | GCA003516445_01870 | CDS | open | 2394-2681 | _na 95_aa | hypothetical protein | |
| 4004 | DPCP01000056.1 | GCA003516445_01871 | CDS | open | 2691-3083 | _na 130_aa | yopX | YopX protein domain-containing protein |
| 4005 | DPCP01000056.1 | GCA003516445_01872 | CDS | open | 3093-3668 | _na 191_aa | hypothetical protein | |
| 4006 | DPCP01000056.1 | GCA003516445_01873 | CDS | open | 3622-3723 | _na 33_aa | hypothetical protein | |
| 4007 | DPCP01000056.1 | GCA003516445_01874 | CDS | open | 3728-3931 | _na 67_aa | hypothetical protein | |
| 4008 | DPCP01000056.1 | GCA003516445_01875 | CDS | open | 4044-4220 | _na 58_aa | hypothetical protein | |
| 4009 | DPCP01000056.1 | GCA003516445_01876 | CDS | open | 4217-4843 | _na 208_aa | DUF3102 domain-containing protein | |
| 4010 | DPCP01000056.1 | GCA003516445_01877 | CDS | open | 4836-5543 | _na 235_aa | AAA domain-containing protein | |
| 4011 | DPCP01000056.1 | GCA003516445_01878 | CDS | open | 5553-5933 | _na 126_aa | Nuclease | |
| 4012 | DPCP01000056.1 | GCA003516445_01879 | CDS | open | 5945-6154 | _na 69_aa | Phage protein | |
| 4013 | DPCP01000056.1 | GCA003516445_01880 | CDS | open | 6166-7212 | _na 348_aa | Phage replisome organiser N-terminal domain-containing protein | |
| 4014 | DPCP01000056.1 | GCA003516445_01881 | CDS | open | 7223-7486 | _na 87_aa | hypothetical protein | |
| 4015 | DPCP01000056.1 | GCA003516445_01882 | CDS | open | 7499-7675 | _na 58_aa | hypothetical protein | |
| 4016 | DPCP01000056.1 | GCA003516445_01883 | CDS | open | 7685-7921 | _na 78_aa | J domain-containing protein | |
| 4017 | DPCP01000056.1 | GCA003516445_01884 | CDS | open | 7931-8140 | _na 69_aa | Phage protein | |
| 4018 | DPCP01000056.1 | GCA003516445_01885 | CDS | open | 8106-8228 | _na 40_aa | hypothetical protein | |
| 4019 | DPCP01000056.1 | GCA003516445_01886 | CDS | open | 8388-8663 | _na 91_aa | hypothetical protein | |
| 4020 | DPCP01000056.1 | GCA003516445_01887 | CDS | open | 8838-9053 | _na 71_aa | HTH cro/C1-type domain-containing protein | |
| 4021 | DPCP01000056.1 | GCA003516445_01888 | CDS | open | 9162-9896 | _na 244_aa | Lipoprotein | |
| 4022 | DPCP01000056.1 | GCA003516445_01889 | CDS | open | 9917-10360 | _na 147_aa | hypothetical protein | |
| 4023 | DPCP01000056.1 | GCA003516445_01890 | CDS | open | 10361-10642 | _na 93_aa | Transposase | |
| 4024 | DPCP01000056.1 | GCA003516445_01891 | CDS | open | 10768-11142 | _na 124_aa | hypothetical protein | |
| 4025 | DPCP01000056.1 | GCA003516445_01892 | CDS | open | 11142-11633 | _na 163_aa | hypothetical protein | |
| 4026 | DPCP01000056.1 | GCA003516445_01893 | CDS | open | 11705-12109 | _na 134_aa | DUF2513 domain-containing protein | |
| 4027 | DPCP01000056.1 | GCA003516445_01894 | CDS | open | 12080-12319 | _na 79_aa | PepSY domain-containing protein | |
| 4028 | DPCP01000056.1 | GCA003516445_01895 | CDS | open | 12464-12685 | _na 73_aa | hypothetical protein | |
| 4029 | DPCP01000056.1 | GCA003516445_01896 | CDS | open | 12909-13373 | _na 154_aa | HTH cro/C1-type domain-containing protein | |
| 4030 | DPCP01000056.1 | GCA003516445_01897 | CDS | open | 13496-13798 | _na 100_aa | Type II toxin-antitoxin system antitoxin%2C RelB/DinJ family | |
| 4031 | DPCP01000056.1 | GCA003516445_01898 | CDS | open | 13791-14051 | _na 86_aa | Txe/YoeB family addiction module toxin | |
| 4032 | DPCP01000056.1 | GCA003516445_01899 | CDS | open | 14212-14436 | _na 74_aa | hypothetical protein | |
| 4033 | DPCP01000056.1 | GCA003516445_01900 | CDS | open | 14415-14606 | _na 63_aa | YgiT-type zinc finger domain protein | |
| 4034 | DPCP01000056.1 | GCA003516445_01901 | CDS | open | 14608-15696 | _na 362_aa | apeA | ApeA N-terminal domain-containing protein |
| 4035 | DPCP01000056.1 | GCA003516445_01902 | CDS | open | 15874-17190 | _na 438_aa | Methyltransferase | |
| 4036 | DPCP01000056.1 | GCA003516445_01903 | CDS | open | 17187-17858 | _na 223_aa | Terminase | |
| 4037 | DPCP01000056.1 | GCA003516445_01904 | CDS | open | 17970-18443 | _na 157_aa | Terminase small subunit | |
| 4038 | DPCP01000056.1 | GCA003516445_01905 | CDS | open | 18406-20178 | _na 590_aa | Phage terminase large subunit family protein | |
| 4039 | DPCP01000056.1 | GCA003516445_01906 | CDS | open | 20178-20396 | _na 72_aa | head-tail adaptor | |
| 4040 | DPCP01000056.1 | GCA003516445_01907 | CDS | open | 20406-21941 | _na 511_aa | phage portal protein | |
| 4041 | DPCP01000056.1 | GCA003516445_01908 | CDS | open | 21941-23044 | _na 367_aa | ATP-dependent Clp protease proteolytic subunit | |
| 4042 | DPCP01000056.1 | GCA003516445_01909 | CDS | open | 23056-23373 | _na 105_aa | Head decoration protein | |
| 4043 | DPCP01000056.1 | GCA003516445_01910 | CDS | open | 23386-24393 | _na 335_aa | Major capsid protein E | |
| 4044 | DPCP01000056.1 | GCA003516445_01911 | CDS | open | 24445-24672 | _na 75_aa | hypothetical protein | |
| 4045 | DPCP01000056.1 | GCA003516445_01912 | CDS | open | 24672-24986 | _na 104_aa | yopX | YopX protein domain-containing protein |
| 4046 | DPCP01000056.1 | GCA003516445_01913 | CDS | open | 24986-25594 | _na 202_aa | Phage tail protein | |
| 4047 | DPCP01000056.1 | GCA003516445_01914 | CDS | open | 25591-26067 | _na 158_aa | Tail-completion protein | |
| 4048 | DPCP01000056.1 | GCA003516445_01915 | CDS | open | 26054-26422 | _na 122_aa | hypothetical protein | |
| 4049 | DPCP01000056.1 | GCA003516445_01916 | CDS | open | 26423-27823 | _na 466_aa | Phage tail protein | |
| 4050 | DPCP01000056.1 | GCA003516445_01917 | CDS | open | 27835-28368 | _na 177_aa | Phage major tail tube protein | |
| 4051 | DPCP01000056.1 | GCA003516445_01918 | CDS | open | 28379-28714 | _na 111_aa | Phage tail assembly protein | |
| 4052 | DPCP01000056.1 | GCA003516445_01919 | CDS | open | 28717-28830 | _na 37_aa | hypothetical protein | |
| 4053 | DPCP01000056.1 | GCA003516445_01920 | CDS | open | 28888-29118 | _na 76_aa | hypothetical protein | |
| 4054 | DPCP01000056.1 | GCA003516445_01921 | CDS | open | 29191-31938 | _na 915_aa | Tail tape measure protein | |
| 4055 | DPCP01000056.1 | GCA003516445_01922 | CDS | open | 31901-32137 | _na 78_aa | lysM | LysM domain-containing protein |
| 4056 | DPCP01000056.1 | GCA003516445_01923 | CDS | open | 32137-33222 | _na 361_aa | Late control protein D | |
| 4057 | DPCP01000056.1 | GCA003516445_01924 | CDS | open | 33219-33752 | _na 177_aa | Phage baseplate assembly protein V | |
| 4058 | DPCP01000056.1 | GCA003516445_01925 | CDS | open | 33752-34138 | _na 128_aa | Phage tail protein | |
