HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Lachnoanaerobaculum orale (GCA_003862485.1)

Select a Genome:
BAKTA Annotations for GCA_003862485.1
Genome Selected: Lachnoanaerobaculum orale
ContigsBases CDSrRNA tmRNAtRNA
13 2800999 2563 12 1 51
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 5284 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 5284 [11 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1 RRCM01000001.1 GCA003862485_00767 gene open 773867-774202 ssrA
2 RRCM01000001.1 GCA003862485_00767 tmRNA open 773867-774202 ssrA transfer-messenger RNA%2C SsrA
3 RRCM01000001.1 GCA003862485_00065 gene open 40161-41692 rrs
4 RRCM01000001.1 GCA003862485_00066 gene open 41863-41980 rrf
5 RRCM01000001.1 GCA003862485_00068 gene open 42261-45156 rrl
6 RRCM01000001.1 GCA003862485_00136 gene open 129078-129248 Clostridiales-1
7 RRCM01000001.1 GCA003862485_00297 gene open 284141-284402 5_ureB_sRNA
8 RRCM01000001.1 GCA003862485_00658 gene open 661907-663435 rrs
9 RRCM01000001.1 GCA003862485_00659 gene open 663746-663863 rrf
10 RRCM01000001.1 GCA003862485_00661 gene open 664537-667424 rrl
11 RRCM01000001.1 GCA003862485_00834 gene open 850766-851084 RNaseP_bact_a
12 RRCM01000001.1 GCA003862485_00966 gene open 996494-998025 rrs
13 RRCM01000001.1 GCA003862485_00967 gene open 998251-998368 rrf
14 RRCM01000001.1 GCA003862485_00969 gene open 998852-1001736 rrl
15 RRCM01000001.1 GCA003862485_00136 ncRNA open 129078-129248 Clostridiales-1 RNA
16 RRCM01000001.1 GCA003862485_00297 ncRNA open 284141-284402 5' ureB small RNA
17 RRCM01000001.1 GCA003862485_00834 ncRNA open 850766-851084 Bacterial RNase P class A
18 RRCM01000001.1 regulatory_region open 129292-129534 T-box leader
19 RRCM01000001.1 regulatory_region open 574842-574995 glmS glucosamine-6-phosphate activated ribozyme aptamer
20 RRCM01000001.1 regulatory_region open 648554-648678 azaaromatic riboswitch aptamer (yjdF RNA)
21 RRCM01000001.1 regulatory_region open 1084537-1084636 TPP riboswitch aptamer (THI element)
22 RRCM01000001.1 regulatory_region open 1205519-1205652 Ribosomal protein L10 leader
23 RRCM01000001.1 regulatory_region open 1249346-1249524 Cobalamin riboswitch aptamer
24 RRCM01000001.1 regulatory_region open 1270226-1270342 FMN riboswitch aptamer (RFN element)
25 RRCM01000001.1 regulatory_region open 1588045-1588237 T-box leader
26 RRCM01000001.1 regulatory_region open 1669563-1669658 SAM riboswitch aptamer (S box leader)
27 RRCM01000001.1 regulatory_region open 1838933-1839008 S10-Clostridia ribosomal protein leader
28 RRCM01000001.1 regulatory_region open 1870529-1870624 Purine riboswitch aptamer
29 RRCM01000001.1 regulatory_region open 1952255-1952368 FMN riboswitch aptamer (RFN element)
30 RRCM01000001.1 regulatory_region open 1993306-1993532 T-box leader
31 RRCM01000001.1 GCA003862485_00065 rRNA open 40161-41692 rrs 16S ribosomal RNA
32 RRCM01000001.1 GCA003862485_00066 rRNA open 41863-41980 rrf 5S ribosomal RNA
33 RRCM01000001.1 GCA003862485_00068 rRNA open 42261-45156 rrl 23S ribosomal RNA
34 RRCM01000001.1 GCA003862485_00658 rRNA open 661907-663435 rrs 16S ribosomal RNA
35 RRCM01000001.1 GCA003862485_00659 rRNA open 663746-663863 rrf 5S ribosomal RNA
36 RRCM01000001.1 GCA003862485_00661 rRNA open 664537-667424 rrl 23S ribosomal RNA
37 RRCM01000001.1 GCA003862485_00966 rRNA open 996494-998025 rrs 16S ribosomal RNA
38 RRCM01000001.1 GCA003862485_00967 rRNA open 998251-998368 rrf 5S ribosomal RNA
39 RRCM01000001.1 GCA003862485_00969 rRNA open 998852-1001736 rrl 23S ribosomal RNA
40 RRCM01000001.1 repeat_region open 1298799-1298997 CRISPR array with 3 repeats of length 30%2C consensus sequence GTGAGTACCTTACCTATAAGGAATGGAAAC and spacer length 37
41 RRCM01000001.1 GCA003862485_00002 CDS open 238-1272 _na     344_aa Site-specific recombinase%2C phage integrase family
42 RRCM01000001.1 GCA003862485_00003 CDS open 1468-2328 _na     286_aa Lipoprotein
43 RRCM01000001.1 GCA003862485_00004 CDS open 2564-2944 _na     126_aa XRE family transcriptional regulator
44 RRCM01000001.1 GCA003862485_00005 CDS open 3114-3386 _na     90_aa hypothetical protein
45 RRCM01000001.1 GCA003862485_00006 CDS open 3438-3590 _na     50_aa hypothetical protein
46 RRCM01000001.1 GCA003862485_00007 CDS open 3601-3759 _na     52_aa hypothetical protein
47 RRCM01000001.1 GCA003862485_00008 CDS open 3756-4505 _na     249_aa Phage antirepressor Ant
48 RRCM01000001.1 GCA003862485_00009 CDS open 4514-4795 _na     93_aa hypothetical protein
49 RRCM01000001.1 GCA003862485_00010 CDS open 4792-4968 _na     58_aa hypothetical protein
50 RRCM01000001.1 GCA003862485_00011 CDS open 4928-5170 _na     80_aa XRE family transcriptional regulator
51 RRCM01000001.1 GCA003862485_00012 CDS open 5173-5820 _na     215_aa YqaJ-like viral recombinase domain protein
52 RRCM01000001.1 GCA003862485_00013 CDS open 5870-6694 _na     274_aa DUF1351 domain-containing protein
53 RRCM01000001.1 GCA003862485_00014 CDS open 6697-7614 _na     305_aa recT Recombinase%2C phage RecT family
54 RRCM01000001.1 GCA003862485_00015 CDS open 7923-8819 _na     298_aa Helix-turn-helix domain-containing protein
55 RRCM01000001.1 GCA003862485_00016 CDS open 8812-9237 _na     141_aa rusA Crossover junction endodeoxyribonuclease RusA
56 RRCM01000001.1 GCA003862485_00017 CDS open 9396-10328 _na     310_aa Adenylyl-sulfate reductase
57 RRCM01000001.1 GCA003862485_00018 CDS open 10325-10642 _na     105_aa PF14359 domain protein
58 RRCM01000001.1 GCA003862485_00019 CDS open 10696-11160 _na     154_aa DUF1449 domain-containing protein
59 RRCM01000001.1 GCA003862485_00020 CDS open 11210-11533 _na     107_aa Phage protein
60 RRCM01000001.1 GCA003862485_00021 CDS open 11526-11741 _na     71_aa hypothetical protein
61 RRCM01000001.1 GCA003862485_00022 CDS open 11742-12254 _na     170_aa N-6 DNA methylase
62 RRCM01000001.1 GCA003862485_00023 CDS open 12220-13206 _na     328_aa site-specific DNA-methyltransferase (adenine-specific)
63 RRCM01000001.1 GCA003862485_00024 CDS open 13230-13397 _na     55_aa hypothetical protein
64 RRCM01000001.1 GCA003862485_00025 CDS open 13390-13929 _na     179_aa hypothetical protein
65 RRCM01000001.1 GCA003862485_00026 CDS open 14043-14486 _na     147_aa hypothetical protein
66 RRCM01000001.1 GCA003862485_00027 CDS open 14458-14712 _na     84_aa Glutathione peroxidase
67 RRCM01000001.1 GCA003862485_00028 CDS open 14706-14978 _na     90_aa hypothetical protein
68 RRCM01000001.1 GCA003862485_00029 CDS open 14982-15332 _na     116_aa hypothetical protein
69 RRCM01000001.1 GCA003862485_00030 CDS open 15332-15745 _na     137_aa PF07374 family protein
70 RRCM01000001.1 GCA003862485_00031 CDS open 15942-16331 _na     129_aa HNH endonuclease
71 RRCM01000001.1 GCA003862485_00032 CDS open 16489-16968 _na     159_aa phage terminase small subunit P27 family
72 RRCM01000001.1 GCA003862485_00033 CDS open 16971-17654 _na     227_aa terminase large subunit domain-containing protein
