BAKTAGenome Explorer: Campylobacter rectus (GCA_003859865.1)
Select a Genome:
|
BAKTA Annotations for GCA_003859865.1
|
Search & Sort all 4566 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 2501 | RQYP01000012.1 | GCA003859865_00407 | CDS | open | 40923-41705 | _na 260_aa | surE | 5'/3'-nucleotidase SurE |
| 2502 | RQYP01000012.1 | GCA003859865_00408 | CDS | open | 42033-42545 | _na 170_aa | nrfH | cytochrome c nitrite reductase small subunit |
| 2503 | RQYP01000012.1 | GCA003859865_00409 | CDS | open | 42568-44277 | _na 569_aa | nitrite reductase (cytochrome%3B ammonia-forming) | |
| 2504 | RQYP01000012.1 | GCA003859865_00410 | CDS | open | 44432-44878 | _na 148_aa | DUF1311 domain-containing protein | |
| 2505 | RQYP01000012.1 | GCA003859865_00411 | CDS | open | 44875-45909 | _na 344_aa | lpxB | lipid-A-disaccharide synthase |
| 2506 | RQYP01000012.1 | GCA003859865_00412 | CDS | open | 45913-46401 | _na 162_aa | greA | transcription elongation factor GreA |
| 2507 | RQYP01000012.1 | GCA003859865_00413 | CDS | open | 46401-46910 | _na 169_aa | hypothetical protein | |
| 2508 | RQYP01000012.1 | GCA003859865_00414 | CDS | open | 46910-47650 | _na 246_aa | UDP-2%2C3-diacylglucosamine hydrolase | |
| 2509 | RQYP01000012.1 | GCA003859865_00415 | CDS | open | 47652-48593 | _na 313_aa | cheV | Chemotaxis protein CheV |
| 2510 | RQYP01000012.1 | GCA003859865_00416 | CDS | open | 48604-50964 | _na 786_aa | histidine kinase | |
| 2511 | RQYP01000012.1 | GCA003859865_00417 | CDS | open | 50968-51465 | _na 165_aa | cheW | Purine-binding chemotaxis protein CheW |
| 2512 | RQYP01000012.1 | GCA003859865_00418 | CDS | open | 51474-52097 | _na 207_aa | serB | phosphoserine phosphatase SerB |
| 2513 | RQYP01000012.1 | GCA003859865_00419 | CDS | open | 52110-53105 | _na 331_aa | transaldolase | |
| 2514 | RQYP01000012.1 | GCA003859865_00420 | CDS | open | 53118-55484 | _na 788_aa | Type II/IV secretion system protein%2C PilT/PilU family | |
| 2515 | RQYP01000012.1 | GCA003859865_00421 | CDS | open | 55543-56079 | _na 178_aa | 50S ribosomal protein L25/general stress protein Ctc | |
| 2516 | RQYP01000012.1 | GCA003859865_00422 | CDS | open | 56088-56648 | _na 186_aa | pth | aminoacyl-tRNA hydrolase |
| 2517 | RQYP01000012.1 | GCA003859865_00423 | CDS | open | 56660-57502 | _na 280_aa | hypothetical protein | |
| 2518 | RQYP01000012.1 | GCA003859865_00424 | CDS | open | 57499-58560 | _na 353_aa | Methionyl-tRNA formyltransferase | |
| 2519 | RQYP01000012.1 | GCA003859865_00425 | CDS | open | 58616-59857 | _na 413_aa | lysA | diaminopimelate decarboxylase |
| 2520 | RQYP01000012.1 | GCA003859865_00426 | CDS | open | 59867-60943 | _na 358_aa | pheA | prephenate dehydratase |
| 2521 | RQYP01000012.1 | GCA003859865_00427 | CDS | open | 60945-62045 | _na 366_aa | hisC | histidinol-phosphate transaminase |
| 2522 | RQYP01000012.1 | GCA003859865_00428 | CDS | open | 62046-63740 | _na 564_aa | fliF | flagellar basal-body MS-ring/collar protein FliF |
| 2523 | RQYP01000012.1 | GCA003859865_00429 | CDS | open | 63740-64771 | _na 343_aa | fliG | flagellar motor switch protein FliG |
| 2524 | RQYP01000012.1 | GCA003859865_00430 | CDS | open | 64768-65580 | _na 270_aa | fliH | flagellar assembly protein FliH |
| 2525 | RQYP01000012.1 | GCA003859865_00431 | CDS | open | 65580-67424 | _na 614_aa | dxs | 1-deoxy-D-xylulose-5-phosphate synthase |
| 2526 | RQYP01000012.1 | GCA003859865_00432 | CDS | open | 68309-68719 | _na 136_aa | perR | Peroxide stress transcriptional regulator PerR |
| 2527 | RQYP01000012.1 | GCA003859865_00433 | CDS | open | 70868-71326 | _na 152_aa | DUF6847 domain-containing protein | |
| 2528 | RQYP01000012.1 | GCA003859865_00434 | CDS | open | 71345-72025 | _na 226_aa | Putative lipoprotein | |
| 2529 | RQYP01000012.1 | GCA003859865_00435 | CDS | open | 72015-72761 | _na 248_aa | Lipoprotein | |
| 2530 | RQYP01000012.1 | GCA003859865_00436 | CDS | open | 72771-73436 | _na 221_aa | csgG | Curli production assembly/transport component CsgG |
| 2531 | RQYP01000012.1 | GCA003859865_00437 | CDS | open | 73543-73839 | _na 98_aa | hypothetical protein | |
| 2532 | RQYP01000012.1 | GCA003859865_00438 | CDS | open | 74165-74413 | _na 82_aa | ISXO2-like transposase domain-containing protein | |
| 2533 | RQYP01000012.1 | GCA003859865_00365 | gene | open | 3640-4977 | purF | ||
| 2534 | RQYP01000012.1 | GCA003859865_00366 | gene | open | 5415-6182 | dapB | ||
| 2535 | RQYP01000012.1 | GCA003859865_00367 | gene | open | 6976-7527 | |||
| 2536 | RQYP01000012.1 | GCA003859865_00368 | gene | open | 7502-7666 | |||
| 2537 | RQYP01000012.1 | GCA003859865_00369 | gene | open | 8152-8562 | |||
| 2538 | RQYP01000012.1 | GCA003859865_00370 | gene | open | 8611-9042 | |||
| 2539 | RQYP01000012.1 | GCA003859865_00371 | gene | open | 9343-10281 | |||
| 2540 | RQYP01000012.1 | GCA003859865_00372 | gene | open | 10292-10741 | |||
| 2541 | RQYP01000012.1 | GCA003859865_00373 | gene | open | 10741-11055 | trxA | ||
| 2542 | RQYP01000012.1 | GCA003859865_00374 | gene | open | 11126-11464 | yraN | ||
| 2543 | RQYP01000012.1 | GCA003859865_00375 | gene | open | 11728-11958 | |||
| 2544 | RQYP01000012.1 | GCA003859865_00376 | gene | open | 12036-13298 | |||
| 2545 | RQYP01000012.1 | GCA003859865_00377 | gene | open | 13295-14503 | |||
| 2546 | RQYP01000012.1 | GCA003859865_00378 | gene | open | 14514-15311 | |||
| 2547 | RQYP01000012.1 | GCA003859865_00379 | gene | open | 15305-16318 | |||
| 2548 | RQYP01000012.1 | GCA003859865_00380 | gene | open | 16311-16991 | rlmB | ||
| 2549 | RQYP01000012.1 | GCA003859865_00381 | gene | open | 17073-17885 | rsmI | ||
| 2550 | RQYP01000012.1 | GCA003859865_00382 | gene | open | 17890-18090 | rpmE | ||
| 2551 | RQYP01000012.1 | GCA003859865_00383 | gene | open | 18173-18829 | |||
| 2552 | RQYP01000012.1 | GCA003859865_00384 | gene | open | 18826-19239 | |||
| 2553 | RQYP01000012.1 | GCA003859865_00385 | gene | open | 19236-19418 | |||
| 2554 | RQYP01000012.1 | GCA003859865_00386 | gene | open | 19424-20005 | |||
| 2555 | RQYP01000012.1 | GCA003859865_00387 | gene | open | 20391-21155 | |||
| 2556 | RQYP01000012.1 | GCA003859865_00388 | gene | open | 21832-22800 | moaA | ||
| 2557 | RQYP01000012.1 | GCA003859865_00389 | gene | open | 22942-23454 | |||
| 2558 | RQYP01000012.1 | GCA003859865_00390 | gene | open | 23447-23965 | |||
| 2559 | RQYP01000012.1 | GCA003859865_00391 | gene | open | 23962-24828 | mqnP | ||
