HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Corynebacterium bovis (GCA_003932215.1)

Select a Genome:
BAKTA Annotations for GCA_003932215.1
Genome Selected: Corynebacterium bovis
ContigsBases CDSrRNA tmRNAtRNA
31 2628675 2103 3 1 52
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4327 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:2]    |    Number of Records Found: 4327 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
501 PQNK01000002.1 repeat_region open 190472-191743 CRISPR array with 21 repeats of length 28%2C consensus sequence GTGCTCCCCGCGTGAGCGGGGATGATCC and spacer length 33
502 PQNK01000002.1 GCA003932215_00871 CDS open 1270-3567 _na     765_aa copD Copper resistance protein CopD
503 PQNK01000002.1 GCA003932215_00872 CDS open 3814-4449 _na     211_aa Single-stranded DNA-binding protein
504 PQNK01000002.1 GCA003932215_00873 CDS open 4678-6348 _na     556_aa ettA energy-dependent translational throttle protein EttA
505 PQNK01000002.1 GCA003932215_00874 CDS open 6477-7352 _na     291_aa Hedgehog/Intein (Hint) domain-containing protein
506 PQNK01000002.1 GCA003932215_00875 CDS open 7230-7559 _na     109_aa hypothetical protein
507 PQNK01000002.1 GCA003932215_00876 CDS open 7755-8306 _na     183_aa Globin
508 PQNK01000002.1 GCA003932215_00877 CDS open 8303-11038 _na     911_aa pepN aminopeptidase N
509 PQNK01000002.1 GCA003932215_00878 CDS open 11167-11805 _na     212_aa dsbA Disulfide bond formation protein DsbA
510 PQNK01000002.1 GCA003932215_00879 CDS open 12077-12655 _na     192_aa Antitoxin SocA-like Panacea domain-containing protein
511 PQNK01000002.1 GCA003932215_00880 CDS open 12652-13041 _na     129_aa Type II toxin-antitoxin system death-on-curing family toxin
512 PQNK01000002.1 GCA003932215_00881 CDS open 13535-13687 _na     50_aa hypothetical protein
513 PQNK01000002.1 GCA003932215_00882 CDS open 13938-14423 _na     161_aa ribose-5-phosphate isomerase
514 PQNK01000002.1 GCA003932215_00883 CDS open 14834-15061 _na     75_aa Transcriptional regulator
515 PQNK01000002.1 GCA003932215_00884 CDS open 15701-17458 _na     585_aa pyruvate dehydrogenase
516 PQNK01000002.1 GCA003932215_00885 CDS open 17949-20483 _na     844_aa site-specific DNA-methyltransferase (adenine-specific)
517 PQNK01000002.1 GCA003932215_00886 CDS open 20456-22555 _na     699_aa phospholipase C
518 PQNK01000002.1 GCA003932215_00889 CDS open 23740-25398 _na     552_aa tig trigger factor
519 PQNK01000002.1 GCA003932215_00890 CDS open 25760-26401 _na     213_aa ATP-dependent Clp protease proteolytic subunit
520 PQNK01000002.1 GCA003932215_00891 CDS open 26466-27179 _na     237_aa clpP2 ATP-dependent Clp protease proteolytic subunit 2
521 PQNK01000002.1 GCA003932215_00892 CDS open 27402-28688 _na     428_aa clpX ATP-dependent Clp protease ATP-binding subunit ClpX
522 PQNK01000002.1 GCA003932215_00893 CDS open 28789-29751 _na     320_aa tetR TetR family transcriptional regulator
523 PQNK01000002.1 GCA003932215_00894 CDS open 30111-31301 _na     396_aa malate dehydrogenase
524 PQNK01000002.1 GCA003932215_00895 CDS open 31326-34121 _na     931_aa valine--tRNA ligase
525 PQNK01000002.1 GCA003932215_00896 CDS open 34118-35767 _na     549_aa folC bifunctional tetrahydrofolate synthase/dihydrofolate synthase
526 PQNK01000002.1 GCA003932215_00897 CDS open 35767-36360 _na     197_aa Cytokinin riboside 5'-monophosphate phosphoribohydrolase
527 PQNK01000002.1 GCA003932215_00898 CDS open 36449-36958 _na     169_aa DUF4233 domain-containing protein
528 PQNK01000002.1 GCA003932215_00899 CDS open 37047-37466 _na     139_aa hypothetical protein
529 PQNK01000002.1 GCA003932215_00900 CDS open 37606-38421 _na     271_aa hypothetical protein
530 PQNK01000002.1 GCA003932215_00901 CDS open 38661-43112 _na     1483_aa Ribonuclease E
531 PQNK01000002.1 GCA003932215_00902 CDS open 43501-43806 _na     101_aa rplU 50S ribosomal protein L21
532 PQNK01000002.1 GCA003932215_00903 CDS open 43850-44122 _na     90_aa rpmA 50S ribosomal protein L27
533 PQNK01000002.1 GCA003932215_00904 CDS open 44245-45759 _na     504_aa obgE GTPase ObgE
534 PQNK01000002.1 GCA003932215_00905 CDS open 45886-47175 _na     429_aa Glutamate 5-kinase
535 PQNK01000002.1 GCA003932215_00906 CDS open 47200-48507 _na     435_aa glutamate-5-semialdehyde dehydrogenase
536 PQNK01000002.1 GCA003932215_00907 CDS open 48640-49803 _na     387_aa YwiC-like family protein
537 PQNK01000002.1 GCA003932215_00908 CDS open 49918-50715 _na     265_aa putative nicotinate-nucleotide adenylyltransferase
538 PQNK01000002.1 GCA003932215_00909 CDS open 50887-51360 _na     157_aa rsfS ribosome silencing factor
539 PQNK01000002.1 GCA003932215_00910 CDS open 51371-52303 _na     310_aa Histidine phosphatase family protein
540 PQNK01000002.1 GCA003932215_00911 CDS open 52300-53349 _na     349_aa EDD domain protein
541 PQNK01000002.1 GCA003932215_00912 CDS open 53590-55203 _na     537_aa DUF2029 domain-containing protein
542 PQNK01000002.1 GCA003932215_00913 CDS open 55355-56362 _na     335_aa Helix-hairpin-helix DNA-binding motif class 1 domain-containing protein
543 PQNK01000002.1 GCA003932215_00914 CDS open 56346-58697 _na     783_aa ComEC/Rec2-related protein domain-containing protein
544 PQNK01000002.1 GCA003932215_00915 CDS open 58830-59855 _na     341_aa holA DNA polymerase III subunit delta
545 PQNK01000002.1 GCA003932215_00916 CDS open 59948-61009 _na     353_aa ADP-ribosylglycohydrolase
546 PQNK01000002.1 GCA003932215_00917 CDS open 61307-62758 _na     483_aa hypothetical protein
547 PQNK01000002.1 GCA003932215_00918 CDS open 63073-63336 _na     87_aa rpsT 30S ribosomal protein S20
548 PQNK01000002.1 GCA003932215_00919 CDS open 63560-64150 _na     196_aa PemK-like protein
549 PQNK01000002.1 GCA003932215_00920 CDS open 64233-66083 _na     616_aa lepA translation elongation factor 4
550 PQNK01000002.1 GCA003932215_00921 CDS open 66153-66587 _na     144_aa DUF4917 domain-containing protein
