HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Corynebacterium bovis (GCA_003932295.1)

Select a Genome:
BAKTA Annotations for GCA_003932295.1
Genome Selected: Corynebacterium bovis
ContigsBases CDSrRNA tmRNAtRNA
12 2666089 2131 5 2 52
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4389 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:4]    |    Number of Records Found: 4389 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1501 PQNX01000001.1 GCA003932295_00688 gene open 812652-812840
1502 PQNX01000001.1 GCA003932295_00689 gene open 812846-814321
1503 PQNX01000001.1 GCA003932295_00690 gene open 814318-815085 amaP
1504 PQNX01000001.1 GCA003932295_00691 gene open 815082-815645 amaP
1505 PQNX01000001.1 GCA003932295_00692 gene open 815836-816816
1506 PQNX01000001.1 GCA003932295_00693 gene open 817098-818288 tuf
1507 PQNX01000001.1 GCA003932295_00694 gene open 818673-820805 fusA
1508 PQNX01000001.1 GCA003932295_00695 gene open 821077-821547 rpsG
1509 PQNX01000001.1 GCA003932295_00696 gene open 821549-821920 rpsL
1510 PQNX01000001.1 GCA003932295_00697 gene open 822597-826568
1511 PQNX01000001.1 GCA003932295_00698 gene open 826717-830208 rpoB
1512 PQNX01000001.1 GCA003932295_00699 gene open 830863-831249 rplL
1513 PQNX01000001.1 GCA003932295_00700 gene open 831331-831843 rplJ
1514 PQNX01000001.1 GCA003932295_00701 gene open 832321-833361
1515 PQNX01000001.1 GCA003932295_00702 gene open 833549-834262 rplA
1516 PQNX01000001.1 GCA003932295_00703 gene open 834402-834842 rplK
1517 PQNX01000001.1 GCA003932295_00704 gene open 834998-835963 nusG
1518 PQNX01000001.1 GCA003932295_00705 gene open 836153-836506 secE
1519 PQNX01000001.1 GCA003932295_00710 gene open 837577-838587
1520 PQNX01000001.1 GCA003932295_00711 gene open 838861-840207
1521 PQNX01000001.1 GCA003932295_00712 gene open 840334-841023
1522 PQNX01000001.1 GCA003932295_00713 gene open 841189-842403
1523 PQNX01000001.1 GCA003932295_00714 gene open 842583-843056
1524 PQNX01000001.1 GCA003932295_00715 gene open 843053-844858 menD
1525 PQNX01000001.1 GCA003932295_00716 gene open 845071-846231
1526 PQNX01000001.1 GCA003932295_00717 gene open 846335-847273
1527 PQNX01000001.1 GCA003932295_00718 gene open 847447-848079 doxX
1528 PQNX01000001.1 GCA003932295_00719 gene open 848249-849574
1529 PQNX01000001.1 GCA003932295_00720 gene open 849577-849846
1530 PQNX01000001.1 GCA003932295_00721 gene open 850047-850466
1531 PQNX01000001.1 GCA003932295_00722 gene open 850325-850624
1532 PQNX01000001.1 GCA003932295_00723 gene open 850666-851967
1533 PQNX01000001.1 GCA003932295_00724 gene open 852200-853078
1534 PQNX01000001.1 GCA003932295_00725 gene open 853259-853702
1535 PQNX01000001.1 GCA003932295_00726 gene open 853838-854422
1536 PQNX01000001.1 GCA003932295_00727 gene open 854419-855294 rfbA
1537 PQNX01000001.1 GCA003932295_00728 gene open 855295-856029
1538 PQNX01000001.1 GCA003932295_00729 gene open 856152-857537
1539 PQNX01000001.1 GCA003932295_00730 gene open 857681-858757 rfbB
1540 PQNX01000001.1 GCA003932295_00731 gene open 858767-859516
1541 PQNX01000001.1 GCA003932295_00732 gene open 859523-861652
1542 PQNX01000001.1 GCA003932295_00733 gene open 861652-862572
1543 PQNX01000001.1 GCA003932295_00734 gene open 862844-864022 ccsB
1544 PQNX01000001.1 GCA003932295_00735 gene open 864183-865916 resB
1545 PQNX01000001.1 GCA003932295_00736 gene open 866053-866841 resC
1546 PQNX01000001.1 GCA003932295_00737 gene open 866855-867457
1547 PQNX01000001.1 GCA003932295_00738 gene open 867802-868407 phoE
1548 PQNX01000001.1 GCA003932295_00739 gene open 868620-869945 hemL
1549 PQNX01000001.1 GCA003932295_00740 gene open 870125-872815
1550 PQNX01000001.1 GCA003932295_00741 gene open 872829-873398
1551 PQNX01000001.1 GCA003932295_00742 gene open 873401-874588
1552 PQNX01000001.1 GCA003932295_00743 gene open 874662-875306 plsY
1553 PQNX01000001.1 GCA003932295_00744 gene open 875365-876393 hemB
1554 PQNX01000001.1 GCA003932295_00745 gene open 876496-878433
1555 PQNX01000001.1 GCA003932295_00746 gene open 878769-879833 hemC
1556 PQNX01000001.1 GCA003932295_00747 gene open 879830-881374
1557 PQNX01000001.1 GCA003932295_00748 gene open 881640-881900
1558 PQNX01000001.1 GCA003932295_00749 gene open 882045-883439
1559 PQNX01000001.1 GCA003932295_00750 gene open 883691-883792
1560 PQNX01000001.1 GCA003932295_00751 gene open 884034-884234
1561 PQNX01000001.1 GCA003932295_00752 gene open 884574-885416 proC
1562 PQNX01000001.1 GCA003932295_00753 gene open 885591-886751
1563 PQNX01000001.1 GCA003932295_00754 gene open 886959-887828
1564 PQNX01000001.1 GCA003932295_00755 gene open 888096-889160
1565 PQNX01000001.1 GCA003932295_00756 gene open 889263-889955 regX3
1566 PQNX01000001.1 GCA003932295_00757 gene open 890290-891519 senX3
1567 PQNX01000001.1 GCA003932295_00758 gene open 891533-892306
1568 PQNX01000001.1 GCA003932295_00759 gene open 892399-892977 ybjN
1569 PQNX01000001.1 GCA003932295_00760 gene open 893084-894457 mshA
1570 PQNX01000001.1 GCA003932295_00761 gene open 894571-896307
1571 PQNX01000001.1 GCA003932295_00762 gene open 896397-897755
1572 PQNX01000001.1 GCA003932295_00763 gene open 897770-898270
1573 PQNX01000001.1 GCA003932295_00764 gene open 898380-899156
1574 PQNX01000001.1 GCA003932295_00765 gene open 899276-900025 deoC
1575 PQNX01000001.1 GCA003932295_00766 gene open 900136-900438
1576 PQNX01000001.1 GCA003932295_00767 gene open 900542-901861
1577 PQNX01000001.1 GCA003932295_00768 gene open 901958-902308
1578 PQNX01000001.1 GCA003932295_00769 gene open 902524-903273
1579 PQNX01000001.1 GCA003932295_00770 gene open 903273-905309
1580 PQNX01000001.1 GCA003932295_00771 gene open 905339-906082
1581 PQNX01000001.1 GCA003932295_00772 gene open 906513-909209
1582 PQNX01000001.1 GCA003932295_00773 gene open 909317-910111
1583 PQNX01000001.1 GCA003932295_00774 gene open 910350-912554