| 2560 | RQYP01000012.1 | GCA003859865_00392 | gene | open | 24919-25809 | miaA | ||
| 2561 | RQYP01000012.1 | GCA003859865_00393 | gene | open | 26330-27427 | queH | ||
| 2562 | RQYP01000012.1 | GCA003859865_00394 | gene | open | 27964-28410 | fabZ | ||
| 2563 | RQYP01000012.1 | GCA003859865_00395 | gene | open | 28419-29207 | lpxA | ||
| 2564 | RQYP01000012.1 | GCA003859865_00396 | gene | open | 29207-30439 | clpX | ||
| 2565 | RQYP01000012.1 | GCA003859865_00397 | gene | open | 30448-31485 | mreB | ||
| 2566 | RQYP01000012.1 | GCA003859865_00398 | gene | open | 31475-32230 | mreC | ||
| 2567 | RQYP01000012.1 | GCA003859865_00399 | gene | open | 32230-35523 | carB | ||
| 2568 | RQYP01000012.1 | GCA003859865_00400 | gene | open | 35757-36923 | |||
| 2569 | RQYP01000012.1 | GCA003859865_00401 | gene | open | 36901-37269 | |||
| 2570 | RQYP01000012.1 | GCA003859865_00402 | gene | open | 37281-38084 | |||
| 2571 | RQYP01000012.1 | GCA003859865_00403 | gene | open | 38167-38640 | |||
| 2572 | RQYP01000012.1 | GCA003859865_00404 | gene | open | 38807-39766 | |||
| 2573 | RQYP01000012.1 | GCA003859865_00405 | gene | open | 39816-40238 | |||
| 2574 | RQYP01000012.1 | GCA003859865_00406 | gene | open | 40255-40926 | |||
| 2575 | RQYP01000012.1 | GCA003859865_00407 | gene | open | 40923-41705 | surE | ||
| 2576 | RQYP01000012.1 | GCA003859865_00408 | gene | open | 42033-42545 | nrfH | ||
| 2577 | RQYP01000012.1 | GCA003859865_00409 | gene | open | 42568-44277 | |||
| 2578 | RQYP01000012.1 | GCA003859865_00410 | gene | open | 44432-44878 | |||
| 2579 | RQYP01000012.1 | GCA003859865_00411 | gene | open | 44875-45909 | lpxB | ||
| 2580 | RQYP01000012.1 | GCA003859865_00412 | gene | open | 45913-46401 | greA | ||
| 2581 | RQYP01000012.1 | GCA003859865_00413 | gene | open | 46401-46910 | |||
| 2582 | RQYP01000012.1 | GCA003859865_00414 | gene | open | 46910-47650 | |||
| 2583 | RQYP01000012.1 | GCA003859865_00415 | gene | open | 47652-48593 | cheV | ||
| 2584 | RQYP01000012.1 | GCA003859865_00416 | gene | open | 48604-50964 | |||
| 2585 | RQYP01000012.1 | GCA003859865_00417 | gene | open | 50968-51465 | cheW | ||
| 2586 | RQYP01000012.1 | GCA003859865_00418 | gene | open | 51474-52097 | serB | ||
| 2587 | RQYP01000012.1 | GCA003859865_00419 | gene | open | 52110-53105 | |||
| 2588 | RQYP01000012.1 | GCA003859865_00420 | gene | open | 53118-55484 | |||
| 2589 | RQYP01000012.1 | GCA003859865_00421 | gene | open | 55543-56079 | |||
| 2590 | RQYP01000012.1 | GCA003859865_00422 | gene | open | 56088-56648 | pth | ||
| 2591 | RQYP01000012.1 | GCA003859865_00423 | gene | open | 56660-57502 | |||
| 2592 | RQYP01000012.1 | GCA003859865_00424 | gene | open | 57499-58560 | |||
| 2593 | RQYP01000012.1 | GCA003859865_00425 | gene | open | 58616-59857 | lysA | ||
| 2594 | RQYP01000012.1 | GCA003859865_00426 | gene | open | 59867-60943 | pheA | ||
| 2595 | RQYP01000012.1 | GCA003859865_00427 | gene | open | 60945-62045 | hisC | ||
| 2596 | RQYP01000012.1 | GCA003859865_00428 | gene | open | 62046-63740 | fliF | ||
| 2597 | RQYP01000012.1 | GCA003859865_00429 | gene | open | 63740-64771 | fliG | ||
| 2598 | RQYP01000012.1 | GCA003859865_00430 | gene | open | 64768-65580 | fliH | ||
| 2599 | RQYP01000012.1 | GCA003859865_00431 | gene | open | 65580-67424 | dxs | ||
| 2600 | RQYP01000012.1 | GCA003859865_00432 | gene | open | 68309-68719 | perR | ||
| 2601 | RQYP01000012.1 | GCA003859865_00433 | gene | open | 70868-71326 | |||
| 2602 | RQYP01000012.1 | GCA003859865_00434 | gene | open | 71345-72025 | |||
| 2603 | RQYP01000012.1 | GCA003859865_00435 | gene | open | 72015-72761 | |||
| 2604 | RQYP01000012.1 | GCA003859865_00436 | gene | open | 72771-73436 | csgG | ||
| 2605 | RQYP01000012.1 | GCA003859865_00437 | gene | open | 73543-73839 | |||
| 2606 | RQYP01000012.1 | GCA003859865_00438 | gene | open | 74165-74413 | |||
| 2607 | RQYP01000012.1 | GCA003859865_00364 | gene | open | 3224-3300 | trnM | ||
| 2608 | RQYP01000012.1 | GCA003859865_00364 | tRNA | open | 3224-3300 | trnM | tRNA-Met(cat) | |
| 2609 | RQYP01000013.1 | GCA003859865_00439 | CDS | open | 90-1703 | _na 537_aa | hypothetical protein | |
| 2610 | RQYP01000013.1 | GCA003859865_00441 | CDS | open | 2460-3632 | _na 390_aa | Two-component system sensor histidine kinase | |
| 2611 | RQYP01000013.1 | GCA003859865_00442 | CDS | open | 3629-4183 | _na 184_aa | hypothetical protein | |
| 2612 | RQYP01000013.1 | GCA003859865_00443 | CDS | open | 4180-4893 | _na 237_aa | hypothetical protein | |
| 2613 | RQYP01000013.1 | GCA003859865_00444 | CDS | open | 4886-5548 | _na 220_aa | Two-component system response regulator | |
| 2614 | RQYP01000013.1 | GCA003859865_00445 | CDS | open | 6096-6587 | _na 163_aa | DUF1104 domain-containing protein | |
| 2615 | RQYP01000013.1 | GCA003859865_00446 | CDS | open | 6643-7482 | _na 279_aa | Zinc metallopeptidase%2C M23 family | |
| 2616 | RQYP01000013.1 | GCA003859865_00447 | CDS | open | 7580-8245 | _na 221_aa | Ysc84 actin-binding domain-containing protein | |
| 2617 | RQYP01000013.1 | GCA003859865_00448 | CDS | open | 8272-8481 | _na 69_aa | Bacteriocin immunity protein | |
| 2618 | RQYP01000013.1 | GCA003859865_00449 | CDS | open | 8641-9078 | _na 145_aa | Ferric uptake regulation protein FUR | |
| 2619 | RQYP01000013.1 | GCA003859865_00450 | CDS | open | 9188-9529 | _na 113_aa | Cation transporter | |
| 2620 | RQYP01000013.1 | GCA003859865_00451 | CDS | open | 9526-10167 | _na 213_aa | Aminotransferase | |
| 2621 | RQYP01000013.1 | GCA003859865_00452 | CDS | open | 10190-10627 | _na 145_aa | ytxH | YtxH domain-containing protein |
| 2622 | RQYP01000013.1 | GCA003859865_00453 | CDS | open | 10640-10945 | _na 101_aa | hypothetical protein | |
| 2623 | RQYP01000013.1 | GCA003859865_00454 | CDS | open | 10942-11286 | _na 114_aa | ytxH | YtxH domain-containing protein |
| 2624 | RQYP01000013.1 | GCA003859865_00455 | CDS | open | 11270-13345 | _na 691_aa | Lead%2C cadmium%2C zinc and mercury transporting ATPase | |
| 2625 | RQYP01000013.1 | GCA003859865_00456 | CDS | open | 13363-14823 | _na 486_aa | Amino acid carrier protein | |
| 2626 | RQYP01000013.1 | GCA003859865_00457 | CDS | open | 14820-15104 | _na 94_aa | Helicase | |
| 2627 | RQYP01000013.1 | GCA003859865_00458 | CDS | open | 15088-15930 | _na 280_aa | modD | Putative pyrophosphorylase ModD |
| 2628 | RQYP01000013.1 | GCA003859865_00459 | CDS | open | 16229-16717 | _na 162_aa | YcxB-like protein domain-containing protein | |
