HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Corynebacterium bovis (GCA_003932255.1)

Select a Genome:
BAKTA Annotations for GCA_003932255.1
Genome Selected: Corynebacterium bovis
ContigsBases CDSrRNA tmRNAtRNA
43 2673236 2180 5 1 51
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4483 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:6]    |    Number of Records Found: 4483 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2501 PQNU01000009.1 GCA003932255_02205 CDS open 60789-62216 _na     475_aa NADH:ubiquinone reductase (non-electrogenic)
2502 PQNU01000009.1 GCA003932255_02206 CDS open 62579-63181 _na     200_aa Thioesterase domain-containing protein
2503 PQNU01000009.1 GCA003932255_02207 CDS open 63481-64953 _na     490_aa gndA NADP-dependent phosphogluconate dehydrogenase
2504 PQNU01000009.1 GCA003932255_02208 CDS open 64954-66612 _na     552_aa Superfamily II DNA/RNA helicase
2505 PQNU01000009.1 GCA003932255_02209 CDS open 66778-68196 _na     472_aa HlyC/CorC family transporter
2506 PQNU01000009.1 GCA003932255_02210 CDS open 68189-69247 _na     352_aa HlyC/CorC family transporter
2507 PQNU01000009.1 GCA003932255_02211 CDS open 69306-70358 _na     350_aa 3-methyladenine DNA glycosylase
2508 PQNU01000009.1 GCA003932255_02212 CDS open 70397-72184 _na     595_aa VWFA domain-containing protein
2509 PQNU01000009.1 GCA003932255_02213 CDS open 72265-72852 _na     195_aa merR DNA-binding transcriptional MerR regulator
2510 PQNU01000009.1 GCA003932255_02214 CDS open 73113-73697 _na     194_aa BFN domain-containing protein
2511 PQNU01000009.1 GCA003932255_02215 CDS open 73711-74454 _na     247_aa merR MerR family transcriptional regulator
2512 PQNU01000009.1 GCA003932255_02216 CDS open 74631-75065 _na     144_aa odhI oxoglutarate dehydrogenase inhibitor Odhl
2513 PQNU01000009.1 GCA003932255_02217 CDS open 75302-77764 _na     820_aa secA2 accessory Sec system translocase SecA2
2514 PQNU01000009.1 GCA003932255_02218 CDS open 78015-78800 _na     261_aa osmC Osmotically inducible protein OsmC
2515 PQNU01000009.1 GCA003932255_02219 CDS open 78822-79367 _na     181_aa rraA ribonuclease E activity regulator RraA
2516 PQNU01000009.1 GCA003932255_02221 CDS open 79640-80362 _na     240_aa Hly III family transporter
2517 PQNU01000009.1 GCA003932255_02222 CDS open 80528-82207 _na     559_aa Fatty-acyl-CoA synthase
2518 PQNU01000009.1 GCA003932255_02223 CDS open 82480-84192 _na     570_aa der ribosome biogenesis GTPase Der
2519 PQNU01000009.1 GCA003932255_02224 CDS open 84189-85082 _na     297_aa cmk (d)CMP kinase
2520 PQNU01000009.1 GCA003932255_02225 CDS open 85079-86074 _na     331_aa Pseudouridine synthase
2521 PQNU01000009.1 GCA003932255_02226 CDS open 86210-86758 _na     182_aa scpB SMC-Scp complex subunit ScpB
2522 PQNU01000009.1 GCA003932255_02227 CDS open 86941-87783 _na     280_aa Segregation and condensation protein A
2523 PQNU01000009.1 GCA003932255_02228 CDS open 87780-88697 _na     305_aa parA ParA family protein
2524 PQNU01000009.1 GCA003932255_02229 CDS open 88801-89739 _na     312_aa xerC Tyrosine recombinase XerC
2525 PQNU01000009.1 GCA003932255_02230 CDS open 89729-90430 _na     233_aa ADP-ribose pyrophosphatase
2526 PQNU01000009.1 GCA003932255_02231 CDS open 90556-92241 _na     561_aa CTP synthase
2527 PQNU01000009.1 GCA003932255_02232 CDS open 92439-93368 _na     309_aa Copper transporter
2528 PQNU01000009.1 GCA003932255_02233 CDS open 93389-94570 _na     393_aa steA putative cytokinetic ring protein SteA
2529 PQNU01000009.1 GCA003932255_02234 CDS open 94720-96480 _na     586_aa recN DNA repair protein RecN
2530 PQNU01000009.1 GCA003932255_02235 CDS open 96574-97626 _na     350_aa NAD kinase
2531 PQNU01000009.1 GCA003932255_02236 CDS open 97623-98462 _na     279_aa tlyA TlyA family rRNA (Cytidine-2'-O)-methyltransferase
2532 PQNU01000009.1 GCA003932255_02237 CDS open 98462-98788 _na     108_aa hypothetical protein
2533 PQNU01000009.1 GCA003932255_02238 CDS open 98785-99954 _na     389_aa Hydrolase
2534 PQNU01000009.1 GCA003932255_02239 CDS open 99951-100625 _na     224_aa Tetratricopeptide repeat protein
2535 PQNU01000009.1 GCA003932255_02152 gene open 47-892 hisG
2536 PQNU01000009.1 GCA003932255_02153 gene open 934-2766 aspA
2537 PQNU01000009.1 GCA003932255_02154 gene open 2941-4257 dcuA
2538 PQNU01000009.1 GCA003932255_02155 gene open 4254-5183
2539 PQNU01000009.1 GCA003932255_02156 gene open 5246-6160 recB
2540 PQNU01000009.1 GCA003932255_02157 gene open 6277-7734
2541 PQNU01000009.1 GCA003932255_02158 gene open 8053-10677 irtA
2542 PQNU01000009.1 GCA003932255_02159 gene open 10677-12386
2543 PQNU01000009.1 GCA003932255_02160 gene open 12529-13362 trmI
2544 PQNU01000009.1 GCA003932255_02161 gene open 13425-15074 arc
2545 PQNU01000009.1 GCA003932255_02162 gene open 15134-16699 dop
2546 PQNU01000009.1 GCA003932255_02163 gene open 16812-16997
2547 PQNU01000009.1 GCA003932255_02164 gene open 16994-18421 pafA
2548 PQNU01000009.1 GCA003932255_02165 gene open 18421-19488
2549 PQNU01000009.1 GCA003932255_02166 gene open 19485-20678
2550 PQNU01000009.1 GCA003932255_02167 gene open 20729-21076 tatA
2551 PQNU01000009.1 GCA003932255_02168 gene open 21236-22192 tatC
2552 PQNU01000009.1 GCA003932255_02169 gene open 22182-24956 helY
2553 PQNU01000009.1 GCA003932255_02170 gene open 24983-26116