1584 PQNX01000001.1 GCA003932295_00775 gene open 913245-914540 aceA
1585 PQNX01000001.1 GCA003932295_00776 gene open 914778-916211 lpdA
1586 PQNX01000001.1 GCA003932295_00777 gene open 916441-916551
1587 PQNX01000001.1 GCA003932295_00778 gene open 916895-918004
1588 PQNX01000001.1 GCA003932295_00779 gene open 918213-919769
1589 PQNX01000001.1 GCA003932295_00780 gene open 919780-921414
1590 PQNX01000001.1 GCA003932295_00781 gene open 921458-922450
1591 PQNX01000001.1 GCA003932295_00782 gene open 922516-923247
1592 PQNX01000001.1 GCA003932295_00783 gene open 923244-923633
1593 PQNX01000001.1 GCA003932295_00784 gene open 923711-924628
1594 PQNX01000001.1 GCA003932295_00785 gene open 924776-926164
1595 PQNX01000001.1 GCA003932295_00786 gene open 926274-928406
1596 PQNX01000001.1 GCA003932295_00787 gene open 928571-928771 pspC
1597 PQNX01000001.1 GCA003932295_00788 gene open 928990-929235
1598 PQNX01000001.1 GCA003932295_00790 gene open 930036-931403
1599 PQNX01000001.1 GCA003932295_00791 gene open 931588-933294
1600 PQNX01000001.1 GCA003932295_00792 gene open 933411-934433
1601 PQNX01000001.1 GCA003932295_00793 gene open 934566-937625 topA
1602 PQNX01000001.1 GCA003932295_00794 gene open 937971-938174 cspC
1603 PQNX01000001.1 GCA003932295_00795 gene open 938457-940979
1604 PQNX01000001.1 GCA003932295_00796 gene open 941111-942247
1605 PQNX01000001.1 GCA003932295_00797 gene open 942419-942919
1606 PQNX01000001.1 GCA003932295_00798 gene open 942916-943353 tadE
1607 PQNX01000001.1 GCA003932295_00799 gene open 943328-943750
1608 PQNX01000001.1 GCA003932295_00800 gene open 944003-945199 gspF
1609 PQNX01000001.1 GCA003932295_00801 gene open 945220-946581
1610 PQNX01000001.1 GCA003932295_00802 gene open 946578-947831
1611 PQNX01000001.1 GCA003932295_00803 gene open 948081-949016
1612 PQNX01000001.1 GCA003932295_00804 gene open 949090-950022
1613 PQNX01000001.1 GCA003932295_00805 gene open 950165-950674
1614 PQNX01000001.1 GCA003932295_00806 gene open 950702-951685
1615 PQNX01000001.1 GCA003932295_00807 gene open 951786-952979 marP
1616 PQNX01000001.1 GCA003932295_00808 gene open 952983-953801
1617 PQNX01000001.1 GCA003932295_00809 gene open 953882-954697
1618 PQNX01000001.1 GCA003932295_00810 gene open 954694-955506 nth
1619 PQNX01000001.1 GCA003932295_00811 gene open 955764-956447
1620 PQNX01000001.1 GCA003932295_00812 gene open 956600-957445
1621 PQNX01000001.1 GCA003932295_00813 gene open 957719-958309 lysR
1622 PQNX01000001.1 GCA003932295_00814 gene open 958320-958472
1623 PQNX01000001.1 GCA003932295_00815 gene open 958614-958973 whiB
1624 PQNX01000001.1 GCA003932295_00816 gene open 959519-961627
1625 PQNX01000001.1 GCA003932295_00817 gene open 961727-962731
1626 PQNX01000001.1 GCA003932295_00819 gene open 963370-964254
1627 PQNX01000001.1 GCA003932295_00820 gene open 964354-965214
1628 PQNX01000001.1 GCA003932295_00821 gene open 965526-968969
1629 PQNX01000001.1 GCA003932295_00822 gene open 968966-969391
1630 PQNX01000001.1 GCA003932295_00823 gene open 969391-971136
1631 PQNX01000001.1 GCA003932295_00824 gene open 971133-972191 mnhE
1632 PQNX01000001.1 GCA003932295_00825 gene open 972188-972466
1633 PQNX01000001.1 GCA003932295_00826 gene open 972468-972887
1634 PQNX01000001.1 GCA003932295_00827 gene open 973049-973483
1635 PQNX01000001.1 GCA003932295_00828 gene open 973780-975441
1636 PQNX01000001.1 GCA003932295_00829 gene open 975891-976646
1637 PQNX01000001.1 GCA003932295_00830 gene open 976731-977774
1638 PQNX01000001.1 GCA003932295_00831 gene open 977902-978975
1639 PQNX01000001.1 GCA003932295_00832 gene open 979040-980305
1640 PQNX01000001.1 GCA003932295_00833 gene open 980565-981422
1641 PQNX01000001.1 GCA003932295_00834 gene open 981549-983027
1642 PQNX01000001.1 GCA003932295_00835 gene open 983290-985128 leuA
1643 PQNX01000001.1 GCA003932295_00836 gene open 985326-985958 tetR
1644 PQNX01000001.1 GCA003932295_00837 gene open 986645-988588
1645 PQNX01000001.1 GCA003932295_00838 gene open 988790-990172 murT
1646 PQNX01000001.1 GCA003932295_00839 gene open 990165-991049 gatD
1647 PQNX01000001.1 GCA003932295_00840 gene open 991117-991719
1648 PQNX01000001.1 GCA003932295_00841 gene open 991724-992233 doxX
1649 PQNX01000001.1 GCA003932295_00842 gene open 992383-993105 recR
1650 PQNX01000001.1 GCA003932295_00843 gene open 993200-993514
1651 PQNX01000001.1 GCA003932295_00844 gene open 993656-996856
1652 PQNX01000001.1 GCA003932295_00845 gene open 996903-997526
1653 PQNX01000001.1 GCA003932295_00846 gene open 997531-998910 mocR
1654 PQNX01000001.1 GCA003932295_00849 gene open 999947-1006357
1655 PQNX01000001.1 GCA003932295_00034 gene open 37018-37089 trnV
1656 PQNX01000001.1 GCA003932295_00035 gene open 37420-37492 trnG
1657 PQNX01000001.1 GCA003932295_00036 gene open 37563-37634 trnC
1658 PQNX01000001.1 GCA003932295_00037 gene open 37643-37714 trnV
1659 PQNX01000001.1 GCA003932295_00038 gene open 37744-37819 trnG
1660 PQNX01000001.1 GCA003932295_00039 gene open 37843-37914 trnV
1661 PQNX01000001.1 GCA003932295_00040 gene open 37949-38024 trnG
1662 PQNX01000001.1 GCA003932295_00191 gene open 226152-226224 trnE
1663 PQNX01000001.1 GCA003932295_00193 gene open 227378-227450 trnE
1664 PQNX01000001.1 GCA003932295_00194 gene open 227514-227585 trnQ
1665 PQNX01000001.1 GCA003932295_00275 gene open 327202-327274 trnR
1666 PQNX01000001.1 GCA003932295_00362 gene open 430249-430322 trnL
1667 PQNX01000001.1 GCA003932295_00369 gene open 437792-437868 trnL
1668 PQNX01000001.1 GCA003932295_00381 gene open 451849-451920 trnQ
1669 PQNX01000001.1 GCA003932295_00459 gene open 547034-547107 trnfM
1670 PQNX01000001.1 GCA003932295_00706 gene open 836553-836625 trnW
1671 PQNX01000001.1 GCA003932295_00707 gene open 836859-836932 trnM
1672 PQNX01000001.1 GCA003932295_00708 gene open 836983-837055 trnT
1673 PQNX01000001.1 GCA003932295_00709 gene open 837385-837469 trnY
1674 PQNX01000001.1 GCA003932295_00789 gene open 929711-929786 trnT