| 2629 | RQYP01000013.1 | GCA003859865_00460 | CDS | open | 16852-17466 | _na 204_aa | ATPase%2C AAA family | |
| 2630 | RQYP01000013.1 | GCA003859865_00461 | CDS | open | 17463-19496 | _na 677_aa | Glycine--tRNA ligase beta subunit | |
| 2631 | RQYP01000013.1 | GCA003859865_00462 | CDS | open | 19493-19621 | _na 42_aa | hypothetical protein | |
| 2632 | RQYP01000013.1 | GCA003859865_00463 | CDS | open | 19608-20945 | _na 445_aa | Endonuclease/exonuclease/phosphatase domain-containing protein | |
| 2633 | RQYP01000013.1 | GCA003859865_00464 | CDS | open | 20942-21421 | _na 159_aa | Putative tRNA (cytidine(34)-2'-O)-methyltransferase | |
| 2634 | RQYP01000013.1 | GCA003859865_00465 | CDS | open | 21648-21935 | _na 95_aa | hypothetical protein | |
| 2635 | RQYP01000013.1 | GCA003859865_00466 | CDS | open | 22132-23262 | _na 376_aa | tRNA nucleotidyltransferase | |
| 2636 | RQYP01000013.1 | GCA003859865_00467 | CDS | open | 23228-23734 | _na 168_aa | Campylobacter invasion antigen D C-terminal domain-containing protein | |
| 2637 | RQYP01000013.1 | GCA003859865_00468 | CDS | open | 23731-23976 | _na 81_aa | Tetratricopeptide repeat protein | |
| 2638 | RQYP01000013.1 | GCA003859865_00469 | CDS | open | 23973-25043 | _na 356_aa | leuB | 3-isopropylmalate dehydrogenase |
| 2639 | RQYP01000013.1 | GCA003859865_00470 | CDS | open | 25045-25527 | _na 160_aa | 3-isopropylmalate dehydratase small subunit | |
| 2640 | RQYP01000013.1 | GCA003859865_00471 | CDS | open | 26132-26731 | _na 199_aa | Putative threonine efflux protein | |
| 2641 | RQYP01000013.1 | GCA003859865_00472 | CDS | open | 27274-27684 | _na 136_aa | DUF1877 domain-containing protein | |
| 2642 | RQYP01000013.1 | GCA003859865_00473 | CDS | open | 28511-28696 | _na 61_aa | hypothetical protein | |
| 2643 | RQYP01000013.1 | GCA003859865_00474 | CDS | open | 28685-29731 | _na 348_aa | Asparaginase II | |
| 2644 | RQYP01000013.1 | GCA003859865_00475 | CDS | open | 29815-30150 | _na 111_aa | azlD | Branched-chain amino acid transport protein%2C AzlD family |
| 2645 | RQYP01000013.1 | GCA003859865_00476 | CDS | open | 30147-30809 | _na 220_aa | azlC | Branched-chain amino acid transport protein azlC |
| 2646 | RQYP01000013.1 | GCA003859865_00477 | CDS | open | 31001-31276 | _na 91_aa | hypothetical protein | |
| 2647 | RQYP01000013.1 | GCA003859865_00478 | CDS | open | 31455-31871 | _na 138_aa | beta-lactamase | |
| 2648 | RQYP01000013.1 | GCA003859865_00479 | CDS | open | 32105-33529 | _na 474_aa | beta-lactamase | |
| 2649 | RQYP01000013.1 | GCA003859865_00480 | CDS | open | 33684-34472 | _na 262_aa | flgG | flagellar basal-body rod protein FlgG |
| 2650 | RQYP01000013.1 | GCA003859865_00481 | CDS | open | 35044-35856 | _na 270_aa | Flagellar basal body rod protein | |
| 2651 | RQYP01000013.1 | GCA003859865_00482 | CDS | open | 36193-38073 | _na 626_aa | rpoD | RNA polymerase sigma factor RpoD |
| 2652 | RQYP01000013.1 | GCA003859865_00483 | CDS | open | 38224-38430 | _na 68_aa | hypothetical protein | |
| 2653 | RQYP01000013.1 | GCA003859865_00484 | CDS | open | 38437-38853 | _na 138_aa | hypothetical protein | |
| 2654 | RQYP01000013.1 | GCA003859865_00485 | CDS | open | 40621-40983 | _na 120_aa | DUF2892 domain-containing protein | |
| 2655 | RQYP01000013.1 | GCA003859865_00486 | CDS | open | 40995-42455 | _na 486_aa | Tat pathway signal sequence domain protein | |
| 2656 | RQYP01000013.1 | GCA003859865_00487 | CDS | open | 42465-44048 | _na 527_aa | DUF3373 domain-containing protein | |
| 2657 | RQYP01000013.1 | GCA003859865_00488 | CDS | open | 44061-44399 | _na 112_aa | Cytochrome c | |
| 2658 | RQYP01000013.1 | GCA003859865_00489 | CDS | open | 44984-46018 | _na 344_aa | Fe/B12 periplasmic-binding domain-containing protein | |
| 2659 | RQYP01000013.1 | GCA003859865_00490 | CDS | open | 46015-46995 | _na 326_aa | ABC transporter%2C permease protein | |
| 2660 | RQYP01000013.1 | GCA003859865_00491 | CDS | open | 46979-47743 | _na 254_aa | ABC transporter%2C ATP-binding protein | |
| 2661 | RQYP01000013.1 | GCA003859865_00492 | CDS | open | 48999-49496 | _na 165_aa | hypothetical protein | |
| 2662 | RQYP01000013.1 | GCA003859865_00493 | CDS | open | 51004-51930 | _na 308_aa | ABC transporter%2C ATP-binding protein | |
| 2663 | RQYP01000013.1 | GCA003859865_00494 | CDS | open | 51934-53490 | _na 518_aa | ABC transporter%2C permease protein | |
| 2664 | RQYP01000013.1 | GCA003859865_00495 | CDS | open | 53490-54491 | _na 333_aa | ABC transporter%2C solute-binding protein | |
| 2665 | RQYP01000013.1 | GCA003859865_00496 | CDS | open | 54654-55031 | _na 125_aa | Rhodanese domain-containing protein | |
| 2666 | RQYP01000013.1 | GCA003859865_00497 | CDS | open | 55606-55773 | _na 55_aa | Dihydroneopterin aldolase | |
| 2667 | RQYP01000013.1 | GCA003859865_00498 | CDS | open | 55783-57339 | _na 518_aa | dsbB | Disulfide bond formation protein%2C DsbB family |
| 2668 | RQYP01000013.1 | GCA003859865_00499 | CDS | open | 57525-58622 | _na 365_aa | Competence/damage-inducible domain protein | |
| 2669 | RQYP01000013.1 | GCA003859865_00500 | CDS | open | 58744-61500 | _na 918_aa | ileS | isoleucine--tRNA ligase |
| 2670 | RQYP01000013.1 | GCA003859865_00501 | CDS | open | 61597-62955 | _na 452_aa | gatA | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA |
| 2671 | RQYP01000013.1 | GCA003859865_00502 | CDS | open | 62960-64408 | _na 482_aa | guaB | IMP dehydrogenase |
| 2672 | RQYP01000013.1 | GCA003859865_00503 | CDS | open | 64408-65508 | _na 366_aa | homoserine O-acetyltransferase | |
| 2673 | RQYP01000013.1 | GCA003859865_00504 | CDS | open | 65501-65695 | _na 64_aa | xseB | exodeoxyribonuclease VII small subunit |
| 2674 | RQYP01000013.1 | GCA003859865_00505 | CDS | open | 65688-66500 | _na 270_aa | Putative amidohydrolase | |
| 2675 | RQYP01000013.1 | GCA003859865_00506 | CDS | open | 67119-68669 | _na 516_aa | Flavocytochrome c | |
| 2676 | RQYP01000013.1 | GCA003859865_00439 | gene | open | 90-1703 | |||
| 2677 | RQYP01000013.1 | GCA003859865_00441 | gene | open | 2460-3632 | |||
| 2678 | RQYP01000013.1 | GCA003859865_00442 | gene | open | 3629-4183 | |||
| 2679 | RQYP01000013.1 | GCA003859865_00443 | gene | open | 4180-4893 | |||
| 2680 | RQYP01000013.1 | GCA003859865_00444 | gene | open | 4886-5548 | |||
| 2681 | RQYP01000013.1 | GCA003859865_00445 | gene | open | 6096-6587 | |||
| 2682 | RQYP01000013.1 | GCA003859865_00446 | gene | open | 6643-7482 | |||