| 4059 | DPCP01000056.1 | GCA003516445_01926 | CDS | open | 34138-34452 | _na 104_aa | baseplate wedge subunit | |
| 4060 | DPCP01000056.1 | GCA003516445_01927 | CDS | open | 34445-35545 | _na 366_aa | Baseplate protein J-like domain-containing protein | |
| 4061 | DPCP01000056.1 | GCA003516445_01928 | CDS | open | 35538-36173 | _na 211_aa | phage tail protein I | |
| 4062 | DPCP01000056.1 | GCA003516445_01867 | gene | open | 49-771 | |||
| 4063 | DPCP01000056.1 | GCA003516445_01868 | gene | open | 839-2257 | |||
| 4064 | DPCP01000056.1 | GCA003516445_01869 | gene | open | 2258-2434 | |||
| 4065 | DPCP01000056.1 | GCA003516445_01870 | gene | open | 2394-2681 | |||
| 4066 | DPCP01000056.1 | GCA003516445_01871 | gene | open | 2691-3083 | yopX | ||
| 4067 | DPCP01000056.1 | GCA003516445_01872 | gene | open | 3093-3668 | |||
| 4068 | DPCP01000056.1 | GCA003516445_01873 | gene | open | 3622-3723 | |||
| 4069 | DPCP01000056.1 | GCA003516445_01874 | gene | open | 3728-3931 | |||
| 4070 | DPCP01000056.1 | GCA003516445_01875 | gene | open | 4044-4220 | |||
| 4071 | DPCP01000056.1 | GCA003516445_01876 | gene | open | 4217-4843 | |||
| 4072 | DPCP01000056.1 | GCA003516445_01877 | gene | open | 4836-5543 | |||
| 4073 | DPCP01000056.1 | GCA003516445_01878 | gene | open | 5553-5933 | |||
| 4074 | DPCP01000056.1 | GCA003516445_01879 | gene | open | 5945-6154 | |||
| 4075 | DPCP01000056.1 | GCA003516445_01880 | gene | open | 6166-7212 | |||
| 4076 | DPCP01000056.1 | GCA003516445_01881 | gene | open | 7223-7486 | |||
| 4077 | DPCP01000056.1 | GCA003516445_01882 | gene | open | 7499-7675 | |||
| 4078 | DPCP01000056.1 | GCA003516445_01883 | gene | open | 7685-7921 | |||
| 4079 | DPCP01000056.1 | GCA003516445_01884 | gene | open | 7931-8140 | |||
| 4080 | DPCP01000056.1 | GCA003516445_01885 | gene | open | 8106-8228 | |||
| 4081 | DPCP01000056.1 | GCA003516445_01886 | gene | open | 8388-8663 | |||
| 4082 | DPCP01000056.1 | GCA003516445_01887 | gene | open | 8838-9053 | |||
| 4083 | DPCP01000056.1 | GCA003516445_01888 | gene | open | 9162-9896 | |||
| 4084 | DPCP01000056.1 | GCA003516445_01889 | gene | open | 9917-10360 | |||
| 4085 | DPCP01000056.1 | GCA003516445_01890 | gene | open | 10361-10642 | |||
| 4086 | DPCP01000056.1 | GCA003516445_01891 | gene | open | 10768-11142 | |||
| 4087 | DPCP01000056.1 | GCA003516445_01892 | gene | open | 11142-11633 | |||
| 4088 | DPCP01000056.1 | GCA003516445_01893 | gene | open | 11705-12109 | |||
| 4089 | DPCP01000056.1 | GCA003516445_01894 | gene | open | 12080-12319 | |||
| 4090 | DPCP01000056.1 | GCA003516445_01895 | gene | open | 12464-12685 | |||
| 4091 | DPCP01000056.1 | GCA003516445_01896 | gene | open | 12909-13373 | |||
| 4092 | DPCP01000056.1 | GCA003516445_01897 | gene | open | 13496-13798 | |||
| 4093 | DPCP01000056.1 | GCA003516445_01898 | gene | open | 13791-14051 | |||
| 4094 | DPCP01000056.1 | GCA003516445_01899 | gene | open | 14212-14436 | |||
| 4095 | DPCP01000056.1 | GCA003516445_01900 | gene | open | 14415-14606 | |||
| 4096 | DPCP01000056.1 | GCA003516445_01901 | gene | open | 14608-15696 | apeA | ||
| 4097 | DPCP01000056.1 | GCA003516445_01902 | gene | open | 15874-17190 | |||
| 4098 | DPCP01000056.1 | GCA003516445_01903 | gene | open | 17187-17858 | |||
| 4099 | DPCP01000056.1 | GCA003516445_01904 | gene | open | 17970-18443 | |||
| 4100 | DPCP01000056.1 | GCA003516445_01905 | gene | open | 18406-20178 | |||
| 4101 | DPCP01000056.1 | GCA003516445_01906 | gene | open | 20178-20396 | |||
| 4102 | DPCP01000056.1 | GCA003516445_01907 | gene | open | 20406-21941 | |||
| 4103 | DPCP01000056.1 | GCA003516445_01908 | gene | open | 21941-23044 | |||
| 4104 | DPCP01000056.1 | GCA003516445_01909 | gene | open | 23056-23373 | |||
| 4105 | DPCP01000056.1 | GCA003516445_01910 | gene | open | 23386-24393 | |||
| 4106 | DPCP01000056.1 | GCA003516445_01911 | gene | open | 24445-24672 | |||
| 4107 | DPCP01000056.1 | GCA003516445_01912 | gene | open | 24672-24986 | yopX | ||
| 4108 | DPCP01000056.1 | GCA003516445_01913 | gene | open | 24986-25594 | |||
| 4109 | DPCP01000056.1 | GCA003516445_01914 | gene | open | 25591-26067 | |||
| 4110 | DPCP01000056.1 | GCA003516445_01915 | gene | open | 26054-26422 | |||
| 4111 | DPCP01000056.1 | GCA003516445_01916 | gene | open | 26423-27823 | |||
| 4112 | DPCP01000056.1 | GCA003516445_01917 | gene | open | 27835-28368 | |||
| 4113 | DPCP01000056.1 | GCA003516445_01918 | gene | open | 28379-28714 | |||
| 4114 | DPCP01000056.1 | GCA003516445_01919 | gene | open | 28717-28830 | |||
| 4115 | DPCP01000056.1 | GCA003516445_01920 | gene | open | 28888-29118 | |||
| 4116 | DPCP01000056.1 | GCA003516445_01921 | gene | open | 29191-31938 | |||
| 4117 | DPCP01000056.1 | GCA003516445_01922 | gene | open | 31901-32137 | lysM | ||
| 4118 | DPCP01000056.1 | GCA003516445_01923 | gene | open | 32137-33222 | |||
| 4119 | DPCP01000056.1 | GCA003516445_01924 | gene | open | 33219-33752 | |||
| 4120 | DPCP01000056.1 | GCA003516445_01925 | gene | open | 33752-34138 | |||
| 4121 | DPCP01000056.1 | GCA003516445_01926 | gene | open | 34138-34452 | |||
| 4122 | DPCP01000056.1 | GCA003516445_01927 | gene | open | 34445-35545 | |||
| 4123 | DPCP01000056.1 | GCA003516445_01928 | gene | open | 35538-36173 | |||
| 4124 | DPCP01000057.1 | GCA003516445_00874 | gene | open | 7457-7800 | ssrA | ||
| 4125 | DPCP01000057.1 | GCA003516445_00874 | tmRNA | open | 7457-7800 | ssrA | transfer-messenger RNA%2C SsrA | |
| 4126 | DPCP01000057.1 | repeat_region | open | 60-1100 | CRISPR array with 14 repeats of length 35%2C consensus sequence ATAAGAGAGAATATAACTCCGATAGGAGACGGAAA and spacer length 41 | |||
| 4127 | DPCP01000057.1 | GCA003516445_00868 | CDS | open | 1767-2192 | _na 141_aa | Mannose-6-phosphate isomerase | |
| 4128 | DPCP01000057.1 | GCA003516445_00869 | CDS | open | 2353-2682 | _na 109_aa | Elongation factor Tu | |
| 4129 | DPCP01000057.1 | GCA003516445_00870 | CDS | open | 2702-4063 | _na 453_aa | putative ESS family glutamate:sodium (Na+) symporter | |
| 4130 | DPCP01000057.1 | GCA003516445_00871 | CDS | open | 4099-5283 | _na 394_aa | Peptidase M20 dimerisation domain-containing protein | |
| 4131 | DPCP01000057.1 | GCA003516445_00872 | CDS | open | 5464-6663 | _na 399_aa | Helix-turn-helix type 11 domain-containing protein | |
| 4132 | DPCP01000057.1 | GCA003516445_00873 | CDS | open | 6697-7323 | _na 208_aa | Lipoprotein | |
| 4133 | DPCP01000057.1 | GCA003516445_00875 | CDS | open | 7926-8666 | _na 246_aa | VWFA domain-containing protein | |
| 4134 | DPCP01000057.1 | GCA003516445_00868 | gene | open | 1767-2192 | |||