1675 PQNX01000001.1 GCA003932295_00818 gene open 962868-962941 trnP
1676 PQNX01000001.1 GCA003932295_00848 gene open 999445-999533 trnS
1677 PQNX01000001.1 GCA003932295_00034 tRNA open 37018-37089 trnV tRNA-Val(cac)
1678 PQNX01000001.1 GCA003932295_00035 tRNA open 37420-37492 trnG tRNA-Gly(gcc)
1679 PQNX01000001.1 GCA003932295_00036 tRNA open 37563-37634 trnC tRNA-Cys(gca)
1680 PQNX01000001.1 GCA003932295_00037 tRNA open 37643-37714 trnV tRNA-Val(gac)
1681 PQNX01000001.1 GCA003932295_00038 tRNA open 37744-37819 trnG tRNA-Gly(gcc)
1682 PQNX01000001.1 GCA003932295_00039 tRNA open 37843-37914 trnV tRNA-Val(gac)
1683 PQNX01000001.1 GCA003932295_00040 tRNA open 37949-38024 trnG tRNA-Gly(gcc)
1684 PQNX01000001.1 GCA003932295_00191 tRNA open 226152-226224 trnE tRNA-Glu(ctc)
1685 PQNX01000001.1 GCA003932295_00193 tRNA open 227378-227450 trnE tRNA-Glu(ctc)
1686 PQNX01000001.1 GCA003932295_00194 tRNA open 227514-227585 trnQ tRNA-Gln(ctg)
1687 PQNX01000001.1 GCA003932295_00275 tRNA open 327202-327274 trnR tRNA-Arg(ccg)
1688 PQNX01000001.1 GCA003932295_00362 tRNA open 430249-430322 trnL tRNA-Leu(taa)
1689 PQNX01000001.1 GCA003932295_00369 tRNA open 437792-437868 trnL tRNA-Leu(taa)
1690 PQNX01000001.1 GCA003932295_00381 tRNA open 451849-451920 trnQ tRNA-Gln(ttg)
1691 PQNX01000001.1 GCA003932295_00459 tRNA open 547034-547107 trnfM tRNA-fMet(cat)
1692 PQNX01000001.1 GCA003932295_00706 tRNA open 836553-836625 trnW tRNA-Trp(cca)
1693 PQNX01000001.1 GCA003932295_00707 tRNA open 836859-836932 trnM tRNA-Met(cat)
1694 PQNX01000001.1 GCA003932295_00708 tRNA open 836983-837055 trnT tRNA-Thr(ggt)
1695 PQNX01000001.1 GCA003932295_00709 tRNA open 837385-837469 trnY tRNA-Tyr(gta)
1696 PQNX01000001.1 GCA003932295_00789 tRNA open 929711-929786 trnT tRNA-Thr(cgt)
1697 PQNX01000001.1 GCA003932295_00818 tRNA open 962868-962941 trnP tRNA-Pro(cgg)
1698 PQNX01000001.1 GCA003932295_00848 tRNA open 999445-999533 trnS tRNA-Ser(gga)
1699 PQNX01000002.1 GCA003932295_00954 gene open 82856-83225 ssrA
1700 PQNX01000002.1 GCA003932295_00954 tmRNA open 82856-83225 ssrA transfer-messenger RNA%2C SsrA
1701 PQNX01000002.1 GCA003932295_00879 gene open 1-71 rrf
1702 PQNX01000002.1 GCA003932295_01164 gene open 332602-333040 RNaseP_bact_a
1703 PQNX01000002.1 GCA003932295_01164 ncRNA open 332602-333040 Bacterial RNase P class A
1704 PQNX01000002.1 regulatory_region open 402321-402430 mraW RNA
1705 PQNX01000002.1 GCA003932295_00879 rRNA open 1-71 rrf 5S ribosomal RNA
1706 PQNX01000002.1 repeat_region open 325190-325776 CRISPR array with 10 repeats of length 28%2C consensus sequence GTGCTCCCCGCGTGAGCGGGGATGATCC and spacer length 33
1707 PQNX01000002.1 GCA003932295_00880 CDS open 304-1569 _na     421_aa 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase
1708 PQNX01000002.1 GCA003932295_00881 CDS open 1553-2785 _na     410_aa N-succinyldiaminopimelate aminotransferase
1709 PQNX01000002.1 GCA003932295_00882 CDS open 2855-3823 _na     322_aa Alpha/beta hydrolase
1710 PQNX01000002.1 GCA003932295_00883 CDS open 3829-5061 _na     410_aa Endonuclease/exonuclease/phosphatase domain-containing protein
1711 PQNX01000002.1 GCA003932295_00884 CDS open 5083-5736 _na     217_aa DUF3239 domain-containing protein
1712 PQNX01000002.1 GCA003932295_00885 CDS open 5733-7394 _na     553_aa DNA repair helicase XPB
1713 PQNX01000002.1 GCA003932295_00886 CDS open 7433-9715 _na     760_aa Helicase XPB/Ssl2 N-terminal domain-containing protein
1714 PQNX01000002.1 GCA003932295_00887 CDS open 10047-10733 _na     228_aa DUF3235 domain-containing protein
1715 PQNX01000002.1 GCA003932295_00888 CDS open 10917-11300 _na     127_aa Cold-shock protein
1716 PQNX01000002.1 GCA003932295_00889 CDS open 11329-11967 _na     212_aa DUF2771 domain-containing protein
1717 PQNX01000002.1 GCA003932295_00890 CDS open 12074-12865 _na     263_aa Glutamine cyclotransferase
1718 PQNX01000002.1 GCA003932295_00891 CDS open 12926-14461 _na     511_aa AGZA family xanthine/uracil permease-like MFS transporter
1719 PQNX01000002.1 GCA003932295_00892 CDS open 14458-15318 _na     286_aa rRNA methyltransferase
1720 PQNX01000002.1 GCA003932295_00893 CDS open 15350-16186 _na     278_aa DUF6928 domain-containing protein
1721 PQNX01000002.1 GCA003932295_00894 CDS open 16194-17282 _na     362_aa sepH septation protein SepH
1722 PQNX01000002.1 GCA003932295_00895 CDS open 17506-17772 _na     88_aa hypothetical protein
1723 PQNX01000002.1 GCA003932295_00896 CDS open 17769-18899 _na     376_aa serC phosphoserine transaminase
1724 PQNX01000002.1 GCA003932295_00897 CDS open 19159-20460 _na     433_aa citrate synthase
1725 PQNX01000002.1 GCA003932295_00898 CDS open 20519-20878 _na     119_aa Peptidyl-prolyl cis-trans isomerase
1726 PQNX01000002.1 GCA003932295_00899 CDS open 21006-21872 _na     288_aa 2%2C5-diketo-D-gluconate reductase A
1727 PQNX01000002.1 GCA003932295_00900 CDS open 21869-22438 _na     189_aa yndB putative protein YndB with AHSA1/START domain
1728 PQNX01000002.1 GCA003932295_00901 CDS open 22667-23800 _na     377_aa LLM class flavin-dependent oxidoreductase
1729 PQNX01000002.1 GCA003932295_00902 CDS open 23867-24535 _na     222_aa Oxidoreductase
1730 PQNX01000002.1 GCA003932295_00903 CDS open 24781-24984 _na     67_aa Cold-shock protein
1731 PQNX01000002.1 GCA003932295_00904 CDS open 25161-26486 _na     441_aa ATP/GTP-binding protein
1732 PQNX01000002.1 GCA003932295_00905 CDS open 26496-27098 _na     200_aa rloB RloB family protein
1733 PQNX01000002.1 GCA003932295_00906 CDS open 27110-27883 _na     257_aa hypothetical protein
1734 PQNX01000002.1 GCA003932295_00907 CDS open 28156-28359 _na     67_aa Cold-shock protein
1735 PQNX01000002.1 GCA003932295_00908 CDS open 28449-29747 _na     432_aa J domain-containing protein
1736 PQNX01000002.1 GCA003932295_00909 CDS open 30323-30664 _na     113_aa XRE family transcriptional regulator