| 2683 | RQYP01000013.1 | GCA003859865_00447 | gene | open | 7580-8245 | |||
| 2684 | RQYP01000013.1 | GCA003859865_00448 | gene | open | 8272-8481 | |||
| 2685 | RQYP01000013.1 | GCA003859865_00449 | gene | open | 8641-9078 | |||
| 2686 | RQYP01000013.1 | GCA003859865_00450 | gene | open | 9188-9529 | |||
| 2687 | RQYP01000013.1 | GCA003859865_00451 | gene | open | 9526-10167 | |||
| 2688 | RQYP01000013.1 | GCA003859865_00452 | gene | open | 10190-10627 | ytxH | ||
| 2689 | RQYP01000013.1 | GCA003859865_00453 | gene | open | 10640-10945 | |||
| 2690 | RQYP01000013.1 | GCA003859865_00454 | gene | open | 10942-11286 | ytxH | ||
| 2691 | RQYP01000013.1 | GCA003859865_00455 | gene | open | 11270-13345 | |||
| 2692 | RQYP01000013.1 | GCA003859865_00456 | gene | open | 13363-14823 | |||
| 2693 | RQYP01000013.1 | GCA003859865_00457 | gene | open | 14820-15104 | |||
| 2694 | RQYP01000013.1 | GCA003859865_00458 | gene | open | 15088-15930 | modD | ||
| 2695 | RQYP01000013.1 | GCA003859865_00459 | gene | open | 16229-16717 | |||
| 2696 | RQYP01000013.1 | GCA003859865_00460 | gene | open | 16852-17466 | |||
| 2697 | RQYP01000013.1 | GCA003859865_00461 | gene | open | 17463-19496 | |||
| 2698 | RQYP01000013.1 | GCA003859865_00462 | gene | open | 19493-19621 | |||
| 2699 | RQYP01000013.1 | GCA003859865_00463 | gene | open | 19608-20945 | |||
| 2700 | RQYP01000013.1 | GCA003859865_00464 | gene | open | 20942-21421 | |||
| 2701 | RQYP01000013.1 | GCA003859865_00465 | gene | open | 21648-21935 | |||
| 2702 | RQYP01000013.1 | GCA003859865_00466 | gene | open | 22132-23262 | |||
| 2703 | RQYP01000013.1 | GCA003859865_00467 | gene | open | 23228-23734 | |||
| 2704 | RQYP01000013.1 | GCA003859865_00468 | gene | open | 23731-23976 | |||
| 2705 | RQYP01000013.1 | GCA003859865_00469 | gene | open | 23973-25043 | leuB | ||
| 2706 | RQYP01000013.1 | GCA003859865_00470 | gene | open | 25045-25527 | |||
| 2707 | RQYP01000013.1 | GCA003859865_00471 | gene | open | 26132-26731 | |||
| 2708 | RQYP01000013.1 | GCA003859865_00472 | gene | open | 27274-27684 | |||
| 2709 | RQYP01000013.1 | GCA003859865_00473 | gene | open | 28511-28696 | |||
| 2710 | RQYP01000013.1 | GCA003859865_00474 | gene | open | 28685-29731 | |||
| 2711 | RQYP01000013.1 | GCA003859865_00475 | gene | open | 29815-30150 | azlD | ||
| 2712 | RQYP01000013.1 | GCA003859865_00476 | gene | open | 30147-30809 | azlC | ||
| 2713 | RQYP01000013.1 | GCA003859865_00477 | gene | open | 31001-31276 | |||
| 2714 | RQYP01000013.1 | GCA003859865_00478 | gene | open | 31455-31871 | |||
| 2715 | RQYP01000013.1 | GCA003859865_00479 | gene | open | 32105-33529 | |||
| 2716 | RQYP01000013.1 | GCA003859865_00480 | gene | open | 33684-34472 | flgG | ||
| 2717 | RQYP01000013.1 | GCA003859865_00481 | gene | open | 35044-35856 | |||
| 2718 | RQYP01000013.1 | GCA003859865_00482 | gene | open | 36193-38073 | rpoD | ||
| 2719 | RQYP01000013.1 | GCA003859865_00483 | gene | open | 38224-38430 | |||
| 2720 | RQYP01000013.1 | GCA003859865_00484 | gene | open | 38437-38853 | |||
| 2721 | RQYP01000013.1 | GCA003859865_00485 | gene | open | 40621-40983 | |||
| 2722 | RQYP01000013.1 | GCA003859865_00486 | gene | open | 40995-42455 | |||
| 2723 | RQYP01000013.1 | GCA003859865_00487 | gene | open | 42465-44048 | |||
| 2724 | RQYP01000013.1 | GCA003859865_00488 | gene | open | 44061-44399 | |||
| 2725 | RQYP01000013.1 | GCA003859865_00489 | gene | open | 44984-46018 | |||
| 2726 | RQYP01000013.1 | GCA003859865_00490 | gene | open | 46015-46995 | |||
| 2727 | RQYP01000013.1 | GCA003859865_00491 | gene | open | 46979-47743 | |||
| 2728 | RQYP01000013.1 | GCA003859865_00492 | gene | open | 48999-49496 | |||
| 2729 | RQYP01000013.1 | GCA003859865_00493 | gene | open | 51004-51930 | |||
| 2730 | RQYP01000013.1 | GCA003859865_00494 | gene | open | 51934-53490 | |||
| 2731 | RQYP01000013.1 | GCA003859865_00495 | gene | open | 53490-54491 | |||
| 2732 | RQYP01000013.1 | GCA003859865_00496 | gene | open | 54654-55031 | |||
| 2733 | RQYP01000013.1 | GCA003859865_00497 | gene | open | 55606-55773 | |||
| 2734 | RQYP01000013.1 | GCA003859865_00498 | gene | open | 55783-57339 | dsbB | ||
| 2735 | RQYP01000013.1 | GCA003859865_00499 | gene | open | 57525-58622 | |||
| 2736 | RQYP01000013.1 | GCA003859865_00500 | gene | open | 58744-61500 | ileS | ||
| 2737 | RQYP01000013.1 | GCA003859865_00501 | gene | open | 61597-62955 | gatA | ||
| 2738 | RQYP01000013.1 | GCA003859865_00502 | gene | open | 62960-64408 | guaB | ||
| 2739 | RQYP01000013.1 | GCA003859865_00503 | gene | open | 64408-65508 | |||
| 2740 | RQYP01000013.1 | GCA003859865_00504 | gene | open | 65501-65695 | xseB | ||
| 2741 | RQYP01000013.1 | GCA003859865_00505 | gene | open | 65688-66500 | |||
| 2742 | RQYP01000013.1 | GCA003859865_00506 | gene | open | 67119-68669 | |||
| 2743 | RQYP01000013.1 | GCA003859865_00440 | gene | open | 1902-1978 | trnR | ||
| 2744 | RQYP01000013.1 | GCA003859865_00440 | tRNA | open | 1902-1978 | trnR | tRNA-Arg(gcg) | |
| 2745 | RQYP01000014.1 | repeat_region | open | 4497-4753 | CRISPR array with 4 repeats of length 28%2C consensus sequence TTCAAACTCCAACGGAGTAAATTTTAAC and spacer length 38 | |||
| 2746 | RQYP01000014.1 | GCA003859865_00507 | CDS | open | 441-2057 | _na 538_aa | Phage integrase family protein | |
| 2747 | RQYP01000014.1 | GCA003859865_00508 | CDS | open | 2133-3377 | _na 414_aa | Phage integrase family protein | |
| 2748 | RQYP01000014.1 | GCA003859865_00510 | CDS | open | 3947-4201 | _na 84_aa | Pathogenicity locus | |
| 2749 | RQYP01000014.1 | GCA003859865_00511 | CDS | open | 4901-5587 | _na 228_aa | pyrF | orotidine-5'-phosphate decarboxylase |
| 2750 | RQYP01000014.1 | GCA003859865_00512 | CDS | open | 5584-5979 | _na 131_aa | nusB | transcription antitermination factor NusB |
| 2751 | RQYP01000014.1 | GCA003859865_00513 | CDS | open | 5981-6451 | _na 156_aa | ribH | 6%2C7-dimethyl-8-ribityllumazine synthase |
| 2752 | RQYP01000014.1 | GCA003859865_00514 | CDS | open | 6461-6784 | _na 107_aa | emrE | Multidrug efflux system protein%2C EmrE family |
| 2753 | RQYP01000014.1 | GCA003859865_00515 | CDS | open | 6781-7107 | _na 108_aa | emrE | Multidrug efflux system protein%2C EmrE family |
| 2754 | RQYP01000014.1 | GCA003859865_00516 | CDS | open | 7097-7903 | _na 268_aa | kdsA | 3-deoxy-8-phosphooctulonate synthase |
| 2755 | RQYP01000014.1 | GCA003859865_00517 | CDS | open | 7903-8796 | _na 297_aa | eamA | EamA domain-containing protein |