| 4135 | DPCP01000057.1 | GCA003516445_00869 | gene | open | 2353-2682 | |||
| 4136 | DPCP01000057.1 | GCA003516445_00870 | gene | open | 2702-4063 | |||
| 4137 | DPCP01000057.1 | GCA003516445_00871 | gene | open | 4099-5283 | |||
| 4138 | DPCP01000057.1 | GCA003516445_00872 | gene | open | 5464-6663 | |||
| 4139 | DPCP01000057.1 | GCA003516445_00873 | gene | open | 6697-7323 | |||
| 4140 | DPCP01000057.1 | GCA003516445_00875 | gene | open | 7926-8666 | |||
| 4141 | DPCP01000058.1 | regulatory_region | open | 10677-10763 | SAM riboswitch aptamer (S box leader) | |||
| 4142 | DPCP01000058.1 | regulatory_region | open | 65600-65780 | Cobalamin riboswitch aptamer | |||
| 4143 | DPCP01000058.1 | regulatory_region | open | 108514-108603 | Glycine riboswitch aptamer | |||
| 4144 | DPCP01000058.1 | regulatory_region | open | 108604-108685 | Glycine riboswitch aptamer | |||
| 4145 | DPCP01000058.1 | regulatory_region | open | 134189-134276 | SAM riboswitch aptamer (S box leader) | |||
| 4146 | DPCP01000058.1 | GCA003516445_00406 | CDS | open | 34-171 | _na 45_aa | hypothetical protein | |
| 4147 | DPCP01000058.1 | GCA003516445_00407 | CDS | open | 181-6735 | _na 2184_aa | Outer membrane protein | |
| 4148 | DPCP01000058.1 | GCA003516445_00408 | CDS | open | 6891-8402 | _na 503_aa | yfcC | YfcC family protein |
| 4149 | DPCP01000058.1 | GCA003516445_00409 | CDS | open | 8498-9784 | _na 428_aa | O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase | |
| 4150 | DPCP01000058.1 | GCA003516445_00410 | CDS | open | 9808-10587 | _na 259_aa | Methionine ABC transporter substrate-binding protein | |
| 4151 | DPCP01000058.1 | GCA003516445_00411 | CDS | open | 10823-12685 | _na 620_aa | zntA | Zinc-transporting ATPase |
| 4152 | DPCP01000058.1 | GCA003516445_00412 | CDS | open | 12691-12912 | _na 73_aa | Zinc-transporting ATPase | |
| 4153 | DPCP01000058.1 | GCA003516445_00413 | CDS | open | 12914-13294 | _na 126_aa | arsR | HTH arsR-type domain-containing protein |
| 4154 | DPCP01000058.1 | GCA003516445_00414 | CDS | open | 13484-15118 | _na 544_aa | AAA-ATPase-like domain-containing protein | |
| 4155 | DPCP01000058.1 | GCA003516445_00415 | CDS | open | 15137-15868 | _na 243_aa | pflA | pyruvate formate-lyase-activating protein |
| 4156 | DPCP01000058.1 | GCA003516445_00416 | CDS | open | 15929-18160 | _na 743_aa | pflB | formate C-acetyltransferase |
| 4157 | DPCP01000058.1 | GCA003516445_00417 | CDS | open | 18480-19163 | _na 227_aa | peptidylprolyl isomerase | |
| 4158 | DPCP01000058.1 | GCA003516445_00418 | CDS | open | 19268-19657 | _na 129_aa | fadA | Adhesion protein FadA |
| 4159 | DPCP01000058.1 | GCA003516445_00419 | CDS | open | 19810-20745 | _na 311_aa | ABC transporter permease | |
| 4160 | DPCP01000058.1 | GCA003516445_00420 | CDS | open | 20720-21955 | _na 411_aa | envC | Peptidase M23 domain-containing protein |
| 4161 | DPCP01000058.1 | GCA003516445_00421 | CDS | open | 21973-22776 | _na 267_aa | nadK | NAD kinase |
| 4162 | DPCP01000058.1 | GCA003516445_00422 | CDS | open | 22770-24431 | _na 553_aa | recN | DNA repair protein RecN |
| 4163 | DPCP01000058.1 | GCA003516445_00423 | CDS | open | 24421-25191 | _na 256_aa | Core-binding (CB) domain-containing protein | |
| 4164 | DPCP01000058.1 | GCA003516445_00424 | CDS | open | 25191-26084 | _na 297_aa | era | GTPase Era |
| 4165 | DPCP01000058.1 | GCA003516445_00425 | CDS | open | 26086-26364 | _na 92_aa | Schlafen AlbA-2 domain-containing protein | |
| 4166 | DPCP01000058.1 | GCA003516445_00426 | CDS | open | 26498-27502 | _na 334_aa | winged helix-turn-helix transcriptional regulator | |
| 4167 | DPCP01000058.1 | GCA003516445_00427 | CDS | open | 27530-28225 | _na 231_aa | Aspartate racemase | |
| 4168 | DPCP01000058.1 | GCA003516445_00428 | CDS | open | 28447-29106 | _na 219_aa | Glutamine ABC superfamily ATP binding cassette transporter%2C membrane protein | |
| 4169 | DPCP01000058.1 | GCA003516445_00429 | CDS | open | 29087-29767 | _na 226_aa | ABC transporter%2C permease protein | |
| 4170 | DPCP01000058.1 | GCA003516445_00430 | CDS | open | 29764-30519 | _na 251_aa | ABC transporter domain-containing protein | |
| 4171 | DPCP01000058.1 | GCA003516445_00431 | CDS | open | 30537-31415 | _na 292_aa | Amino acid ABC transporter substrate-binding protein | |
| 4172 | DPCP01000058.1 | GCA003516445_00432 | CDS | open | 31478-31963 | _na 161_aa | YARHG domain-containing protein | |
| 4173 | DPCP01000058.1 | GCA003516445_00433 | CDS | open | 32025-33011 | _na 328_aa | HTH deoR-type domain-containing protein | |
| 4174 | DPCP01000058.1 | GCA003516445_00434 | CDS | open | 33044-33421 | _na 125_aa | Pyridoxamine 5'-phosphate oxidase N-terminal domain-containing protein | |
| 4175 | DPCP01000058.1 | GCA003516445_00435 | CDS | open | 33500-34648 | _na 382_aa | cysteine-S-conjugate beta-lyase | |
| 4176 | DPCP01000058.1 | GCA003516445_00436 | CDS | open | 34703-36322 | _na 539_aa | nptA | PhoU domain-containing protein |
| 4177 | DPCP01000058.1 | GCA003516445_00437 | CDS | open | 36341-37213 | _na 290_aa | Phosphatidylglycerol lysyltransferase C-terminal domain-containing protein | |
| 4178 | DPCP01000058.1 | GCA003516445_00438 | CDS | open | 37226-38584 | _na 452_aa | pepV | dipeptidase PepV |
| 4179 | DPCP01000058.1 | GCA003516445_00439 | CDS | open | 38728-39495 | _na 255_aa | mlaA | VacJ family lipoprotein |
| 4180 | DPCP01000058.1 | GCA003516445_00440 | CDS | open | 39485-40768 | _na 427_aa | Serine/threonine protein kinase | |
| 4181 | DPCP01000058.1 | GCA003516445_00441 | CDS | open | 40780-45129 | _na 1449_aa | polC | PolC-type DNA polymerase III |
| 4182 | DPCP01000058.1 | GCA003516445_00442 | CDS | open | 45131-45694 | _na 187_aa | tRNA (Guanine-N1)-methyltransferase | |
| 4183 | DPCP01000058.1 | GCA003516445_00443 | CDS | open | 45704-46420 | _na 238_aa | trmD | tRNA (guanosine(37)-N1)-methyltransferase TrmD |
| 4184 | DPCP01000058.1 | GCA003516445_00444 | CDS | open | 46417-46932 | _na 171_aa | rimM | ribosome maturation factor RimM |
| 4185 | DPCP01000058.1 | GCA003516445_00445 | CDS | open | 46941-47198 | _na 85_aa | ylqC | RNA-binding protein KhpA |
| 4186 | DPCP01000058.1 | GCA003516445_00446 | CDS | open | 47198-47440 | _na 80_aa | DUF4911 domain-containing protein | |
| 4187 | DPCP01000058.1 | GCA003516445_00447 | CDS | open | 47449-48243 | _na 264_aa | rsmA | 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA |
| 4188 | DPCP01000058.1 | GCA003516445_00448 | CDS | open | 48253-48780 | _na 175_aa | hpt | hypoxanthine phosphoribosyltransferase |