1737 PQNX01000002.1 GCA003932295_00910 CDS open 30934-31359 _na     141_aa J domain-containing protein
1738 PQNX01000002.1 GCA003932295_00911 CDS open 31472-32638 _na     388_aa Lipoprotein
1739 PQNX01000002.1 GCA003932295_00912 CDS open 32713-34323 _na     536_aa hypothetical protein
1740 PQNX01000002.1 GCA003932295_00913 CDS open 34387-35784 _na     465_aa DUF2029 domain-containing protein
1741 PQNX01000002.1 GCA003932295_00914 CDS open 35781-36044 _na     87_aa hypothetical protein
1742 PQNX01000002.1 GCA003932295_00915 CDS open 36079-36525 _na     148_aa hypothetical protein
1743 PQNX01000002.1 GCA003932295_00917 CDS open 36862-38133 _na     423_aa Sodium:proton antiporter
1744 PQNX01000002.1 GCA003932295_00918 CDS open 38201-39823 _na     540_aa Cation acetate symporter
1745 PQNX01000002.1 GCA003932295_00919 CDS open 39873-40235 _na     120_aa DUF485 domain-containing protein
1746 PQNX01000002.1 GCA003932295_00920 CDS open 40359-41009 _na     216_aa secG Preprotein translocase subunit SecG
1747 PQNX01000002.1 GCA003932295_00921 CDS open 41006-42367 _na     453_aa ABC transporter permease
1748 PQNX01000002.1 GCA003932295_00922 CDS open 42364-43119 _na     251_aa Multidrug ABC transporter ATP-binding protein
1749 PQNX01000002.1 GCA003932295_00923 CDS open 43321-43635 _na     104_aa Mycoredoxin
1750 PQNX01000002.1 GCA003932295_00924 CDS open 43669-44355 _na     228_aa dihydrofolate reductase
1751 PQNX01000002.1 GCA003932295_00925 CDS open 44352-45158 _na     268_aa thymidylate synthase
1752 PQNX01000002.1 GCA003932295_00926 CDS open 45215-45979 _na     254_aa 3'(2')%2C 5'-bisphosphate nucleotidase
1753 PQNX01000002.1 GCA003932295_00927 CDS open 46006-50844 _na     1612_aa ATP-dependent Lhr-like helicase
1754 PQNX01000002.1 GCA003932295_00928 CDS open 50841-51074 _na     77_aa hypothetical protein
1755 PQNX01000002.1 GCA003932295_00929 CDS open 51200-52042 _na     280_aa DNA-(apurinic or apyrimidinic site) lyase
1756 PQNX01000002.1 GCA003932295_00930 CDS open 52378-53484 _na     368_aa ABC transporter
1757 PQNX01000002.1 GCA003932295_00931 CDS open 53481-54392 _na     303_aa sn-glycerol 3-phosphate transport system permease protein
1758 PQNX01000002.1 GCA003932295_00932 CDS open 54389-55273 _na     294_aa sn-glycerol 3-phosphate transport system permease protein
1759 PQNX01000002.1 GCA003932295_00933 CDS open 55270-56637 _na     455_aa Glycerol 3-phosphate ABC transporter substrate-binding protein
1760 PQNX01000002.1 GCA003932295_00934 CDS open 56634-57374 _na     246_aa DUF1868 domain-containing protein
1761 PQNX01000002.1 GCA003932295_00935 CDS open 57380-58420 _na     346_aa lacI LacI family transcriptional regulator
1762 PQNX01000002.1 GCA003932295_00936 CDS open 58532-60106 _na     524_aa Mannitol 2-dehydrogenase
1763 PQNX01000002.1 GCA003932295_00937 CDS open 60167-61573 _na     468_aa MFS family permease
1764 PQNX01000002.1 GCA003932295_00938 CDS open 61761-62621 _na     286_aa DeoR/GlpR transcriptional regulator
1765 PQNX01000002.1 GCA003932295_00939 CDS open 62618-63997 _na     459_aa xylB xylulokinase
1766 PQNX01000002.1 GCA003932295_00940 CDS open 64018-64743 _na     241_aa Glucosamine-6-phosphate deaminase
1767 PQNX01000002.1 GCA003932295_00941 CDS open 64748-65902 _na     384_aa N-acetylglucosamine-6-phosphate deacetylase
1768 PQNX01000002.1 GCA003932295_00942 CDS open 65905-67683 _na     592_aa pgi glucose-6-phosphate isomerase
1769 PQNX01000002.1 GCA003932295_00943 CDS open 67819-69441 _na     540_aa Succinate-semialdehyde dehydrogenase/glutarate-semialdehyde dehydrogenase
1770 PQNX01000002.1 GCA003932295_00944 CDS open 69426-70241 _na     271_aa hisN histidinol-phosphatase
1771 PQNX01000002.1 GCA003932295_00945 CDS open 70300-71166 _na     288_aa Inositol monophosphatase family protein
1772 PQNX01000002.1 GCA003932295_00946 CDS open 71230-72351 _na     373_aa prfB peptide chain release factor 2
1773 PQNX01000002.1 GCA003932295_00947 CDS open 72341-75817 _na     1158_aa L-glutamate gamma-semialdehyde dehydrogenase
1774 PQNX01000002.1 GCA003932295_00948 CDS open 75920-77542 _na     540_aa p-aminobenzoyl-glutamate transporter
1775 PQNX01000002.1 GCA003932295_00949 CDS open 77673-78362 _na     229_aa ftsE cell division ATP-binding protein FtsE
1776 PQNX01000002.1 GCA003932295_00950 CDS open 78372-79274 _na     300_aa ftsX permease-like cell division protein FtsX
1777 PQNX01000002.1 GCA003932295_00951 CDS open 79296-79784 _na     162_aa smpB SsrA-binding protein SmpB
1778 PQNX01000002.1 GCA003932295_00952 CDS open 80039-80590 _na     183_aa hypothetical protein
1779 PQNX01000002.1 GCA003932295_00953 CDS open 81095-82318 _na     407_aa hypothetical protein
1780 PQNX01000002.1 GCA003932295_00955 CDS open 83393-83845 _na     150_aa DUF4442 domain-containing protein
1781 PQNX01000002.1 GCA003932295_00956 CDS open 83959-85671 _na     570_aa pgm phosphoglucomutase (alpha-D-glucose-1%2C6-bisphosphate-dependent)
1782 PQNX01000002.1 GCA003932295_00957 CDS open 85935-86669 _na     244_aa Thioredoxin-like fold domain-containing protein
1783 PQNX01000002.1 GCA003932295_00959 CDS open 87043-87747 _na     234_aa ABC transporter permease
1784 PQNX01000002.1 GCA003932295_00960 CDS open 87744-88475 _na     243_aa ABC transporter domain-containing protein
1785 PQNX01000002.1 GCA003932295_00961 CDS open 88479-89258 _na     259_aa ABC transporter
1786 PQNX01000002.1 GCA003932295_00962 CDS open 89248-90195 _na     315_aa ABC-2 type transport system ATP-binding protein
1787 PQNX01000002.1 GCA003932295_00963 CDS open 90195-91163 _na     322_aa hypothetical protein
1788 PQNX01000002.1 GCA003932295_00964 CDS open 91267-92319 _na     350_aa Molybdopterin/thiamine biosynthesis adenylyltransferase
1789 PQNX01000002.1 GCA003932295_00965 CDS open 93451-94935 _na     494_aa MFS transporter
1790 PQNX01000002.1 GCA003932295_00966 CDS open 95418-96143 _na     241_aa Vitamin K epoxide reductase