73 RRCM01000001.1 GCA003862485_00034 CDS open 17693-18646 _na     317_aa GIY-YIG domain-containing protein
74 RRCM01000001.1 GCA003862485_00035 CDS open 18864-19916 _na     350_aa terL terminase TerL endonuclease subunit
75 RRCM01000001.1 GCA003862485_00036 CDS open 19918-21174 _na     418_aa phage portal protein
76 RRCM01000001.1 GCA003862485_00037 CDS open 21164-21820 _na     218_aa ATP-dependent Clp protease proteolytic subunit
77 RRCM01000001.1 GCA003862485_00038 CDS open 21834-22970 _na     378_aa phage major capsid protein
78 RRCM01000001.1 GCA003862485_00039 CDS open 23017-23304 _na     95_aa head-tail connector protein
79 RRCM01000001.1 GCA003862485_00040 CDS open 23301-23651 _na     116_aa phage head closure protein
80 RRCM01000001.1 GCA003862485_00041 CDS open 23644-24063 _na     139_aa Bacteriophage protein%2C PF04883 family
81 RRCM01000001.1 GCA003862485_00042 CDS open 24063-24503 _na     146_aa PF11367 family protein
82 RRCM01000001.1 GCA003862485_00043 CDS open 24506-25612 _na     368_aa Phage tail sheath-like protein
83 RRCM01000001.1 GCA003862485_00044 CDS open 25623-26057 _na     144_aa Phage portal protein
84 RRCM01000001.1 GCA003862485_00045 CDS open 26071-26514 _na     147_aa XkdN-like protein
85 RRCM01000001.1 GCA003862485_00046 CDS open 26538-26672 _na     44_aa hypothetical protein
86 RRCM01000001.1 GCA003862485_00047 CDS open 26672-28843 _na     723_aa Phage tail tape measure protein
87 RRCM01000001.1 GCA003862485_00048 CDS open 28827-29492 _na     221_aa xkdP Putative phage-like element PBSX protein XkdP
88 RRCM01000001.1 GCA003862485_00049 CDS open 29501-30718 _na     405_aa Phage late control protein D protein
89 RRCM01000001.1 GCA003862485_00050 CDS open 30720-31049 _na     109_aa DUF2577 domain-containing protein
90 RRCM01000001.1 GCA003862485_00051 CDS open 31046-31480 _na     144_aa DUF2634 domain-containing protein
91 RRCM01000001.1 GCA003862485_00052 CDS open 31467-32534 _na     355_aa Phage tail protein
92 RRCM01000001.1 GCA003862485_00053 CDS open 32531-33085 _na     184_aa DUF2313 domain-containing protein
93 RRCM01000001.1 GCA003862485_00054 CDS open 33089-33646 _na     185_aa Phage tail protein
94 RRCM01000001.1 GCA003862485_00055 CDS open 33648-34811 _na     387_aa Tail fiber protein
95 RRCM01000001.1 GCA003862485_00056 CDS open 34826-35170 _na     114_aa hypothetical protein
96 RRCM01000001.1 GCA003862485_00057 CDS open 35215-35397 _na     60_aa hypothetical protein
97 RRCM01000001.1 GCA003862485_00058 CDS open 35418-35903 _na     161_aa hypothetical protein
98 RRCM01000001.1 GCA003862485_00059 CDS open 35908-36120 _na     70_aa Holin
99 RRCM01000001.1 GCA003862485_00060 CDS open 36178-36996 _na     272_aa parB Chromosome partitioning protein ParB
100 RRCM01000001.1 GCA003862485_00061 CDS open 37006-37959 _na     317_aa Cell wall-binding protein
101 RRCM01000001.1 GCA003862485_00062 CDS open 38003-38401 _na     132_aa hypothetical protein
102 RRCM01000001.1 GCA003862485_00063 CDS open 38480-38716 _na     78_aa XRE family transcriptional regulator
103 RRCM01000001.1 GCA003862485_00064 CDS open 38782-38991 _na     69_aa hypothetical protein
104 RRCM01000001.1 GCA003862485_00070 CDS open 45703-46536 _na     277_aa Lipoprotein
105 RRCM01000001.1 GCA003862485_00071 CDS open 46937-47746 _na     269_aa TIGR00027 family methyltransferase
106 RRCM01000001.1 GCA003862485_00072 CDS open 47830-50220 _na     796_aa Clostripain family protein
107 RRCM01000001.1 GCA003862485_00073 CDS open 50346-50714 _na     122_aa Choline-binding protein A
108 RRCM01000001.1 GCA003862485_00074 CDS open 50863-51264 _na     133_aa Nodulation efficiency protein D
109 RRCM01000001.1 GCA003862485_00075 CDS open 51279-52193 _na     304_aa hflC Band 7 domain-containing protein
110 RRCM01000001.1 GCA003862485_00076 CDS open 52252-53652 _na     466_aa baeS histidine kinase
111 RRCM01000001.1 GCA003862485_00077 CDS open 53649-54356 _na     235_aa Stage 0 sporulation A-like protein
112 RRCM01000001.1 GCA003862485_00078 CDS open 54374-56731 _na     785_aa rqcU endonuclease MutS2
113 RRCM01000001.1 GCA003862485_00079 CDS open 56827-57870 _na     347_aa TPM domain-containing protein
114 RRCM01000001.1 GCA003862485_00080 CDS open 57874-60447 _na     857_aa secA preprotein translocase subunit SecA
115 RRCM01000001.1 GCA003862485_00081 CDS open 60704-62062 _na     452_aa norM putative multidrug resistance protein NorM
116 RRCM01000001.1 GCA003862485_00082 CDS open 62509-64458 _na     649_aa PTS system%2C glucose-like IIB component
117 RRCM01000001.1 GCA003862485_00083 CDS open 64521-65009 _na     162_aa Bacterial Pleckstrin-like y domain-containing protein
118 RRCM01000001.1 GCA003862485_00084 CDS open 65002-65856 _na     284_aa pucR PucR C-terminal helix-turn-helix domain-containing protein
119 RRCM01000001.1 GCA003862485_00085 CDS open 65923-67035 _na     370_aa malK ABC transporter domain-containing protein
120 RRCM01000001.1 GCA003862485_00086 CDS open 67297-68961 _na     554_aa Oligo-1%2C6-glucosidase
121 RRCM01000001.1 GCA003862485_00087 CDS open 69018-70373 _na     451_aa ABC transporter%2C solute-binding protein
122 RRCM01000001.1 GCA003862485_00088 CDS open 70601-71641 _na     346_aa ABC transmembrane type-1 domain-containing protein
123 RRCM01000001.1 GCA003862485_00089 CDS open 71641-72501 _na     286_aa ugpE ABC transmembrane type-1 domain-containing protein
124 RRCM01000001.1 GCA003862485_00090 CDS open 72561-74057 _na     498_aa malQ 4-alpha-glucanotransferase
125 RRCM01000001.1 GCA003862485_00091 CDS open 74113-75789 _na     558_aa amyA Glycosyl hydrolase family 13 catalytic domain-containing protein
126 RRCM01000001.1 GCA003862485_00092 CDS open 75903-76589 _na     228_aa TIGR01906 family protein
127 RRCM01000001.1 GCA003862485_00093 CDS open 76589-77206 _na     205_aa ntpD V-type ATP synthase subunit D
128 RRCM01000001.1 GCA003862485_00094 CDS open 77209-78636 _na     475_aa ntpB V-type ATP synthase beta chain
129 RRCM01000001.1 GCA003862485_00095 CDS open 78648-80414 _na     588_aa ntpA V-type ATP synthase alpha chain
130 RRCM01000001.1 GCA003862485_00096 CDS open 80414-80995 _na     193_aa ATP synthase%2C subunit E
131 RRCM01000001.1 GCA003862485_00097 CDS open 81111-81419 _na     102_aa ntpF ATP synthase subunit
132 RRCM01000001.1 GCA003862485_00098 CDS open 81431-81856 _na     141_aa ATP synthase F(0) sector subunit c
133 RRCM01000001.1 GCA003862485_00099 CDS open 81927-83852 _na     641_aa V-type ATP synthase subunit I
134 RRCM01000001.1 GCA003862485_00100 CDS open 83849-84916 _na     355_aa ATPase
135 RRCM01000001.1 GCA003862485_00101 CDS open 84919-85230 _na     103_aa ATPase
136 RRCM01000001.1 GCA003862485_00102 CDS open 85682-86599 _na     305_aa dppB ABC transmembrane type-1 domain-containing protein
137 RRCM01000001.1 GCA003862485_00103 CDS open 86653-87699 _na     348_aa dppC ABC transmembrane type-1 domain-containing protein
138 RRCM01000001.1 GCA003862485_00104 CDS open 87710-88723 _na     337_aa dppD ABC transporter domain-containing protein