551 PQNK01000002.1 GCA003932215_00922 CDS open 67425-67880 _na     151_aa hypothetical protein
552 PQNK01000002.1 GCA003932215_00923 CDS open 68506-68910 _na     134_aa hypothetical protein
553 PQNK01000002.1 GCA003932215_00924 CDS open 69226-69897 _na     223_aa Lipoprotein
554 PQNK01000002.1 GCA003932215_00925 CDS open 69901-71106 _na     401_aa 6-bladed beta-propeller
555 PQNK01000002.1 GCA003932215_00926 CDS open 71110-71442 _na     110_aa hypothetical protein
556 PQNK01000002.1 GCA003932215_00927 CDS open 71852-72073 _na     73_aa DUF2188 domain-containing protein
557 PQNK01000002.1 GCA003932215_00928 CDS open 72868-73851 _na     327_aa ABC transporter permease
558 PQNK01000002.1 GCA003932215_00929 CDS open 73852-74904 _na     350_aa Peptide/nickel transport system permease protein
559 PQNK01000002.1 GCA003932215_00930 CDS open 74901-77033 _na     710_aa nikD nickel import ATP-binding protein NikD
560 PQNK01000002.1 GCA003932215_00931 CDS open 77092-78771 _na     559_aa Peptide/nickel transport system substrate-binding protein
561 PQNK01000002.1 GCA003932215_00932 CDS open 79246-80430 _na     394_aa L-lactate dehydrogenase (Cytochrome)
562 PQNK01000002.1 GCA003932215_00933 CDS open 80787-81308 _na     173_aa hypothetical protein
563 PQNK01000002.1 GCA003932215_00934 CDS open 82121-84241 _na     706_aa ATPase of the ABC class
564 PQNK01000002.1 GCA003932215_00935 CDS open 84639-85160 _na     173_aa hypothetical protein
565 PQNK01000002.1 GCA003932215_00936 CDS open 85636-86244 _na     202_aa Secreted protein
566 PQNK01000002.1 GCA003932215_00937 CDS open 86429-89251 _na     940_aa long-chain-fatty-acyl-CoA reductase
567 PQNK01000002.1 GCA003932215_00938 CDS open 89248-90495 _na     415_aa luxE Acyl-protein synthetase LuxE domain-containing protein
568 PQNK01000002.1 GCA003932215_00939 CDS open 90492-91940 _na     482_aa N-acetyltransferase domain-containing protein
569 PQNK01000002.1 GCA003932215_00940 CDS open 91937-93244 _na     435_aa Putative MFS family arabinose efflux permease
570 PQNK01000002.1 GCA003932215_00941 CDS open 93241-94503 _na     420_aa Phenylacetate-CoA ligase
571 PQNK01000002.1 GCA003932215_00942 CDS open 95021-96025 _na     334_aa eamA EamA family transporter
572 PQNK01000002.1 GCA003932215_00943 CDS open 96022-97371 _na     449_aa MHS family alpha-ketoglutarate permease-like MFS transporter
573 PQNK01000002.1 GCA003932215_00944 CDS open 97516-98265 _na     249_aa DUF2786 domain-containing protein
574 PQNK01000002.1 GCA003932215_00945 CDS open 98520-99119 _na     199_aa Phosphoprotein phosphatase
575 PQNK01000002.1 GCA003932215_00946 CDS open 99399-100520 _na     373_aa hypothetical protein
576 PQNK01000002.1 GCA003932215_00947 CDS open 100728-101654 _na     308_aa Dihydrofolate reductase
577 PQNK01000002.1 GCA003932215_00948 CDS open 101739-102197 _na     152_aa Integral membrane protein
578 PQNK01000002.1 GCA003932215_00949 CDS open 102349-102909 _na     186_aa N-acetyltransferase domain-containing protein
579 PQNK01000002.1 GCA003932215_00950 CDS open 103108-104505 _na     465_aa Succinate-semialdehyde dehydrogenase/glutarate-semialdehyde dehydrogenase
580 PQNK01000002.1 GCA003932215_00951 CDS open 104725-105993 _na     422_aa Glycerophosphoryl diester phosphodiesterase
581 PQNK01000002.1 GCA003932215_00952 CDS open 105981-106589 _na     202_aa acetolactate synthase
582 PQNK01000002.1 GCA003932215_00953 CDS open 106743-107855 _na     370_aa acetolactate synthase
583 PQNK01000002.1 GCA003932215_00954 CDS open 107978-108679 _na     233_aa NAD-dependent dehydratase
584 PQNK01000002.1 GCA003932215_00955 CDS open 108753-111299 _na     848_aa ATP-dependent helicase
585 PQNK01000002.1 GCA003932215_00956 CDS open 111350-112060 _na     236_aa DUF1990 domain-containing protein
586 PQNK01000002.1 GCA003932215_00957 CDS open 112057-113685 _na     542_aa POT family proton-dependent oligopeptide transporter
587 PQNK01000002.1 GCA003932215_00958 CDS open 114217-115962 _na     581_aa Multidrug DMT transporter permease
588 PQNK01000002.1 GCA003932215_00959 CDS open 116140-116994 _na     284_aa 3-hydroxybutyryl-CoA dehydrogenase
589 PQNK01000002.1 GCA003932215_00960 CDS open 117229-117438 _na     69_aa csbD CsbD family protein
590 PQNK01000002.1 GCA003932215_00961 CDS open 117578-119038 _na     486_aa Aspartate aminotransferase family protein
591 PQNK01000002.1 GCA003932215_00962 CDS open 119265-121148 _na     627_aa Iron ABC transporter ATP-binding protein
592 PQNK01000002.1 GCA003932215_00963 CDS open 121141-122349 _na     402_aa cysteine-S-conjugate beta-lyase
593 PQNK01000002.1 GCA003932215_00964 CDS open 122469-123968 _na     499_aa Carboxylesterase type B domain-containing protein
594 PQNK01000002.1 GCA003932215_00965 CDS open 124207-126336 _na     709_aa Peptidyl-dipeptidase Dcp
595 PQNK01000002.1 GCA003932215_00966 CDS open 126347-126583 _na     78_aa hypothetical protein
596 PQNK01000002.1 GCA003932215_00967 CDS open 126806-127867 _na     353_aa NADP-dependent oxidoreductase
597 PQNK01000002.1 GCA003932215_00968 CDS open 128374-130200 _na     608_aa Acyl-CoA synthetase
598 PQNK01000002.1 GCA003932215_00969 CDS open 130372-131052 _na     226_aa Secreted protein
599 PQNK01000002.1 GCA003932215_00970 CDS open 131090-132397 _na     435_aa hemW radical SAM family heme chaperone HemW
600 PQNK01000002.1 GCA003932215_00971 CDS open 132401-133483 _na     360_aa hrcA heat-inducible transcriptional repressor HrcA
601 PQNK01000002.1 GCA003932215_00972 CDS open 133631-134779 _na     382_aa dnaJ molecular chaperone DnaJ
602 PQNK01000002.1 GCA003932215_00973 CDS open 134783-135643 _na     286_aa 16S rRNA (uracil(1498)-N(3))-methyltransferase
603 PQNK01000002.1 GCA003932215_00974 CDS open 135640-136725 _na     361_aa PhoH-like protein
604 PQNK01000002.1 GCA003932215_00975 CDS open 136722-137399 _na     225_aa ybeY rRNA maturation RNase YbeY