1791 PQNX01000002.1 GCA003932295_00967 CDS open 96255-97220 _na     321_aa nadE ammonia-dependent NAD(+) synthetase
1792 PQNX01000002.1 GCA003932295_00968 CDS open 97445-97567 _na     40_aa ykgO type B 50S ribosomal protein L36
1793 PQNX01000002.1 GCA003932295_00969 CDS open 98185-98415 _na     76_aa nrdH Glutaredoxin-like protein NrdH
1794 PQNX01000002.1 GCA003932295_00970 CDS open 98542-100089 _na     515_aa MFS family permease
1795 PQNX01000002.1 GCA003932295_00971 CDS open 100093-100539 _na     148_aa nrdI class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI
1796 PQNX01000002.1 GCA003932295_00972 CDS open 100733-102901 _na     722_aa nrdE class 1b ribonucleoside-diphosphate reductase subunit alpha
1797 PQNX01000002.1 GCA003932295_00973 CDS open 103143-103637 _na     164_aa Ferritin
1798 PQNX01000002.1 GCA003932295_00974 CDS open 104203-105201 _na     332_aa nrdF class 1b ribonucleoside-diphosphate reductase subunit beta
1799 PQNX01000002.1 GCA003932295_00975 CDS open 105535-107232 _na     565_aa ctaD cytochrome c oxidase subunit I
1800 PQNX01000002.1 GCA003932295_00976 CDS open 107461-108738 _na     425_aa serB phosphoserine phosphatase SerB
1801 PQNX01000002.1 GCA003932295_00977 CDS open 108731-109552 _na     273_aa peptidyl-tRNA hydrolase
1802 PQNX01000002.1 GCA003932295_00978 CDS open 109629-111206 _na     525_aa Acyl-CoA synthetase (AMP-forming)/AMP-acid ligase II
1803 PQNX01000002.1 GCA003932295_00979 CDS open 111437-113590 _na     717_aa DNA 5'-3' helicase
1804 PQNX01000002.1 GCA003932295_00980 CDS open 113574-114827 _na     417_aa nicotinate phosphoribosyltransferase
1805 PQNX01000002.1 GCA003932295_00981 CDS open 115013-115327 _na     104_aa clpS ATP-dependent Clp protease adapter ClpS
1806 PQNX01000002.1 GCA003932295_00982 CDS open 115476-116042 _na     188_aa DUF2017 domain-containing protein
1807 PQNX01000002.1 GCA003932295_00983 CDS open 116039-116953 _na     304_aa murI glutamate racemase
1808 PQNX01000002.1 GCA003932295_00984 CDS open 117099-117881 _na     260_aa Metallo-beta-lactamase domain-containing protein
1809 PQNX01000002.1 GCA003932295_00985 CDS open 117892-119139 _na     415_aa ATP-grasp domain-containing protein
1810 PQNX01000002.1 GCA003932295_00986 CDS open 119139-120479 _na     446_aa MFS transporter
1811 PQNX01000002.1 GCA003932295_00987 CDS open 120656-121486 _na     276_aa rph ribonuclease PH
1812 PQNX01000002.1 GCA003932295_00988 CDS open 121483-122130 _na     215_aa dITP/XTP pyrophosphatase
1813 PQNX01000002.1 GCA003932295_00989 CDS open 122166-123524 _na     452_aa Hippurate hydrolase
1814 PQNX01000002.1 GCA003932295_00990 CDS open 123609-124133 _na     174_aa DUF3817 domain-containing protein
1815 PQNX01000002.1 GCA003932295_00991 CDS open 124130-124660 _na     176_aa DNA-binding transcriptional regulator of glucitol operon
1816 PQNX01000002.1 GCA003932295_00993 CDS open 124860-126674 _na     604_aa EmrB/QacA subfamily drug resistance transporter
1817 PQNX01000002.1 GCA003932295_00994 CDS open 126782-127090 _na     102_aa Peroxiredoxin
1818 PQNX01000002.1 GCA003932295_00995 CDS open 127589-127867 _na     92_aa DUF3618 domain-containing protein
1819 PQNX01000002.1 GCA003932295_00996 CDS open 127894-128985 _na     363_aa Ammonia monooxygenase
1820 PQNX01000002.1 GCA003932295_00998 CDS open 129967-130329 _na     120_aa hypothetical protein
1821 PQNX01000002.1 GCA003932295_00999 CDS open 130435-131175 _na     246_aa L%2CD-TPase catalytic domain-containing protein
1822 PQNX01000002.1 GCA003932295_01000 CDS open 131336-131548 _na     70_aa Branched-chain amino acid ABC transporter permease
1823 PQNX01000002.1 GCA003932295_01001 CDS open 131635-132168 _na     177_aa rutF Flavin reductase (DIM6/NTAB) family NADH-FMN oxidoreductase RutF
1824 PQNX01000002.1 GCA003932295_01002 CDS open 132180-133196 _na     338_aa Alkane 1-monooxygenase
1825 PQNX01000002.1 GCA003932295_01004 CDS open 133593-134261 _na     222_aa orn oligoribonuclease
1826 PQNX01000002.1 GCA003932295_01005 CDS open 134326-135138 _na     270_aa cmrA mycolate reductase
1827 PQNX01000002.1 GCA003932295_01006 CDS open 135484-136074 _na     196_aa rodZ Cytoskeletal protein RodZ
1828 PQNX01000002.1 GCA003932295_01008 CDS open 136707-139004 _na     765_aa copD Copper resistance protein CopD
1829 PQNX01000002.1 GCA003932295_01009 CDS open 139251-139886 _na     211_aa Single-stranded DNA-binding protein
1830 PQNX01000002.1 GCA003932295_01010 CDS open 140104-141774 _na     556_aa ettA energy-dependent translational throttle protein EttA
1831 PQNX01000002.1 GCA003932295_01011 CDS open 141847-142722 _na     291_aa Hedgehog/Intein (Hint) domain-containing protein
1832 PQNX01000002.1 GCA003932295_01012 CDS open 142600-142929 _na     109_aa hypothetical protein
1833 PQNX01000002.1 GCA003932295_01013 CDS open 143125-143628 _na     167_aa Globin
1834 PQNX01000002.1 GCA003932295_01014 CDS open 143625-146360 _na     911_aa pepN aminopeptidase N
1835 PQNX01000002.1 GCA003932295_01015 CDS open 146489-147127 _na     212_aa dsbA Disulfide bond formation protein DsbA
1836 PQNX01000002.1 GCA003932295_01016 CDS open 147399-147977 _na     192_aa Antitoxin SocA-like Panacea domain-containing protein
1837 PQNX01000002.1 GCA003932295_01017 CDS open 147974-148363 _na     129_aa Type II toxin-antitoxin system death-on-curing family toxin
1838 PQNX01000002.1 GCA003932295_01018 CDS open 148857-149009 _na     50_aa hypothetical protein
1839 PQNX01000002.1 GCA003932295_01019 CDS open 149279-149764 _na     161_aa ribose-5-phosphate isomerase
1840 PQNX01000002.1 GCA003932295_01020 CDS open 150208-150435 _na     75_aa Transcriptional regulator
1841 PQNX01000002.1 GCA003932295_01021 CDS open 151075-152832 _na     585_aa pyruvate dehydrogenase
1842 PQNX01000002.1 GCA003932295_01022 CDS open 153300-155825 _na     841_aa site-specific DNA-methyltransferase (adenine-specific)