139 RRCM01000001.1 GCA003862485_00105 CDS open 88708-89760 _na     350_aa dppD ABC transporter domain-containing protein
140 RRCM01000001.1 GCA003862485_00106 CDS open 89806-91461 _na     551_aa Peptide ABC transporter substrate-binding protein
141 RRCM01000001.1 GCA003862485_00107 CDS open 91489-93141 _na     550_aa ABC transporter%2C substrate-binding protein%2C family 5
142 RRCM01000001.1 GCA003862485_00108 CDS open 93386-95083 _na     565_aa Solute-binding protein family 5 domain-containing protein
143 RRCM01000001.1 GCA003862485_00109 CDS open 95193-95786 _na     197_aa Abortive infection protein AbiGI
144 RRCM01000001.1 GCA003862485_00110 CDS open 95783-96622 _na     279_aa Nucleotidyl transferase%2C PF08843 family
145 RRCM01000001.1 GCA003862485_00111 CDS open 96852-97037 _na     61_aa XRE family transcriptional regulator
146 RRCM01000001.1 GCA003862485_00112 CDS open 97418-98035 _na     205_aa acrR Transcriptional regulator%2C TetR family
147 RRCM01000001.1 GCA003862485_00113 CDS open 98123-98851 _na     242_aa rbbA ABC transporter%2C ATP-binding protein
148 RRCM01000001.1 GCA003862485_00114 CDS open 98826-100388 _na     520_aa ATP synthase F0%2C A subunit
149 RRCM01000001.1 GCA003862485_00115 CDS open 100362-101219 _na     285_aa araC AraC-like ligand binding domain / DNA-binding helix-turn-helix multi-domain protein
150 RRCM01000001.1 GCA003862485_00116 CDS open 101389-104412 _na     1007_aa Beta-galactosidase
151 RRCM01000001.1 GCA003862485_00117 CDS open 104437-105792 _na     451_aa melB Major facilitator superfamily (MFS) profile domain-containing protein
152 RRCM01000001.1 GCA003862485_00118 CDS open 106131-107198 _na     355_aa mviM Gfo/Idh/MocA-like oxidoreductase N-terminal domain-containing protein
153 RRCM01000001.1 GCA003862485_00119 CDS open 107198-107929 _na     243_aa thuA Trehalose utilization protein ThuA
154 RRCM01000001.1 GCA003862485_00120 CDS open 108134-108946 _na     270_aa ycjR Xylose isomerase-like TIM barrel domain-containing protein
155 RRCM01000001.1 GCA003862485_00121 CDS open 108981-110150 _na     389_aa Periplasmic binding protein domain-containing protein
156 RRCM01000001.1 GCA003862485_00122 CDS open 110190-111695 _na     501_aa ccmA heme ABC exporter ATP-binding protein CcmA
157 RRCM01000001.1 GCA003862485_00123 CDS open 111676-112635 _na     319_aa araH Autoinducer 2 import system permease protein LsrD
158 RRCM01000001.1 GCA003862485_00124 CDS open 112654-113829 _na     391_aa mviM Gfo/Idh/MocA-like oxidoreductase N-terminal domain-containing protein
159 RRCM01000001.1 GCA003862485_00125 CDS open 113826-114740 _na     304_aa ycjR Xylose isomerase-like TIM barrel domain-containing protein
160 RRCM01000001.1 GCA003862485_00126 CDS open 114974-117028 _na     684_aa lacI LacI family DNA-binding transcriptional regulator
161 RRCM01000001.1 GCA003862485_00127 CDS open 117098-121366 _na     1422_aa CoA-substrate-specific enzyme activase
162 RRCM01000001.1 GCA003862485_00128 CDS open 121621-122391 _na     256_aa trpA tryptophan synthase subunit alpha
163 RRCM01000001.1 GCA003862485_00129 CDS open 122384-123574 _na     396_aa trpB tryptophan synthase subunit beta
164 RRCM01000001.1 GCA003862485_00130 CDS open 123561-124175 _na     204_aa N-(5'-phosphoribosyl)anthranilate isomerase
165 RRCM01000001.1 GCA003862485_00131 CDS open 124162-124959 _na     265_aa trpC indole-3-glycerol phosphate synthase TrpC
166 RRCM01000001.1 GCA003862485_00132 CDS open 124952-125968 _na     338_aa Anthranilate phosphoribosyltransferase
167 RRCM01000001.1 GCA003862485_00133 CDS open 125965-126537 _na     190_aa Glutamine amidotransferase%2C class I
168 RRCM01000001.1 GCA003862485_00134 CDS open 126534-127985 _na     483_aa trpE anthranilate synthase component I
169 RRCM01000001.1 GCA003862485_00135 CDS open 127995-129008 _na     337_aa aroGA bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase
170 RRCM01000001.1 GCA003862485_00137 CDS open 129818-130639 _na     273_aa Peptidase S54 rhomboid domain-containing protein
171 RRCM01000001.1 GCA003862485_00138 CDS open 130744-132180 _na     478_aa pyk pyruvate kinase
172 RRCM01000001.1 GCA003862485_00139 CDS open 132356-132874 _na     172_aa Peptidyl-prolyl cis-trans isomerase
173 RRCM01000001.1 GCA003862485_00140 CDS open 132852-133478 _na     208_aa Acetyltransferase%2C GNAT family
174 RRCM01000001.1 GCA003862485_00141 CDS open 133598-134476 _na     292_aa ispE 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase
175 RRCM01000001.1 GCA003862485_00142 CDS open 134493-135173 _na     226_aa gntR HTH gntR-type domain-containing protein
176 RRCM01000001.1 GCA003862485_00143 CDS open 135173-136222 _na     349_aa D-alanine--D-alanine ligase
177 RRCM01000001.1 GCA003862485_00144 CDS open 136227-137027 _na     266_aa murI glutamate racemase
178 RRCM01000001.1 GCA003862485_00145 CDS open 137288-137734 _na     148_aa ywiB Rho guanine nucleotide exchange factor
179 RRCM01000001.1 GCA003862485_00146 CDS open 137762-138343 _na     193_aa Peptidase%2C S54 family
180 RRCM01000001.1 GCA003862485_00147 CDS open 138351-138587 _na     78_aa DUF3791 domain-containing protein
181 RRCM01000001.1 GCA003862485_00148 CDS open 138584-139057 _na     157_aa Sortase
182 RRCM01000001.1 GCA003862485_00149 CDS open 139054-139284 _na     76_aa DUF3791 domain-containing protein
183 RRCM01000001.1 GCA003862485_00150 CDS open 139438-139695 _na     85_aa Txe/YoeB family addiction module toxin
184 RRCM01000001.1 GCA003862485_00151 CDS open 139701-139958 _na     85_aa RelB/DinJ family addiction module antitoxin
185 RRCM01000001.1 GCA003862485_00152 CDS open 140134-143592 _na     1152_aa DNA polymerase III subunit alpha
186 RRCM01000001.1 GCA003862485_00153 CDS open 143715-144485 _na     256_aa mrp Iron-sulfur cluster carrier protein
187 RRCM01000001.1 GCA003862485_00154 CDS open 144536-145249 _na     237_aa RelA/SpoT domain-containing protein
188 RRCM01000001.1 GCA003862485_00155 CDS open 145304-146665 _na     453_aa norM putative multidrug resistance protein NorM
189 RRCM01000001.1 GCA003862485_00156 CDS open 146677-148041 _na     454_aa fumC class II fumarate hydratase
190 RRCM01000001.1 GCA003862485_00157 CDS open 148147-148677 _na     176_aa lepB signal peptidase I
191 RRCM01000001.1 GCA003862485_00158 CDS open 148697-149536 _na     279_aa ylqF ribosome biogenesis GTPase YlqF
192 RRCM01000001.1 GCA003862485_00159 CDS open 149543-150187 _na     214_aa ribonuclease HII
193 RRCM01000001.1 GCA003862485_00160 CDS open 150216-150521 _na     101_aa yraN YraN family protein
194 RRCM01000001.1 GCA003862485_00161 CDS open 150518-151369 _na     283_aa pgeF peptidoglycan editing factor PgeF
195 RRCM01000001.1 GCA003862485_00162 CDS open 151453-151758 _na     101_aa hypothetical protein
196 RRCM01000001.1 GCA003862485_00163 CDS open 151775-153055 _na     426_aa aRO8 Aminotransferase class I/classII domain-containing protein
197 RRCM01000001.1 GCA003862485_00164 CDS open 153058-154695 _na     545_aa uup ABC transporter domain-containing protein