2554 PQNU01000009.1 GCA003932255_02171 gene open 26113-26871
2555 PQNU01000009.1 GCA003932255_02172 gene open 27027-27581 fxsA
2556 PQNU01000009.1 GCA003932255_02173 gene open 27578-29251 lnt
2557 PQNU01000009.1 GCA003932255_02174 gene open 29264-30070
2558 PQNU01000009.1 GCA003932255_02175 gene open 30163-31503
2559 PQNU01000009.1 GCA003932255_02176 gene open 31500-32507
2560 PQNU01000009.1 GCA003932255_02177 gene open 32636-33550
2561 PQNU01000009.1 GCA003932255_02178 gene open 33665-34069
2562 PQNU01000009.1 GCA003932255_02179 gene open 34079-34486
2563 PQNU01000009.1 GCA003932255_02180 gene open 34595-34975 rbpA
2564 PQNU01000009.1 GCA003932255_02181 gene open 35153-35584
2565 PQNU01000009.1 GCA003932255_02182 gene open 35614-36321 yceI
2566 PQNU01000009.1 GCA003932255_02183 gene open 36417-36593 yfcC
2567 PQNU01000009.1 GCA003932255_02184 gene open 36756-38141 mgtE
2568 PQNU01000009.1 GCA003932255_02185 gene open 38216-39346 arsB
2569 PQNU01000009.1 GCA003932255_02186 gene open 39632-40012 arsR
2570 PQNU01000009.1 GCA003932255_02187 gene open 42377-42487
2571 PQNU01000009.1 GCA003932255_02188 gene open 42563-42760
2572 PQNU01000009.1 GCA003932255_02189 gene open 43781-44008
2573 PQNU01000009.1 GCA003932255_02190 gene open 44311-44706
2574 PQNU01000009.1 GCA003932255_02191 gene open 44910-45023
2575 PQNU01000009.1 GCA003932255_02192 gene open 46225-46875
2576 PQNU01000009.1 GCA003932255_02193 gene open 46877-48391
2577 PQNU01000009.1 GCA003932255_02194 gene open 48501-49265
2578 PQNU01000009.1 GCA003932255_02195 gene open 49262-50560
2579 PQNU01000009.1 GCA003932255_02196 gene open 51191-51604
2580 PQNU01000009.1 GCA003932255_02197 gene open 51601-52371
2581 PQNU01000009.1 GCA003932255_02198 gene open 52414-53091
2582 PQNU01000009.1 GCA003932255_02199 gene open 53503-54135
2583 PQNU01000009.1 GCA003932255_02200 gene open 54184-54657
2584 PQNU01000009.1 GCA003932255_02201 gene open 54733-56541
2585 PQNU01000009.1 GCA003932255_02202 gene open 56793-58208
2586 PQNU01000009.1 GCA003932255_02203 gene open 58373-58999 dedA
2587 PQNU01000009.1 GCA003932255_02204 gene open 59138-60406
2588 PQNU01000009.1 GCA003932255_02205 gene open 60789-62216
2589 PQNU01000009.1 GCA003932255_02206 gene open 62579-63181
2590 PQNU01000009.1 GCA003932255_02207 gene open 63481-64953 gndA
2591 PQNU01000009.1 GCA003932255_02208 gene open 64954-66612
2592 PQNU01000009.1 GCA003932255_02209 gene open 66778-68196
2593 PQNU01000009.1 GCA003932255_02210 gene open 68189-69247
2594 PQNU01000009.1 GCA003932255_02211 gene open 69306-70358
2595 PQNU01000009.1 GCA003932255_02212 gene open 70397-72184
2596 PQNU01000009.1 GCA003932255_02213 gene open 72265-72852 merR
2597 PQNU01000009.1 GCA003932255_02214 gene open 73113-73697
2598 PQNU01000009.1 GCA003932255_02215 gene open 73711-74454 merR
2599 PQNU01000009.1 GCA003932255_02216 gene open 74631-75065 odhI
2600 PQNU01000009.1 GCA003932255_02217 gene open 75302-77764 secA2
2601 PQNU01000009.1 GCA003932255_02218 gene open 78015-78800 osmC
2602 PQNU01000009.1 GCA003932255_02219 gene open 78822-79367 rraA
2603 PQNU01000009.1 GCA003932255_02221 gene open 79640-80362
2604 PQNU01000009.1 GCA003932255_02222 gene open 80528-82207
2605 PQNU01000009.1 GCA003932255_02223 gene open 82480-84192 der
2606 PQNU01000009.1 GCA003932255_02224 gene open 84189-85082 cmk
2607 PQNU01000009.1 GCA003932255_02225 gene open 85079-86074
2608 PQNU01000009.1 GCA003932255_02226 gene open 86210-86758 scpB
2609 PQNU01000009.1 GCA003932255_02227 gene open 86941-87783
2610 PQNU01000009.1 GCA003932255_02228 gene open 87780-88697 parA
2611 PQNU01000009.1 GCA003932255_02229 gene open 88801-89739 xerC
2612 PQNU01000009.1 GCA003932255_02230 gene open 89729-90430
2613 PQNU01000009.1 GCA003932255_02231 gene open 90556-92241
2614 PQNU01000009.1 GCA003932255_02232 gene open 92439-93368
2615 PQNU01000009.1 GCA003932255_02233 gene open 93389-94570 steA
2616 PQNU01000009.1 GCA003932255_02234 gene open 94720-96480 recN
2617 PQNU01000009.1 GCA003932255_02235 gene open 96574-97626
2618 PQNU01000009.1 GCA003932255_02236 gene open 97623-98462 tlyA
2619 PQNU01000009.1 GCA003932255_02237 gene open 98462-98788
2620 PQNU01000009.1 GCA003932255_02238 gene open 98785-99954
2621 PQNU01000009.1 GCA003932255_02239 gene open 99951-100625
2622 PQNU01000009.1 GCA003932255_02220 gene open 79487-79563 trnP
2623 PQNU01000009.1 GCA003932255_02220 tRNA open 79487-79563 trnP tRNA-Pro(ggg)
2624 PQNU01000010.1 GCA003932255_00287 gene open 41406-41500 Bacteria_small_SRP
2625 PQNU01000010.1 GCA003932255_00287 ncRNA open 41406-41500 Bacterial small signal recognition particle RNA
2626 PQNU01000010.1 GCA003932255_00252 CDS open 161-751 _na     196_aa lysR LysR family transcriptional regulator
2627 PQNU01000010.1 GCA003932255_00253 CDS open 762-914 _na     50_aa DUF4177 domain-containing protein
2628 PQNU01000010.1 GCA003932255_00254 CDS open 1088-1447 _na     119_aa whiB Transcriptional regulator WhiB
2629 PQNU01000010.1 GCA003932255_00255 CDS open 1993-4101 _na     702_aa peptidoglycan glycosyltransferase
2630 PQNU01000010.1 GCA003932255_00256 CDS open 4228-5232 _na     334_aa Metallophosphoesterase
2631 PQNU01000010.1 GCA003932255_00258 CDS open 5689-5817 _na     42_aa hypothetical protein
2632 PQNU01000010.1 GCA003932255_00259 CDS open 5933-6817 _na     294_aa SGNH hydrolase-type esterase domain-containing protein