| 4189 | DPCP01000058.1 | GCA003516445_00449 | CDS | open | 48941-50083 | _na 380_aa | DUF4271 domain-containing protein | |
| 4190 | DPCP01000058.1 | GCA003516445_00450 | CDS | open | 50598-51155 | _na 185_aa | DUF304 domain-containing protein | |
| 4191 | DPCP01000058.1 | GCA003516445_00451 | CDS | open | 51118-51339 | _na 73_aa | hypothetical protein | |
| 4192 | DPCP01000058.1 | GCA003516445_00452 | CDS | open | 51424-52218 | _na 264_aa | Cthe-2314-like HEPN domain-containing protein | |
| 4193 | DPCP01000058.1 | GCA003516445_00453 | CDS | open | 52285-52782 | _na 165_aa | PH domain-containing protein | |
| 4194 | DPCP01000058.1 | GCA003516445_00454 | CDS | open | 52871-53341 | _na 156_aa | DUF304 domain-containing protein | |
| 4195 | DPCP01000058.1 | GCA003516445_00455 | CDS | open | 53319-53543 | _na 74_aa | hypothetical protein | |
| 4196 | DPCP01000058.1 | GCA003516445_00456 | CDS | open | 53974-54504 | _na 176_aa | hypothetical protein | |
| 4197 | DPCP01000058.1 | GCA003516445_00457 | CDS | open | 54485-54976 | _na 163_aa | YcxB-like protein domain-containing protein | |
| 4198 | DPCP01000058.1 | GCA003516445_00458 | CDS | open | 54987-55163 | _na 58_aa | Exotoxin | |
| 4199 | DPCP01000058.1 | GCA003516445_00459 | CDS | open | 55619-56158 | _na 179_aa | Organic solvent tolerance protein | |
| 4200 | DPCP01000058.1 | GCA003516445_00460 | CDS | open | 56171-56731 | _na 186_aa | YcxB-like protein domain-containing protein | |
| 4201 | DPCP01000058.1 | GCA003516445_00461 | CDS | open | 56904-57716 | _na 270_aa | tktA1 | Transketolase N-terminal domain-containing protein |
| 4202 | DPCP01000058.1 | GCA003516445_00462 | CDS | open | 57741-58670 | _na 309_aa | tktA2 | Transketolase-like pyrimidine-binding domain-containing protein |
| 4203 | DPCP01000058.1 | GCA003516445_00463 | CDS | open | 58726-59493 | _na 255_aa | rraB | Cytoplasmic protein |
| 4204 | DPCP01000058.1 | GCA003516445_00464 | CDS | open | 59526-60398 | _na 290_aa | PF10020 family protein | |
| 4205 | DPCP01000058.1 | GCA003516445_00465 | CDS | open | 60424-61020 | _na 198_aa | Immunity protein 63 domain-containing protein | |
| 4206 | DPCP01000058.1 | GCA003516445_00466 | CDS | open | 61144-62367 | _na 407_aa | Replication-associated recombination protein A | |
| 4207 | DPCP01000058.1 | GCA003516445_00467 | CDS | open | 62379-63617 | _na 412_aa | hisS | histidine--tRNA ligase |
| 4208 | DPCP01000058.1 | GCA003516445_00468 | CDS | open | 63636-65414 | _na 592_aa | aspS | aspartate--tRNA ligase |
| 4209 | DPCP01000058.1 | GCA003516445_00469 | CDS | open | 66378-67595 | _na 405_aa | hypothetical protein | |
| 4210 | DPCP01000058.1 | GCA003516445_00470 | CDS | open | 67624-68601 | _na 325_aa | ABC transmembrane type-1 domain-containing protein | |
| 4211 | DPCP01000058.1 | GCA003516445_00471 | CDS | open | 68591-69451 | _na 286_aa | ABC transmembrane type-1 domain-containing protein | |
| 4212 | DPCP01000058.1 | GCA003516445_00472 | CDS | open | 69456-70286 | _na 276_aa | nikD | Nickel import system ATP-binding protein NikD |
| 4213 | DPCP01000058.1 | GCA003516445_00473 | CDS | open | 70316-70930 | _na 204_aa | Dipeptide ABC superfamily ATP binding cassette transporter%2C ABC protein | |
| 4214 | DPCP01000058.1 | GCA003516445_00474 | CDS | open | 70965-71999 | _na 344_aa | fepB | Fe/B12 periplasmic-binding domain-containing protein |
| 4215 | DPCP01000058.1 | GCA003516445_00475 | CDS | open | 72009-73055 | _na 348_aa | fepD | Iron ABC transporter permease |
| 4216 | DPCP01000058.1 | GCA003516445_00476 | CDS | open | 73058-73822 | _na 254_aa | ABC transporter ATP-binding protein | |
| 4217 | DPCP01000058.1 | GCA003516445_00477 | CDS | open | 73851-74681 | _na 276_aa | cfbC | Putative nitrogenase iron protein |
| 4218 | DPCP01000058.1 | GCA003516445_00478 | CDS | open | 74684-76339 | _na 551_aa | cfbD | Nitrogenase/oxidoreductase component 1 domain-containing protein |
| 4219 | DPCP01000058.1 | GCA003516445_00479 | CDS | open | 76362-77414 | _na 350_aa | fepB | Fe/B12 periplasmic-binding domain-containing protein |
| 4220 | DPCP01000058.1 | GCA003516445_00480 | CDS | open | 77430-78425 | _na 331_aa | fepD | Iron ABC transporter permease |
| 4221 | DPCP01000058.1 | GCA003516445_00481 | CDS | open | 78428-79213 | _na 261_aa | fepC | Iron(III) dicitrate transport ATP-binding protein fecE |
| 4222 | DPCP01000058.1 | GCA003516445_00482 | CDS | open | 79348-80406 | _na 352_aa | afuA | Iron(III)-binding protein |
| 4223 | DPCP01000058.1 | GCA003516445_00483 | CDS | open | 80425-82107 | _na 560_aa | Iron ABC transporter permease | |
| 4224 | DPCP01000058.1 | GCA003516445_00484 | CDS | open | 82122-83192 | _na 356_aa | malK | ABC transporter domain-containing protein |
| 4225 | DPCP01000058.1 | GCA003516445_00485 | CDS | open | 83452-85638 | _na 728_aa | nrdD | anaerobic ribonucleoside-triphosphate reductase |
| 4226 | DPCP01000058.1 | GCA003516445_00486 | CDS | open | 85648-86154 | _na 168_aa | nrdG | anaerobic ribonucleoside-triphosphate reductase activating protein |
| 4227 | DPCP01000058.1 | GCA003516445_00487 | CDS | open | 86177-86434 | _na 85_aa | hypothetical protein | |
| 4228 | DPCP01000058.1 | GCA003516445_00488 | CDS | open | 86455-86796 | _na 113_aa | hypothetical protein | |
| 4229 | DPCP01000058.1 | GCA003516445_00489 | CDS | open | 86840-87676 | _na 278_aa | DUF3800 domain-containing protein | |
| 4230 | DPCP01000058.1 | GCA003516445_00490 | CDS | open | 87824-89128 | _na 434_aa | rsmB | 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB |
| 4231 | DPCP01000058.1 | GCA003516445_00491 | CDS | open | 89122-89778 | _na 218_aa | trmR | tRNA 5-hydroxyuridine methyltransferase |
| 4232 | DPCP01000058.1 | GCA003516445_00492 | CDS | open | 89852-90697 | _na 281_aa | ydeE | HTH araC/xylS-type domain-containing protein |
| 4233 | DPCP01000058.1 | GCA003516445_00493 | CDS | open | 91094-91600 | _na 168_aa | Lipoprotein | |
| 4234 | DPCP01000058.1 | GCA003516445_00494 | CDS | open | 91678-92865 | _na 395_aa | trpB | tryptophan synthase subunit beta |
| 4235 | DPCP01000058.1 | GCA003516445_00495 | CDS | open | 93361-93717 | _na 118_aa | VOC domain-containing protein | |
| 4236 | DPCP01000058.1 | GCA003516445_00496 | CDS | open | 93781-94287 | _na 168_aa | citX | citrate lyase holo-[acyl-carrier protein] synthase |
| 4237 | DPCP01000058.1 | GCA003516445_00497 | CDS | open | 94303-95340 | _na 345_aa | citC | [citrate (pro-3S)-lyase] ligase |
| 4238 | DPCP01000058.1 | GCA003516445_00498 | CDS | open | 95350-96204 | _na 284_aa | HTH lysR-type domain-containing protein | |