1843 PQNX01000002.1 GCA003932295_01023 CDS open 155798-158020 _na     740_aa phospholipase C
1844 PQNX01000002.1 GCA003932295_01026 CDS open 159116-160798 _na     560_aa tig trigger factor
1845 PQNX01000002.1 GCA003932295_01027 CDS open 161174-161815 _na     213_aa ATP-dependent Clp protease proteolytic subunit
1846 PQNX01000002.1 GCA003932295_01028 CDS open 161880-162593 _na     237_aa clpP2 ATP-dependent Clp protease proteolytic subunit 2
1847 PQNX01000002.1 GCA003932295_01029 CDS open 162806-164092 _na     428_aa clpX ATP-dependent Clp protease ATP-binding subunit ClpX
1848 PQNX01000002.1 GCA003932295_01030 CDS open 164221-165183 _na     320_aa tetR TetR family transcriptional regulator
1849 PQNX01000002.1 GCA003932295_01031 CDS open 165543-166733 _na     396_aa malate dehydrogenase
1850 PQNX01000002.1 GCA003932295_01032 CDS open 166758-169553 _na     931_aa valine--tRNA ligase
1851 PQNX01000002.1 GCA003932295_01033 CDS open 169550-171199 _na     549_aa folC bifunctional tetrahydrofolate synthase/dihydrofolate synthase
1852 PQNX01000002.1 GCA003932295_01034 CDS open 171199-171792 _na     197_aa Cytokinin riboside 5'-monophosphate phosphoribohydrolase
1853 PQNX01000002.1 GCA003932295_01035 CDS open 171881-172390 _na     169_aa DUF4233 domain-containing protein
1854 PQNX01000002.1 GCA003932295_01036 CDS open 172479-172898 _na     139_aa hypothetical protein
1855 PQNX01000002.1 GCA003932295_01037 CDS open 173046-173858 _na     270_aa hypothetical protein
1856 PQNX01000002.1 GCA003932295_01038 CDS open 174098-178453 _na     1451_aa Ribonuclease E
1857 PQNX01000002.1 GCA003932295_01039 CDS open 178842-179147 _na     101_aa rplU 50S ribosomal protein L21
1858 PQNX01000002.1 GCA003932295_01040 CDS open 179191-179463 _na     90_aa rpmA 50S ribosomal protein L27
1859 PQNX01000002.1 GCA003932295_01041 CDS open 179586-181100 _na     504_aa obgE GTPase ObgE
1860 PQNX01000002.1 GCA003932295_01042 CDS open 181227-182516 _na     429_aa Glutamate 5-kinase
1861 PQNX01000002.1 GCA003932295_01043 CDS open 182541-183848 _na     435_aa glutamate-5-semialdehyde dehydrogenase
1862 PQNX01000002.1 GCA003932295_01044 CDS open 183990-185123 _na     377_aa YwiC-like family protein
1863 PQNX01000002.1 GCA003932295_01045 CDS open 185238-186083 _na     281_aa nadD nicotinate-nucleotide adenylyltransferase
1864 PQNX01000002.1 GCA003932295_01046 CDS open 186240-186713 _na     157_aa rsfS ribosome silencing factor
1865 PQNX01000002.1 GCA003932295_01047 CDS open 186724-187683 _na     319_aa Histidine phosphatase family protein
1866 PQNX01000002.1 GCA003932295_01048 CDS open 187680-188759 _na     359_aa EDD domain protein
1867 PQNX01000002.1 GCA003932295_01049 CDS open 188992-190605 _na     537_aa DUF2029 domain-containing protein
1868 PQNX01000002.1 GCA003932295_01050 CDS open 190788-191795 _na     335_aa Helix-hairpin-helix DNA-binding motif class 1 domain-containing protein
1869 PQNX01000002.1 GCA003932295_01051 CDS open 192393-194123 _na     576_aa ComEC/Rec2 family competence protein
1870 PQNX01000002.1 GCA003932295_01052 CDS open 194256-195281 _na     341_aa holA DNA polymerase III subunit delta
1871 PQNX01000002.1 GCA003932295_01053 CDS open 195379-196440 _na     353_aa ADP-ribosylglycohydrolase
1872 PQNX01000002.1 GCA003932295_01054 CDS open 196676-198145 _na     489_aa hypothetical protein
1873 PQNX01000002.1 GCA003932295_01055 CDS open 198493-198756 _na     87_aa rpsT 30S ribosomal protein S20
1874 PQNX01000002.1 GCA003932295_01056 CDS open 198980-199570 _na     196_aa PemK-like protein
1875 PQNX01000002.1 GCA003932295_01057 CDS open 199653-201503 _na     616_aa lepA translation elongation factor 4
1876 PQNX01000002.1 GCA003932295_01058 CDS open 202074-203201 _na     375_aa DUF4917 domain-containing protein
1877 PQNX01000002.1 GCA003932295_01059 CDS open 203266-203718 _na     150_aa hypothetical protein
1878 PQNX01000002.1 GCA003932295_01060 CDS open 204343-204747 _na     134_aa hypothetical protein
1879 PQNX01000002.1 GCA003932295_01061 CDS open 204980-205651 _na     223_aa Lipoprotein
1880 PQNX01000002.1 GCA003932295_01062 CDS open 205803-207383 _na     526_aa Cell surface protein
1881 PQNX01000002.1 GCA003932295_01063 CDS open 207939-208160 _na     73_aa DUF2188 domain-containing protein
1882 PQNX01000002.1 GCA003932295_01064 CDS open 208216-209574 _na     452_aa hypothetical protein
1883 PQNX01000002.1 GCA003932295_01065 CDS open 209678-210661 _na     327_aa ABC transporter permease
1884 PQNX01000002.1 GCA003932295_01066 CDS open 210714-211781 _na     355_aa Peptide/nickel transport system permease protein
1885 PQNX01000002.1 GCA003932295_01067 CDS open 211778-214000 _na     740_aa nikD nickel import ATP-binding protein NikD
1886 PQNX01000002.1 GCA003932295_01068 CDS open 214058-215737 _na     559_aa Peptide/nickel transport system substrate-binding protein
1887 PQNX01000002.1 GCA003932295_01069 CDS open 216359-217543 _na     394_aa L-lactate dehydrogenase (Cytochrome)
1888 PQNX01000002.1 GCA003932295_01070 CDS open 217552-217689 _na     45_aa hypothetical protein
1889 PQNX01000002.1 GCA003932295_01071 CDS open 218208-220334 _na     708_aa ATPase of the ABC class
1890 PQNX01000002.1 GCA003932295_01072 CDS open 220694-221215 _na     173_aa hypothetical protein
1891 PQNX01000002.1 GCA003932295_01073 CDS open 221692-222345 _na     217_aa Secreted protein
1892 PQNX01000002.1 GCA003932295_01074 CDS open 222481-225168 _na     895_aa long-chain-fatty-acyl-CoA reductase
1893 PQNX01000002.1 GCA003932295_01075 CDS open 225165-226412 _na     415_aa luxE Acyl-protein synthetase LuxE domain-containing protein
1894 PQNX01000002.1 GCA003932295_01076 CDS open 226409-227920 _na     503_aa N-acetyltransferase domain-containing protein
1895 PQNX01000002.1 GCA003932295_01077 CDS open 227917-229224 _na     435_aa Putative MFS family arabinose efflux permease