2633 PQNU01000010.1 GCA003932255_00260 CDS open 6926-7786 _na     286_aa NADP-dependent oxidoreductase domain-containing protein
2634 PQNU01000010.1 GCA003932255_00261 CDS open 8098-11520 _na     1140_aa DUF4040 domain-containing protein
2635 PQNU01000010.1 GCA003932255_00262 CDS open 11517-11942 _na     141_aa Cation:proton antiporter
2636 PQNU01000010.1 GCA003932255_00263 CDS open 11942-13678 _na     578_aa Cation:proton antiporter
2637 PQNU01000010.1 GCA003932255_00264 CDS open 13675-14727 _na     350_aa mnhE MnhE protein
2638 PQNU01000010.1 GCA003932255_00265 CDS open 14724-15002 _na     92_aa Cation:proton antiporter
2639 PQNU01000010.1 GCA003932255_00266 CDS open 15004-15423 _na     139_aa Na+/H+ antiporter subunit G
2640 PQNU01000010.1 GCA003932255_00267 CDS open 15590-16024 _na     144_aa Organic hydroperoxide resistance protein
2641 PQNU01000010.1 GCA003932255_00268 CDS open 16309-17970 _na     553_aa Catalase
2642 PQNU01000010.1 GCA003932255_00269 CDS open 18420-19175 _na     251_aa RNA polymerase sigma factor
2643 PQNU01000010.1 GCA003932255_00270 CDS open 19260-20303 _na     347_aa ferrochelatase
2644 PQNU01000010.1 GCA003932255_00271 CDS open 20406-21479 _na     357_aa aspartate-semialdehyde dehydrogenase
2645 PQNU01000010.1 GCA003932255_00272 CDS open 21544-22809 _na     421_aa aspartate kinase
2646 PQNU01000010.1 GCA003932255_00273 CDS open 23070-23927 _na     285_aa Multidrug DMT transporter permease
2647 PQNU01000010.1 GCA003932255_00274 CDS open 24037-25554 _na     505_aa hypothetical protein
2648 PQNU01000010.1 GCA003932255_00275 CDS open 25817-27655 _na     612_aa leuA 2-isopropylmalate synthase
2649 PQNU01000010.1 GCA003932255_00276 CDS open 27841-28473 _na     210_aa tetR TetR family transcriptional regulator
2650 PQNU01000010.1 GCA003932255_00277 CDS open 29159-30937 _na     592_aa DNA polymerase-3 subunit epsilon
2651 PQNU01000010.1 GCA003932255_00278 CDS open 31139-32488 _na     449_aa murT Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit MurT
2652 PQNU01000010.1 GCA003932255_00279 CDS open 32481-33365 _na     294_aa gatD Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit GatD
2653 PQNU01000010.1 GCA003932255_00280 CDS open 33415-34014 _na     199_aa Pyrrolidone-carboxylate peptidase
2654 PQNU01000010.1 GCA003932255_00281 CDS open 34019-34525 _na     168_aa doxX DoxX family protein
2655 PQNU01000010.1 GCA003932255_00282 CDS open 34705-35427 _na     240_aa recR recombination mediator RecR
2656 PQNU01000010.1 GCA003932255_00283 CDS open 35522-35836 _na     104_aa YbaB/EbfC family nucleoid-associated protein
2657 PQNU01000010.1 GCA003932255_00284 CDS open 35978-39178 _na     1066_aa DNA polymerase III subunit gamma and tau
2658 PQNU01000010.1 GCA003932255_00285 CDS open 39225-39848 _na     207_aa Suppressor of fused-like domain-containing protein
2659 PQNU01000010.1 GCA003932255_00286 CDS open 39853-41130 _na     425_aa mocR DNA-binding transcriptional MocR family regulator
2660 PQNU01000010.1 GCA003932255_00289 CDS open 42435-48590 _na     2051_aa VWFA domain-containing protein
2661 PQNU01000010.1 GCA003932255_00290 CDS open 48840-49886 _na     348_aa gluQRS tRNA glutamyl-Q(34) synthetase GluQRS
2662 PQNU01000010.1 GCA003932255_00291 CDS open 49907-51184 _na     425_aa tgt tRNA guanosine(34) transglycosylase Tgt
2663 PQNU01000010.1 GCA003932255_00293 CDS open 51521-51709 _na     62_aa csbD CsbD family protein
2664 PQNU01000010.1 GCA003932255_00294 CDS open 52008-52502 _na     164_aa hypothetical protein
2665 PQNU01000010.1 GCA003932255_00295 CDS open 52509-53060 _na     183_aa tRNA-specific adenosine deaminase
2666 PQNU01000010.1 GCA003932255_00296 CDS open 53053-53763 _na     236_aa tRNA adenosine deaminase
2667 PQNU01000010.1 GCA003932255_00297 CDS open 53883-55040 _na     385_aa prephenate dehydrogenase
2668 PQNU01000010.1 GCA003932255_00298 CDS open 55133-56179 _na     348_aa Beta-lactamase class A
2669 PQNU01000010.1 GCA003932255_00302 CDS open 58018-59082 _na     354_aa hisC histidinol-phosphate transaminase
2670 PQNU01000010.1 GCA003932255_00303 CDS open 59202-59630 _na     142_aa putative protein (TIGR02611 family)
2671 PQNU01000010.1 GCA003932255_00304 CDS open 59705-61132 _na     475_aa Class I SAM-dependent methyltransferase
2672 PQNU01000010.1 GCA003932255_00305 CDS open 61137-62687 _na     516_aa Dehydrogenase
2673 PQNU01000010.1 GCA003932255_00306 CDS open 62949-63335 _na     128_aa N-acetyltransferase domain-containing protein
2674 PQNU01000010.1 GCA003932255_00307 CDS open 63447-63839 _na     130_aa Catechol 2%2C3-dioxygenase-like lactoylglutathione lyase family enzyme
2675 PQNU01000010.1 GCA003932255_00308 CDS open 63858-64943 _na     361_aa alc allantoicase
2676 PQNU01000010.1 GCA003932255_00309 CDS open 65004-66578 _na     524_aa allB allantoinase AllB
2677 PQNU01000010.1 GCA003932255_00310 CDS open 66575-68023 _na     482_aa Aldolase
2678 PQNU01000010.1 GCA003932255_00311 CDS open 68034-69443 _na     469_aa Nitrate reductase
2679 PQNU01000010.1 GCA003932255_00312 CDS open 69616-70215 _na     199_aa Asp/Glu/hydantoin racemase
2680 PQNU01000010.1 GCA003932255_00313 CDS open 70284-70517 _na     77_aa hypothetical protein
2681 PQNU01000010.1 GCA003932255_00314 CDS open 70663-71451 _na     262_aa ABC transporter ATP-binding protein