198 RRCM01000001.1 GCA003862485_00165 CDS open 154634-155455 _na     273_aa xthA exodeoxyribonuclease III
199 RRCM01000001.1 GCA003862485_00166 CDS open 155480-157282 _na     600_aa glgX Glycogen debranching enzyme GlgX
200 RRCM01000001.1 GCA003862485_00167 CDS open 157279-157971 _na     230_aa Lipoprotein
201 RRCM01000001.1 GCA003862485_00169 CDS open 158229-158876 _na     215_aa Peptidase C26
202 RRCM01000001.1 GCA003862485_00170 CDS open 158884-159594 _na     236_aa Acyl-ACP thioesterase
203 RRCM01000001.1 GCA003862485_00171 CDS open 159604-160425 _na     273_aa S1 domain / S1 RNA binding domain multi-domain protein
204 RRCM01000001.1 GCA003862485_00172 CDS open 160474-161463 _na     329_aa SH3 domain protein
205 RRCM01000001.1 GCA003862485_00173 CDS open 161488-161724 _na     78_aa Polya polymerase
206 RRCM01000001.1 GCA003862485_00174 CDS open 161879-163237 _na     452_aa trkA Trk system potassium transporter TrkA
207 RRCM01000001.1 GCA003862485_00175 CDS open 163237-164685 _na     482_aa trkG Cation transporter
208 RRCM01000001.1 GCA003862485_00176 CDS open 164769-165839 _na     356_aa abcC ABC transporter domain-containing protein
209 RRCM01000001.1 GCA003862485_00177 CDS open 165796-166476 _na     226_aa metP ABC transmembrane type-1 domain-containing protein
210 RRCM01000001.1 GCA003862485_00178 CDS open 166536-167432 _na     298_aa Lipoprotein
211 RRCM01000001.1 GCA003862485_00179 CDS open 167814-168581 _na     255_aa thiF ThiF family protein
212 RRCM01000001.1 GCA003862485_00180 CDS open 168578-169975 _na     465_aa alsT Amino acid carrier protein
213 RRCM01000001.1 GCA003862485_00181 CDS open 170053-170361 _na     102_aa trxA thioredoxin
214 RRCM01000001.1 GCA003862485_00182 CDS open 170418-171329 _na     303_aa trxB Thioredoxin reductase
215 RRCM01000001.1 GCA003862485_00183 CDS open 171355-171900 _na     181_aa btuE Glutathione peroxidase
216 RRCM01000001.1 GCA003862485_00184 CDS open 171983-172426 _na     147_aa Organic hydroperoxide resistance transcriptional regulator
217 RRCM01000001.1 GCA003862485_00185 CDS open 172462-172986 _na     174_aa Hydrolase%2C NUDIX family
218 RRCM01000001.1 GCA003862485_00186 CDS open 173261-174079 _na     272_aa SCP domain-containing protein
219 RRCM01000001.1 GCA003862485_00187 CDS open 174260-174919 _na     219_aa ABC transmembrane type-1 domain-containing protein
220 RRCM01000001.1 GCA003862485_00188 CDS open 174900-175571 _na     223_aa hisM ABC transmembrane type-1 domain-containing protein
221 RRCM01000001.1 GCA003862485_00189 CDS open 175591-176364 _na     257_aa ABC transporter domain-containing protein
222 RRCM01000001.1 GCA003862485_00190 CDS open 176425-177294 _na     289_aa ABC transporter%2C substrate-binding protein%2C family 3
223 RRCM01000001.1 GCA003862485_00191 CDS open 177316-177804 _na     162_aa HD domain protein
224 RRCM01000001.1 GCA003862485_00192 CDS open 177888-178556 _na     222_aa insH Transposase InsH N-terminal domain-containing protein
225 RRCM01000001.1 GCA003862485_00193 CDS open 178704-179489 _na     261_aa transposase
226 RRCM01000001.1 GCA003862485_00194 CDS open 179594-179953 _na     119_aa Cupin domain protein
227 RRCM01000001.1 GCA003862485_00195 CDS open 180091-180726 _na     211_aa DUF421 domain-containing protein
228 RRCM01000001.1 GCA003862485_00196 CDS open 180728-181177 _na     149_aa DUF3290 domain-containing protein
229 RRCM01000001.1 GCA003862485_00197 CDS open 181378-182133 _na     251_aa ABC transporter%2C ATP-binding protein
230 RRCM01000001.1 GCA003862485_00198 CDS open 182167-182931 _na     254_aa dppD Dipeptide ABC transporter%2C ATP-binding protein DppD family protein
231 RRCM01000001.1 GCA003862485_00199 CDS open 182931-184493 _na     520_aa ABC transporter%2C substrate-binding protein%2C family 5
232 RRCM01000001.1 GCA003862485_00200 CDS open 184526-185323 _na     265_aa dppC Putative dipeptide ABC transporter%2C permease protein DppC
233 RRCM01000001.1 GCA003862485_00201 CDS open 185313-186260 _na     315_aa appB Putative oligopeptide ABC transporter%2C permease protein AppB
234 RRCM01000001.1 GCA003862485_00202 CDS open 186724-188892 _na     722_aa nrdD anaerobic ribonucleoside-triphosphate reductase
235 RRCM01000001.1 GCA003862485_00203 CDS open 189111-190337 _na     408_aa tyrS tyrosine--tRNA ligase
236 RRCM01000001.1 GCA003862485_00204 CDS open 190607-191635 _na     342_aa 3-deoxy-7-phosphoheptulonate synthase
237 RRCM01000001.1 GCA003862485_00205 CDS open 191635-192183 _na     182_aa nrdG anaerobic ribonucleoside-triphosphate reductase activating protein
238 RRCM01000001.1 GCA003862485_00206 CDS open 192155-192826 _na     223_aa Peptidase C39-like domain-containing protein
239 RRCM01000001.1 GCA003862485_00207 CDS open 192904-194364 _na     486_aa histidine kinase
240 RRCM01000001.1 GCA003862485_00208 CDS open 194386-195102 _na     238_aa Stage 0 sporulation A-like protein
241 RRCM01000001.1 GCA003862485_00209 CDS open 195225-196307 _na     360_aa dctP TRAP transporter solute receptor%2C DctP family
242 RRCM01000001.1 GCA003862485_00210 CDS open 196362-196898 _na     178_aa TRAP transporter%2C DctQ-like membrane protein
243 RRCM01000001.1 GCA003862485_00211 CDS open 196895-198190 _na     431_aa dctM TRAP C4-dicarboxylate transport system permease DctM subunit domain-containing protein
244 RRCM01000001.1 GCA003862485_00212 CDS open 198388-199722 _na     444_aa nox H2O-forming NADH oxidase
245 RRCM01000001.1 GCA003862485_00213 CDS open 199800-201245 _na     481_aa ptsG2 PTS system%2C N-acetylglucosamine-specific IIBC component
246 RRCM01000001.1 GCA003862485_00214 CDS open 201300-201776 _na     158_aa PTS system%2C glucose subfamily%2C IIA component
247 RRCM01000001.1 GCA003862485_00215 CDS open 201779-202615 _na     278_aa licT BglG family transcription antiterminator LicT
248 RRCM01000001.1 GCA003862485_00216 CDS open 202982-204169 _na     395_aa BMP family ABC transporter substrate-binding protein
249 RRCM01000001.1 GCA003862485_00217 CDS open 204183-205721 _na     512_aa ABC transporter%2C ATP-binding protein
250 RRCM01000001.1 GCA003862485_00218 CDS open 205711-206733 _na     340_aa Branched-chain amino acid ABC transporter%2C permease protein
251 RRCM01000001.1 GCA003862485_00219 CDS open 206770-207681 _na     303_aa Branched-chain amino acid ABC transporter%2C permease protein
252 RRCM01000001.1 GCA003862485_00220 CDS open 207694-208254 _na     186_aa Cysteine hydrolase
253 RRCM01000001.1 GCA003862485_00221 CDS open 208268-209218 _na     316_aa Carbohydrate kinase family protein
254 RRCM01000001.1 GCA003862485_00222 CDS open 209224-209982 _na     252_aa Uridine phosphorylase
255 RRCM01000001.1 GCA003862485_00223 CDS open 209979-210770 _na     263_aa BtpA/SgcQ family protein
256 RRCM01000001.1 GCA003862485_00224 CDS open 210781-211938 _na     385_aa Iron-containing alcohol dehydrogenase
257 RRCM01000001.1 GCA003862485_00225 CDS open 211939-212658 _na     239_aa tryptophan synthase