| 2756 | RQYP01000014.1 | GCA003859865_00518 | CDS | open | 8935-10338 | _na 467_aa | der | ribosome biogenesis GTPase Der |
| 2757 | RQYP01000014.1 | GCA003859865_00519 | CDS | open | 10331-10846 | _na 171_aa | Shikimate kinase | |
| 2758 | RQYP01000014.1 | GCA003859865_00520 | CDS | open | 11216-12181 | _na 321_aa | trpS | tryptophan--tRNA ligase |
| 2759 | RQYP01000014.1 | GCA003859865_00521 | CDS | open | 12197-12610 | _na 137_aa | copD | copper resistance protein CopD |
| 2760 | RQYP01000014.1 | GCA003859865_00522 | CDS | open | 12636-13880 | _na 414_aa | serS | serine--tRNA ligase |
| 2761 | RQYP01000014.1 | GCA003859865_00523 | CDS | open | 13880-16267 | _na 795_aa | Paralysed flagella protein B | |
| 2762 | RQYP01000014.1 | GCA003859865_00524 | CDS | open | 16350-17108 | _na 252_aa | CAAX protease | |
| 2763 | RQYP01000014.1 | GCA003859865_00525 | CDS | open | 17338-18036 | _na 232_aa | VWFA domain-containing protein | |
| 2764 | RQYP01000014.1 | GCA003859865_00526 | CDS | open | 18244-19761 | _na 505_aa | 2-isopropylmalate synthase | |
| 2765 | RQYP01000014.1 | GCA003859865_00527 | CDS | open | 19885-20664 | _na 259_aa | pssA | CDP-diacylglycerol--serine O-phosphatidyltransferase |
| 2766 | RQYP01000014.1 | GCA003859865_00528 | CDS | open | 20645-21289 | _na 214_aa | Phosphatidylserine decarboxylase | |
| 2767 | RQYP01000014.1 | GCA003859865_00529 | CDS | open | 21294-23222 | _na 642_aa | ftsH | ATP-dependent zinc metalloprotease FtsH |
| 2768 | RQYP01000014.1 | GCA003859865_00530 | CDS | open | 23241-24071 | _na 276_aa | 50S ribosomal protein L11 methyltransferase | |
| 2769 | RQYP01000014.1 | GCA003859865_00531 | CDS | open | 24084-24449 | _na 121_aa | cheY | Chemotaxis regulator-transmits chemoreceptor signals to flagelllar motor components CheY |
| 2770 | RQYP01000014.1 | GCA003859865_00532 | CDS | open | 24517-25227 | _na 236_aa | hisA | 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase |
| 2771 | RQYP01000014.1 | GCA003859865_00533 | CDS | open | 25227-25847 | _na 206_aa | hisH | imidazole glycerol phosphate synthase subunit HisH |
| 2772 | RQYP01000014.1 | GCA003859865_00534 | CDS | open | 25844-26740 | _na 298_aa | General glycosylation pathway protein | |
| 2773 | RQYP01000014.1 | GCA003859865_00535 | CDS | open | 26743-28521 | _na 592_aa | pglF | UDP-N-acetylglucosamine 4%2C6-dehydratase (configuration-retaining) |
| 2774 | RQYP01000014.1 | GCA003859865_00536 | CDS | open | 28522-29610 | _na 362_aa | pglE | UDP-N-acetylbacillosamine transaminase |
| 2775 | RQYP01000014.1 | GCA003859865_00537 | CDS | open | 29674-29892 | _na 72_aa | transcriptional regulator | |
| 2776 | RQYP01000014.1 | GCA003859865_00538 | CDS | open | 30061-30297 | _na 78_aa | hypothetical protein | |
| 2777 | RQYP01000014.1 | GCA003859865_00539 | CDS | open | 30287-30592 | _na 101_aa | hypothetical protein | |
| 2778 | RQYP01000014.1 | GCA003859865_00540 | CDS | open | 30589-30903 | _na 104_aa | hypothetical protein | |
| 2779 | RQYP01000014.1 | GCA003859865_00541 | CDS | open | 30882-31208 | _na 108_aa | hypothetical protein | |
| 2780 | RQYP01000014.1 | GCA003859865_00542 | CDS | open | 31220-31825 | _na 201_aa | pglD | UDP-N-acetylbacillosamine N-acetyltransferase |
| 2781 | RQYP01000014.1 | GCA003859865_00543 | CDS | open | 31812-32417 | _na 201_aa | pglC | undecaprenyl phosphate N%2CN'-diacetylbacillosamine 1-phosphate transferase |
| 2782 | RQYP01000014.1 | GCA003859865_00544 | CDS | open | 32410-33537 | _na 375_aa | pglA | N%2CN'-diacetylbacillosaminyl-diphospho-undecaprenol alpha-1%2C3-N-acetylgalactosaminyltransferase |
| 2783 | RQYP01000014.1 | GCA003859865_00545 | CDS | open | 33600-35960 | _na 786_aa | Undecaprenyl-diphosphooligosaccharide--protein glycotransferase | |
| 2784 | RQYP01000014.1 | GCA003859865_00546 | CDS | open | 35950-37077 | _na 375_aa | N-acetylgalactosamine-N%2C N'-diacetylbacillosaminyl-diphospho-undecaprenol 4-alpha-N-acetylgalactosaminyltransferase | |
| 2785 | RQYP01000014.1 | GCA003859865_00547 | CDS | open | 37074-38291 | _na 405_aa | GalNAc5-diNAcBac-PP-undecaprenol beta-1%2C3-glucosyltransferase | |
| 2786 | RQYP01000014.1 | GCA003859865_00548 | CDS | open | 38293-39357 | _na 354_aa | Glycosyltransferase%2C group 1 family protein | |
| 2787 | RQYP01000014.1 | GCA003859865_00549 | CDS | open | 39450-40205 | _na 251_aa | Glycosyltransferase%2C family 25 | |
| 2788 | RQYP01000014.1 | GCA003859865_00550 | CDS | open | 40202-41716 | _na 504_aa | Flippase | |
| 2789 | RQYP01000014.1 | GCA003859865_00551 | CDS | open | 41716-42948 | _na 410_aa | tviB | Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB |
| 2790 | RQYP01000014.1 | GCA003859865_00552 | CDS | open | 42945-43373 | _na 142_aa | Ecotin | |
| 2791 | RQYP01000014.1 | GCA003859865_00553 | CDS | open | 43370-44692 | _na 440_aa | UDP-glucose 6-dehydrogenase | |
| 2792 | RQYP01000014.1 | GCA003859865_00554 | CDS | open | 44689-45687 | _na 332_aa | galE | UDP-glucose 4-epimerase GalE |
| 2793 | RQYP01000014.1 | GCA003859865_00555 | CDS | open | 45743-45961 | _na 72_aa | Excalibur calcium-binding domain protein | |
| 2794 | RQYP01000014.1 | GCA003859865_00556 | CDS | open | 46043-46336 | _na 97_aa | helix-turn-helix transcriptional regulator | |
| 2795 | RQYP01000014.1 | GCA003859865_00557 | CDS | open | 46921-47898 | _na 325_aa | DNA ligase | |
| 2796 | RQYP01000014.1 | GCA003859865_00558 | CDS | open | 47895-48953 | _na 352_aa | NAD dependent epimerase/dehydratase family protein | |
| 2797 | RQYP01000014.1 | GCA003859865_00559 | CDS | open | 49030-49758 | _na 242_aa | Lipoprotein | |
| 2798 | RQYP01000014.1 | GCA003859865_00560 | CDS | open | 49889-50806 | _na 305_aa | putative 3'-5' exonuclease PolB-like domain-containing protein | |
| 2799 | RQYP01000014.1 | GCA003859865_00561 | CDS | open | 50870-51856 | _na 328_aa | waaC | lipopolysaccharide heptosyltransferase I |
| 2800 | RQYP01000014.1 | GCA003859865_00562 | CDS | open | 51849-52742 | _na 297_aa | lipid A biosynthesis lauroyl acyltransferase | |
| 2801 | RQYP01000014.1 | GCA003859865_00563 | CDS | open | 52736-53500 | _na 254_aa | Glycosyltransferase%2C group 2 family protein | |
| 2802 | RQYP01000014.1 | GCA003859865_00564 | CDS | open | 53497-54585 | _na 362_aa | rfaQ | putative lipopolysaccharide heptosyltransferase III |
| 2803 | RQYP01000014.1 | GCA003859865_00565 | CDS | open | 54614-55558 | _na 314_aa | DUF2393 domain-containing protein | |