2682 PQNU01000010.1 GCA003932255_00315 CDS open 71448-72563 _na     371_aa Iron complex transport system substrate-binding protein
2683 PQNU01000010.1 GCA003932255_00316 CDS open 72784-73905 _na     373_aa Iron complex transport system permease protein
2684 PQNU01000010.1 GCA003932255_00317 CDS open 74058-74375 _na     105_aa arsR DNA-binding transcriptional ArsR family regulator
2685 PQNU01000010.1 GCA003932255_00318 CDS open 74499-75527 _na     342_aa ureD Urease accessory protein UreD
2686 PQNU01000010.1 GCA003932255_00319 CDS open 75524-76237 _na     237_aa ureG urease accessory protein UreG
2687 PQNU01000010.1 GCA003932255_00320 CDS open 76330-77127 _na     265_aa ureF Urease accessory protein UreF
2688 PQNU01000010.1 GCA003932255_00321 CDS open 77218-78930 _na     570_aa ureC urease subunit alpha
2689 PQNU01000010.1 GCA003932255_00322 CDS open 78917-79462 _na     181_aa urease subunit beta
2690 PQNU01000010.1 GCA003932255_00323 CDS open 79464-80465 _na     333_aa cbiX Cobalamin biosynthesis protein CbiX
2691 PQNU01000010.1 GCA003932255_00324 CDS open 80473-80778 _na     101_aa urease subunit gamma
2692 PQNU01000010.1 GCA003932255_00325 CDS open 80969-84049 _na     1026_aa hrpB ATP-dependent helicase HrpB
2693 PQNU01000010.1 GCA003932255_00326 CDS open 84249-84554 _na     101_aa GlsB/YeaQ/YmgE family stress response membrane protein
2694 PQNU01000010.1 GCA003932255_00327 CDS open 84618-85313 _na     231_aa pspC Phage shock protein PspC N-terminal domain-containing protein
2695 PQNU01000010.1 GCA003932255_00328 CDS open 85426-86400 _na     324_aa DUF5642 domain-containing protein
2696 PQNU01000010.1 GCA003932255_00329 CDS open 86466-88034 _na     522_aa hypothetical protein
2697 PQNU01000010.1 GCA003932255_00330 CDS open 88153-88932 _na     259_aa DNA-binding response regulator
2698 PQNU01000010.1 GCA003932255_00331 CDS open 89027-90040 _na     337_aa Nitronate monooxygenase
2699 PQNU01000010.1 GCA003932255_00332 CDS open 90329-90649 _na     106_aa Integral membrane protein
2700 PQNU01000010.1 GCA003932255_00333 CDS open 91024-91950 _na     308_aa DUF418 domain-containing protein
2701 PQNU01000010.1 GCA003932255_00334 CDS open 92015-92533 _na     172_aa Flavodoxin
2702 PQNU01000010.1 GCA003932255_00335 CDS open 92831-93574 _na     247_aa Glutamine amidotransferase
2703 PQNU01000010.1 GCA003932255_00336 CDS open 93660-94409 _na     249_aa DUF732 domain-containing protein
2704 PQNU01000010.1 GCA003932255_00337 CDS open 94423-94800 _na     125_aa hypothetical protein
2705 PQNU01000010.1 GCA003932255_00338 CDS open 94876-95544 _na     222_aa ABC transporter permease
2706 PQNU01000010.1 GCA003932255_00339 CDS open 95537-96235 _na     232_aa Multidrug ABC transporter ATP-binding protein
2707 PQNU01000010.1 GCA003932255_00340 CDS open 96532-97635 _na     367_aa Esterase
2708 PQNU01000010.1 GCA003932255_00252 gene open 161-751 lysR
2709 PQNU01000010.1 GCA003932255_00253 gene open 762-914
2710 PQNU01000010.1 GCA003932255_00254 gene open 1088-1447 whiB
2711 PQNU01000010.1 GCA003932255_00255 gene open 1993-4101
2712 PQNU01000010.1 GCA003932255_00256 gene open 4228-5232
2713 PQNU01000010.1 GCA003932255_00258 gene open 5689-5817
2714 PQNU01000010.1 GCA003932255_00259 gene open 5933-6817
2715 PQNU01000010.1 GCA003932255_00260 gene open 6926-7786
2716 PQNU01000010.1 GCA003932255_00261 gene open 8098-11520
2717 PQNU01000010.1 GCA003932255_00262 gene open 11517-11942
2718 PQNU01000010.1 GCA003932255_00263 gene open 11942-13678
2719 PQNU01000010.1 GCA003932255_00264 gene open 13675-14727 mnhE
2720 PQNU01000010.1 GCA003932255_00265 gene open 14724-15002
2721 PQNU01000010.1 GCA003932255_00266 gene open 15004-15423
2722 PQNU01000010.1 GCA003932255_00267 gene open 15590-16024
2723 PQNU01000010.1 GCA003932255_00268 gene open 16309-17970
2724 PQNU01000010.1 GCA003932255_00269 gene open 18420-19175
2725 PQNU01000010.1 GCA003932255_00270 gene open 19260-20303
2726 PQNU01000010.1 GCA003932255_00271 gene open 20406-21479
2727 PQNU01000010.1 GCA003932255_00272 gene open 21544-22809
2728 PQNU01000010.1 GCA003932255_00273 gene open 23070-23927
2729 PQNU01000010.1 GCA003932255_00274 gene open 24037-25554
2730 PQNU01000010.1 GCA003932255_00275 gene open 25817-27655 leuA
2731 PQNU01000010.1 GCA003932255_00276 gene open 27841-28473 tetR
2732 PQNU01000010.1 GCA003932255_00277 gene open 29159-30937
2733 PQNU01000010.1 GCA003932255_00278 gene open 31139-32488 murT
2734 PQNU01000010.1 GCA003932255_00279 gene open 32481-33365 gatD
2735 PQNU01000010.1 GCA003932255_00280 gene open 33415-34014
2736 PQNU01000010.1 GCA003932255_00281 gene open 34019-34525 doxX
2737 PQNU01000010.1 GCA003932255_00282 gene open 34705-35427 recR
2738 PQNU01000010.1 GCA003932255_00283 gene open 35522-35836
2739 PQNU01000010.1 GCA003932255_00284 gene open 35978-39178
2740 PQNU01000010.1 GCA003932255_00285 gene open 39225-39848
2741 PQNU01000010.1 GCA003932255_00286 gene open 39853-41130 mocR
2742 PQNU01000010.1 GCA003932255_00289 gene open 42435-48590
2743 PQNU01000010.1 GCA003932255_00290 gene open 48840-49886 gluQRS
2744 PQNU01000010.1 GCA003932255_00291 gene open 49907-51184 tgt
2745 PQNU01000010.1 GCA003932255_00293 gene open 51521-51709 csbD
2746 PQNU01000010.1 GCA003932255_00294 gene open 52008-52502
2747 PQNU01000010.1 GCA003932255_00295 gene open 52509-53060
2748 PQNU01000010.1 GCA003932255_00296 gene open 53053-53763