258 RRCM01000001.1 GCA003862485_00226 CDS open 212729-213463 _na     244_aa ubiC Transcriptional regulator%2C GntR family / UbiC transcription regulator-associated domain multi-domain protein
259 RRCM01000001.1 GCA003862485_00227 CDS open 213713-214399 _na     228_aa HTH gntR-type domain-containing protein
260 RRCM01000001.1 GCA003862485_00228 CDS open 214714-215484 _na     256_aa ATPase BadF/BadG/BcrA/BcrD type domain-containing protein
261 RRCM01000001.1 GCA003862485_00229 CDS open 215515-216744 _na     409_aa (R)-2-hydroxyglutaryl-CoA dehydratase subunit alpha
262 RRCM01000001.1 GCA003862485_00230 CDS open 216756-217862 _na     368_aa Benzoyl-CoA reductase
263 RRCM01000001.1 GCA003862485_00231 CDS open 217873-219027 _na     384_aa Amino acid permease/ SLC12A domain-containing protein
264 RRCM01000001.1 GCA003862485_00232 CDS open 219048-220280 _na     410_aa Cinnamoyl-CoA:phenyllactate CoA-transferase
265 RRCM01000001.1 GCA003862485_00233 CDS open 220364-221911 _na     515_aa AMP-dependent synthetase/ligase domain-containing protein
266 RRCM01000001.1 GCA003862485_00234 CDS open 221875-223023 _na     382_aa Acyl-CoA dehydrogenase
267 RRCM01000001.1 GCA003862485_00235 CDS open 223036-223824 _na     262_aa etfB electron transfer flavoprotein subunit beta
268 RRCM01000001.1 GCA003862485_00236 CDS open 223835-225016 _na     393_aa 4Fe-4S ferredoxin-type domain-containing protein
269 RRCM01000001.1 GCA003862485_00237 CDS open 225133-225573 _na     146_aa RpiB/LacA/LacB family sugar-phosphate isomerase
270 RRCM01000001.1 GCA003862485_00238 CDS open 225636-226172 _na     178_aa ycxB YcxB family protein
271 RRCM01000001.1 GCA003862485_00239 CDS open 226176-227204 _na     342_aa Putative 2-keto-3-deoxygluconate transporter
272 RRCM01000001.1 GCA003862485_00240 CDS open 227229-227837 _na     202_aa nucleotide-binding domain containing protein
273 RRCM01000001.1 GCA003862485_00241 CDS open 228080-228577 _na     165_aa hypothetical protein
274 RRCM01000001.1 GCA003862485_00242 CDS open 228583-229605 _na     340_aa pdxA 4-hydroxythreonine-4-phosphate dehydrogenase PdxA
275 RRCM01000001.1 GCA003862485_00243 CDS open 229909-230712 _na     267_aa tpiA triose-phosphate isomerase
276 RRCM01000001.1 GCA003862485_00244 CDS open 230716-231480 _na     254_aa deoR Transcriptional regulator%2C DeoR family
277 RRCM01000001.1 GCA003862485_00245 CDS open 231637-233223 _na     528_aa Stage 0 sporulation A-like protein
278 RRCM01000001.1 GCA003862485_00246 CDS open 233234-234202 _na     322_aa histidine kinase
279 RRCM01000001.1 GCA003862485_00247 CDS open 234199-235614 _na     471_aa ABC transporter domain-containing protein
280 RRCM01000001.1 GCA003862485_00248 CDS open 235726-236736 _na     336_aa lacI Periplasmic binding protein and sugar binding domain of the LacI family protein
281 RRCM01000001.1 GCA003862485_00249 CDS open 236824-238332 _na     502_aa ABC transporter%2C ATP-binding protein
282 RRCM01000001.1 GCA003862485_00250 CDS open 238322-239296 _na     324_aa Branched-chain amino acid ABC transporter%2C permease protein
283 RRCM01000001.1 GCA003862485_00251 CDS open 239293-240183 _na     296_aa AP endonuclease%2C family 2
284 RRCM01000001.1 GCA003862485_00252 CDS open 240187-240747 _na     186_aa Putative 6-phospho 3-hexuloisomerase
285 RRCM01000001.1 GCA003862485_00253 CDS open 240751-242499 _na     582_aa dhaL dihydroxyacetone kinase subunit DhaL
286 RRCM01000001.1 GCA003862485_00254 CDS open 242500-242943 _na     147_aa Sugar-phosphate isomerase%2C RpiB/LacA/LacB family
287 RRCM01000001.1 GCA003862485_00255 CDS open 243133-243600 _na     155_aa YcxB-like C-terminal domain-containing protein
288 RRCM01000001.1 GCA003862485_00256 CDS open 243597-244583 _na     328_aa dctP TRAP transporter solute receptor%2C DctP family
289 RRCM01000001.1 GCA003862485_00257 CDS open 244592-245794 _na     400_aa gldA Alcohol dehydrogenase iron-type/glycerol dehydrogenase GldA domain-containing protein
290 RRCM01000001.1 GCA003862485_00258 CDS open 245935-247107 _na     390_aa ATPase AAA-type core domain-containing protein
291 RRCM01000001.1 GCA003862485_00259 CDS open 247104-247274 _na     56_aa hypothetical protein
292 RRCM01000001.1 GCA003862485_00260 CDS open 247337-247540 _na     67_aa hypothetical protein
293 RRCM01000001.1 GCA003862485_00261 CDS open 247573-248046 _na     157_aa CYTH domain-containing protein
294 RRCM01000001.1 GCA003862485_00262 CDS open 248333-249757 _na     474_aa IS1634 family transposase
295 RRCM01000001.1 GCA003862485_00263 CDS open 249873-250151 _na     92_aa Transposase
296 RRCM01000001.1 GCA003862485_00264 CDS open 250449-250958 _na     169_aa hypothetical protein
297 RRCM01000001.1 GCA003862485_00265 CDS open 251077-252363 _na     428_aa tig trigger factor
298 RRCM01000001.1 GCA003862485_00266 CDS open 252438-253019 _na     193_aa clpP ATP-dependent Clp endopeptidase proteolytic subunit ClpP
299 RRCM01000001.1 GCA003862485_00267 CDS open 253029-254312 _na     427_aa clpX ATP-dependent Clp protease ATP-binding subunit ClpX
300 RRCM01000001.1 GCA003862485_00268 CDS open 254363-256657 _na     764_aa lon endopeptidase La
301 RRCM01000001.1 GCA003862485_00269 CDS open 256665-257261 _na     198_aa yihA ribosome biogenesis GTP-binding protein YihA/YsxC
302 RRCM01000001.1 GCA003862485_00270 CDS open 257266-257937 _na     223_aa Stage 0 sporulation A-like protein
303 RRCM01000001.1 GCA003862485_00271 CDS open 257940-258833 _na     297_aa histidine kinase
304 RRCM01000001.1 GCA003862485_00272 CDS open 258953-259711 _na     252_aa ABC transporter%2C ATP-binding protein
305 RRCM01000001.1 GCA003862485_00273 CDS open 259708-261672 _na     654_aa ABC3 transporter permease C-terminal domain-containing protein
306 RRCM01000001.1 GCA003862485_00274 CDS open 261749-263047 _na     432_aa M18 family aminopeptidase
307 RRCM01000001.1 GCA003862485_00275 CDS open 263048-264283 _na     411_aa ATP synthase F0%2C A subunit
308 RRCM01000001.1 GCA003862485_00276 CDS open 264339-264926 _na     195_aa DUF1877 domain-containing protein
309 RRCM01000001.1 GCA003862485_00277 CDS open 264937-266193 _na     418_aa Erythromycin esterase
310 RRCM01000001.1 GCA003862485_00278 CDS open 266270-266653 _na     127_aa Heavy metal-associated domain protein
311 RRCM01000001.1 GCA003862485_00279 CDS open 266840-267355 _na     171_aa Protein-disulfide isomerase
312 RRCM01000001.1 GCA003862485_00280 CDS open 267626-268219 _na     197_aa 3D domain protein
313 RRCM01000001.1 GCA003862485_00281 CDS open 268447-269343 _na     298_aa Polysaccharide deacetylase
314 RRCM01000001.1 GCA003862485_00282 CDS open 269635-270561 _na     308_aa K+-dependent Na+/Ca+ exchanger family protein
315 RRCM01000001.1 GCA003862485_00283 CDS open 270627-271988 _na     453_aa TIGR00366 family protein
316 RRCM01000001.1 GCA003862485_00284 CDS open 272208-272852 _na     214_aa Butyrate--acetoacetate CoA-transferase subunit B