| 4239 | DPCP01000058.1 | GCA003516445_00499 | CDS | open | 96238-96876 | _na 212_aa | Transposase | |
| 4240 | DPCP01000058.1 | GCA003516445_00500 | CDS | open | 97146-97325 | _na 59_aa | Citrate lyase acyl carrier protein | |
| 4241 | DPCP01000058.1 | GCA003516445_00501 | CDS | open | 97322-97426 | _na 34_aa | hypothetical protein | |
| 4242 | DPCP01000058.1 | GCA003516445_00502 | CDS | open | 97407-97883 | _na 158_aa | HpcH/HpaI aldolase/citrate lyase domain-containing protein | |
| 4243 | DPCP01000058.1 | GCA003516445_00503 | CDS | open | 98320-99168 | _na 282_aa | Citrate (Pro-3S)-lyase alpha chain family protein | |
| 4244 | DPCP01000058.1 | GCA003516445_00504 | CDS | open | 99156-99542 | _na 128_aa | putative transcriptional regulator | |
| 4245 | DPCP01000058.1 | GCA003516445_00505 | CDS | open | 99544-100551 | _na 335_aa | Luciferase-like domain-containing protein | |
| 4246 | DPCP01000058.1 | GCA003516445_00506 | CDS | open | 100563-101105 | _na 180_aa | rutF | Flavin reductase like domain-containing protein |
| 4247 | DPCP01000058.1 | GCA003516445_00507 | CDS | open | 101259-103082 | _na 607_aa | htpG | molecular chaperone HtpG |
| 4248 | DPCP01000058.1 | GCA003516445_00508 | CDS | open | 103238-104125 | _na 295_aa | fda | fructose bisphosphate aldolase |
| 4249 | DPCP01000058.1 | GCA003516445_00509 | CDS | open | 104276-104515 | _na 79_aa | hypothetical protein | |
| 4250 | DPCP01000058.1 | GCA003516445_00510 | CDS | open | 104517-105353 | _na 278_aa | Zeta toxin domain-containing protein | |
| 4251 | DPCP01000058.1 | GCA003516445_00513 | CDS | open | 105638-105988 | _na 116_aa | rplT | 50S ribosomal protein L20 |
| 4252 | DPCP01000058.1 | GCA003516445_00514 | CDS | open | 106013-106219 | _na 68_aa | rpmI | 50S ribosomal protein L35 |
| 4253 | DPCP01000058.1 | GCA003516445_00515 | CDS | open | 106297-106722 | _na 141_aa | infC | translation initiation factor IF-3 |
| 4254 | DPCP01000058.1 | GCA003516445_00516 | CDS | open | 107049-108398 | _na 449_aa | alsT | AGCS family alanine/glycine:sodium (Na+) symporter |
| 4255 | DPCP01000058.1 | GCA003516445_00517 | CDS | open | 108887-109321 | _na 144_aa | rplM | 50S ribosomal protein L13 |
| 4256 | DPCP01000058.1 | GCA003516445_00518 | CDS | open | 109337-109738 | _na 133_aa | Small ribosomal subunit protein uS9 | |
| 4257 | DPCP01000058.1 | GCA003516445_00519 | CDS | open | 109863-110825 | _na 320_aa | PF10020 family protein | |
| 4258 | DPCP01000058.1 | GCA003516445_00520 | CDS | open | 110860-111915 | _na 351_aa | corA | magnesium/cobalt transporter CorA |
| 4259 | DPCP01000058.1 | GCA003516445_00521 | CDS | open | 111932-112492 | _na 186_aa | glpP | Glycerol-3-phosphate responsive antiterminator |
| 4260 | DPCP01000058.1 | GCA003516445_00522 | CDS | open | 112503-113750 | _na 415_aa | tyrB | Aminotransferase |
| 4261 | DPCP01000058.1 | GCA003516445_00523 | CDS | open | 113840-114388 | _na 182_aa | ompF | Outer membrane protein OmpF |
| 4262 | DPCP01000058.1 | GCA003516445_00524 | CDS | open | 114431-115633 | _na 400_aa | L%2CD-TPase catalytic domain-containing protein | |
| 4263 | DPCP01000058.1 | GCA003516445_00525 | CDS | open | 115802-116122 | _na 106_aa | DUF2283 domain-containing protein | |
| 4264 | DPCP01000058.1 | GCA003516445_00526 | CDS | open | 116281-116736 | _na 151_aa | Histidine kinase | |
| 4265 | DPCP01000058.1 | GCA003516445_00527 | CDS | open | 116788-118098 | _na 436_aa | spoVV | Nucleoside transporter/FeoB GTPase Gate domain-containing protein |
| 4266 | DPCP01000058.1 | GCA003516445_00528 | CDS | open | 118198-119499 | _na 433_aa | Na+/H+ antiporter NhaC-like C-terminal domain-containing protein | |
| 4267 | DPCP01000058.1 | GCA003516445_00529 | CDS | open | 119536-120039 | _na 167_aa | ppiB | Peptidyl-prolyl cis-trans isomerase |
| 4268 | DPCP01000058.1 | GCA003516445_00530 | CDS | open | 120095-120754 | _na 219_aa | DUF1351 domain-containing protein | |
| 4269 | DPCP01000058.1 | GCA003516445_00531 | CDS | open | 120738-121877 | _na 379_aa | rlmL | Methyltransferase |
| 4270 | DPCP01000058.1 | GCA003516445_00532 | CDS | open | 121874-122965 | _na 363_aa | Permease | |
| 4271 | DPCP01000058.1 | GCA003516445_00533 | CDS | open | 122988-123380 | _na 130_aa | nusG | NusG domain-containing protein |
| 4272 | DPCP01000058.1 | GCA003516445_00534 | CDS | open | 123367-124269 | _na 300_aa | phosphatidylserine decarboxylase | |
| 4273 | DPCP01000058.1 | GCA003516445_00535 | CDS | open | 124331-125836 | _na 501_aa | pncB | nicotinate phosphoribosyltransferase |
| 4274 | DPCP01000058.1 | GCA003516445_00536 | CDS | open | 125964-126419 | _na 151_aa | D-aminoacyl-tRNA deacylase | |
| 4275 | DPCP01000058.1 | GCA003516445_00537 | CDS | open | 126514-126963 | _na 149_aa | Magnesium transporter | |
| 4276 | DPCP01000058.1 | GCA003516445_00538 | CDS | open | 126989-127435 | _na 148_aa | DUF2846 domain-containing protein | |
| 4277 | DPCP01000058.1 | GCA003516445_00539 | CDS | open | 127741-129120 | _na 459_aa | nhaC | Na+/H+ antiporter NhaC |
| 4278 | DPCP01000058.1 | GCA003516445_00541 | CDS | open | 129293-130168 | _na 291_aa | rhaT | EamA domain-containing protein |
| 4279 | DPCP01000058.1 | GCA003516445_00542 | CDS | open | 130230-130325 | _na 31_aa | hypothetical protein | |
| 4280 | DPCP01000058.1 | GCA003516445_00543 | CDS | open | 130418-131332 | _na 304_aa | branched-chain amino acid transaminase | |
| 4281 | DPCP01000058.1 | GCA003516445_00544 | CDS | open | 131530-131925 | _na 131_aa | General stress protein | |
| 4282 | DPCP01000058.1 | GCA003516445_00545 | CDS | open | 131951-132445 | _na 164_aa | General stress protein | |
| 4283 | DPCP01000058.1 | GCA003516445_00546 | CDS | open | 132474-132725 | _na 83_aa | Transglycosylase | |
| 4284 | DPCP01000058.1 | GCA003516445_00547 | CDS | open | 132959-134107 | _na 382_aa | metK | methionine adenosyltransferase |
| 4285 | DPCP01000058.1 | GCA003516445_00548 | CDS | open | 134430-135614 | _na 394_aa | tnpB | IS200/IS605 family element RNA-guided endonuclease TnpB |
| 4286 | DPCP01000058.1 | GCA003516445_00549 | CDS | open | 135745-136116 | _na 123_aa | gloA | Aldoketomutase |
| 4287 | DPCP01000058.1 | GCA003516445_00550 | CDS | open | 136136-136540 | _na 134_aa | atpC | ATP synthase F1 subunit epsilon |
| 4288 | DPCP01000058.1 | GCA003516445_00551 | CDS | open | 136550-137938 | _na 462_aa | atpD | F0F1 ATP synthase subunit beta |
| 4289 | DPCP01000058.1 | GCA003516445_00552 | CDS | open | 138210-139058 | _na 282_aa | atpG | ATP synthase F1 subunit gamma |