2749 PQNU01000010.1 GCA003932255_00297 gene open 53883-55040
2750 PQNU01000010.1 GCA003932255_00298 gene open 55133-56179
2751 PQNU01000010.1 GCA003932255_00302 gene open 58018-59082 hisC
2752 PQNU01000010.1 GCA003932255_00303 gene open 59202-59630
2753 PQNU01000010.1 GCA003932255_00304 gene open 59705-61132
2754 PQNU01000010.1 GCA003932255_00305 gene open 61137-62687
2755 PQNU01000010.1 GCA003932255_00306 gene open 62949-63335
2756 PQNU01000010.1 GCA003932255_00307 gene open 63447-63839
2757 PQNU01000010.1 GCA003932255_00308 gene open 63858-64943 alc
2758 PQNU01000010.1 GCA003932255_00309 gene open 65004-66578 allB
2759 PQNU01000010.1 GCA003932255_00310 gene open 66575-68023
2760 PQNU01000010.1 GCA003932255_00311 gene open 68034-69443
2761 PQNU01000010.1 GCA003932255_00312 gene open 69616-70215
2762 PQNU01000010.1 GCA003932255_00313 gene open 70284-70517
2763 PQNU01000010.1 GCA003932255_00314 gene open 70663-71451
2764 PQNU01000010.1 GCA003932255_00315 gene open 71448-72563
2765 PQNU01000010.1 GCA003932255_00316 gene open 72784-73905
2766 PQNU01000010.1 GCA003932255_00317 gene open 74058-74375 arsR
2767 PQNU01000010.1 GCA003932255_00318 gene open 74499-75527 ureD
2768 PQNU01000010.1 GCA003932255_00319 gene open 75524-76237 ureG
2769 PQNU01000010.1 GCA003932255_00320 gene open 76330-77127 ureF
2770 PQNU01000010.1 GCA003932255_00321 gene open 77218-78930 ureC
2771 PQNU01000010.1 GCA003932255_00322 gene open 78917-79462
2772 PQNU01000010.1 GCA003932255_00323 gene open 79464-80465 cbiX
2773 PQNU01000010.1 GCA003932255_00324 gene open 80473-80778
2774 PQNU01000010.1 GCA003932255_00325 gene open 80969-84049 hrpB
2775 PQNU01000010.1 GCA003932255_00326 gene open 84249-84554
2776 PQNU01000010.1 GCA003932255_00327 gene open 84618-85313 pspC
2777 PQNU01000010.1 GCA003932255_00328 gene open 85426-86400
2778 PQNU01000010.1 GCA003932255_00329 gene open 86466-88034
2779 PQNU01000010.1 GCA003932255_00330 gene open 88153-88932
2780 PQNU01000010.1 GCA003932255_00331 gene open 89027-90040
2781 PQNU01000010.1 GCA003932255_00332 gene open 90329-90649
2782 PQNU01000010.1 GCA003932255_00333 gene open 91024-91950
2783 PQNU01000010.1 GCA003932255_00334 gene open 92015-92533
2784 PQNU01000010.1 GCA003932255_00335 gene open 92831-93574
2785 PQNU01000010.1 GCA003932255_00336 gene open 93660-94409
2786 PQNU01000010.1 GCA003932255_00337 gene open 94423-94800
2787 PQNU01000010.1 GCA003932255_00338 gene open 94876-95544
2788 PQNU01000010.1 GCA003932255_00339 gene open 95537-96235
2789 PQNU01000010.1 GCA003932255_00340 gene open 96532-97635
2790 PQNU01000010.1 GCA003932255_00257 gene open 5369-5442 trnP
2791 PQNU01000010.1 GCA003932255_00288 gene open 41671-41759 trnS
2792 PQNU01000010.1 GCA003932255_00292 gene open 51353-51442 trnS
2793 PQNU01000010.1 GCA003932255_00299 gene open 56656-56728 trnR
2794 PQNU01000010.1 GCA003932255_00300 gene open 57312-57387 trnR
2795 PQNU01000010.1 GCA003932255_00301 gene open 57561-57652 trnS
2796 PQNU01000010.1 GCA003932255_00257 tRNA open 5369-5442 trnP tRNA-Pro(cgg)
2797 PQNU01000010.1 GCA003932255_00288 tRNA open 41671-41759 trnS tRNA-Ser(gga)
2798 PQNU01000010.1 GCA003932255_00292 tRNA open 51353-51442 trnS tRNA-Ser(cga)
2799 PQNU01000010.1 GCA003932255_00299 tRNA open 56656-56728 trnR tRNA-Arg(acg)
2800 PQNU01000010.1 GCA003932255_00300 tRNA open 57312-57387 trnR tRNA-Arg(acg)
2801 PQNU01000010.1 GCA003932255_00301 tRNA open 57561-57652 trnS tRNA-Ser(gct)
2802 PQNU01000011.1 GCA003932255_00358 gene open 21761-22199 RNaseP_bact_a
2803 PQNU01000011.1 GCA003932255_00358 ncRNA open 21761-22199 Bacterial RNase P class A
2804 PQNU01000011.1 repeat_region open 29037-29808 CRISPR array with 13 repeats of length 27%2C consensus sequence GGATCATCCCCGCTCACGCGGGGAGCA and spacer length 34
2805 PQNU01000011.1 GCA003932255_00341 CDS open 103-1437 _na     444_aa Secreted protein
2806 PQNU01000011.1 GCA003932255_00342 CDS open 1538-3490 _na     650_aa Gamma-glutamyltranspeptidase/glutathione hydrolase
2807 PQNU01000011.1 GCA003932255_00343 CDS open 4128-4787 _na     219_aa Glycine transporter domain-containing protein
2808 PQNU01000011.1 GCA003932255_00344 CDS open 4906-6222 _na     438_aa Nramp family divalent metal transporter
2809 PQNU01000011.1 GCA003932255_00345 CDS open 6316-7359 _na     347_aa nitrate/nitrite transporter
2810 PQNU01000011.1 GCA003932255_00346 CDS open 7461-7745 _na     94_aa hypothetical protein
2811 PQNU01000011.1 GCA003932255_00347 CDS open 7879-9189 _na     436_aa DUF2029 domain-containing protein
2812 PQNU01000011.1 GCA003932255_00348 CDS open 9201-10004 _na     267_aa Fructosamine kinase
2813 PQNU01000011.1 GCA003932255_00349 CDS open 10001-10726 _na     241_aa tetR TetR family transcriptional regulator
2814 PQNU01000011.1 GCA003932255_00350 CDS open 10791-11486 _na     231_aa Biliverdin-producing heme oxygenase
2815 PQNU01000011.1 GCA003932255_00351 CDS open 11636-12460 _na     274_aa heme ABC transporter ATP-binding protein
2816 PQNU01000011.1 GCA003932255_00352 CDS open 12457-13515 _na     352_aa ABC transporter permease
2817 PQNU01000011.1 GCA003932255_00353 CDS open 13512-15656 _na     714_aa Htaa domain-containing protein
2818 PQNU01000011.1 GCA003932255_00354 CDS open 15847-18978 _na     1043_aa bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase
2819 PQNU01000011.1 GCA003932255_00355 CDS open 18988-20328 _na     446_aa glnA type I glutamate--ammonia ligase
2820 PQNU01000011.1 GCA003932255_00356 CDS open 20437-21366 _na     309_aa panB 3-methyl-2-oxobutanoate hydroxymethyltransferase
2821 PQNU01000011.1 GCA003932255_00357 CDS open 21510-21686 _na     58_aa SPOR domain-containing protein
2822 PQNU01000011.1 GCA003932255_00359 CDS open 22357-23190 _na     277_aa HTH cro/C1-type domain-containing protein
2823 PQNU01000011.1 GCA003932255_00360 CDS open 23279-24520 _na     413_aa bifunctional RNase H/acid phosphatase
2824 PQNU01000011.1 GCA003932255_00361 CDS open 24677-25930 _na     417_aa Nif3-like dinuclear metal center hexameric protein
2825 PQNU01000011.1 GCA003932255_00362 CDS open 26214-26657 _na     147_aa Phosphoglycolate phosphatase-like HAD superfamily hydrolase
2826 PQNU01000011.1 GCA003932255_00363 CDS open 26816-27343 _na     175_aa protein-tyrosine-phosphatase
2827 PQNU01000011.1 GCA003932255_00364 CDS open 27473-28729 _na     418_aa SURF1-like protein
2828 PQNU01000011.1 GCA003932255_00365 CDS open 30239-30790 _na     183_aa cas1 CRISPR-associated endonuclease Cas1
2829 PQNU01000011.1 GCA003932255_00366 CDS open 30787-31461 _na     224_aa cas6e type I-E CRISPR-associated protein Cas6/Cse3/CasE
2830 PQNU01000011.1 GCA003932255_00367 CDS open 31462-32160 _na     232_aa cas5e type I-E CRISPR-associated protein Cas5/CasD
2831 PQNU01000011.1 GCA003932255_00368 CDS open 32166-33275 _na     369_aa cas7e type I-E CRISPR-associated protein Cas7/Cse4/CasC
2832 PQNU01000011.1 GCA003932255_00369 CDS open 33440-34156 _na     238_aa casB type I-E CRISPR-associated protein Cse2/CasB
2833 PQNU01000011.1 GCA003932255_00370 CDS open 34134-34796 _na     220_aa CRISPR-associated protein Cse1 (CRISPR_cse1)
2834 PQNU01000011.1 GCA003932255_00371 CDS open 34824-35297 _na     157_aa hypothetical protein
2835 PQNU01000011.1 GCA003932255_00372 CDS open 35294-35941 _na     215_aa casA type I-E CRISPR-associated protein Cse1/CasA
2836 PQNU01000011.1 GCA003932255_00373 CDS open 36164-37534 _na     456_aa CRISPR-associated helicase Cas3
2837 PQNU01000011.1 GCA003932255_00374 CDS open 37583-38980 _na     465_aa CRISPR-associated endonuclease Cas3
2838 PQNU01000011.1 GCA003932255_00376 CDS open 39647-40075 _na     142_aa DUF3052 domain-containing protein
2839 PQNU01000011.1 GCA003932255_00377 CDS open 40467-43355 _na     962_aa aceE pyruvate dehydrogenase (acetyl-transferring)%2C homodimeric type
2840 PQNU01000011.1 GCA003932255_00378 CDS open 43360-44232 _na     290_aa HAD family hydrolase
2841 PQNU01000011.1 GCA003932255_00379 CDS open 44315-45433 _na     372_aa AB hydrolase-1 domain-containing protein
2842 PQNU01000011.1 GCA003932255_00380 CDS open 45667-46143 _na     158_aa Carrier domain-containing protein
2843 PQNU01000011.1 GCA003932255_00381 CDS open 46164-47030 _na     288_aa Serine hydrolase
2844 PQNU01000011.1 GCA003932255_00382 CDS open 47272-47784 _na     170_aa DUF202 domain-containing protein
2845 PQNU01000011.1 GCA003932255_00383 CDS open 48064-49143 _na     359_aa Restriction endonuclease
2846 PQNU01000011.1 GCA003932255_00384 CDS open 49362-49718 _na     118_aa hypothetical protein
2847 PQNU01000011.1 GCA003932255_00385 CDS open 49754-50719 _na     321_aa SGNH hydrolase-type esterase domain-containing protein
2848 PQNU01000011.1 GCA003932255_00388 CDS open 51635-52606 _na     323_aa Urea transporter
2849 PQNU01000011.1 GCA003932255_00389 CDS open 52866-53885 _na     339_aa Aminocarboxymuconate-semialdehyde decarboxylase
2850 PQNU01000011.1 GCA003932255_00390 CDS open 54405-55301 _na     298_aa FAD-dependent monooxygenase
2851 PQNU01000011.1 GCA003932255_00391 CDS open 55476-56858 _na     460_aa Glycolate oxidase
2852 PQNU01000011.1 GCA003932255_00392 CDS open 56958-57860 _na     300_aa HTH asnC-type domain-containing protein
2853 PQNU01000011.1 GCA003932255_00393 CDS open 58058-58915 _na     285_aa Pirin family protein
2854 PQNU01000011.1 GCA003932255_00394 CDS open 59150-59542 _na     130_aa Transcriptional regulator
2855 PQNU01000011.1 GCA003932255_00395 CDS open 59604-61811 _na     735_aa Cu+-exporting ATPase
2856 PQNU01000011.1 GCA003932255_00396 CDS open 61939-62652 _na     237_aa Zn-dependent hydrolase
2857 PQNU01000011.1 GCA003932255_00397 CDS open 62649-63767 _na     372_aa S-(hydroxymethyl)mycothiol dehydrogenase
2858 PQNU01000011.1 GCA003932255_00398 CDS open 64077-64397 _na     106_aa ytxH YtxH domain-containing protein
2859 PQNU01000011.1 GCA003932255_00399 CDS open 64438-66378 _na     646_aa DNA primase
2860 PQNU01000011.1 GCA003932255_00400 CDS open 66454-67017 _na     187_aa Ribonuclease
2861 PQNU01000011.1 GCA003932255_00401 CDS open 67108-68472 _na     454_aa MFS transporter
2862 PQNU01000011.1 GCA003932255_00402 CDS open 68763-70046 _na     427_aa deoxyguanosinetriphosphate triphosphohydrolase
2863 PQNU01000011.1 GCA003932255_00403 CDS open 70222-70908 _na     228_aa ydcF YdcF family protein
2864 PQNU01000011.1 GCA003932255_00404 CDS open 70958-73108 _na     716_aa TPM domain-containing protein
2865 PQNU01000011.1 GCA003932255_00405 CDS open 73224-73766 _na     180_aa DUF3068 domain-containing protein
2866 PQNU01000011.1 GCA003932255_00406 CDS open 73814-75196 _na     460_aa glycine--tRNA ligase
2867 PQNU01000011.1 GCA003932255_00407 CDS open 75811-76236 _na     141_aa Transcriptional repressor