317 RRCM01000001.1 GCA003862485_00285 CDS open 272852-273502 _na     216_aa Butyrate--acetoacetate CoA-transferase subunit A
318 RRCM01000001.1 GCA003862485_00286 CDS open 273505-274686 _na     393_aa paaJ acetyl-CoA C-acetyltransferase
319 RRCM01000001.1 GCA003862485_00287 CDS open 275164-275940 _na     258_aa 3-hydroxybutyryl-CoA dehydratase
320 RRCM01000001.1 GCA003862485_00288 CDS open 276013-276849 _na     278_aa 3-hydroxybutyryl-CoA dehydrogenase
321 RRCM01000001.1 GCA003862485_00289 CDS open 277031-278185 _na     384_aa caiA Butyryl-CoA dehydrogenase
322 RRCM01000001.1 GCA003862485_00290 CDS open 278212-278994 _na     260_aa fixA Electron transfer flavoprotein small subunit
323 RRCM01000001.1 GCA003862485_00291 CDS open 279008-280060 _na     350_aa fixB Electron transfer flavoprotein alpha/beta-subunit N-terminal domain-containing protein
324 RRCM01000001.1 GCA003862485_00292 CDS open 280229-282394 _na     721_aa cooS anaerobic carbon-monoxide dehydrogenase catalytic subunit
325 RRCM01000001.1 GCA003862485_00293 CDS open 282783-283301 _na     172_aa Acid-activated urea channel
326 RRCM01000001.1 GCA003862485_00294 CDS open 283315-283617 _na     100_aa urease subunit gamma
327 RRCM01000001.1 GCA003862485_00295 CDS open 283626-283943 _na     105_aa urease subunit beta
328 RRCM01000001.1 GCA003862485_00296 CDS open 283957-285678 _na     573_aa ureC urease subunit alpha
329 RRCM01000001.1 GCA003862485_00298 CDS open 285756-286196 _na     146_aa ureE Urease accessory protein UreE
330 RRCM01000001.1 GCA003862485_00299 CDS open 286193-286906 _na     237_aa ureF Urease accessory protein UreF
331 RRCM01000001.1 GCA003862485_00300 CDS open 286921-287535 _na     204_aa ureG urease accessory protein UreG
332 RRCM01000001.1 GCA003862485_00301 CDS open 287536-288369 _na     277_aa ureD Urease accessory protein UreD
333 RRCM01000001.1 GCA003862485_00302 CDS open 288381-289373 _na     330_aa cbiM cobalt transporter CbiM
334 RRCM01000001.1 GCA003862485_00303 CDS open 289351-290154 _na     267_aa Cobalt transport protein
335 RRCM01000001.1 GCA003862485_00304 CDS open 290151-290876 _na     241_aa ABC transporter%2C ATP-binding protein
336 RRCM01000001.1 GCA003862485_00305 CDS open 290977-291084 _na     35_aa hypothetical protein
337 RRCM01000001.1 GCA003862485_00306 CDS open 291240-292994 _na     584_aa IS1182 family transposase
338 RRCM01000001.1 GCA003862485_00307 CDS open 293170-294870 _na     566_aa norD VWFA domain-containing protein
339 RRCM01000001.1 GCA003862485_00308 CDS open 294867-295784 _na     305_aa ATPase dynein-related AAA domain-containing protein
340 RRCM01000001.1 GCA003862485_00309 CDS open 295869-297413 _na     514_aa cstA CstA N-terminal domain-containing protein
341 RRCM01000001.1 GCA003862485_00310 CDS open 297721-298650 _na     309_aa Succinylglutamate desuccinylase/aspartoacylase family protein
342 RRCM01000001.1 GCA003862485_00311 CDS open 298780-299721 _na     313_aa fabH Beta-ketoacyl-[acyl-carrier-protein] synthase III
343 RRCM01000001.1 GCA003862485_00312 CDS open 299784-300020 _na     78_aa acpP acyl carrier protein
344 RRCM01000001.1 GCA003862485_00313 CDS open 300071-301009 _na     312_aa fabK enoyl-[acyl-carrier-protein] reductase FabK
345 RRCM01000001.1 GCA003862485_00314 CDS open 301013-301930 _na     305_aa fabD ACP S-malonyltransferase
346 RRCM01000001.1 GCA003862485_00315 CDS open 301927-302673 _na     248_aa fabG 3-oxoacyl-[acyl-carrier-protein] reductase
347 RRCM01000001.1 GCA003862485_00316 CDS open 302685-303920 _na     411_aa fabF beta-ketoacyl-ACP synthase II
348 RRCM01000001.1 GCA003862485_00317 CDS open 303925-304359 _na     144_aa accB acetyl-CoA carboxylase biotin carboxyl carrier protein
349 RRCM01000001.1 GCA003862485_00318 CDS open 304365-304790 _na     141_aa fabZ 3-hydroxyacyl-ACP dehydratase FabZ
350 RRCM01000001.1 GCA003862485_00319 CDS open 304791-306137 _na     448_aa pccA acetyl-CoA carboxylase biotin carboxylase subunit
351 RRCM01000001.1 GCA003862485_00320 CDS open 306159-307859 _na     566_aa acetyl-CoA carboxylase carboxyltransferase subunit alpha
352 RRCM01000001.1 GCA003862485_00321 CDS open 307876-309057 _na     393_aa Oxidoreductase%2C 2-nitropropane dioxygenase family protein
353 RRCM01000001.1 GCA003862485_00322 CDS open 309315-310658 _na     447_aa Serine-type D-Ala-D-Ala carboxypeptidase
354 RRCM01000001.1 GCA003862485_00323 CDS open 310666-311526 _na     286_aa Ser/Thr phosphatase family protein
355 RRCM01000001.1 GCA003862485_00324 CDS open 311572-312366 _na     264_aa Segregation and condensation protein A
356 RRCM01000001.1 GCA003862485_00325 CDS open 312359-312955 _na     198_aa scpB SMC-Scp complex subunit ScpB
357 RRCM01000001.1 GCA003862485_00326 CDS open 312966-313397 _na     143_aa dut dUTP diphosphatase
358 RRCM01000001.1 GCA003862485_00327 CDS open 313369-314214 _na     281_aa Tetratricopeptide repeat / tetratricopeptide repeat multi-domain protein
359 RRCM01000001.1 GCA003862485_00328 CDS open 314222-315466 _na     414_aa hflX GTPase HflX
360 RRCM01000001.1 GCA003862485_00329 CDS open 315561-316256 _na     231_aa NC domain protein
361 RRCM01000001.1 GCA003862485_00330 CDS open 316350-316994 _na     214_aa yigZ YigZ family protein
362 RRCM01000001.1 GCA003862485_00331 CDS open 317027-317926 _na     299_aa CorA-like protein
363 RRCM01000001.1 GCA003862485_00332 CDS open 318014-319129 _na     371_aa pfkB Kinase%2C PfkB family
364 RRCM01000001.1 GCA003862485_00333 CDS open 319139-319981 _na     280_aa Class II fructose-bisphosphate aldolase
365 RRCM01000001.1 GCA003862485_00334 CDS open 320132-321145 _na     337_aa rbsB Periplasmic binding protein domain-containing protein
366 RRCM01000001.1 GCA003862485_00335 CDS open 321206-322723 _na     505_aa Ribose/galactose/methyl galactoside import ATP-binding protein
367 RRCM01000001.1 GCA003862485_00336 CDS open 322732-323688 _na     318_aa rbsC Ribose transport system permease rbsC
368 RRCM01000001.1 GCA003862485_00337 CDS open 323688-324650 _na     320_aa Sugar-binding domain protein
369 RRCM01000001.1 GCA003862485_00338 CDS open 324652-325983 _na     443_aa histidine kinase
370 RRCM01000001.1 GCA003862485_00339 CDS open 325976-326629 _na     217_aa citB Stage 0 sporulation A-like protein
371 RRCM01000001.1 GCA003862485_00340 CDS open 326626-327942 _na     438_aa ABC transporter%2C solute-binding protein
372 RRCM01000001.1 GCA003862485_00341 CDS open 327939-328622 _na     227_aa ydaE D-lyxose ketol-isomerase
373 RRCM01000001.1 GCA003862485_00342 CDS open 328712-329713 _na     333_aa lacI Transcriptional regulator%2C LacI family
374 RRCM01000001.1 GCA003862485_00343 CDS open 329739-331130 _na     463_aa ABC transporter%2C solute-binding protein
375 RRCM01000001.1 GCA003862485_00344 CDS open 331184-332083 _na     299_aa ABC transmembrane type-1 domain-containing protein
376 RRCM01000001.1 GCA003862485_00345 CDS open 332095-332934 _na     279_aa ABC transmembrane type-1 domain-containing protein
377 RRCM01000001.1 GCA003862485_00346 CDS open 332946-335234 _na     762_aa Glycoside hydrolase family 65 protein