1896 PQNX01000002.1 GCA003932295_01078 CDS open 229221-230483 _na     420_aa Phenylacetate-CoA ligase
1897 PQNX01000002.1 GCA003932295_01079 CDS open 230797-231936 _na     379_aa eamA EamA family transporter
1898 PQNX01000002.1 GCA003932295_01080 CDS open 231933-233282 _na     449_aa MHS family alpha-ketoglutarate permease-like MFS transporter
1899 PQNX01000002.1 GCA003932295_01081 CDS open 233508-234257 _na     249_aa DUF2786 domain-containing protein
1900 PQNX01000002.1 GCA003932295_01082 CDS open 234512-235111 _na     199_aa Phosphoprotein phosphatase
1901 PQNX01000002.1 GCA003932295_01083 CDS open 235457-236575 _na     372_aa hypothetical protein
1902 PQNX01000002.1 GCA003932295_01084 CDS open 236772-237698 _na     308_aa Dihydrofolate reductase
1903 PQNX01000002.1 GCA003932295_01085 CDS open 237813-238247 _na     144_aa Integral membrane protein
1904 PQNX01000002.1 GCA003932295_01086 CDS open 238446-239006 _na     186_aa N-acetyltransferase domain-containing protein
1905 PQNX01000002.1 GCA003932295_01087 CDS open 239205-240602 _na     465_aa Succinate-semialdehyde dehydrogenase/glutarate-semialdehyde dehydrogenase
1906 PQNX01000002.1 GCA003932295_01088 CDS open 240823-242100 _na     425_aa Glycerophosphoryl diester phosphodiesterase
1907 PQNX01000002.1 GCA003932295_01089 CDS open 242088-243935 _na     615_aa acetolactate synthase
1908 PQNX01000002.1 GCA003932295_01090 CDS open 244085-244786 _na     233_aa NAD(P)-dependent oxidoreductase
1909 PQNX01000002.1 GCA003932295_01091 CDS open 244866-247412 _na     848_aa ATP-dependent helicase
1910 PQNX01000002.1 GCA003932295_01092 CDS open 247464-248147 _na     227_aa DUF1990 domain-containing protein
1911 PQNX01000002.1 GCA003932295_01093 CDS open 248144-249742 _na     532_aa POT family proton-dependent oligopeptide transporter
1912 PQNX01000002.1 GCA003932295_01094 CDS open 250303-252048 _na     581_aa Multidrug DMT transporter permease
1913 PQNX01000002.1 GCA003932295_01095 CDS open 252226-253080 _na     284_aa 3-hydroxybutyryl-CoA dehydrogenase
1914 PQNX01000002.1 GCA003932295_01096 CDS open 253280-253489 _na     69_aa csbD CsbD family protein
1915 PQNX01000002.1 GCA003932295_01097 CDS open 253680-255134 _na     484_aa Taurine--2-oxoglutarate transaminase
1916 PQNX01000002.1 GCA003932295_01098 CDS open 255405-257288 _na     627_aa Iron ABC transporter ATP-binding protein
1917 PQNX01000002.1 GCA003932295_01099 CDS open 257281-258489 _na     402_aa cysteine-S-conjugate beta-lyase
1918 PQNX01000002.1 GCA003932295_01100 CDS open 258588-260123 _na     511_aa Carboxylesterase type B domain-containing protein
1919 PQNX01000002.1 GCA003932295_01101 CDS open 260362-262491 _na     709_aa Peptidyl-dipeptidase Dcp
1920 PQNX01000002.1 GCA003932295_01102 CDS open 262502-262738 _na     78_aa hypothetical protein
1921 PQNX01000002.1 GCA003932295_01103 CDS open 262944-264005 _na     353_aa NADP-dependent oxidoreductase
1922 PQNX01000002.1 GCA003932295_01104 CDS open 264565-266391 _na     608_aa Acyl-CoA synthetase
1923 PQNX01000002.1 GCA003932295_01105 CDS open 266553-267233 _na     226_aa Secreted protein
1924 PQNX01000002.1 GCA003932295_01106 CDS open 267271-268578 _na     435_aa hemW radical SAM family heme chaperone HemW
1925 PQNX01000002.1 GCA003932295_01107 CDS open 268582-269664 _na     360_aa hrcA heat-inducible transcriptional repressor HrcA
1926 PQNX01000002.1 GCA003932295_01108 CDS open 269812-270960 _na     382_aa dnaJ molecular chaperone DnaJ
1927 PQNX01000002.1 GCA003932295_01109 CDS open 270964-271824 _na     286_aa 16S rRNA (uracil(1498)-N(3))-methyltransferase
1928 PQNX01000002.1 GCA003932295_01110 CDS open 271821-272906 _na     361_aa PhoH-like protein
1929 PQNX01000002.1 GCA003932295_01111 CDS open 272903-273580 _na     225_aa ybeY rRNA maturation RNase YbeY
1930 PQNX01000002.1 GCA003932295_01112 CDS open 273577-274923 _na     448_aa HlyC/CorC family transporter
1931 PQNX01000002.1 GCA003932295_01113 CDS open 274913-275941 _na     342_aa era GTPase Era
1932 PQNX01000002.1 GCA003932295_01114 CDS open 276217-276939 _na     240_aa hypothetical protein
1933 PQNX01000002.1 GCA003932295_01115 CDS open 276997-277758 _na     253_aa recO DNA repair protein RecO
1934 PQNX01000002.1 GCA003932295_01116 CDS open 277814-278689 _na     291_aa isoprenyl transferase
1935 PQNX01000002.1 GCA003932295_01117 CDS open 278686-279999 _na     437_aa VIT1/CCC1 family putative Fe2+/Mn2+ transporter
1936 PQNX01000002.1 GCA003932295_01118 CDS open 280108-280533 _na     141_aa Transcriptional repressor
1937 PQNX01000002.1 GCA003932295_01119 CDS open 281069-282451 _na     460_aa glycine--tRNA ligase
1938 PQNX01000002.1 GCA003932295_01120 CDS open 282499-283041 _na     180_aa DUF3068 domain-containing protein
1939 PQNX01000002.1 GCA003932295_01121 CDS open 283148-285301 _na     717_aa TPM domain-containing protein
1940 PQNX01000002.1 GCA003932295_01122 CDS open 285315-286037 _na     240_aa ydcF YdcF family protein
1941 PQNX01000002.1 GCA003932295_01123 CDS open 286174-287457 _na     427_aa deoxyguanosinetriphosphate triphosphohydrolase
1942 PQNX01000002.1 GCA003932295_01124 CDS open 287745-289109 _na     454_aa MFS transporter
1943 PQNX01000002.1 GCA003932295_01125 CDS open 289163-289756 _na     197_aa Ribonuclease
1944 PQNX01000002.1 GCA003932295_01126 CDS open 289832-291772 _na     646_aa DNA primase
1945 PQNX01000002.1 GCA003932295_01127 CDS open 291813-292133 _na     106_aa ytxH YtxH domain-containing protein
1946 PQNX01000002.1 GCA003932295_01128 CDS open 292443-293561 _na     372_aa S-(hydroxymethyl)mycothiol dehydrogenase
1947 PQNX01000002.1 GCA003932295_01129 CDS open 293558-294262 _na     234_aa Zn-dependent hydrolase
1948 PQNX01000002.1 GCA003932295_01130 CDS open 294390-296597 _na     735_aa Cu+-exporting ATPase
1949 PQNX01000002.1 GCA003932295_01131 CDS open 296718-297110 _na     130_aa Transcriptional regulator