2868 PQNU01000011.1 GCA003932255_00408 CDS open 76345-77586 _na     413_aa Rubrerythrin diiron-binding domain-containing protein
2869 PQNU01000011.1 GCA003932255_00409 CDS open 77583-78458 _na     291_aa isoprenyl transferase
2870 PQNU01000011.1 GCA003932255_00410 CDS open 78514-79275 _na     253_aa recO DNA repair protein RecO
2871 PQNU01000011.1 GCA003932255_00411 CDS open 79333-80049 _na     238_aa hypothetical protein
2872 PQNU01000011.1 GCA003932255_00412 CDS open 80306-81325 _na     339_aa era GTPase Era
2873 PQNU01000011.1 GCA003932255_00413 CDS open 81315-82661 _na     448_aa HlyC/CorC family transporter
2874 PQNU01000011.1 GCA003932255_00414 CDS open 82658-83335 _na     225_aa ybeY rRNA maturation RNase YbeY
2875 PQNU01000011.1 GCA003932255_00415 CDS open 83332-84417 _na     361_aa PhoH-like protein
2876 PQNU01000011.1 GCA003932255_00416 CDS open 84414-85274 _na     286_aa 16S rRNA (uracil(1498)-N(3))-methyltransferase
2877 PQNU01000011.1 GCA003932255_00417 CDS open 85278-86414 _na     378_aa dnaJ molecular chaperone DnaJ
2878 PQNU01000011.1 GCA003932255_00418 CDS open 86595-87677 _na     360_aa hrcA heat-inducible transcriptional repressor HrcA
2879 PQNU01000011.1 GCA003932255_00419 CDS open 87681-88988 _na     435_aa hemW radical SAM family heme chaperone HemW
2880 PQNU01000011.1 GCA003932255_00420 CDS open 89026-89706 _na     226_aa Secreted protein
2881 PQNU01000011.1 GCA003932255_00421 CDS open 89878-90249 _na     123_aa hypothetical protein
2882 PQNU01000011.1 GCA003932255_00341 gene open 103-1437
2883 PQNU01000011.1 GCA003932255_00342 gene open 1538-3490
2884 PQNU01000011.1 GCA003932255_00343 gene open 4128-4787
2885 PQNU01000011.1 GCA003932255_00344 gene open 4906-6222
2886 PQNU01000011.1 GCA003932255_00345 gene open 6316-7359
2887 PQNU01000011.1 GCA003932255_00346 gene open 7461-7745
2888 PQNU01000011.1 GCA003932255_00347 gene open 7879-9189
2889 PQNU01000011.1 GCA003932255_00348 gene open 9201-10004
2890 PQNU01000011.1 GCA003932255_00349 gene open 10001-10726 tetR
2891 PQNU01000011.1 GCA003932255_00350 gene open 10791-11486
2892 PQNU01000011.1 GCA003932255_00351 gene open 11636-12460
2893 PQNU01000011.1 GCA003932255_00352 gene open 12457-13515
2894 PQNU01000011.1 GCA003932255_00353 gene open 13512-15656
2895 PQNU01000011.1 GCA003932255_00354 gene open 15847-18978
2896 PQNU01000011.1 GCA003932255_00355 gene open 18988-20328 glnA
2897 PQNU01000011.1 GCA003932255_00356 gene open 20437-21366 panB
2898 PQNU01000011.1 GCA003932255_00357 gene open 21510-21686
2899 PQNU01000011.1 GCA003932255_00359 gene open 22357-23190
2900 PQNU01000011.1 GCA003932255_00360 gene open 23279-24520
2901 PQNU01000011.1 GCA003932255_00361 gene open 24677-25930
2902 PQNU01000011.1 GCA003932255_00362 gene open 26214-26657
2903 PQNU01000011.1 GCA003932255_00363 gene open 26816-27343
2904 PQNU01000011.1 GCA003932255_00364 gene open 27473-28729
2905 PQNU01000011.1 GCA003932255_00365 gene open 30239-30790 cas1
2906 PQNU01000011.1 GCA003932255_00366 gene open 30787-31461 cas6e
2907 PQNU01000011.1 GCA003932255_00367 gene open 31462-32160 cas5e
2908 PQNU01000011.1 GCA003932255_00368 gene open 32166-33275 cas7e
2909 PQNU01000011.1 GCA003932255_00369 gene open 33440-34156 casB
2910 PQNU01000011.1 GCA003932255_00370 gene open 34134-34796
2911 PQNU01000011.1 GCA003932255_00371 gene open 34824-35297
2912 PQNU01000011.1 GCA003932255_00372 gene open 35294-35941 casA
2913 PQNU01000011.1 GCA003932255_00373 gene open 36164-37534
2914 PQNU01000011.1 GCA003932255_00374 gene open 37583-38980
2915 PQNU01000011.1 GCA003932255_00376 gene open 39647-40075
2916 PQNU01000011.1 GCA003932255_00377 gene open 40467-43355 aceE
2917 PQNU01000011.1 GCA003932255_00378 gene open 43360-44232
2918 PQNU01000011.1 GCA003932255_00379 gene open 44315-45433
2919 PQNU01000011.1 GCA003932255_00380 gene open 45667-46143
2920 PQNU01000011.1 GCA003932255_00381 gene open 46164-47030
2921 PQNU01000011.1 GCA003932255_00382 gene open 47272-47784
2922 PQNU01000011.1 GCA003932255_00383 gene open 48064-49143
2923 PQNU01000011.1 GCA003932255_00384 gene open 49362-49718
2924 PQNU01000011.1 GCA003932255_00385 gene open 49754-50719
2925 PQNU01000011.1 GCA003932255_00388 gene open 51635-52606
2926 PQNU01000011.1 GCA003932255_00389 gene open 52866-53885
2927 PQNU01000011.1 GCA003932255_00390 gene open 54405-55301
2928 PQNU01000011.1 GCA003932255_00391 gene open 55476-56858
2929 PQNU01000011.1 GCA003932255_00392 gene open 56958-57860
2930 PQNU01000011.1 GCA003932255_00393 gene open 58058-58915
2931 PQNU01000011.1 GCA003932255_00394 gene open 59150-59542
2932 PQNU01000011.1 GCA003932255_00395 gene open 59604-61811
2933 PQNU01000011.1 GCA003932255_00396 gene open 61939-62652
2934 PQNU01000011.1 GCA003932255_00397 gene open 62649-63767
2935 PQNU01000011.1 GCA003932255_00398 gene open 64077-64397 ytxH
2936 PQNU01000011.1 GCA003932255_00399 gene open 64438-66378
2937 PQNU01000011.1 GCA003932255_00400 gene open 66454-67017
2938 PQNU01000011.1 GCA003932255_00401 gene open 67108-68472
2939 PQNU01000011.1 GCA003932255_00402 gene open 68763-70046
2940 PQNU01000011.1 GCA003932255_00403 gene open 70222-70908 ydcF
2941 PQNU01000011.1 GCA003932255_00404 gene open 70958-73108
2942 PQNU01000011.1 GCA003932255_00405 gene open 73224-73766
2943 PQNU01000011.1 GCA003932255_00406 gene open 73814-75196