378 RRCM01000001.1 GCA003862485_00347 CDS open 335251-335895 _na     214_aa pgmB beta-phosphoglucomutase
379 RRCM01000001.1 GCA003862485_00348 CDS open 335908-338289 _na     793_aa Glycosyl hydrolase%2C family 31
380 RRCM01000001.1 GCA003862485_00349 CDS open 338448-339035 _na     195_aa DUF3990 domain-containing protein
381 RRCM01000001.1 GCA003862485_00350 CDS open 339028-339282 _na     84_aa hypothetical protein
382 RRCM01000001.1 GCA003862485_00351 CDS open 339293-339670 _na     125_aa secB Preprotein translocase subunit SecB
383 RRCM01000001.1 GCA003862485_00352 CDS open 339761-340111 _na     116_aa arsC Transcriptional regulator%2C Spx/MgsR family
384 RRCM01000001.1 GCA003862485_00353 CDS open 340090-342321 _na     743_aa bglX beta-glucosidase
385 RRCM01000001.1 GCA003862485_00354 CDS open 342476-343390 _na     304_aa N-acetylneuraminate lyase
386 RRCM01000001.1 GCA003862485_00355 CDS open 343387-344337 _na     316_aa ROK family protein (Putative glucokinase)
387 RRCM01000001.1 GCA003862485_00356 CDS open 344387-345751 _na     454_aa TrpB-like pyridoxal phosphate-dependent enzyme
388 RRCM01000001.1 GCA003862485_00357 CDS open 345916-347247 _na     443_aa uraA Xanthine permease
389 RRCM01000001.1 GCA003862485_00358 CDS open 347262-348209 _na     315_aa arcC carbamate kinase
390 RRCM01000001.1 GCA003862485_00359 CDS open 348349-349545 _na     398_aa ygeW knotted carbamoyltransferase YgeW
391 RRCM01000001.1 GCA003862485_00360 CDS open 349665-350993 _na     442_aa ygeY YgeY family selenium metabolism-linked hydrolase
392 RRCM01000001.1 GCA003862485_00361 CDS open 351030-352223 _na     397_aa dpaL diaminopropionate ammonia-lyase
393 RRCM01000001.1 GCA003862485_00362 CDS open 352260-352922 _na     220_aa YheO-like / HTH domain multi-domain protein
394 RRCM01000001.1 GCA003862485_00363 CDS open 353299-353808 _na     169_aa Lipoprotein
395 RRCM01000001.1 GCA003862485_00364 CDS open 353811-354290 _na     159_aa tadA tRNA adenosine(34) deaminase TadA
396 RRCM01000001.1 GCA003862485_00365 CDS open 354483-355178 _na     231_aa ompR Stage 0 sporulation A-like protein
397 RRCM01000001.1 GCA003862485_00366 CDS open 355162-357450 _na     762_aa histidine kinase
398 RRCM01000001.1 GCA003862485_00367 CDS open 357591-359402 _na     603_aa ftsH ATP-dependent zinc metalloprotease FtsH
399 RRCM01000001.1 GCA003862485_00368 CDS open 359564-360619 _na     351_aa prfB peptide chain release factor 2
400 RRCM01000001.1 GCA003862485_00369 CDS open 360669-361313 _na     214_aa hypothetical protein
401 RRCM01000001.1 GCA003862485_00370 CDS open 361448-362515 _na     355_aa ABC transporter%2C solute-binding protein
402 RRCM01000001.1 GCA003862485_00371 CDS open 362651-363772 _na     373_aa ABC transporter domain-containing protein
403 RRCM01000001.1 GCA003862485_00372 CDS open 363762-365417 _na     551_aa ABC transmembrane type-1 domain-containing protein
404 RRCM01000001.1 GCA003862485_00373 CDS open 365453-367147 _na     564_aa histidine kinase
405 RRCM01000001.1 GCA003862485_00374 CDS open 367160-367954 _na     264_aa Stage 0 sporulation A-like protein
406 RRCM01000001.1 GCA003862485_00375 CDS open 368066-368353 _na     95_aa rpsF 30S ribosomal protein S6
407 RRCM01000001.1 GCA003862485_00376 CDS open 368377-368826 _na     149_aa ssb Single-stranded DNA-binding protein
408 RRCM01000001.1 GCA003862485_00377 CDS open 368854-369123 _na     89_aa rpsR 30S ribosomal protein S18
409 RRCM01000001.1 GCA003862485_00378 CDS open 369289-370632 _na     447_aa Cell wall-binding protein
410 RRCM01000001.1 GCA003862485_00379 CDS open 370643-371053 _na     136_aa HIT domain-containing protein
411 RRCM01000001.1 GCA003862485_00380 CDS open 371050-371682 _na     210_aa Peptidase%2C S54 family
412 RRCM01000001.1 GCA003862485_00381 CDS open 371771-372556 _na     261_aa rpsB 30S ribosomal protein S2
413 RRCM01000001.1 GCA003862485_00382 CDS open 372643-373587 _na     314_aa tsf translation elongation factor Ts
414 RRCM01000001.1 GCA003862485_00383 CDS open 373658-373882 _na     74_aa Nif11 domain-containing protein
415 RRCM01000001.1 GCA003862485_00384 CDS open 373845-374609 _na     254_aa PHP domain protein
416 RRCM01000001.1 GCA003862485_00385 CDS open 374633-376021 _na     462_aa MATE efflux family protein
417 RRCM01000001.1 GCA003862485_00386 CDS open 376014-376883 _na     289_aa Putative membrane protein
418 RRCM01000001.1 GCA003862485_00387 CDS open 377044-377988 _na     314_aa lysR LysR substrate binding domain protein
419 RRCM01000001.1 GCA003862485_00388 CDS open 378086-380053 _na     655_aa uvrB excinuclease ABC subunit UvrB
420 RRCM01000001.1 GCA003862485_00389 CDS open 380116-380886 _na     256_aa Threonine/serine exporter-like N-terminal domain-containing protein
421 RRCM01000001.1 GCA003862485_00390 CDS open 380894-381316 _na     140_aa thrE Threonine/Serine exporter ThrE domain-containing protein
422 RRCM01000001.1 GCA003862485_00391 CDS open 381686-383152 _na     488_aa xylB xylulokinase
423 RRCM01000001.1 GCA003862485_00392 CDS open 383163-383618 _na     151_aa bcp thioredoxin-dependent peroxiredoxin
424 RRCM01000001.1 GCA003862485_00393 CDS open 383615-384364 _na     249_aa yaaA peroxide stress protein YaaA
425 RRCM01000001.1 GCA003862485_00394 CDS open 384369-384914 _na     181_aa YbaK/aminoacyl-tRNA synthetase-associated domain-containing protein
426 RRCM01000001.1 GCA003862485_00395 CDS open 384907-386373 _na     488_aa DNA methylase
427 RRCM01000001.1 GCA003862485_00396 CDS open 386446-387411 _na     321_aa yhcG Cytoplasmic protein
428 RRCM01000001.1 GCA003862485_00397 CDS open 387489-388001 _na     170_aa Lipoprotein
429 RRCM01000001.1 GCA003862485_00398 CDS open 388571-389320 _na     249_aa hypothetical protein
430 RRCM01000001.1 GCA003862485_00399 CDS open 389428-389931 _na     167_aa DUF4825 domain-containing protein
431 RRCM01000001.1 GCA003862485_00400 CDS open 390051-390218 _na     55_aa hypothetical protein
432 RRCM01000001.1 GCA003862485_00401 CDS open 390233-390982 _na     249_aa hypothetical protein
433 RRCM01000001.1 GCA003862485_00402 CDS open 390969-391511 _na     180_aa Bypass of forespore C C-terminal domain-containing protein
434 RRCM01000001.1 GCA003862485_00403 CDS open 391682-392431 _na     249_aa hypothetical protein
435 RRCM01000001.1 GCA003862485_00404 CDS open 392462-393487 _na     341_aa DUF4474 domain-containing protein
436 RRCM01000001.1 GCA003862485_00405 CDS open 393487-394059 _na     190_aa Lipoprotein
437 RRCM01000001.1 GCA003862485_00406 CDS open 394059-394382 _na     107_aa WXG100 family type VII secretion target
438 RRCM01000001.1 GCA003862485_00407 CDS open 394379-394960 _na     193_aa DUF5104 domain-containing protein
439 RRCM01000001.1 GCA003862485_00408 CDS open 395144-395716 _na     190_aa DUF5104 domain-containing protein
440 RRCM01000001.1 GCA003862485_00409 CDS open 395814-396272 _na     152_aa GyrI-like small molecule binding domain-containing protein