1950 PQNX01000002.1 GCA003932295_01132 CDS open 297345-298202 _na     285_aa Pirin family protein
1951 PQNX01000002.1 GCA003932295_01133 CDS open 298400-299302 _na     300_aa HTH asnC-type domain-containing protein
1952 PQNX01000002.1 GCA003932295_01134 CDS open 299393-300775 _na     460_aa Glycolate oxidase
1953 PQNX01000002.1 GCA003932295_01135 CDS open 300969-302264 _na     431_aa 2-polyprenyl-6-methoxyphenol hydroxylase-like FAD-dependent oxidoreductase
1954 PQNX01000002.1 GCA003932295_01136 CDS open 302432-303451 _na     339_aa Aminocarboxymuconate-semialdehyde decarboxylase
1955 PQNX01000002.1 GCA003932295_01137 CDS open 303711-304682 _na     323_aa Urea transporter
1956 PQNX01000002.1 GCA003932295_01140 CDS open 305497-306489 _na     330_aa SGNH hydrolase-type esterase domain-containing protein
1957 PQNX01000002.1 GCA003932295_01141 CDS open 306497-306847 _na     116_aa hypothetical protein
1958 PQNX01000002.1 GCA003932295_01142 CDS open 306914-307552 _na     212_aa DUF202 domain-containing protein
1959 PQNX01000002.1 GCA003932295_01143 CDS open 307805-308671 _na     288_aa Serine hydrolase
1960 PQNX01000002.1 GCA003932295_01144 CDS open 308692-309168 _na     158_aa Carrier domain-containing protein
1961 PQNX01000002.1 GCA003932295_01145 CDS open 309402-310514 _na     370_aa AB hydrolase-1 domain-containing protein
1962 PQNX01000002.1 GCA003932295_01146 CDS open 310570-311442 _na     290_aa HAD family hydrolase
1963 PQNX01000002.1 GCA003932295_01147 CDS open 311447-314335 _na     962_aa aceE pyruvate dehydrogenase (acetyl-transferring)%2C homodimeric type
1964 PQNX01000002.1 GCA003932295_01148 CDS open 314727-315155 _na     142_aa DUF3052 domain-containing protein
1965 PQNX01000002.1 GCA003932295_01150 CDS open 315775-318591 _na     938_aa CRISPR-associated endonuclease/helicase Cas3
1966 PQNX01000002.1 GCA003932295_01151 CDS open 318823-320631 _na     602_aa casA type I-E CRISPR-associated protein Cse1/CasA
1967 PQNX01000002.1 GCA003932295_01152 CDS open 320609-321337 _na     242_aa casB type I-E CRISPR-associated protein Cse2/CasB
1968 PQNX01000002.1 GCA003932295_01153 CDS open 321502-322611 _na     369_aa cas7e type I-E CRISPR-associated protein Cas7/Cse4/CasC
1969 PQNX01000002.1 GCA003932295_01154 CDS open 322617-323315 _na     232_aa cas5e type I-E CRISPR-associated protein Cas5/CasD
1970 PQNX01000002.1 GCA003932295_01155 CDS open 323316-323990 _na     224_aa cas6e type I-E CRISPR-associated protein Cas6/Cse3/CasE
1971 PQNX01000002.1 GCA003932295_01156 CDS open 323994-324749 _na     251_aa cas1 CRISPR-associated endonuclease Cas1
1972 PQNX01000002.1 GCA003932295_01157 CDS open 324746-325108 _na     120_aa cas2e type I-E CRISPR-associated endoribonuclease Cas2e
1973 PQNX01000002.1 GCA003932295_01158 CDS open 326143-327399 _na     418_aa SURF1-like protein
1974 PQNX01000002.1 GCA003932295_01159 CDS open 327529-328056 _na     175_aa protein-tyrosine-phosphatase
1975 PQNX01000002.1 GCA003932295_01160 CDS open 328201-328917 _na     238_aa Phosphoglycolate phosphatase-like HAD superfamily hydrolase
1976 PQNX01000002.1 GCA003932295_01161 CDS open 328941-330182 _na     413_aa Nif3-like dinuclear metal center hexameric protein
1977 PQNX01000002.1 GCA003932295_01162 CDS open 330338-331534 _na     398_aa bifunctional RNase H/acid phosphatase
1978 PQNX01000002.1 GCA003932295_01163 CDS open 331539-332456 _na     305_aa HTH cro/C1-type domain-containing protein
1979 PQNX01000002.1 GCA003932295_01165 CDS open 333113-333289 _na     58_aa SPOR domain-containing protein
1980 PQNX01000002.1 GCA003932295_01166 CDS open 333420-334373 _na     317_aa panB 3-methyl-2-oxobutanoate hydroxymethyltransferase
1981 PQNX01000002.1 GCA003932295_01167 CDS open 334482-335822 _na     446_aa glnA type I glutamate--ammonia ligase
1982 PQNX01000002.1 GCA003932295_01168 CDS open 335832-339020 _na     1062_aa bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase
1983 PQNX01000002.1 GCA003932295_01169 CDS open 339199-339528 _na     109_aa hypothetical protein
1984 PQNX01000002.1 GCA003932295_01170 CDS open 339711-341930 _na     739_aa Htaa domain-containing protein
1985 PQNX01000002.1 GCA003932295_01171 CDS open 341927-342898 _na     323_aa ABC transporter permease
1986 PQNX01000002.1 GCA003932295_01172 CDS open 342895-343719 _na     274_aa heme ABC transporter ATP-binding protein
1987 PQNX01000002.1 GCA003932295_01173 CDS open 343951-344646 _na     231_aa Biliverdin-producing heme oxygenase
1988 PQNX01000002.1 GCA003932295_01174 CDS open 344711-345436 _na     241_aa tetR TetR family transcriptional regulator
1989 PQNX01000002.1 GCA003932295_01175 CDS open 345433-346236 _na     267_aa Fructosamine kinase
1990 PQNX01000002.1 GCA003932295_01176 CDS open 346317-347561 _na     414_aa DUF2029 domain-containing protein
1991 PQNX01000002.1 GCA003932295_01177 CDS open 347847-349127 _na     426_aa MFS family permease
1992 PQNX01000002.1 GCA003932295_01178 CDS open 349220-350536 _na     438_aa Nramp family divalent metal transporter
1993 PQNX01000002.1 GCA003932295_01179 CDS open 350655-351458 _na     267_aa Glycine transporter domain-containing protein
1994 PQNX01000002.1 GCA003932295_01180 CDS open 351952-353904 _na     650_aa Gamma-glutamyltranspeptidase/glutathione hydrolase
1995 PQNX01000002.1 GCA003932295_01181 CDS open 354005-355747 _na     580_aa Secreted protein
1996 PQNX01000002.1 GCA003932295_01182 CDS open 356146-357582 _na     478_aa glnA type I glutamate--ammonia ligase
1997 PQNX01000002.1 GCA003932295_01183 CDS open 357928-358413 _na     161_aa RDD domain-containing protein
1998 PQNX01000002.1 GCA003932295_01184 CDS open 358483-359256 _na     257_aa DUF4191 domain-containing protein
1999 PQNX01000002.1 GCA003932295_01185 CDS open 359374-360417 _na     347_aa lipA lipoyl synthase
2000 PQNX01000002.1 GCA003932295_01186 CDS open 360461-361237 _na     258_aa lipB lipoyl(octanoyl) transferase LipB