2944 PQNU01000011.1 GCA003932255_00407 gene open 75811-76236
2945 PQNU01000011.1 GCA003932255_00408 gene open 76345-77586
2946 PQNU01000011.1 GCA003932255_00409 gene open 77583-78458
2947 PQNU01000011.1 GCA003932255_00410 gene open 78514-79275 recO
2948 PQNU01000011.1 GCA003932255_00411 gene open 79333-80049
2949 PQNU01000011.1 GCA003932255_00412 gene open 80306-81325 era
2950 PQNU01000011.1 GCA003932255_00413 gene open 81315-82661
2951 PQNU01000011.1 GCA003932255_00414 gene open 82658-83335 ybeY
2952 PQNU01000011.1 GCA003932255_00415 gene open 83332-84417
2953 PQNU01000011.1 GCA003932255_00416 gene open 84414-85274
2954 PQNU01000011.1 GCA003932255_00417 gene open 85278-86414 dnaJ
2955 PQNU01000011.1 GCA003932255_00418 gene open 86595-87677 hrcA
2956 PQNU01000011.1 GCA003932255_00419 gene open 87681-88988 hemW
2957 PQNU01000011.1 GCA003932255_00420 gene open 89026-89706
2958 PQNU01000011.1 GCA003932255_00421 gene open 89878-90249
2959 PQNU01000011.1 GCA003932255_00375 gene open 39343-39415 trnV
2960 PQNU01000011.1 GCA003932255_00386 gene open 51029-51102 trnI
2961 PQNU01000011.1 GCA003932255_00387 gene open 51369-51443 trnN
2962 PQNU01000011.1 GCA003932255_00375 tRNA open 39343-39415 trnV tRNA-Val(tac)
2963 PQNU01000011.1 GCA003932255_00386 tRNA open 51029-51102 trnI tRNA-Ile2(cat)
2964 PQNU01000011.1 GCA003932255_00387 tRNA open 51369-51443 trnN tRNA-Asn(gtt)
2965 PQNU01000012.1 GCA003932255_00422 CDS open 186-443 _na     85_aa Molybdopterin synthase sulfur carrier subunit
2966 PQNU01000012.1 GCA003932255_00423 CDS open 534-1088 _na     184_aa moaC cyclic pyranopterin monophosphate synthase MoaC
2967 PQNU01000012.1 GCA003932255_00424 CDS open 1090-1626 _na     178_aa Molybdenum cofactor biosynthesis protein
2968 PQNU01000012.1 GCA003932255_00425 CDS open 1619-2149 _na     176_aa Molybdopterin synthase catalytic subunit
2969 PQNU01000012.1 GCA003932255_00426 CDS open 2146-3489 _na     447_aa Adenylyltransferase/sulfurtransferase
2970 PQNU01000012.1 GCA003932255_00427 CDS open 3449-4456 _na     335_aa fdhD formate dehydrogenase accessory sulfurtransferase FdhD
2971 PQNU01000012.1 GCA003932255_00428 CDS open 4466-6913 _na     815_aa Formate dehydrogenase
2972 PQNU01000012.1 GCA003932255_00429 CDS open 7056-7406 _na     116_aa DUF6457 domain-containing protein
2973 PQNU01000012.1 GCA003932255_00430 CDS open 8032-8430 _na     132_aa rpsH 30S ribosomal protein S8
2974 PQNU01000012.1 GCA003932255_00431 CDS open 8445-8981 _na     178_aa rplF 50S ribosomal protein L6
2975 PQNU01000012.1 GCA003932255_00432 CDS open 8981-9385 _na     134_aa rplR 50S ribosomal protein L18
2976 PQNU01000012.1 GCA003932255_00433 CDS open 9426-10070 _na     214_aa rpsE 30S ribosomal protein S5
2977 PQNU01000012.1 GCA003932255_00434 CDS open 10076-10261 _na     61_aa rpmD 50S ribosomal protein L30
2978 PQNU01000012.1 GCA003932255_00435 CDS open 10268-10714 _na     148_aa rplO 50S ribosomal protein L15
2979 PQNU01000012.1 GCA003932255_00436 CDS open 10739-12514 _na     591_aa hypothetical protein
2980 PQNU01000012.1 GCA003932255_00437 CDS open 12511-13062 _na     183_aa adenylate kinase
2981 PQNU01000012.1 GCA003932255_00438 CDS open 13206-14000 _na     264_aa map type I methionyl aminopeptidase
2982 PQNU01000012.1 GCA003932255_00439 CDS open 14382-14603 _na     73_aa infA translation initiation factor IF-1
2983 PQNU01000012.1 GCA003932255_00440 CDS open 14898-15266 _na     122_aa rpsM 30S ribosomal protein S13
2984 PQNU01000012.1 GCA003932255_00441 CDS open 15266-15670 _na     134_aa rpsK 30S ribosomal protein S11
2985 PQNU01000012.1 GCA003932255_00442 CDS open 15714-16319 _na     201_aa rpsD 30S ribosomal protein S4
2986 PQNU01000012.1 GCA003932255_00443 CDS open 16562-17575 _na     337_aa DNA-directed RNA polymerase subunit alpha
2987 PQNU01000012.1 GCA003932255_00444 CDS open 17627-18199 _na     190_aa rplQ 50S ribosomal protein L17
2988 PQNU01000012.1 GCA003932255_00445 CDS open 18359-19357 _na     332_aa DUF998 domain-containing protein
2989 PQNU01000012.1 GCA003932255_00446 CDS open 19354-20241 _na     295_aa truA tRNA pseudouridine(38-40) synthase TruA
2990 PQNU01000012.1 GCA003932255_00447 CDS open 20379-23306 _na     975_aa aftA Arabinofuranosyltransferase AftA N-terminal domain-containing protein
2991 PQNU01000012.1 GCA003932255_00448 CDS open 23275-24477 _na     400_aa eccB Type VII secretion protein EccB
2992 PQNU01000012.1 GCA003932255_00449 CDS open 24618-26009 _na     463_aa eccB type VII secretion protein EccB
2993 PQNU01000012.1 GCA003932255_00450 CDS open 26864-27289 _na     141_aa hypothetical protein
2994 PQNU01000012.1 GCA003932255_00451 CDS open 27292-28647 _na     451_aa eccD Type VII secretion integral membrane protein EccD
2995 PQNU01000012.1 GCA003932255_00452 CDS open 29326-30165 _na     279_aa putative protein (TIGR02271 family)
2996 PQNU01000012.1 GCA003932255_00453 CDS open 30381-33617 _na     1078_aa ftsK Cell division protein FtsK
2997 PQNU01000012.1 GCA003932255_00454 CDS open 33614-35110 _na     498_aa Type VII secretion-associated protein
2998 PQNU01000012.1 GCA003932255_00455 CDS open 35351-35638 _na     95_aa ESAT-6-like protein
2999 PQNU01000012.1 GCA003932255_00456 CDS open 35719-36000 _na     93_aa ESAT-6-like protein
3000 PQNU01000012.1 GCA003932255_00457 CDS open 36342-36785 _na     147_aa rplM 50S ribosomal protein L13