441 RRCM01000001.1 GCA003862485_00410 CDS open 396297-397694 _na     465_aa DUF4825 domain-containing protein
442 RRCM01000001.1 GCA003862485_00411 CDS open 397757-399040 _na     427_aa DUF4825 domain-containing protein
443 RRCM01000001.1 GCA003862485_00412 CDS open 399182-400678 _na     498_aa glpK glycerol kinase GlpK
444 RRCM01000001.1 GCA003862485_00413 CDS open 400730-401005 _na     91_aa Chorismate mutase
445 RRCM01000001.1 GCA003862485_00414 CDS open 401214-401612 _na     132_aa Rubrerythrin diiron-binding domain-containing protein
446 RRCM01000001.1 GCA003862485_00415 CDS open 401693-402628 _na     311_aa Phosphatidylglycerol lysyltransferase C-terminal domain-containing protein
447 RRCM01000001.1 GCA003862485_00416 CDS open 402632-403675 _na     347_aa N-acetyltransferase domain-containing protein
448 RRCM01000001.1 GCA003862485_00417 CDS open 403774-404418 _na     214_aa Peptidase C39-like domain-containing protein
449 RRCM01000001.1 GCA003862485_00418 CDS open 404465-405091 _na     208_aa RelA/SpoT domain-containing protein
450 RRCM01000001.1 GCA003862485_00419 CDS open 405063-405287 _na     74_aa DUF6718 domain-containing protein
451 RRCM01000001.1 GCA003862485_00420 CDS open 405447-405701 _na     84_aa Antitoxin
452 RRCM01000001.1 GCA003862485_00421 CDS open 405844-406938 _na     364_aa Glycerol dehydrogenase
453 RRCM01000001.1 GCA003862485_00422 CDS open 407037-407546 _na     169_aa PH domain-containing protein
454 RRCM01000001.1 GCA003862485_00423 CDS open 407676-408176 _na     166_aa DUF1643 domain-containing protein
455 RRCM01000001.1 GCA003862485_00424 CDS open 408288-409310 _na     340_aa Nucleotidyltransferase
456 RRCM01000001.1 GCA003862485_00425 CDS open 409300-410094 _na     264_aa Nucleotidyltransferase
457 RRCM01000001.1 GCA003862485_00426 CDS open 410544-410858 _na     104_aa DNA-binding helix-turn-helix protein
458 RRCM01000001.1 GCA003862485_00427 CDS open 410859-412223 _na     454_aa ImmA/IrrE family metallo-endopeptidase
459 RRCM01000001.1 GCA003862485_00428 CDS open 412378-412851 _na     157_aa wzb protein-tyrosine-phosphatase
460 RRCM01000001.1 GCA003862485_00429 CDS open 412838-413635 _na     265_aa Beta-carotene 15%2C15'-monooxygenase
461 RRCM01000001.1 GCA003862485_00430 CDS open 413704-415044 _na     446_aa ATPase
462 RRCM01000001.1 GCA003862485_00431 CDS open 415306-416520 _na     404_aa eutG Alcohol dehydrogenase iron-type/glycerol dehydrogenase GldA domain-containing protein
463 RRCM01000001.1 GCA003862485_00432 CDS open 416742-417161 _na     139_aa Ferric uptake regulator family protein
464 RRCM01000001.1 GCA003862485_00433 CDS open 417158-418123 _na     321_aa ABC transporter%2C substrate-binding protein
465 RRCM01000001.1 GCA003862485_00434 CDS open 418135-418806 _na     223_aa ABC transporter%2C ATP-binding protein
466 RRCM01000001.1 GCA003862485_00435 CDS open 418803-419633 _na     276_aa ABC 3 transport family protein
467 RRCM01000001.1 GCA003862485_00436 CDS open 419803-421332 _na     509_aa gpmI 2%2C3-bisphosphoglycerate-independent phosphoglycerate mutase
468 RRCM01000001.1 GCA003862485_00437 CDS open 421607-422713 _na     368_aa SLH domain-containing protein
469 RRCM01000001.1 GCA003862485_00438 CDS open 422724-424496 _na     590_aa Efflux transporter%2C RND family%2C MFP subunit
470 RRCM01000001.1 GCA003862485_00439 CDS open 424496-425200 _na     234_aa lolD ABC transporter domain-containing protein
471 RRCM01000001.1 GCA003862485_00440 CDS open 425166-426362 _na     398_aa Efflux ABC transporter%2C permease protein
472 RRCM01000001.1 GCA003862485_00441 CDS open 426509-427318 _na     269_aa CAAX amino terminal protease family protein
473 RRCM01000001.1 GCA003862485_00442 CDS open 427315-428334 _na     339_aa wcaA Glycosyltransferase 2-like domain-containing protein
474 RRCM01000001.1 GCA003862485_00445 CDS open 428727-430139 _na     470_aa uxaC glucuronate isomerase
475 RRCM01000001.1 GCA003862485_00446 CDS open 430232-431233 _na     333_aa lacI Transcriptional regulator%2C LacI family
476 RRCM01000001.1 GCA003862485_00447 CDS open 431400-432878 _na     492_aa SAF domain-containing protein
477 RRCM01000001.1 GCA003862485_00448 CDS open 432878-433633 _na     251_aa iclR Transcriptional regulator%2C IclR family protein
478 RRCM01000001.1 GCA003862485_00449 CDS open 433740-434390 _na     216_aa eda 2-dehydro-3-deoxyphosphogluconate aldolase/4-hydroxy-2-oxoglutarate aldolase
479 RRCM01000001.1 GCA003862485_00450 CDS open 434404-435435 _na     343_aa rbsK Carbohydrate kinase PfkB domain-containing protein
480 RRCM01000001.1 GCA003862485_00451 CDS open 435707-436606 _na     299_aa yobV HTH deoR-type domain-containing protein
481 RRCM01000001.1 GCA003862485_00452 CDS open 436670-437284 _na     204_aa mA1133 GyrI-like small molecule binding domain-containing protein
482 RRCM01000001.1 GCA003862485_00453 CDS open 437297-437470 _na     57_aa Mobile element protein
483 RRCM01000001.1 GCA003862485_00454 CDS open 437421-437660 _na     79_aa ClbS/DfsB family four-helix bundle protein
484 RRCM01000001.1 GCA003862485_00455 CDS open 437715-438029 _na     104_aa RelE/StbE family addiction module toxin
485 RRCM01000001.1 GCA003862485_00456 CDS open 438016-438288 _na     90_aa Antitoxin
486 RRCM01000001.1 GCA003862485_00457 CDS open 438449-441049 _na     866_aa adhE bifunctional acetaldehyde-CoA/alcohol dehydrogenase
487 RRCM01000001.1 GCA003862485_00458 CDS open 441074-441829 _na     251_aa cotS Aminoglycoside phosphotransferase domain-containing protein
488 RRCM01000001.1 GCA003862485_00459 CDS open 441955-443100 _na     381_aa Cation diffusion facilitator family transporter
489 RRCM01000001.1 GCA003862485_00460 CDS open 443440-448140 _na     1566_aa Cell wall-binding repeat protein
490 RRCM01000001.1 GCA003862485_00461 CDS open 448412-452299 _na     1295_aa rpoB DNA-directed RNA polymerase subunit beta
491 RRCM01000001.1 GCA003862485_00462 CDS open 452395-456225 _na     1276_aa rpoC DNA-directed RNA polymerase subunit beta'
492 RRCM01000001.1 GCA003862485_00463 CDS open 456164-456283 _na     39_aa hypothetical protein
493 RRCM01000001.1 GCA003862485_00464 CDS open 456589-457467 _na     292_aa Transposase (putative) YhgA-like domain-containing protein
494 RRCM01000001.1 GCA003862485_00465 CDS open 457714-458445 _na     243_aa cas6 CRISPR-associated endoribonuclease Cas6
495 RRCM01000001.1 GCA003862485_00466 CDS open 458654-459802 _na     382_aa Metallo-beta-lactamase domain protein
496 RRCM01000001.1 GCA003862485_00467 CDS open 459815-460900 _na     361_aa grpE Nucleotide exchange factor GrpE
497 RRCM01000001.1 GCA003862485_00468 CDS open 460897-463677 _na     926_aa dnaK Chaperone protein DnaK
498 RRCM01000001.1 GCA003862485_00469 CDS open 463698-464678 _na     326_aa Thermophilic metalloprotease
499 RRCM01000001.1 GCA003862485_00470 CDS open 464884-465585 _na     233_aa DUF969 domain-containing protein
500 RRCM01000001.1 GCA003862485_00471 CDS open 465585-466547 _na     320_aa Permease