| 4290 | DPCP01000058.1 | GCA003516445_00553 | CDS | open | 139069-140571 | _na 500_aa | atpA | F0F1 ATP synthase subunit alpha |
| 4291 | DPCP01000058.1 | GCA003516445_00554 | CDS | open | 140596-141120 | _na 174_aa | atpH | ATP synthase F1 subunit delta |
| 4292 | DPCP01000058.1 | GCA003516445_00555 | CDS | open | 141117-141608 | _na 163_aa | atpF | F0F1 ATP synthase subunit B |
| 4293 | DPCP01000058.1 | GCA003516445_00556 | CDS | open | 141649-141918 | _na 89_aa | atpE | ATP synthase F0 subunit C |
| 4294 | DPCP01000058.1 | GCA003516445_00557 | CDS | open | 141976-142725 | _na 249_aa | atpB | F0F1 ATP synthase subunit A |
| 4295 | DPCP01000058.1 | GCA003516445_00558 | CDS | open | 142761-143135 | _na 124_aa | ATP synthase I | |
| 4296 | DPCP01000058.1 | GCA003516445_00559 | CDS | open | 143227-144585 | _na 452_aa | glmM | phosphoglucosamine mutase |
| 4297 | DPCP01000058.1 | GCA003516445_00560 | CDS | open | 144611-145129 | _na 172_aa | Heptaprenyl diphosphate synthase | |
| 4298 | DPCP01000058.1 | GCA003516445_00561 | CDS | open | 145162-145797 | _na 211_aa | Methyltransferase type 11 domain-containing protein | |
| 4299 | DPCP01000058.1 | GCA003516445_00562 | CDS | open | 145838-147271 | _na 477_aa | purB | adenylosuccinate lyase |
| 4300 | DPCP01000058.1 | GCA003516445_00563 | CDS | open | 147261-147695 | _na 144_aa | rimI | ribosomal protein S18-alanine N-acetyltransferase |
| 4301 | DPCP01000058.1 | GCA003516445_00406 | gene | open | 34-171 | |||
| 4302 | DPCP01000058.1 | GCA003516445_00407 | gene | open | 181-6735 | |||
| 4303 | DPCP01000058.1 | GCA003516445_00408 | gene | open | 6891-8402 | yfcC | ||
| 4304 | DPCP01000058.1 | GCA003516445_00409 | gene | open | 8498-9784 | |||
| 4305 | DPCP01000058.1 | GCA003516445_00410 | gene | open | 9808-10587 | |||
| 4306 | DPCP01000058.1 | GCA003516445_00411 | gene | open | 10823-12685 | zntA | ||
| 4307 | DPCP01000058.1 | GCA003516445_00412 | gene | open | 12691-12912 | |||
| 4308 | DPCP01000058.1 | GCA003516445_00413 | gene | open | 12914-13294 | arsR | ||
| 4309 | DPCP01000058.1 | GCA003516445_00414 | gene | open | 13484-15118 | |||
| 4310 | DPCP01000058.1 | GCA003516445_00415 | gene | open | 15137-15868 | pflA | ||
| 4311 | DPCP01000058.1 | GCA003516445_00416 | gene | open | 15929-18160 | pflB | ||
| 4312 | DPCP01000058.1 | GCA003516445_00417 | gene | open | 18480-19163 | |||
| 4313 | DPCP01000058.1 | GCA003516445_00418 | gene | open | 19268-19657 | fadA | ||
| 4314 | DPCP01000058.1 | GCA003516445_00419 | gene | open | 19810-20745 | |||
| 4315 | DPCP01000058.1 | GCA003516445_00420 | gene | open | 20720-21955 | envC | ||
| 4316 | DPCP01000058.1 | GCA003516445_00421 | gene | open | 21973-22776 | nadK | ||
| 4317 | DPCP01000058.1 | GCA003516445_00422 | gene | open | 22770-24431 | recN | ||
| 4318 | DPCP01000058.1 | GCA003516445_00423 | gene | open | 24421-25191 | |||
| 4319 | DPCP01000058.1 | GCA003516445_00424 | gene | open | 25191-26084 | era | ||
| 4320 | DPCP01000058.1 | GCA003516445_00425 | gene | open | 26086-26364 | |||
| 4321 | DPCP01000058.1 | GCA003516445_00426 | gene | open | 26498-27502 | |||
| 4322 | DPCP01000058.1 | GCA003516445_00427 | gene | open | 27530-28225 | |||
| 4323 | DPCP01000058.1 | GCA003516445_00428 | gene | open | 28447-29106 | |||
| 4324 | DPCP01000058.1 | GCA003516445_00429 | gene | open | 29087-29767 | |||
| 4325 | DPCP01000058.1 | GCA003516445_00430 | gene | open | 29764-30519 | |||
| 4326 | DPCP01000058.1 | GCA003516445_00431 | gene | open | 30537-31415 | |||
| 4327 | DPCP01000058.1 | GCA003516445_00432 | gene | open | 31478-31963 | |||
| 4328 | DPCP01000058.1 | GCA003516445_00433 | gene | open | 32025-33011 | |||
| 4329 | DPCP01000058.1 | GCA003516445_00434 | gene | open | 33044-33421 | |||
| 4330 | DPCP01000058.1 | GCA003516445_00435 | gene | open | 33500-34648 | |||
| 4331 | DPCP01000058.1 | GCA003516445_00436 | gene | open | 34703-36322 | nptA | ||
| 4332 | DPCP01000058.1 | GCA003516445_00437 | gene | open | 36341-37213 | |||
| 4333 | DPCP01000058.1 | GCA003516445_00438 | gene | open | 37226-38584 | pepV | ||
| 4334 | DPCP01000058.1 | GCA003516445_00439 | gene | open | 38728-39495 | mlaA | ||
| 4335 | DPCP01000058.1 | GCA003516445_00440 | gene | open | 39485-40768 | |||
| 4336 | DPCP01000058.1 | GCA003516445_00441 | gene | open | 40780-45129 | polC | ||
| 4337 | DPCP01000058.1 | GCA003516445_00442 | gene | open | 45131-45694 | |||
| 4338 | DPCP01000058.1 | GCA003516445_00443 | gene | open | 45704-46420 | trmD | ||
| 4339 | DPCP01000058.1 | GCA003516445_00444 | gene | open | 46417-46932 | rimM | ||
| 4340 | DPCP01000058.1 | GCA003516445_00445 | gene | open | 46941-47198 | ylqC | ||
| 4341 | DPCP01000058.1 | GCA003516445_00446 | gene | open | 47198-47440 | |||
| 4342 | DPCP01000058.1 | GCA003516445_00447 | gene | open | 47449-48243 | rsmA | ||
| 4343 | DPCP01000058.1 | GCA003516445_00448 | gene | open | 48253-48780 | hpt | ||
| 4344 | DPCP01000058.1 | GCA003516445_00449 | gene | open | 48941-50083 | |||
| 4345 | DPCP01000058.1 | GCA003516445_00450 | gene | open | 50598-51155 | |||
| 4346 | DPCP01000058.1 | GCA003516445_00451 | gene | open | 51118-51339 | |||
| 4347 | DPCP01000058.1 | GCA003516445_00452 | gene | open | 51424-52218 | |||
| 4348 | DPCP01000058.1 | GCA003516445_00453 | gene | open | 52285-52782 | |||
| 4349 | DPCP01000058.1 | GCA003516445_00454 | gene | open | 52871-53341 | |||
| 4350 | DPCP01000058.1 | GCA003516445_00455 | gene | open | 53319-53543 | |||
| 4351 | DPCP01000058.1 | GCA003516445_00456 | gene | open | 53974-54504 | |||
| 4352 | DPCP01000058.1 | GCA003516445_00457 | gene | open | 54485-54976 | |||
| 4353 | DPCP01000058.1 | GCA003516445_00458 | gene | open | 54987-55163 | |||
| 4354 | DPCP01000058.1 | GCA003516445_00459 | gene | open | 55619-56158 | |||
| 4355 | DPCP01000058.1 | GCA003516445_00460 | gene | open | 56171-56731 | |||
| 4356 | DPCP01000058.1 | GCA003516445_00461 | gene | open | 56904-57716 | tktA1 | ||
| 4357 | DPCP01000058.1 | GCA003516445_00462 | gene | open | 57741-58670 | tktA2 | ||
| 4358 | DPCP01000058.1 | GCA003516445_00463 | gene | open | 58726-59493 | rraB | ||
| 4359 | DPCP01000058.1 | GCA003516445_00464 | gene | open | 59526-60398 | |||
| 4360 | DPCP01000058.1 | GCA003516445_00465 | gene | open | 60424-61020 | |||
| 4361 | DPCP01000058.1 | GCA003516445_00466 | gene | open | 61144-62367 | |||
| 4362 | DPCP01000058.1 | GCA003516445_00467 | gene | open | 62379-63617 | hisS | ||
| 4363 | DPCP01000058.1 | GCA003516445_00468 | gene | open | 63636-65414 | aspS | ||
| 4364 | DPCP01000058.1 | GCA003516445_00469 | gene | open | 66378-67595 | |||