| 2804 | RQYP01000014.1 | GCA003859865_00566 | CDS | open | 55837-56277 | _na 146_aa | MFS transporter | |
| 2805 | RQYP01000014.1 | GCA003859865_00567 | CDS | open | 56314-57135 | _na 273_aa | TNase-like domain-containing protein | |
| 2806 | RQYP01000014.1 | GCA003859865_00568 | CDS | open | 57350-58108 | _na 252_aa | Polysaccharide deacetylase | |
| 2807 | RQYP01000014.1 | GCA003859865_00569 | CDS | open | 58098-59441 | _na 447_aa | O-antigen polymerase | |
| 2808 | RQYP01000014.1 | GCA003859865_00570 | CDS | open | 59604-61091 | _na 495_aa | Glycosyltransferase | |
| 2809 | RQYP01000014.1 | GCA003859865_00571 | CDS | open | 61039-62841 | _na 600_aa | Glycosyltransferase%2C family 1 | |
| 2810 | RQYP01000014.1 | GCA003859865_00572 | CDS | open | 62838-63911 | _na 357_aa | ADP-heptose--lipooligosaccharide heptosyltransferase II | |
| 2811 | RQYP01000014.1 | GCA003859865_00573 | CDS | open | 63898-64950 | _na 350_aa | Glycosyltransferase%2C group 1 family protein | |
| 2812 | RQYP01000014.1 | GCA003859865_00574 | CDS | open | 64947-65879 | _na 310_aa | Lipopolysaccharide heptosyltransferase III | |
| 2813 | RQYP01000014.1 | GCA003859865_00575 | CDS | open | 66012-67043 | _na 343_aa | waaG | UDP-glucose:(Heptosyl) LPS alpha1%2C3-glucosyltransferase WaaG |
| 2814 | RQYP01000014.1 | GCA003859865_00576 | CDS | open | 67027-68514 | _na 495_aa | waaF | lipopolysaccharide heptosyltransferase II |
| 2815 | RQYP01000014.1 | GCA003859865_00507 | gene | open | 441-2057 | |||
| 2816 | RQYP01000014.1 | GCA003859865_00508 | gene | open | 2133-3377 | |||
| 2817 | RQYP01000014.1 | GCA003859865_00510 | gene | open | 3947-4201 | |||
| 2818 | RQYP01000014.1 | GCA003859865_00511 | gene | open | 4901-5587 | pyrF | ||
| 2819 | RQYP01000014.1 | GCA003859865_00512 | gene | open | 5584-5979 | nusB | ||
| 2820 | RQYP01000014.1 | GCA003859865_00513 | gene | open | 5981-6451 | ribH | ||
| 2821 | RQYP01000014.1 | GCA003859865_00514 | gene | open | 6461-6784 | emrE | ||
| 2822 | RQYP01000014.1 | GCA003859865_00515 | gene | open | 6781-7107 | emrE | ||
| 2823 | RQYP01000014.1 | GCA003859865_00516 | gene | open | 7097-7903 | kdsA | ||
| 2824 | RQYP01000014.1 | GCA003859865_00517 | gene | open | 7903-8796 | eamA | ||
| 2825 | RQYP01000014.1 | GCA003859865_00518 | gene | open | 8935-10338 | der | ||
| 2826 | RQYP01000014.1 | GCA003859865_00519 | gene | open | 10331-10846 | |||
| 2827 | RQYP01000014.1 | GCA003859865_00520 | gene | open | 11216-12181 | trpS | ||
| 2828 | RQYP01000014.1 | GCA003859865_00521 | gene | open | 12197-12610 | copD | ||
| 2829 | RQYP01000014.1 | GCA003859865_00522 | gene | open | 12636-13880 | serS | ||
| 2830 | RQYP01000014.1 | GCA003859865_00523 | gene | open | 13880-16267 | |||
| 2831 | RQYP01000014.1 | GCA003859865_00524 | gene | open | 16350-17108 | |||
| 2832 | RQYP01000014.1 | GCA003859865_00525 | gene | open | 17338-18036 | |||
| 2833 | RQYP01000014.1 | GCA003859865_00526 | gene | open | 18244-19761 | |||
| 2834 | RQYP01000014.1 | GCA003859865_00527 | gene | open | 19885-20664 | pssA | ||
| 2835 | RQYP01000014.1 | GCA003859865_00528 | gene | open | 20645-21289 | |||
| 2836 | RQYP01000014.1 | GCA003859865_00529 | gene | open | 21294-23222 | ftsH | ||
| 2837 | RQYP01000014.1 | GCA003859865_00530 | gene | open | 23241-24071 | |||
| 2838 | RQYP01000014.1 | GCA003859865_00531 | gene | open | 24084-24449 | cheY | ||
| 2839 | RQYP01000014.1 | GCA003859865_00532 | gene | open | 24517-25227 | hisA | ||
| 2840 | RQYP01000014.1 | GCA003859865_00533 | gene | open | 25227-25847 | hisH | ||
| 2841 | RQYP01000014.1 | GCA003859865_00534 | gene | open | 25844-26740 | |||
| 2842 | RQYP01000014.1 | GCA003859865_00535 | gene | open | 26743-28521 | pglF | ||
| 2843 | RQYP01000014.1 | GCA003859865_00536 | gene | open | 28522-29610 | pglE | ||
| 2844 | RQYP01000014.1 | GCA003859865_00537 | gene | open | 29674-29892 | |||
| 2845 | RQYP01000014.1 | GCA003859865_00538 | gene | open | 30061-30297 | |||
| 2846 | RQYP01000014.1 | GCA003859865_00539 | gene | open | 30287-30592 | |||
| 2847 | RQYP01000014.1 | GCA003859865_00540 | gene | open | 30589-30903 | |||
| 2848 | RQYP01000014.1 | GCA003859865_00541 | gene | open | 30882-31208 | |||
| 2849 | RQYP01000014.1 | GCA003859865_00542 | gene | open | 31220-31825 | pglD | ||
| 2850 | RQYP01000014.1 | GCA003859865_00543 | gene | open | 31812-32417 | pglC | ||
| 2851 | RQYP01000014.1 | GCA003859865_00544 | gene | open | 32410-33537 | pglA | ||
| 2852 | RQYP01000014.1 | GCA003859865_00545 | gene | open | 33600-35960 | |||
| 2853 | RQYP01000014.1 | GCA003859865_00546 | gene | open | 35950-37077 | |||
| 2854 | RQYP01000014.1 | GCA003859865_00547 | gene | open | 37074-38291 | |||
| 2855 | RQYP01000014.1 | GCA003859865_00548 | gene | open | 38293-39357 | |||
| 2856 | RQYP01000014.1 | GCA003859865_00549 | gene | open | 39450-40205 | |||
| 2857 | RQYP01000014.1 | GCA003859865_00550 | gene | open | 40202-41716 | |||
| 2858 | RQYP01000014.1 | GCA003859865_00551 | gene | open | 41716-42948 | tviB | ||
| 2859 | RQYP01000014.1 | GCA003859865_00552 | gene | open | 42945-43373 | |||
| 2860 | RQYP01000014.1 | GCA003859865_00553 | gene | open | 43370-44692 | |||
| 2861 | RQYP01000014.1 | GCA003859865_00554 | gene | open | 44689-45687 | galE | ||
| 2862 | RQYP01000014.1 | GCA003859865_00555 | gene | open | 45743-45961 | |||
| 2863 | RQYP01000014.1 | GCA003859865_00556 | gene | open | 46043-46336 | |||
| 2864 | RQYP01000014.1 | GCA003859865_00557 | gene | open | 46921-47898 | |||
| 2865 | RQYP01000014.1 | GCA003859865_00558 | gene | open | 47895-48953 | |||
| 2866 | RQYP01000014.1 | GCA003859865_00559 | gene | open | 49030-49758 | |||
| 2867 | RQYP01000014.1 | GCA003859865_00560 | gene | open | 49889-50806 | |||
| 2868 | RQYP01000014.1 | GCA003859865_00561 | gene | open | 50870-51856 | waaC | ||
| 2869 | RQYP01000014.1 | GCA003859865_00562 | gene | open | 51849-52742 | |||
| 2870 | RQYP01000014.1 | GCA003859865_00563 | gene | open | 52736-53500 | |||
| 2871 | RQYP01000014.1 | GCA003859865_00564 | gene | open | 53497-54585 | rfaQ | ||
| 2872 | RQYP01000014.1 | GCA003859865_00565 | gene | open | 54614-55558 | |||
| 2873 | RQYP01000014.1 | GCA003859865_00566 | gene | open | 55837-56277 | |||
| 2874 | RQYP01000014.1 | GCA003859865_00567 | gene | open | 56314-57135 | |||
| 2875 | RQYP01000014.1 | GCA003859865_00568 | gene | open | 57350-58108 | |||
| 2876 | RQYP01000014.1 | GCA003859865_00569 | gene | open | 58098-59441 | |||