605 PQNK01000002.1 GCA003932215_00976 CDS open 137396-138742 _na     448_aa HlyC/CorC family transporter
606 PQNK01000002.1 GCA003932215_00977 CDS open 138732-139760 _na     342_aa era GTPase Era
607 PQNK01000002.1 GCA003932215_00978 CDS open 139986-140672 _na     228_aa hypothetical protein
608 PQNK01000002.1 GCA003932215_00979 CDS open 140730-141491 _na     253_aa recO DNA repair protein RecO
609 PQNK01000002.1 GCA003932215_00980 CDS open 141547-142419 _na     290_aa isoprenyl transferase
610 PQNK01000002.1 GCA003932215_00981 CDS open 142416-143759 _na     447_aa VIT1/CCC1 family putative Fe2+/Mn2+ transporter
611 PQNK01000002.1 GCA003932215_00982 CDS open 143857-144282 _na     141_aa Transcriptional repressor
612 PQNK01000002.1 GCA003932215_00983 CDS open 144897-146279 _na     460_aa glycine--tRNA ligase
613 PQNK01000002.1 GCA003932215_00984 CDS open 146326-146868 _na     180_aa DUF3068 domain-containing protein
614 PQNK01000002.1 GCA003932215_00985 CDS open 146984-149149 _na     721_aa TPM domain-containing protein
615 PQNK01000002.1 GCA003932215_00986 CDS open 149199-149885 _na     228_aa ydcF YdcF family protein
616 PQNK01000002.1 GCA003932215_00987 CDS open 150064-151347 _na     427_aa deoxyguanosinetriphosphate triphosphohydrolase
617 PQNK01000002.1 GCA003932215_00988 CDS open 151633-152997 _na     454_aa MFS transporter
618 PQNK01000002.1 GCA003932215_00989 CDS open 153051-153614 _na     187_aa Ribonuclease
619 PQNK01000002.1 GCA003932215_00990 CDS open 153690-155630 _na     646_aa DNA primase
620 PQNK01000002.1 GCA003932215_00991 CDS open 155671-155991 _na     106_aa ytxH YtxH domain-containing protein
621 PQNK01000002.1 GCA003932215_00992 CDS open 156301-157419 _na     372_aa S-(hydroxymethyl)mycothiol dehydrogenase
622 PQNK01000002.1 GCA003932215_00993 CDS open 157416-158129 _na     237_aa Zn-dependent hydrolase
623 PQNK01000002.1 GCA003932215_00994 CDS open 158195-160402 _na     735_aa Cu+-exporting ATPase
624 PQNK01000002.1 GCA003932215_00995 CDS open 160523-160915 _na     130_aa Transcriptional regulator
625 PQNK01000002.1 GCA003932215_00996 CDS open 160953-161810 _na     285_aa Pirin family protein
626 PQNK01000002.1 GCA003932215_00997 CDS open 161974-162876 _na     300_aa HTH asnC-type domain-containing protein
627 PQNK01000002.1 GCA003932215_00998 CDS open 162942-164324 _na     460_aa Glycolate oxidase
628 PQNK01000002.1 GCA003932215_00999 CDS open 164522-165799 _na     425_aa 2-polyprenyl-6-methoxyphenol hydroxylase-like FAD-dependent oxidoreductase
629 PQNK01000002.1 GCA003932215_01000 CDS open 165919-166938 _na     339_aa Aminocarboxymuconate-semialdehyde decarboxylase
630 PQNK01000002.1 GCA003932215_01001 CDS open 167198-168169 _na     323_aa Urea transporter
631 PQNK01000002.1 GCA003932215_01004 CDS open 169005-169997 _na     330_aa SGNH hydrolase-type esterase domain-containing protein
632 PQNK01000002.1 GCA003932215_01005 CDS open 170005-170370 _na     121_aa hypothetical protein
633 PQNK01000002.1 GCA003932215_01006 CDS open 170589-171680 _na     363_aa Restriction endonuclease
634 PQNK01000002.1 GCA003932215_01007 CDS open 171856-172476 _na     206_aa DUF202 domain-containing protein
635 PQNK01000002.1 GCA003932215_01008 CDS open 172697-173572 _na     291_aa Serine hydrolase
636 PQNK01000002.1 GCA003932215_01009 CDS open 173593-174069 _na     158_aa Carrier domain-containing protein
637 PQNK01000002.1 GCA003932215_01010 CDS open 174303-175421 _na     372_aa AB hydrolase-1 domain-containing protein
638 PQNK01000002.1 GCA003932215_01011 CDS open 175431-176303 _na     290_aa HAD family hydrolase
639 PQNK01000002.1 GCA003932215_01012 CDS open 176308-179196 _na     962_aa aceE pyruvate dehydrogenase (acetyl-transferring)%2C homodimeric type
640 PQNK01000002.1 GCA003932215_01013 CDS open 179588-180016 _na     142_aa DUF3052 domain-containing protein
641 PQNK01000002.1 GCA003932215_01015 CDS open 180623-183439 _na     938_aa CRISPR-associated endonuclease/helicase Cas3
642 PQNK01000002.1 GCA003932215_01016 CDS open 183658-185475 _na     605_aa casA type I-E CRISPR-associated protein Cse1/CasA
643 PQNK01000002.1 GCA003932215_01017 CDS open 185453-186169 _na     238_aa casB type I-E CRISPR-associated protein Cse2/CasB
644 PQNK01000002.1 GCA003932215_01018 CDS open 186304-187413 _na     369_aa cas7e type I-E CRISPR-associated protein Cas7/Cse4/CasC
645 PQNK01000002.1 GCA003932215_01019 CDS open 187419-188117 _na     232_aa cas5e type I-E CRISPR-associated protein Cas5/CasD
646 PQNK01000002.1 GCA003932215_01020 CDS open 188118-188792 _na     224_aa cas6e type I-E CRISPR-associated protein Cas6/Cse3/CasE
647 PQNK01000002.1 GCA003932215_01021 CDS open 188789-189787 _na     332_aa cas1e type I-E CRISPR-associated endonuclease Cas1e
648 PQNK01000002.1 GCA003932215_01022 CDS open 189784-190146 _na     120_aa cas2e type I-E CRISPR-associated endoribonuclease Cas2e
649 PQNK01000002.1 GCA003932215_01023 CDS open 191995-193251 _na     418_aa SURF1-like protein
650 PQNK01000002.1 GCA003932215_01024 CDS open 193411-193938 _na     175_aa protein-tyrosine-phosphatase
651 PQNK01000002.1 GCA003932215_01025 CDS open 194138-194854 _na     238_aa Phosphoglycolate phosphatase-like HAD superfamily hydrolase
652 PQNK01000002.1 GCA003932215_01026 CDS open 194878-196119 _na     413_aa Nif3-like dinuclear metal center hexameric protein
653 PQNK01000002.1 GCA003932215_01027 CDS open 196275-197498 _na     407_aa bifunctional RNase H/acid phosphatase
654 PQNK01000002.1 GCA003932215_01028 CDS open 197533-198420 _na     295_aa HTH cro/C1-type domain-containing protein
655 PQNK01000002.1 GCA003932215_01030 CDS open 199101-199277 _na     58_aa SPOR domain-containing protein
656 PQNK01000002.1 GCA003932215_01031 CDS open 199419-200384 _na     321_aa panB 3-methyl-2-oxobutanoate hydroxymethyltransferase
657 PQNK01000002.1 GCA003932215_01032 CDS open 200493-201833 _na     446_aa glnA type I glutamate--ammonia ligase