| 4365 | DPCP01000058.1 | GCA003516445_00470 | gene | open | 67624-68601 | |||
| 4366 | DPCP01000058.1 | GCA003516445_00471 | gene | open | 68591-69451 | |||
| 4367 | DPCP01000058.1 | GCA003516445_00472 | gene | open | 69456-70286 | nikD | ||
| 4368 | DPCP01000058.1 | GCA003516445_00473 | gene | open | 70316-70930 | |||
| 4369 | DPCP01000058.1 | GCA003516445_00474 | gene | open | 70965-71999 | fepB | ||
| 4370 | DPCP01000058.1 | GCA003516445_00475 | gene | open | 72009-73055 | fepD | ||
| 4371 | DPCP01000058.1 | GCA003516445_00476 | gene | open | 73058-73822 | |||
| 4372 | DPCP01000058.1 | GCA003516445_00477 | gene | open | 73851-74681 | cfbC | ||
| 4373 | DPCP01000058.1 | GCA003516445_00478 | gene | open | 74684-76339 | cfbD | ||
| 4374 | DPCP01000058.1 | GCA003516445_00479 | gene | open | 76362-77414 | fepB | ||
| 4375 | DPCP01000058.1 | GCA003516445_00480 | gene | open | 77430-78425 | fepD | ||
| 4376 | DPCP01000058.1 | GCA003516445_00481 | gene | open | 78428-79213 | fepC | ||
| 4377 | DPCP01000058.1 | GCA003516445_00482 | gene | open | 79348-80406 | afuA | ||
| 4378 | DPCP01000058.1 | GCA003516445_00483 | gene | open | 80425-82107 | |||
| 4379 | DPCP01000058.1 | GCA003516445_00484 | gene | open | 82122-83192 | malK | ||
| 4380 | DPCP01000058.1 | GCA003516445_00485 | gene | open | 83452-85638 | nrdD | ||
| 4381 | DPCP01000058.1 | GCA003516445_00486 | gene | open | 85648-86154 | nrdG | ||
| 4382 | DPCP01000058.1 | GCA003516445_00487 | gene | open | 86177-86434 | |||
| 4383 | DPCP01000058.1 | GCA003516445_00488 | gene | open | 86455-86796 | |||
| 4384 | DPCP01000058.1 | GCA003516445_00489 | gene | open | 86840-87676 | |||
| 4385 | DPCP01000058.1 | GCA003516445_00490 | gene | open | 87824-89128 | rsmB | ||
| 4386 | DPCP01000058.1 | GCA003516445_00491 | gene | open | 89122-89778 | trmR | ||
| 4387 | DPCP01000058.1 | GCA003516445_00492 | gene | open | 89852-90697 | ydeE | ||
| 4388 | DPCP01000058.1 | GCA003516445_00493 | gene | open | 91094-91600 | |||
| 4389 | DPCP01000058.1 | GCA003516445_00494 | gene | open | 91678-92865 | trpB | ||
| 4390 | DPCP01000058.1 | GCA003516445_00495 | gene | open | 93361-93717 | |||
| 4391 | DPCP01000058.1 | GCA003516445_00496 | gene | open | 93781-94287 | citX | ||
| 4392 | DPCP01000058.1 | GCA003516445_00497 | gene | open | 94303-95340 | citC | ||
| 4393 | DPCP01000058.1 | GCA003516445_00498 | gene | open | 95350-96204 | |||
| 4394 | DPCP01000058.1 | GCA003516445_00499 | gene | open | 96238-96876 | |||
| 4395 | DPCP01000058.1 | GCA003516445_00500 | gene | open | 97146-97325 | |||
| 4396 | DPCP01000058.1 | GCA003516445_00501 | gene | open | 97322-97426 | |||
| 4397 | DPCP01000058.1 | GCA003516445_00502 | gene | open | 97407-97883 | |||
| 4398 | DPCP01000058.1 | GCA003516445_00503 | gene | open | 98320-99168 | |||
| 4399 | DPCP01000058.1 | GCA003516445_00504 | gene | open | 99156-99542 | |||
| 4400 | DPCP01000058.1 | GCA003516445_00505 | gene | open | 99544-100551 | |||
| 4401 | DPCP01000058.1 | GCA003516445_00506 | gene | open | 100563-101105 | rutF | ||
| 4402 | DPCP01000058.1 | GCA003516445_00507 | gene | open | 101259-103082 | htpG | ||
| 4403 | DPCP01000058.1 | GCA003516445_00508 | gene | open | 103238-104125 | fda | ||
| 4404 | DPCP01000058.1 | GCA003516445_00509 | gene | open | 104276-104515 | |||
| 4405 | DPCP01000058.1 | GCA003516445_00510 | gene | open | 104517-105353 | |||
| 4406 | DPCP01000058.1 | GCA003516445_00513 | gene | open | 105638-105988 | rplT | ||
| 4407 | DPCP01000058.1 | GCA003516445_00514 | gene | open | 106013-106219 | rpmI | ||
| 4408 | DPCP01000058.1 | GCA003516445_00515 | gene | open | 106297-106722 | infC | ||
| 4409 | DPCP01000058.1 | GCA003516445_00516 | gene | open | 107049-108398 | alsT | ||
| 4410 | DPCP01000058.1 | GCA003516445_00517 | gene | open | 108887-109321 | rplM | ||
| 4411 | DPCP01000058.1 | GCA003516445_00518 | gene | open | 109337-109738 | |||
| 4412 | DPCP01000058.1 | GCA003516445_00519 | gene | open | 109863-110825 | |||
| 4413 | DPCP01000058.1 | GCA003516445_00520 | gene | open | 110860-111915 | corA | ||
| 4414 | DPCP01000058.1 | GCA003516445_00521 | gene | open | 111932-112492 | glpP | ||
| 4415 | DPCP01000058.1 | GCA003516445_00522 | gene | open | 112503-113750 | tyrB | ||
| 4416 | DPCP01000058.1 | GCA003516445_00523 | gene | open | 113840-114388 | ompF | ||
| 4417 | DPCP01000058.1 | GCA003516445_00524 | gene | open | 114431-115633 | |||
| 4418 | DPCP01000058.1 | GCA003516445_00525 | gene | open | 115802-116122 | |||
| 4419 | DPCP01000058.1 | GCA003516445_00526 | gene | open | 116281-116736 | |||
| 4420 | DPCP01000058.1 | GCA003516445_00527 | gene | open | 116788-118098 | spoVV | ||
| 4421 | DPCP01000058.1 | GCA003516445_00528 | gene | open | 118198-119499 | |||
| 4422 | DPCP01000058.1 | GCA003516445_00529 | gene | open | 119536-120039 | ppiB | ||
| 4423 | DPCP01000058.1 | GCA003516445_00530 | gene | open | 120095-120754 | |||
| 4424 | DPCP01000058.1 | GCA003516445_00531 | gene | open | 120738-121877 | rlmL | ||
| 4425 | DPCP01000058.1 | GCA003516445_00532 | gene | open | 121874-122965 | |||
| 4426 | DPCP01000058.1 | GCA003516445_00533 | gene | open | 122988-123380 | nusG | ||
| 4427 | DPCP01000058.1 | GCA003516445_00534 | gene | open | 123367-124269 | |||
| 4428 | DPCP01000058.1 | GCA003516445_00535 | gene | open | 124331-125836 | pncB | ||
| 4429 | DPCP01000058.1 | GCA003516445_00536 | gene | open | 125964-126419 | |||
| 4430 | DPCP01000058.1 | GCA003516445_00537 | gene | open | 126514-126963 | |||
| 4431 | DPCP01000058.1 | GCA003516445_00538 | gene | open | 126989-127435 | |||
| 4432 | DPCP01000058.1 | GCA003516445_00539 | gene | open | 127741-129120 | nhaC | ||
| 4433 | DPCP01000058.1 | GCA003516445_00541 | gene | open | 129293-130168 | rhaT | ||
| 4434 | DPCP01000058.1 | GCA003516445_00542 | gene | open | 130230-130325 | |||
| 4435 | DPCP01000058.1 | GCA003516445_00543 | gene | open | 130418-131332 | |||
| 4436 | DPCP01000058.1 | GCA003516445_00544 | gene | open | 131530-131925 | |||
| 4437 | DPCP01000058.1 | GCA003516445_00545 | gene | open | 131951-132445 | |||
| 4438 | DPCP01000058.1 | GCA003516445_00546 | gene | open | 132474-132725 | |||
| 4439 | DPCP01000058.1 | GCA003516445_00547 | gene | open | 132959-134107 | metK | ||
| 4440 | DPCP01000058.1 | GCA003516445_00548 | gene | open | 134430-135614 | tnpB | ||
| 4441 | DPCP01000058.1 | GCA003516445_00549 | gene | open | 135745-136116 | gloA | ||
| 4442 | DPCP01000058.1 | GCA003516445_00550 | gene | open | 136136-136540 | atpC | ||
| 4443 | DPCP01000058.1 | GCA003516445_00551 | gene | open | 136550-137938 | atpD | ||
| 4444 | DPCP01000058.1 | GCA003516445_00552 | gene | open | 138210-139058 | atpG | ||
| 4445 | DPCP01000058.1 | GCA003516445_00553 | gene | open | 139069-140571 | atpA | ||
| 4446 | DPCP01000058.1 | GCA003516445_00554 | gene | open | 140596-141120 | atpH | ||
| 4447 | DPCP01000058.1 | GCA003516445_00555 | gene | open | 141117-141608 | atpF | ||
| 4448 | DPCP01000058.1 | GCA003516445_00556 | gene | open | 141649-141918 | atpE | ||
| 4449 | DPCP01000058.1 | GCA003516445_00557 | gene | open | 141976-142725 | atpB | ||
| 4450 | DPCP01000058.1 | GCA003516445_00558 | gene | open | 142761-143135 | |||
| 4451 | DPCP01000058.1 | GCA003516445_00559 | gene | open | 143227-144585 | glmM | ||
| 4452 | DPCP01000058.1 | GCA003516445_00560 | gene | open | 144611-145129 | |||
| 4453 | DPCP01000058.1 | GCA003516445_00561 | gene | open | 145162-145797 | |||
| 4454 | DPCP01000058.1 | GCA003516445_00562 | gene | open | 145838-147271 | purB | ||
| 4455 | DPCP01000058.1 | GCA003516445_00563 | gene | open | 147261-147695 | rimI | ||
| 4456 | DPCP01000058.1 | GCA003516445_00511 | gene | open | 105395-105483 | trnS | ||
| 4457 | DPCP01000058.1 | GCA003516445_00512 | gene | open | 105506-105589 | trnS | ||
| 4458 | DPCP01000058.1 | GCA003516445_00540 | gene | open | 129125-129201 | trnR | ||
| 4459 | DPCP01000058.1 | GCA003516445_00511 | tRNA | open | 105395-105483 | trnS | tRNA-Ser(gct) | |
| 4460 | DPCP01000058.1 | GCA003516445_00512 | tRNA | open | 105506-105589 | trnS | tRNA-Ser(tga) | |
| 4461 | DPCP01000058.1 | GCA003516445_00540 | tRNA | open | 129125-129201 | trnR | tRNA-Arg(cct) | |
| 4462 | DPCP01000059.1 | GCA003516445_01147 | CDS | open | 63-431 | _na 122_aa | S-ribosylhomocysteine lyase | |
| 4463 | DPCP01000059.1 | GCA003516445_01148 | CDS | open | 632-2434 | _na 600_aa | pepF | oligoendopeptidase F |
| 4464 | DPCP01000059.1 | GCA003516445_01149 | CDS | open | 2547-3317 | _na 256_aa | spoU | rRNA methyltransferase |
| 4465 | DPCP01000059.1 | GCA003516445_01150 | CDS | open | 3319-3837 | _na 172_aa | yjhB | Nudix hydrolase domain-containing protein |
| 4466 | DPCP01000059.1 | GCA003516445_01151 | CDS | open | 4096-5751 | _na 551_aa | sppA | Signal peptide peptidase SppA%2C 36K type |
| 4467 | DPCP01000059.1 | GCA003516445_01152 | CDS | open | 5771-6592 | _na 273_aa | DUF4846 domain-containing protein | |
| 4468 | DPCP01000059.1 | GCA003516445_01153 | CDS | open | 6607-6963 | _na 118_aa | crcB | fluoride efflux transporter CrcB |
| 4469 | DPCP01000059.1 | GCA003516445_01154 | CDS | open | 7070-9064 | _na 664_aa | aroB | 3-dehydroquinate synthase |
| 4470 | DPCP01000059.1 | GCA003516445_01155 | CDS | open | 9061-9924 | _na 287_aa | Rhodanese domain-containing protein | |
| 4471 | DPCP01000059.1 | GCA003516445_01156 | CDS | open | 9935-10729 | _na 264_aa | cof | Cof-like hydrolase |
| 4472 | DPCP01000059.1 | GCA003516445_01157 | CDS | open | 10786-11619 | _na 277_aa | ttcA | tRNA(Ile)-lysidine/2-thiocytidine synthase N-terminal domain-containing protein |
| 4473 | DPCP01000059.1 | GCA003516445_01158 | CDS | open | 11628-11777 | _na 49_aa | Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix domain protein | |
| 4474 | DPCP01000059.1 | GCA003516445_01159 | CDS | open | 11788-14286 | _na 832_aa | fAA1 | Long-chain-fatty-acid--CoA ligase |
| 4475 | DPCP01000059.1 | GCA003516445_01160 | CDS | open | 14311-14997 | _na 228_aa | ybhL | BAX inhibitor (BI)-1/YccA family protein |
| 4476 | DPCP01000059.1 | GCA003516445_01161 | CDS | open | 15016-15798 | _na 260_aa | Outer membrane protein | |
| 4477 | DPCP01000059.1 | GCA003516445_01162 | CDS | open | 15967-17487 | _na 506_aa | malQ | 4-alpha-glucanotransferase |
| 4478 | DPCP01000059.1 | GCA003516445_01163 | CDS | open | 17477-19846 | _na 789_aa | glgP | Alpha-1%2C4 glucan phosphorylase |
| 4479 | DPCP01000059.1 | GCA003516445_01164 | CDS | open | 19882-21708 | _na 608_aa | glgB | 1%2C4-alpha-glucan branching protein GlgB |
| 4480 | DPCP01000059.1 | GCA003516445_01165 | CDS | open | 21741-22874 | _na 377_aa | glgC | glucose-1-phosphate adenylyltransferase |
| 4481 | DPCP01000059.1 | GCA003516445_01166 | CDS | open | 22896-24059 | _na 387_aa | glgD | glucose-1-phosphate adenylyltransferase subunit GlgD |
| 4482 | DPCP01000059.1 | GCA003516445_01167 | CDS | open | 24076-25461 | _na 461_aa | glgA | Glycogen synthase |
| 4483 | DPCP01000059.1 | GCA003516445_01168 | CDS | open | 25512-26111 | _na 199_aa | Alpha/beta hydrolase | |
| 4484 | DPCP01000059.1 | GCA003516445_01169 | CDS | open | 26132-26800 | _na 222_aa | bioC | malonyl-ACP O-methyltransferase BioC |
| 4485 | DPCP01000059.1 | GCA003516445_01170 | CDS | open | 26817-27407 | _na 196_aa | DUF452 domain-containing protein | |
| 4486 | DPCP01000059.1 | GCA003516445_01171 | CDS | open | 27408-28541 | _na 377_aa | bioF | Aminotransferase class I/classII large domain-containing protein |
| 4487 | DPCP01000059.1 | GCA003516445_01172 | CDS | open | 28495-28584 | _na 29_aa | hypothetical protein | |
| 4488 | DPCP01000059.1 | GCA003516445_01173 | CDS | open | 28637-29251 | _na 204_aa | DUF4125 domain-containing protein | |
| 4489 | DPCP01000059.1 | GCA003516445_01174 | CDS | open | 29489-31306 | _na 605_aa | DUF4037 domain-containing protein | |
| 4490 | DPCP01000059.1 | GCA003516445_01175 | CDS | open | 31325-32389 | _na 354_aa | eamA | EamA domain-containing protein |
| 4491 | DPCP01000059.1 | GCA003516445_01176 | CDS | open | 32437-33390 | _na 317_aa | MORN repeat protein | |
| 4492 | DPCP01000059.1 | GCA003516445_01177 | CDS | open | 33470-34639 | _na 389_aa | Transporter | |
| 4493 | DPCP01000059.1 | GCA003516445_01178 | CDS | open | 35015-35233 | _na 72_aa | MORN repeat variant | |
| 4494 | DPCP01000059.1 | GCA003516445_01179 | CDS | open | 35319-35519 | _na 66_aa | Hemolysin | |
| 4495 | DPCP01000059.1 | GCA003516445_01180 | CDS | open | 35494-35883 | _na 129_aa | DUF2335 domain-containing protein | |
| 4496 | DPCP01000059.1 | GCA003516445_01181 | CDS | open | 36059-36844 | _na 261_aa | hypothetical protein | |
| 4497 | DPCP01000059.1 | GCA003516445_01182 | CDS | open | 37105-38091 | _na 328_aa | xerD | Integrase |
| 4498 | DPCP01000059.1 | GCA003516445_01183 | CDS | open | 38104-38352 | _na 82_aa | TRASH domain-containing protein | |
| 4499 | DPCP01000059.1 | GCA003516445_01184 | CDS | open | 38354-39664 | _na 436_aa | parB | Chromosome partitioning protein ParB |
| 4500 | DPCP01000059.1 | GCA003516445_01185 | CDS | open | 39677-39973 | _na 98_aa | Stress-response A/B barrel domain-containing protein |