| 2877 | RQYP01000014.1 | GCA003859865_00570 | gene | open | 59604-61091 | |||
| 2878 | RQYP01000014.1 | GCA003859865_00571 | gene | open | 61039-62841 | |||
| 2879 | RQYP01000014.1 | GCA003859865_00572 | gene | open | 62838-63911 | |||
| 2880 | RQYP01000014.1 | GCA003859865_00573 | gene | open | 63898-64950 | |||
| 2881 | RQYP01000014.1 | GCA003859865_00574 | gene | open | 64947-65879 | |||
| 2882 | RQYP01000014.1 | GCA003859865_00575 | gene | open | 66012-67043 | waaG | ||
| 2883 | RQYP01000014.1 | GCA003859865_00576 | gene | open | 67027-68514 | waaF | ||
| 2884 | RQYP01000014.1 | GCA003859865_00509 | gene | open | 3594-3684 | trnS | ||
| 2885 | RQYP01000014.1 | GCA003859865_00509 | tRNA | open | 3594-3684 | trnS | tRNA-Ser(gct) | |
| 2886 | RQYP01000015.1 | GCA003859865_00577 | CDS | open | 30-353 | _na 107_aa | hypothetical protein | |
| 2887 | RQYP01000015.1 | GCA003859865_00578 | CDS | open | 376-1101 | _na 241_aa | M23 family metallopeptidase | |
| 2888 | RQYP01000015.1 | GCA003859865_00579 | CDS | open | 1098-1562 | _na 154_aa | hypothetical protein | |
| 2889 | RQYP01000015.1 | GCA003859865_00580 | CDS | open | 1590-2384 | _na 264_aa | hypothetical protein | |
| 2890 | RQYP01000015.1 | GCA003859865_00581 | CDS | open | 2997-3953 | _na 318_aa | lpxD | UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase |
| 2891 | RQYP01000015.1 | GCA003859865_00582 | CDS | open | 3953-4420 | _na 155_aa | ilvN | acetolactate synthase small subunit |
| 2892 | RQYP01000015.1 | GCA003859865_00583 | CDS | open | 4423-6123 | _na 566_aa | acetolactate synthase large subunit | |
| 2893 | RQYP01000015.1 | GCA003859865_00584 | CDS | open | 6829-7530 | _na 233_aa | flgH | flagellar basal body L-ring protein FlgH |
| 2894 | RQYP01000015.1 | GCA003859865_00585 | CDS | open | 7595-8980 | _na 461_aa | pta | phosphate acetyltransferase |
| 2895 | RQYP01000015.1 | GCA003859865_00586 | CDS | open | 8980-10206 | _na 408_aa | Acetate kinase | |
| 2896 | RQYP01000015.1 | GCA003859865_00587 | CDS | open | 10840-11781 | _na 313_aa | Galanin | |
| 2897 | RQYP01000015.1 | GCA003859865_00588 | CDS | open | 12946-15942 | _na 998_aa | Tetrathionate reductase TtrDE%2C catalytic subunit D | |
| 2898 | RQYP01000015.1 | GCA003859865_00589 | CDS | open | 15953-16693 | _na 246_aa | Tetrathionate reductase subunit B | |
| 2899 | RQYP01000015.1 | GCA003859865_00590 | CDS | open | 16860-17924 | _na 354_aa | xerH | Tyrosine recombinase XerH |
| 2900 | RQYP01000015.1 | GCA003859865_00591 | CDS | open | 19758-22331 | _na 857_aa | clpB | Chaperone protein ClpB |
| 2901 | RQYP01000015.1 | GCA003859865_00592 | CDS | open | 22509-23813 | _na 434_aa | Peptidase%2C S41 family | |
| 2902 | RQYP01000015.1 | GCA003859865_00593 | CDS | open | 23825-24541 | _na 238_aa | purC | phosphoribosylaminoimidazolesuccinocarboxamide synthase |
| 2903 | RQYP01000015.1 | GCA003859865_00594 | CDS | open | 24543-24800 | _na 85_aa | purS | phosphoribosylformylglycinamidine synthase subunit PurS |
| 2904 | RQYP01000015.1 | GCA003859865_00595 | CDS | open | 24797-25462 | _na 221_aa | purQ | phosphoribosylformylglycinamidine synthase subunit PurQ |
| 2905 | RQYP01000015.1 | GCA003859865_00596 | CDS | open | 25456-26793 | _na 445_aa | Periplasmic protein | |
| 2906 | RQYP01000015.1 | GCA003859865_00597 | CDS | open | 26780-27466 | _na 228_aa | 1-acyl-sn-glycerol-3-phosphate acyltransferase | |
| 2907 | RQYP01000015.1 | GCA003859865_00598 | CDS | open | 27628-28521 | _na 297_aa | Ankyrin domain protein | |
| 2908 | RQYP01000015.1 | GCA003859865_00599 | CDS | open | 28689-29594 | _na 301_aa | Ankyrin domain protein | |
| 2909 | RQYP01000015.1 | GCA003859865_00600 | CDS | open | 29843-31696 | _na 617_aa | htpG | molecular chaperone HtpG |
| 2910 | RQYP01000015.1 | GCA003859865_00601 | CDS | open | 32230-32736 | _na 168_aa | PAS sensor-containing signal-transduction protein | |
| 2911 | RQYP01000015.1 | GCA003859865_00602 | CDS | open | 32733-33449 | _na 238_aa | imidazole glycerol phosphate synthase | |
| 2912 | RQYP01000015.1 | GCA003859865_00603 | CDS | open | 33959-35119 | _na 386_aa | UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase | |
| 2913 | RQYP01000015.1 | GCA003859865_00604 | CDS | open | 35265-36431 | _na 388_aa | ftsW | putative peptidoglycan glycosyltransferase FtsW |
| 2914 | RQYP01000015.1 | GCA003859865_00605 | CDS | open | 37019-39052 | _na 677_aa | DNA 3'-5' helicase | |
| 2915 | RQYP01000015.1 | GCA003859865_00606 | CDS | open | 40034-41470 | _na 478_aa | D-alanyl-D-alanine-adding enzyme | |
| 2916 | RQYP01000015.1 | GCA003859865_00607 | CDS | open | 42102-43472 | _na 456_aa | Alpha/beta hydrolase family protein | |
| 2917 | RQYP01000015.1 | GCA003859865_00608 | CDS | open | 43472-43702 | _na 76_aa | Type II toxin-antitoxin system Phd/YefM family antitoxin | |
| 2918 | RQYP01000015.1 | GCA003859865_00609 | CDS | open | 44314-45348 | _na 344_aa | D-alanine--D-alanine ligase | |
| 2919 | RQYP01000015.1 | GCA003859865_00610 | CDS | open | 45362-45916 | _na 184_aa | ruvA | Holliday junction branch migration protein RuvA |
| 2920 | RQYP01000015.1 | GCA003859865_00611 | CDS | open | 45945-46508 | _na 187_aa | ABC-type transport auxiliary lipoprotein component domain-containing protein | |
| 2921 | RQYP01000015.1 | GCA003859865_00612 | CDS | open | 46505-47437 | _na 310_aa | Mce/MlaD domain-containing protein | |
| 2922 | RQYP01000015.1 | GCA003859865_00613 | CDS | open | 47427-48170 | _na 247_aa | Methionine ABC transporter ATP-binding protein | |
| 2923 | RQYP01000015.1 | GCA003859865_00614 | CDS | open | 48171-49307 | _na 378_aa | ABC transporter permease | |
| 2924 | RQYP01000015.1 | GCA003859865_00615 | CDS | open | 49310-51211 | _na 633_aa | Flagellar Assembly Protein A N-terminal region domain-containing protein | |
| 2925 | RQYP01000015.1 | GCA003859865_00616 | CDS | open | 51351-52751 | _na 466_aa | murJ | murein biosynthesis integral membrane protein MurJ |
| 2926 | RQYP01000015.1 | GCA003859865_00617 | CDS | open | 52738-54126 | _na 462_aa | cysS | cysteine--tRNA ligase |
| 2927 | RQYP01000015.1 | GCA003859865_00618 | CDS | open | 54111-55847 | _na 578_aa | ABC transporter%2C ATP-binding protein | |
| 2928 | RQYP01000015.1 | GCA003859865_00619 | CDS | open | 55890-56963 | _na 357_aa | quinone-dependent dihydroorotate dehydrogenase | |
| 2929 | RQYP01000015.1 | GCA003859865_00620 | CDS | open | 56972-58225 | _na 417_aa | Zn-dependent peptidase%2C M16 family | |