658 PQNK01000002.1 GCA003932215_01033 CDS open 201843-205040 _na     1065_aa bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase
659 PQNK01000002.1 GCA003932215_01034 CDS open 205279-206394 _na     371_aa Htaa domain-containing protein
660 PQNK01000002.1 GCA003932215_01035 CDS open 206333-207931 _na     532_aa Htaa domain-containing protein
661 PQNK01000002.1 GCA003932215_01036 CDS open 207928-208986 _na     352_aa ABC transporter permease
662 PQNK01000002.1 GCA003932215_01037 CDS open 208983-209807 _na     274_aa heme ABC transporter ATP-binding protein
663 PQNK01000002.1 GCA003932215_01038 CDS open 209970-210665 _na     231_aa Biliverdin-producing heme oxygenase
664 PQNK01000002.1 GCA003932215_01039 CDS open 210730-211455 _na     241_aa tetR TetR family transcriptional regulator
665 PQNK01000002.1 GCA003932215_01040 CDS open 211452-212255 _na     267_aa Fructosamine kinase
666 PQNK01000002.1 GCA003932215_01041 CDS open 212338-213582 _na     414_aa DUF2029 domain-containing protein
667 PQNK01000002.1 GCA003932215_01042 CDS open 213868-215148 _na     426_aa MFS family permease
668 PQNK01000002.1 GCA003932215_01043 CDS open 215242-216558 _na     438_aa Nramp family divalent metal transporter
669 PQNK01000002.1 GCA003932215_01044 CDS open 216676-217461 _na     261_aa Glycine transporter domain-containing protein
670 PQNK01000002.1 GCA003932215_01045 CDS open 217957-219909 _na     650_aa Gamma-glutamyltranspeptidase/glutathione hydrolase
671 PQNK01000002.1 GCA003932215_01046 CDS open 220010-221521 _na     503_aa Secreted protein
672 PQNK01000002.1 GCA003932215_00871 gene open 1270-3567 copD
673 PQNK01000002.1 GCA003932215_00872 gene open 3814-4449
674 PQNK01000002.1 GCA003932215_00873 gene open 4678-6348 ettA
675 PQNK01000002.1 GCA003932215_00874 gene open 6477-7352
676 PQNK01000002.1 GCA003932215_00875 gene open 7230-7559
677 PQNK01000002.1 GCA003932215_00876 gene open 7755-8306
678 PQNK01000002.1 GCA003932215_00877 gene open 8303-11038 pepN
679 PQNK01000002.1 GCA003932215_00878 gene open 11167-11805 dsbA
680 PQNK01000002.1 GCA003932215_00879 gene open 12077-12655
681 PQNK01000002.1 GCA003932215_00880 gene open 12652-13041
682 PQNK01000002.1 GCA003932215_00881 gene open 13535-13687
683 PQNK01000002.1 GCA003932215_00882 gene open 13938-14423
684 PQNK01000002.1 GCA003932215_00883 gene open 14834-15061
685 PQNK01000002.1 GCA003932215_00884 gene open 15701-17458
686 PQNK01000002.1 GCA003932215_00885 gene open 17949-20483
687 PQNK01000002.1 GCA003932215_00886 gene open 20456-22555
688 PQNK01000002.1 GCA003932215_00889 gene open 23740-25398 tig
689 PQNK01000002.1 GCA003932215_00890 gene open 25760-26401
690 PQNK01000002.1 GCA003932215_00891 gene open 26466-27179 clpP2
691 PQNK01000002.1 GCA003932215_00892 gene open 27402-28688 clpX
692 PQNK01000002.1 GCA003932215_00893 gene open 28789-29751 tetR
693 PQNK01000002.1 GCA003932215_00894 gene open 30111-31301
694 PQNK01000002.1 GCA003932215_00895 gene open 31326-34121
695 PQNK01000002.1 GCA003932215_00896 gene open 34118-35767 folC
696 PQNK01000002.1 GCA003932215_00897 gene open 35767-36360
697 PQNK01000002.1 GCA003932215_00898 gene open 36449-36958
698 PQNK01000002.1 GCA003932215_00899 gene open 37047-37466
699 PQNK01000002.1 GCA003932215_00900 gene open 37606-38421
700 PQNK01000002.1 GCA003932215_00901 gene open 38661-43112
701 PQNK01000002.1 GCA003932215_00902 gene open 43501-43806 rplU
702 PQNK01000002.1 GCA003932215_00903 gene open 43850-44122 rpmA
703 PQNK01000002.1 GCA003932215_00904 gene open 44245-45759 obgE
704 PQNK01000002.1 GCA003932215_00905 gene open 45886-47175
705 PQNK01000002.1 GCA003932215_00906 gene open 47200-48507
706 PQNK01000002.1 GCA003932215_00907 gene open 48640-49803
707 PQNK01000002.1 GCA003932215_00908 gene open 49918-50715
708 PQNK01000002.1 GCA003932215_00909 gene open 50887-51360 rsfS
709 PQNK01000002.1 GCA003932215_00910 gene open 51371-52303
710 PQNK01000002.1 GCA003932215_00911 gene open 52300-53349
711 PQNK01000002.1 GCA003932215_00912 gene open 53590-55203
712 PQNK01000002.1 GCA003932215_00913 gene open 55355-56362
713 PQNK01000002.1 GCA003932215_00914 gene open 56346-58697
714 PQNK01000002.1 GCA003932215_00915 gene open 58830-59855 holA
715 PQNK01000002.1 GCA003932215_00916 gene open 59948-61009
716 PQNK01000002.1 GCA003932215_00917 gene open 61307-62758
717 PQNK01000002.1 GCA003932215_00918 gene open 63073-63336 rpsT
718 PQNK01000002.1 GCA003932215_00919 gene open 63560-64150
719 PQNK01000002.1 GCA003932215_00920 gene open 64233-66083 lepA
720 PQNK01000002.1 GCA003932215_00921 gene open 66153-66587
721 PQNK01000002.1 GCA003932215_00922 gene open 67425-67880
722 PQNK01000002.1 GCA003932215_00923 gene open 68506-68910
723 PQNK01000002.1 GCA003932215_00924 gene open 69226-69897
724 PQNK01000002.1 GCA003932215_00925 gene open 69901-71106
725 PQNK01000002.1 GCA003932215_00926 gene open 71110-71442
726 PQNK01000002.1 GCA003932215_00927 gene open 71852-72073
727 PQNK01000002.1 GCA003932215_00928 gene open 72868-73851
728 PQNK01000002.1 GCA003932215_00929 gene open 73852-74904
729 PQNK01000002.1 GCA003932215_00930 gene open 74901-77033 nikD
730 PQNK01000002.1 GCA003932215_00931 gene open 77092-78771
731 PQNK01000002.1 GCA003932215_00932 gene open 79246-80430
732 PQNK01000002.1 GCA003932215_00933 gene open 80787-81308
733 PQNK01000002.1 GCA003932215_00934 gene open 82121-84241
734 PQNK01000002.1 GCA003932215_00935 gene open 84639-85160
735 PQNK01000002.1 GCA003932215_00936 gene open 85636-86244
736 PQNK01000002.1 GCA003932215_00937 gene open 86429-89251
737 PQNK01000002.1 GCA003932215_00938 gene open 89248-90495 luxE
738 PQNK01000002.1 GCA003932215_00939 gene open 90492-91940
739 PQNK01000002.1 GCA003932215_00940 gene open 91937-93244
740 PQNK01000002.1 GCA003932215_00941 gene open 93241-94503
741 PQNK01000002.1 GCA003932215_00942 gene open 95021-96025 eamA
742 PQNK01000002.1 GCA003932215_00943 gene open 96022-97371
743 PQNK01000002.1 GCA003932215_00944 gene open 97516-98265
744 PQNK01000002.1 GCA003932215_00945 gene open 98520-99119
745 PQNK01000002.1 GCA003932215_00946 gene open 99399-100520
746 PQNK01000002.1 GCA003932215_00947 gene open 100728-101654
747 PQNK01000002.1 GCA003932215_00948 gene open 101739-102197
748 PQNK01000002.1 GCA003932215_00949 gene open 102349-102909
749 PQNK01000002.1 GCA003932215_00950 gene open 103108-104505
750 PQNK01000002.1 GCA003932215_00951 gene open 104725-105993
751 PQNK01000002.1 GCA003932215_00952 gene open 105981-106589
752 PQNK01000002.1 GCA003932215_00953 gene open 106743-107855
753 PQNK01000002.1 GCA003932215_00954 gene open 107978-108679
754 PQNK01000002.1 GCA003932215_00955 gene open 108753-111299
755 PQNK01000002.1 GCA003932215_00956 gene open 111350-112060
756 PQNK01000002.1 GCA003932215_00957 gene open 112057-113685
757 PQNK01000002.1 GCA003932215_00958 gene open 114217-115962
758 PQNK01000002.1 GCA003932215_00959 gene open 116140-116994
759 PQNK01000002.1 GCA003932215_00960 gene open 117229-117438 csbD
760 PQNK01000002.1 GCA003932215_00961 gene open 117578-119038
761 PQNK01000002.1 GCA003932215_00962 gene open 119265-121148
762 PQNK01000002.1 GCA003932215_00963 gene open 121141-122349
763 PQNK01000002.1 GCA003932215_00964 gene open 122469-123968
764 PQNK01000002.1 GCA003932215_00965 gene open 124207-126336
765 PQNK01000002.1 GCA003932215_00966 gene open 126347-126583
766 PQNK01000002.1 GCA003932215_00967 gene open 126806-127867
767 PQNK01000002.1 GCA003932215_00968 gene open 128374-130200
768 PQNK01000002.1 GCA003932215_00969 gene open 130372-131052
769 PQNK01000002.1 GCA003932215_00970 gene open 131090-132397 hemW
770 PQNK01000002.1 GCA003932215_00971 gene open 132401-133483 hrcA
771 PQNK01000002.1 GCA003932215_00972 gene open 133631-134779 dnaJ
772 PQNK01000002.1 GCA003932215_00973 gene open 134783-135643
773 PQNK01000002.1 GCA003932215_00974 gene open 135640-136725
774 PQNK01000002.1 GCA003932215_00975 gene open 136722-137399 ybeY
775 PQNK01000002.1 GCA003932215_00976 gene open 137396-138742
776 PQNK01000002.1 GCA003932215_00977 gene open 138732-139760 era
777 PQNK01000002.1 GCA003932215_00978 gene open 139986-140672
778 PQNK01000002.1 GCA003932215_00979 gene open 140730-141491 recO
779 PQNK01000002.1 GCA003932215_00980 gene open 141547-142419
780 PQNK01000002.1 GCA003932215_00981 gene open 142416-143759
781 PQNK01000002.1 GCA003932215_00982 gene open 143857-144282
782 PQNK01000002.1 GCA003932215_00983 gene open 144897-146279
783 PQNK01000002.1 GCA003932215_00984 gene open 146326-146868
784 PQNK01000002.1 GCA003932215_00985 gene open 146984-149149
785 PQNK01000002.1 GCA003932215_00986 gene open 149199-149885 ydcF
786 PQNK01000002.1 GCA003932215_00987 gene open 150064-151347
787 PQNK01000002.1 GCA003932215_00988 gene open 151633-152997
788 PQNK01000002.1 GCA003932215_00989 gene open 153051-153614
789 PQNK01000002.1 GCA003932215_00990 gene open 153690-155630
790 PQNK01000002.1 GCA003932215_00991 gene open 155671-155991 ytxH
791 PQNK01000002.1 GCA003932215_00992 gene open 156301-157419
792 PQNK01000002.1 GCA003932215_00993 gene open 157416-158129
793 PQNK01000002.1 GCA003932215_00994 gene open 158195-160402
794 PQNK01000002.1 GCA003932215_00995 gene open 160523-160915
795 PQNK01000002.1 GCA003932215_00996 gene open 160953-161810
796 PQNK01000002.1 GCA003932215_00997 gene open 161974-162876
797 PQNK01000002.1 GCA003932215_00998 gene open 162942-164324
798 PQNK01000002.1 GCA003932215_00999 gene open 164522-165799
799 PQNK01000002.1 GCA003932215_01000 gene open 165919-166938
800 PQNK01000002.1 GCA003932215_01001 gene open 167198-168169
801 PQNK01000002.1 GCA003932215_01004 gene open 169005-169997
802 PQNK01000002.1 GCA003932215_01005 gene open 170005-170370
803 PQNK01000002.1 GCA003932215_01006 gene open 170589-171680
804 PQNK01000002.1 GCA003932215_01007 gene open 171856-172476
805 PQNK01000002.1 GCA003932215_01008 gene open 172697-173572
806 PQNK01000002.1 GCA003932215_01009 gene open 173593-174069
807 PQNK01000002.1 GCA003932215_01010 gene open 174303-175421
808 PQNK01000002.1 GCA003932215_01011 gene open 175431-176303
809 PQNK01000002.1 GCA003932215_01012 gene open 176308-179196 aceE
810 PQNK01000002.1 GCA003932215_01013 gene open 179588-180016
811 PQNK01000002.1 GCA003932215_01015 gene open 180623-183439
812 PQNK01000002.1 GCA003932215_01016 gene open 183658-185475 casA
813 PQNK01000002.1 GCA003932215_01017 gene open 185453-186169 casB
814 PQNK01000002.1 GCA003932215_01018 gene open 186304-187413 cas7e
815 PQNK01000002.1 GCA003932215_01019 gene open 187419-188117 cas5e
816 PQNK01000002.1 GCA003932215_01020 gene open 188118-188792 cas6e
817 PQNK01000002.1 GCA003932215_01021 gene open 188789-189787 cas1e
818 PQNK01000002.1 GCA003932215_01022 gene open 189784-190146 cas2e
819 PQNK01000002.1 GCA003932215_01023 gene open 191995-193251
820 PQNK01000002.1 GCA003932215_01024 gene open 193411-193938
821 PQNK01000002.1 GCA003932215_01025 gene open 194138-194854
822 PQNK01000002.1 GCA003932215_01026 gene open 194878-196119
823 PQNK01000002.1 GCA003932215_01027 gene open 196275-197498
824 PQNK01000002.1 GCA003932215_01028 gene open 197533-198420
825 PQNK01000002.1 GCA003932215_01030 gene open 199101-199277
826 PQNK01000002.1 GCA003932215_01031 gene open 199419-200384 panB
827 PQNK01000002.1 GCA003932215_01032 gene open 200493-201833 glnA
828 PQNK01000002.1 GCA003932215_01033 gene open 201843-205040
829 PQNK01000002.1 GCA003932215_01034 gene open 205279-206394
830 PQNK01000002.1 GCA003932215_01035 gene open 206333-207931
831 PQNK01000002.1 GCA003932215_01036 gene open 207928-208986
832 PQNK01000002.1 GCA003932215_01037 gene open 208983-209807
833 PQNK01000002.1 GCA003932215_01038 gene open 209970-210665
834 PQNK01000002.1 GCA003932215_01039 gene open 210730-211455 tetR
835 PQNK01000002.1 GCA003932215_01040 gene open 211452-212255
836 PQNK01000002.1 GCA003932215_01041 gene open 212338-213582
837 PQNK01000002.1 GCA003932215_01042 gene open 213868-215148
838 PQNK01000002.1 GCA003932215_01043 gene open 215242-216558
839 PQNK01000002.1 GCA003932215_01044 gene open 216676-217461
840 PQNK01000002.1 GCA003932215_01045 gene open 217957-219909
841 PQNK01000002.1 GCA003932215_01046 gene open 220010-221521
842 PQNK01000002.1 GCA003932215_00870 gene open 929-1002 trnR
843 PQNK01000002.1 GCA003932215_00887 gene open 22992-23066 trnG
844 PQNK01000002.1 GCA003932215_00888 gene open 23527-23600 trnP
845 PQNK01000002.1 GCA003932215_01002 gene open 168257-168331 trnN
846 PQNK01000002.1 GCA003932215_01003 gene open 168623-168696 trnI
847 PQNK01000002.1 GCA003932215_01014 gene open 180248-180320 trnV
848 PQNK01000002.1 GCA003932215_00870 tRNA open 929-1002 trnR tRNA-Arg(tct)
849 PQNK01000002.1 GCA003932215_00887 tRNA open 22992-23066 trnG tRNA-Gly(tcc)
850 PQNK01000002.1 GCA003932215_00888 tRNA open 23527-23600 trnP tRNA-Pro(tgg)
851 PQNK01000002.1 GCA003932215_01002 tRNA open 168257-168331 trnN tRNA-Asn(gtt)
852 PQNK01000002.1 GCA003932215_01003 tRNA open 168623-168696 trnI tRNA-Ile2(cat)
853 PQNK01000002.1 GCA003932215_01014 tRNA open 180248-180320 trnV tRNA-Val(tac)
854 PQNK01000003.1 GCA003932215_01228 CDS open 393-1661 _na     422_aa murA UDP-N-acetylglucosamine 1-carboxyvinyltransferase
855 PQNK01000003.1 GCA003932215_01229 CDS open 1722-2609 _na     295_aa ramA acetate metabolism transcriptional regulator RamA
856 PQNK01000003.1 GCA003932215_01230 CDS open 2981-3799 _na     272_aa Enoyl-CoA hydratase
857 PQNK01000003.1 GCA003932215_01231 CDS open 4038-4973 _na     311_aa cysK cysteine synthase A
858 PQNK01000003.1 GCA003932215_01232 CDS open 5135-5719 _na     194_aa epsC serine O-acetyltransferase EpsC
859 PQNK01000003.1 GCA003932215_01237 CDS open 6507-6758 _na     83_aa hypothetical protein
860 PQNK01000003.1 GCA003932215_01238 CDS open 6980-7774 _na     264_aa Metallo-peptidase family M12
861 PQNK01000003.1 GCA003932215_01240 CDS open 7942-9459 _na     505_aa Succinyl-CoA:acetate CoA-transferase
862 PQNK01000003.1 GCA003932215_01241 CDS open 9574-10755 _na     393_aa dusB tRNA dihydrouridine synthase DusB
863 PQNK01000003.1 GCA003932215_01242 CDS open 10780-11511 _na     243_aa Phosphate transport system protein
864 PQNK01000003.1 GCA003932215_01243 CDS open 11512-12288 _na     258_aa pstB phosphate ABC transporter ATP-binding protein PstB
865 PQNK01000003.1 GCA003932215_01244 CDS open 12340-13239 _na     299_aa pstA phosphate ABC transporter permease PstA
866 PQNK01000003.1 GCA003932215_01245 CDS open 13250-14296 _na     348_aa pstC phosphate ABC transporter permease subunit PstC
867 PQNK01000003.1 GCA003932215_01246 CDS open 14399-15511 _na     370_aa pstS phosphate ABC transporter substrate-binding protein PstS
868 PQNK01000003.1 GCA003932215_01247 CDS open 15667-16635 _na     322_aa mshD mycothiol synthase
869 PQNK01000003.1 GCA003932215_01248 CDS open 16664-17344 _na     226_aa glnR GlnR family transcriptional regulator
870 PQNK01000003.1 GCA003932215_01249 CDS open 17383-18243 _na     286_aa DUF2993 domain-containing protein
871 PQNK01000003.1 GCA003932215_01250 CDS open 18256-18927 _na     223_aa Ferric nitrobindin-like protein
872 PQNK01000003.1 GCA003932215_01251 CDS open 18924-19793 _na     289_aa aminodeoxychorismate lyase
873 PQNK01000003.1 GCA003932215_01252 CDS open 19820-21001 _na     393_aa ygfZ Folate-binding protein YgfZ
874 PQNK01000003.1 GCA003932215_01253 CDS open 21146-21322 _na     58_aa DUF3073 domain-containing protein
875 PQNK01000003.1 GCA003932215_01254 CDS open 21326-22411 _na     361_aa Phosphoribosylformylglycinamidine cyclo-ligase
876 PQNK01000003.1 GCA003932215_01255 CDS open 22411-23943 _na     510_aa purF amidophosphoribosyltransferase
877 PQNK01000003.1 GCA003932215_01256 CDS open 23976-24344 _na     122_aa Bacterial SCP orthologue domain-containing protein
878 PQNK01000003.1 GCA003932215_01257 CDS open 24469-25458 _na     329_aa Acyl-CoA thioesterase
879 PQNK01000003.1 GCA003932215_01258 CDS open 25483-27885 _na     800_aa purL phosphoribosylformylglycinamidine synthase subunit PurL
880 PQNK01000003.1 GCA003932215_01259 CDS open 27882-28565 _na     227_aa purQ phosphoribosylformylglycinamidine synthase subunit PurQ
881 PQNK01000003.1 GCA003932215_01260 CDS open 28562-28807 _na     81_aa purS phosphoribosylformylglycinamidine synthase subunit PurS
882 PQNK01000003.1 GCA003932215_01261 CDS open 28869-29567 _na     232_aa DUF2334 domain-containing protein
883 PQNK01000003.1 GCA003932215_01262 CDS open 29644-30945 _na     433_aa dctA C4-dicarboxylate transporter DctA
884 PQNK01000003.1 GCA003932215_01263 CDS open 30983-33076 _na     697_aa Oligopeptidase B
885 PQNK01000003.1 GCA003932215_01264 CDS open 33163-37962 _na     1599_aa Damage-inducible protein
886 PQNK01000003.1 GCA003932215_01265 CDS open 38100-38993 _na     297_aa phosphoribosylaminoimidazolesuccinocarboxamide synthase
887 PQNK01000003.1 GCA003932215_01266 CDS open 39112-40719 _na     535_aa ABC transporter substrate-binding protein
888 PQNK01000003.1 GCA003932215_01267 CDS open 40723-41649 _na     308_aa Oligopeptide transport system permease protein
889 PQNK01000003.1 GCA003932215_01268 CDS open 41642-42523 _na     293_aa ABC transporter permease
890 PQNK01000003.1 GCA003932215_01269 CDS open 42520-44064 _na     514_aa nikD nickel import ATP-binding protein NikD
891 PQNK01000003.1 GCA003932215_01270 CDS open 44099-45646 _na     515_aa purB adenylosuccinate lyase
892 PQNK01000003.1 GCA003932215_01271 CDS open 45651-46016 _na     121_aa DNA-(apurinic or apyrimidinic site) lyase
893 PQNK01000003.1 GCA003932215_01272 CDS open 46954-48222 _na     422_aa DUF222 domain-containing protein
894 PQNK01000003.1 GCA003932215_01273 CDS open 48219-49457 _na     412_aa Phosphoribosylamine--glycine ligase
895 PQNK01000003.1 GCA003932215_01274 CDS open 49490-49888 _na     132_aa Diadenosine tetraphosphate (Ap4A) HIT family hydrolase
896 PQNK01000003.1 GCA003932215_01275 CDS open 49885-50730 _na     281_aa AB hydrolase-1 domain-containing protein
897 PQNK01000003.1 GCA003932215_01276 CDS open 50738-52183 _na     481_aa histidine kinase
898 PQNK01000003.1 GCA003932215_01277 CDS open 52180-52875 _na     231_aa DNA-binding response regulator
899 PQNK01000003.1 GCA003932215_01278 CDS open 53031-53666 _na     211_aa L%2CD-transpeptidase
900 PQNK01000003.1 GCA003932215_01279 CDS open 53666-54313 _na     215_aa N-acetyltransferase domain-containing protein
901 PQNK01000003.1 GCA003932215_01280 CDS open 54303-55799 _na     498_aa Phytoene desaturase
902 PQNK01000003.1 GCA003932215_01281 CDS open 55796-56602 _na     268_aa Phytoene synthase
903 PQNK01000003.1 GCA003932215_01282 CDS open 56599-57921 _na     440_aa Purine permease
904 PQNK01000003.1 GCA003932215_01283 CDS open 57902-58849 _na     315_aa Amidohydrolase
905 PQNK01000003.1 GCA003932215_01285 CDS open 59094-60626 _na     510_aa thrE threonine/serine exporter ThrE
906 PQNK01000003.1 GCA003932215_01286 CDS open 60670-60990 _na     106_aa Histone
907 PQNK01000003.1 GCA003932215_01287 CDS open 60995-62464 _na     489_aa alpha%2Calpha-trehalose-phosphate synthase (ADP-forming)
908 PQNK01000003.1 GCA003932215_01288 CDS open 62461-62922 _na     153_aa DUF306 domain-containing protein
909 PQNK01000003.1 GCA003932215_01289 CDS open 62965-63789 _na     274_aa otsB trehalose-phosphatase
910 PQNK01000003.1 GCA003932215_01290 CDS open 63790-64857 _na     355_aa DNA-binding LacI/PurR family transcriptional regulator
911 PQNK01000003.1 GCA003932215_01291 CDS open 64933-65781 _na     282_aa ABC transporter substrate-binding protein
912 PQNK01000003.1 GCA003932215_01292 CDS open 65778-66380 _na     200_aa ABC transporter ATP-binding protein
913 PQNK01000003.1 GCA003932215_01293 CDS open 66384-67217 _na     277_aa Helicase
914 PQNK01000003.1 GCA003932215_01294 CDS open 67132-68043 _na     303_aa ABC transporter permease
915 PQNK01000003.1 GCA003932215_01295 CDS open 68150-68707 _na     185_aa acrR AcrR family transcriptional regulator
916 PQNK01000003.1 GCA003932215_01296 CDS open 68704-69765 _na     353_aa 2%2C4-dienoyl-CoA reductase-like NADH-dependent reductase (Old Yellow Enzyme family)
917 PQNK01000003.1 GCA003932215_01297 CDS open 69771-70721 _na     316_aa rlmB 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
918 PQNK01000003.1 GCA003932215_01298 CDS open 70773-72161 _na     462_aa cysS cysteine--tRNA ligase
919 PQNK01000003.1 GCA003932215_01299 CDS open 72172-72657 _na     161_aa 2-C-methyl-D-erythritol 2%2C4-cyclodiphosphate synthase
920 PQNK01000003.1 GCA003932215_01300 CDS open 72654-73394 _na     246_aa 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase
921 PQNK01000003.1 GCA003932215_01301 CDS open 73375-73980 _na     201_aa carD CarD family transcriptional regulator
922 PQNK01000003.1 GCA003932215_01302 CDS open 74095-74700 _na     201_aa lpqE Lipoprotein LpqE
923 PQNK01000003.1 GCA003932215_01303 CDS open 74762-76018 _na     418_aa radA DNA repair protein RadA
924 PQNK01000003.1 GCA003932215_01304 CDS open 76005-76661 _na     218_aa DUF4232 domain-containing protein
925 PQNK01000003.1 GCA003932215_01305 CDS open 76671-77345 _na     224_aa Carbonic anhydrase
926 PQNK01000003.1 GCA003932215_01306 CDS open 77382-78305 _na     307_aa Adenine DNA glycosylase
927 PQNK01000003.1 GCA003932215_01307 CDS open 78360-79700 _na     446_aa brnQ branched-chain amino acid transport system II carrier protein
928 PQNK01000003.1 GCA003932215_01308 CDS open 79697-82213 _na     838_aa ATP-dependent Clp protease ATP-binding subunit
929 PQNK01000003.1 GCA003932215_01309 CDS open 82447-84147 _na     566_aa Acyl-CoA synthetase
930 PQNK01000003.1 GCA003932215_01310 CDS open 84144-84935 _na     263_aa Bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase
931 PQNK01000003.1 GCA003932215_01311 CDS open 84913-86124 _na     403_aa Acyl-CoA dehydrogenase
932 PQNK01000003.1 GCA003932215_01312 CDS open 86156-87532 _na     458_aa Butyryl-CoA dehydrogenase
933 PQNK01000003.1 GCA003932215_01313 CDS open 87606-89153 _na     515_aa lysS lysine--tRNA ligase
934 PQNK01000003.1 GCA003932215_01314 CDS open 89176-90195 _na     339_aa HNH nuclease domain-containing protein
935 PQNK01000003.1 GCA003932215_01315 CDS open 90351-91457 _na     368_aa nitric oxide dioxygenase
936 PQNK01000003.1 GCA003932215_01316 CDS open 91463-91885 _na     140_aa Rrf2 family nitric oxide-sensitive transcriptional repressor
937 PQNK01000003.1 GCA003932215_01317 CDS open 91999-92400 _na     133_aa panD aspartate 1-decarboxylase
938 PQNK01000003.1 GCA003932215_01318 CDS open 92423-93295 _na     290_aa panC pantoate--beta-alanine ligase
939 PQNK01000003.1 GCA003932215_01319 CDS open 93339-94157 _na     272_aa DUF2520 domain-containing protein
940 PQNK01000003.1 GCA003932215_01320 CDS open 94154-94873 _na     239_aa DUF6779 domain-containing protein
941 PQNK01000003.1 GCA003932215_01321 CDS open 94915-95367 _na     150_aa DUF3180 domain-containing protein
942 PQNK01000003.1 GCA003932215_01322 CDS open 95361-95861 _na     166_aa folK 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase
943 PQNK01000003.1 GCA003932215_01323 CDS open 95848-96228 _na     126_aa folB dihydroneopterin aldolase
944 PQNK01000003.1 GCA003932215_01324 CDS open 96221-97093 _na     290_aa folP dihydropteroate synthase
945 PQNK01000003.1 GCA003932215_01325 CDS open 97093-97668 _na     191_aa folE GTP cyclohydrolase I FolE
946 PQNK01000003.1 GCA003932215_01326 CDS open 97665-99818 _na     717_aa ftsH ATP-dependent zinc metalloprotease FtsH
947 PQNK01000003.1 GCA003932215_01327 CDS open 99847-100413 _na     188_aa hpt hypoxanthine phosphoribosyltransferase
948 PQNK01000003.1 GCA003932215_01328 CDS open 100410-101399 _na     329_aa tRNA(Ile)-lysidine synthase
949 PQNK01000003.1 GCA003932215_01329 CDS open 101408-102772 _na     454_aa dacB D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase
950 PQNK01000003.1 GCA003932215_01330 CDS open 102793-104637 _na     614_aa Phenol 2-monooxygenase
951 PQNK01000003.1 GCA003932215_01331 CDS open 104831-104989 _na     52_aa hypothetical protein
952 PQNK01000003.1 GCA003932215_01332 CDS open 104919-106064 _na     381_aa hypothetical protein
953 PQNK01000003.1 GCA003932215_01333 CDS open 106234-107703 _na     489_aa fumarylacetoacetate hydrolase family protein
954 PQNK01000003.1 GCA003932215_01334 CDS open 107700-108416 _na     238_aa gntR GntR family transcriptional regulator
955 PQNK01000003.1 GCA003932215_01335 CDS open 108413-109924 _na     503_aa hpaE 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase
956 PQNK01000003.1 GCA003932215_01336 CDS open 109955-111049 _na     364_aa hpaD 3%2C4-dihydroxyphenylacetate 2%2C3-dioxygenase
957 PQNK01000003.1 GCA003932215_01337 CDS open 111094-111273 _na     59_aa hypothetical protein
958 PQNK01000003.1 GCA003932215_01338 CDS open 111285-111866 _na     193_aa 2-hydroxyhexa-2%2C4-dienoate hydratase
959 PQNK01000003.1 GCA003932215_01339 CDS open 111851-112684 _na     277_aa 4-hydroxy-2-oxoheptanedioate aldolase
960 PQNK01000003.1 GCA003932215_01340 CDS open 112690-114162 _na     490_aa Succinate-semialdehyde dehydrogenase/glutarate-semialdehyde dehydrogenase
961 PQNK01000003.1 GCA003932215_01341 CDS open 114194-114655 _na     153_aa SRPBCC family protein
962 PQNK01000003.1 GCA003932215_01342 CDS open 114728-115201 _na     157_aa Inorganic pyrophosphatase
963 PQNK01000003.1 GCA003932215_01343 CDS open 115228-115536 _na     102_aa Sulfurtransferase
964 PQNK01000003.1 GCA003932215_01344 CDS open 115616-116062 _na     148_aa marR MarR family transcriptional regulator
965 PQNK01000003.1 GCA003932215_01345 CDS open 116064-119945 _na     1293_aa Amino acid adenylation protein
966 PQNK01000003.1 GCA003932215_01346 CDS open 119942-120871 _na     309_aa ppk2 polyphosphate kinase 2
967 PQNK01000003.1 GCA003932215_01347 CDS open 121007-121120 _na     37_aa hypothetical protein
968 PQNK01000003.1 GCA003932215_01348 CDS open 121245-122891 _na     548_aa groL chaperonin GroEL
969 PQNK01000003.1 GCA003932215_01349 CDS open 123163-124617 _na     484_aa Acetylornithine deacetylase/succinyl-diaminopimelate desuccinylase-like protein
970 PQNK01000003.1 GCA003932215_01350 CDS open 124813-125451 _na     212_aa Acetyl-CoA acetyltransferase
971 PQNK01000003.1 GCA003932215_01351 CDS open 125455-126633 _na     392_aa glutamate--cysteine ligase
972 PQNK01000003.1 GCA003932215_01352 CDS open 126644-127486 _na     280_aa LytR/CpsA/Psr regulator C-terminal domain-containing protein
973 PQNK01000003.1 GCA003932215_01353 CDS open 127554-127793 _na     79_aa DUF3263 domain-containing protein
974 PQNK01000003.1 GCA003932215_01354 CDS open 127864-128490 _na     208_aa peptide deformylase
975 PQNK01000003.1 GCA003932215_01355 CDS open 128499-129569 _na     356_aa GNAT family N-acetyltransferase
976 PQNK01000003.1 GCA003932215_01356 CDS open 129579-130367 _na     262_aa exodeoxyribonuclease III
977 PQNK01000003.1 GCA003932215_01357 CDS open 130364-131923 _na     519_aa cls cardiolipin synthase
978 PQNK01000003.1 GCA003932215_01358 CDS open 132051-132581 _na     176_aa marR MarR family transcriptional regulator
979 PQNK01000003.1 GCA003932215_01359 CDS open 132578-133762 _na     394_aa Bcr/CflA family drug resistance efflux transporter
980 PQNK01000003.1 GCA003932215_01360 CDS open 133973-135697 _na     574_aa thiC phosphomethylpyrimidine synthase ThiC
981 PQNK01000003.1 GCA003932215_01361 CDS open 135752-136366 _na     204_aa HTH tetR-type domain-containing protein
982 PQNK01000003.1 GCA003932215_01362 CDS open 136417-137247 _na     276_aa ABC-2 type transport system permease protein
983 PQNK01000003.1 GCA003932215_01363 CDS open 137244-138236 _na     330_aa ABC transporter ATP-binding protein
984 PQNK01000003.1 GCA003932215_01364 CDS open 138326-139105 _na     259_aa Thiazole synthase
985 PQNK01000003.1 GCA003932215_01365 CDS open 139102-139308 _na     68_aa thiS sulfur carrier protein ThiS
986 PQNK01000003.1 GCA003932215_01366 CDS open 139283-140482 _na     399_aa FAD dependent oxidoreductase domain-containing protein
987 PQNK01000003.1 GCA003932215_01367 CDS open 140475-141206 _na     243_aa Thiamine-phosphate synthase
988 PQNK01000003.1 GCA003932215_01368 CDS open 141340-142809 _na     489_aa Chemotaxis methyl-accepting receptor HlyB-like 4HB MCP domain-containing protein
989 PQNK01000003.1 GCA003932215_01369 CDS open 142809-143897 _na     362_aa Amino acid ABC transporter substrate-binding protein
990 PQNK01000003.1 GCA003932215_01370 CDS open 143894-146356 _na     820_aa non-specific serine/threonine protein kinase
991 PQNK01000003.1 GCA003932215_01371 CDS open 146705-148108 _na     467_aa Peptidase S1 domain-containing protein
992 PQNK01000003.1 GCA003932215_01372 CDS open 148414-149673 _na     419_aa Acetate kinase
993 PQNK01000003.1 GCA003932215_01373 CDS open 149709-151154 _na     481_aa pta phosphate acetyltransferase
994 PQNK01000003.1 GCA003932215_01374 CDS open 151289-152350 _na     353_aa putative membrane transporter protein
995 PQNK01000003.1 GCA003932215_01375 CDS open 152347-153159 _na     270_aa Sirohydrochlorin chelatase
996 PQNK01000003.1 GCA003932215_01376 CDS open 153205-154509 _na     434_aa sulfate adenylyltransferase
997 PQNK01000003.1 GCA003932215_01377 CDS open 154509-155447 _na     312_aa Sulfate adenylyltransferase subunit 2
998 PQNK01000003.1 GCA003932215_01378 CDS open 155545-156345 _na     266_aa phosphoadenylyl-sulfate reductase
999 PQNK01000003.1 GCA003932215_01379 CDS open 156653-156940 _na     95_aa Insertion element protein
1000 PQNK01000003.1 GCA003932215_01380 CDS open 156937-158625 _na     562_aa assimilatory sulfite reductase (ferredoxin)