| 2930 | RQYP01000015.1 | GCA003859865_00621 | CDS | open | 58218-59114 | _na 298_aa | dapA | 4-hydroxy-tetrahydrodipicolinate synthase |
| 2931 | RQYP01000015.1 | GCA003859865_00622 | CDS | open | 59114-59899 | _na 261_aa | enoyl-ACP reductase | |
| 2932 | RQYP01000015.1 | GCA003859865_00623 | CDS | open | 59896-60771 | _na 291_aa | hypothetical protein | |
| 2933 | RQYP01000015.1 | GCA003859865_00624 | CDS | open | 60768-61310 | _na 180_aa | pgsA | CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase |
| 2934 | RQYP01000015.1 | GCA003859865_00625 | CDS | open | 61325-61504 | _na 59_aa | hypothetical protein | |
| 2935 | RQYP01000015.1 | GCA003859865_00626 | CDS | open | 61742-62143 | _na 133_aa | hypothetical protein | |
| 2936 | RQYP01000015.1 | GCA003859865_00627 | CDS | open | 63575-64687 | _na 370_aa | rseP | RIP metalloprotease RseP |
| 2937 | RQYP01000015.1 | GCA003859865_00628 | CDS | open | 64684-65319 | _na 211_aa | Pyridoxal phosphate homeostasis protein | |
| 2938 | RQYP01000015.1 | GCA003859865_00629 | CDS | open | 65331-65849 | _na 172_aa | hypothetical protein | |
| 2939 | RQYP01000015.1 | GCA003859865_00630 | CDS | open | 65850-66623 | _na 257_aa | hypothetical protein | |
| 2940 | RQYP01000015.1 | GCA003859865_00577 | gene | open | 30-353 | |||
| 2941 | RQYP01000015.1 | GCA003859865_00578 | gene | open | 376-1101 | |||
| 2942 | RQYP01000015.1 | GCA003859865_00579 | gene | open | 1098-1562 | |||
| 2943 | RQYP01000015.1 | GCA003859865_00580 | gene | open | 1590-2384 | |||
| 2944 | RQYP01000015.1 | GCA003859865_00581 | gene | open | 2997-3953 | lpxD | ||
| 2945 | RQYP01000015.1 | GCA003859865_00582 | gene | open | 3953-4420 | ilvN | ||
| 2946 | RQYP01000015.1 | GCA003859865_00583 | gene | open | 4423-6123 | |||
| 2947 | RQYP01000015.1 | GCA003859865_00584 | gene | open | 6829-7530 | flgH | ||
| 2948 | RQYP01000015.1 | GCA003859865_00585 | gene | open | 7595-8980 | pta | ||
| 2949 | RQYP01000015.1 | GCA003859865_00586 | gene | open | 8980-10206 | |||
| 2950 | RQYP01000015.1 | GCA003859865_00587 | gene | open | 10840-11781 | |||
| 2951 | RQYP01000015.1 | GCA003859865_00588 | gene | open | 12946-15942 | |||
| 2952 | RQYP01000015.1 | GCA003859865_00589 | gene | open | 15953-16693 | |||
| 2953 | RQYP01000015.1 | GCA003859865_00590 | gene | open | 16860-17924 | xerH | ||
| 2954 | RQYP01000015.1 | GCA003859865_00591 | gene | open | 19758-22331 | clpB | ||
| 2955 | RQYP01000015.1 | GCA003859865_00592 | gene | open | 22509-23813 | |||
| 2956 | RQYP01000015.1 | GCA003859865_00593 | gene | open | 23825-24541 | purC | ||
| 2957 | RQYP01000015.1 | GCA003859865_00594 | gene | open | 24543-24800 | purS | ||
| 2958 | RQYP01000015.1 | GCA003859865_00595 | gene | open | 24797-25462 | purQ | ||
| 2959 | RQYP01000015.1 | GCA003859865_00596 | gene | open | 25456-26793 | |||
| 2960 | RQYP01000015.1 | GCA003859865_00597 | gene | open | 26780-27466 | |||
| 2961 | RQYP01000015.1 | GCA003859865_00598 | gene | open | 27628-28521 | |||
| 2962 | RQYP01000015.1 | GCA003859865_00599 | gene | open | 28689-29594 | |||
| 2963 | RQYP01000015.1 | GCA003859865_00600 | gene | open | 29843-31696 | htpG | ||
| 2964 | RQYP01000015.1 | GCA003859865_00601 | gene | open | 32230-32736 | |||
| 2965 | RQYP01000015.1 | GCA003859865_00602 | gene | open | 32733-33449 | |||
| 2966 | RQYP01000015.1 | GCA003859865_00603 | gene | open | 33959-35119 | |||
| 2967 | RQYP01000015.1 | GCA003859865_00604 | gene | open | 35265-36431 | ftsW | ||
| 2968 | RQYP01000015.1 | GCA003859865_00605 | gene | open | 37019-39052 | |||
| 2969 | RQYP01000015.1 | GCA003859865_00606 | gene | open | 40034-41470 | |||
| 2970 | RQYP01000015.1 | GCA003859865_00607 | gene | open | 42102-43472 | |||
| 2971 | RQYP01000015.1 | GCA003859865_00608 | gene | open | 43472-43702 | |||
| 2972 | RQYP01000015.1 | GCA003859865_00609 | gene | open | 44314-45348 | |||
| 2973 | RQYP01000015.1 | GCA003859865_00610 | gene | open | 45362-45916 | ruvA | ||
| 2974 | RQYP01000015.1 | GCA003859865_00611 | gene | open | 45945-46508 | |||
| 2975 | RQYP01000015.1 | GCA003859865_00612 | gene | open | 46505-47437 | |||
| 2976 | RQYP01000015.1 | GCA003859865_00613 | gene | open | 47427-48170 | |||
| 2977 | RQYP01000015.1 | GCA003859865_00614 | gene | open | 48171-49307 | |||
| 2978 | RQYP01000015.1 | GCA003859865_00615 | gene | open | 49310-51211 | |||
| 2979 | RQYP01000015.1 | GCA003859865_00616 | gene | open | 51351-52751 | murJ | ||
| 2980 | RQYP01000015.1 | GCA003859865_00617 | gene | open | 52738-54126 | cysS | ||
| 2981 | RQYP01000015.1 | GCA003859865_00618 | gene | open | 54111-55847 | |||
| 2982 | RQYP01000015.1 | GCA003859865_00619 | gene | open | 55890-56963 | |||
| 2983 | RQYP01000015.1 | GCA003859865_00620 | gene | open | 56972-58225 | |||
| 2984 | RQYP01000015.1 | GCA003859865_00621 | gene | open | 58218-59114 | dapA | ||
| 2985 | RQYP01000015.1 | GCA003859865_00622 | gene | open | 59114-59899 | |||
| 2986 | RQYP01000015.1 | GCA003859865_00623 | gene | open | 59896-60771 | |||
| 2987 | RQYP01000015.1 | GCA003859865_00624 | gene | open | 60768-61310 | pgsA | ||
| 2988 | RQYP01000015.1 | GCA003859865_00625 | gene | open | 61325-61504 | |||
| 2989 | RQYP01000015.1 | GCA003859865_00626 | gene | open | 61742-62143 | |||
| 2990 | RQYP01000015.1 | GCA003859865_00627 | gene | open | 63575-64687 | rseP | ||
| 2991 | RQYP01000015.1 | GCA003859865_00628 | gene | open | 64684-65319 | |||
| 2992 | RQYP01000015.1 | GCA003859865_00629 | gene | open | 65331-65849 | |||
| 2993 | RQYP01000015.1 | GCA003859865_00630 | gene | open | 65850-66623 | |||
| 2994 | RQYP01000016.1 | repeat_region | open | 33987-34777 | CRISPR array with 12 repeats of length 30%2C consensus sequence GTTAAAATTTACTCCGTTGGAGTTTGAAAC and spacer length 35 | |||
| 2995 | RQYP01000016.1 | GCA003859865_00631 | CDS | open | 120-242 | _na 40_aa | Lipoprotein | |
| 2996 | RQYP01000016.1 | GCA003859865_00632 | CDS | open | 254-613 | _na 119_aa | hypothetical protein | |
| 2997 | RQYP01000016.1 | GCA003859865_00633 | CDS | open | 642-1157 | _na 171_aa | hypothetical protein | |
| 2998 | RQYP01000016.1 | GCA003859865_00634 | CDS | open | 1889-2164 | _na 91_aa | Putative membrane protein | |
| 2999 | RQYP01000016.1 | GCA003859865_00635 | CDS | open | 3271-3903 | _na 210_aa | protein-L-isoaspartate(D-aspartate) O-methyltransferase | |
| 3000 | RQYP01000016.1 | GCA003859865_00636 | CDS | open | 3900-4670 | _na 256_aa | Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase |

