HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Streptococcus intermedius (GCA_003943125.1)

Select a Genome:
BAKTA Annotations for GCA_003943125.1
Genome Selected: Streptococcus intermedius
ContigsBases CDSrRNA tmRNAtRNA
26 2003880 1932 4 1 63
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4046 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:6]    |    Number of Records Found: 4046 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2501 RJOO01000003.1 GCA003943125_01187 gene open 193560-194801
2502 RJOO01000003.1 GCA003943125_01188 gene open 195132-196202
2503 RJOO01000003.1 GCA003943125_01189 gene open 196549-197334
2504 RJOO01000003.1 GCA003943125_01190 gene open 197542-198078 nusG
2505 RJOO01000003.1 GCA003943125_01191 gene open 198224-198400 secE
2506 RJOO01000003.1 GCA003943125_01192 gene open 198410-198562 rpmG
2507 RJOO01000003.1 GCA003943125_01193 gene open 198612-200822 pbp2a
2508 RJOO01000003.1 GCA003943125_01194 gene open 200969-201838
2509 RJOO01000003.1 GCA003943125_01195 gene open 201879-202088
2510 RJOO01000003.1 GCA003943125_01196 gene open 202101-204353
2511 RJOO01000003.1 GCA003943125_01197 gene open 204373-204828
2512 RJOO01000003.1 GCA003943125_01198 gene open 205096-206598 znuA
2513 RJOO01000003.1 GCA003943125_01199 gene open 206608-207414
2514 RJOO01000003.1 GCA003943125_01200 gene open 207407-208111 adcC
2515 RJOO01000003.1 GCA003943125_01201 gene open 208108-208551 marR
2516 RJOO01000003.1 GCA003943125_01202 gene open 209101-210699 ily
2517 RJOO01000003.1 GCA003943125_01203 gene open 210885-212303 yfhO
2518 RJOO01000003.1 GCA003943125_01204 gene open 212642-218077
2519 RJOO01000003.1 GCA003943125_01205 gene open 218258-218911
2520 RJOO01000003.1 GCA003943125_01206 gene open 219034-219645
2521 RJOO01000003.1 GCA003943125_01207 gene open 219642-220919 norM
2522 RJOO01000003.1 GCA003943125_01208 gene open 221038-222522 thrC
2523 RJOO01000003.1 GCA003943125_01209 gene open 222824-223447 atpD
2524 RJOO01000003.1 GCA003943125_01210 gene open 223460-224851 atpB
2525 RJOO01000003.1 GCA003943125_01211 gene open 224838-226628
2526 RJOO01000003.1 GCA003943125_01212 gene open 226641-226964
2527 RJOO01000003.1 GCA003943125_01213 gene open 226954-227964
2528 RJOO01000003.1 GCA003943125_01214 gene open 227976-228566
2529 RJOO01000003.1 GCA003943125_01215 gene open 228622-229101
2530 RJOO01000003.1 GCA003943125_01216 gene open 229201-231159
2531 RJOO01000003.1 GCA003943125_01217 gene open 231149-231472
2532 RJOO01000003.1 GCA003943125_01218 gene open 231925-232749
2533 RJOO01000003.1 GCA003943125_01219 gene open 232868-233794 murQ
2534 RJOO01000003.1 GCA003943125_01220 gene open 233784-235193
2535 RJOO01000003.1 GCA003943125_01221 gene open 235177-236232
2536 RJOO01000003.1 GCA003943125_01222 gene open 236464-237309
2537 RJOO01000003.1 GCA003943125_01223 gene open 237378-238262
2538 RJOO01000003.1 GCA003943125_01224 gene open 238280-239197
2539 RJOO01000003.1 GCA003943125_01225 gene open 239223-239870
2540 RJOO01000003.1 GCA003943125_01226 gene open 239895-240350
2541 RJOO01000003.1 GCA003943125_01227 gene open 240364-241194 ugpE
2542 RJOO01000003.1 GCA003943125_01228 gene open 241211-242098 ugpA
2543 RJOO01000003.1 GCA003943125_01229 gene open 242210-243535
2544 RJOO01000003.1 GCA003943125_01230 gene open 243581-244285
2545 RJOO01000003.1 GCA003943125_01231 gene open 244606-247344 esaA
2546 RJOO01000003.1 GCA003943125_01232 gene open 247573-247761
2547 RJOO01000003.1 GCA003943125_01233 gene open 247827-248630
2548 RJOO01000003.1 GCA003943125_01234 gene open 248639-248962
2549 RJOO01000003.1 GCA003943125_01235 gene open 249059-249877
2550 RJOO01000003.1 GCA003943125_01236 gene open 250094-250888
2551 RJOO01000003.1 GCA003943125_01237 gene open 250909-251064
2552 RJOO01000003.1 GCA003943125_01238 gene open 251260-252087
2553 RJOO01000003.1 GCA003943125_01239 gene open 252589-253389
2554 RJOO01000003.1 GCA003943125_01240 gene open 253391-253621
2555 RJOO01000003.1 GCA003943125_01241 gene open 253746-254054
2556 RJOO01000003.1 GCA003943125_01242 gene open 254167-254949
2557 RJOO01000003.1 GCA003943125_01243 gene open 254955-255416
2558 RJOO01000003.1 GCA003943125_01244 gene open 255472-255780
2559 RJOO01000003.1 GCA003943125_01245 gene open 255780-256604
2560 RJOO01000003.1 GCA003943125_01246 gene open 256607-258073
2561 RJOO01000003.1 GCA003943125_01247 gene open 258075-258719
2562 RJOO01000003.1 GCA003943125_01248 gene open 258716-259000
2563 RJOO01000003.1 GCA003943125_01249 gene open 259013-259423
2564 RJOO01000003.1 GCA003943125_01250 gene open 259501-264000 essC
2565 RJOO01000003.1 GCA003943125_01251 gene open 263948-265105 essB
2566 RJOO01000003.1 GCA003943125_01252 gene open 265125-265373 yukD
2567 RJOO01000003.1 GCA003943125_01253 gene open 265336-265794 essA
2568 RJOO01000003.1 GCA003943125_01254 gene open 265864-266154
2569 RJOO01000003.1 GCA003943125_01255 gene open 266453-269104 adhE
2570 RJOO01000003.1 GCA003943125_01256 gene open 269478-271295
2571 RJOO01000003.1 GCA003943125_01257 gene open 271285-271707
2572 RJOO01000003.1 GCA003943125_01258 gene open 271707-272135
2573 RJOO01000003.1 GCA003943125_01259 gene open 272385-273281
2574 RJOO01000003.1 GCA003943125_01260 gene open 273314-274783
2575 RJOO01000003.1 GCA003943125_01261 gene open 274860-277583
2576 RJOO01000003.1 GCA003943125_01262 gene open 277894-278118
2577 RJOO01000003.1 GCA003943125_01263 gene open 278115-278462
2578 RJOO01000003.1 GCA003943125_01264 gene open 278468-279619 ruvB
2579 RJOO01000003.1 GCA003943125_01265 gene open 279875-280642
2580 RJOO01000003.1 GCA003943125_01266 gene open 280738-281784
2581 RJOO01000003.1 GCA003943125_01267 gene open 281827-282828 lacD
2582 RJOO01000003.1 GCA003943125_01268 gene open 282839-284092
2583 RJOO01000003.1 GCA003943125_01269 gene open 284161-284565
2584 RJOO01000003.1 GCA003943125_01270 gene open 284583-285410
2585 RJOO01000003.1 GCA003943125_01271 gene open 285397-286290
2586 RJOO01000003.1 GCA003943125_01272 gene open 286309-286785
2587 RJOO01000003.1 GCA003943125_01273 gene open 286782-288611
2588 RJOO01000003.1 GCA003943125_01274 gene open 288737-289453 dasR
2589 RJOO01000003.1 GCA003943125_01275 gene open 289718-290986 purB
2590 RJOO01000003.1 GCA003943125_01276 gene open 291215-293368
2591 RJOO01000003.1 GCA003943125_01277 gene open 293533-294144
2592 RJOO01000003.1 GCA003943125_01278 gene open 294238-294930 racX
2593 RJOO01000003.1 GCA003943125_01279 gene open 295008-296048
2594 RJOO01000003.1 GCA003943125_01280 gene open 296049-297122 purK
2595 RJOO01000003.1 GCA003943125_01281 gene open 297109-297546 purE
2596 RJOO01000003.1 GCA003943125_01282 gene open 297920-299095 accC
2597 RJOO01000003.1 GCA003943125_01283 gene open 299155-300414 purD
2598 RJOO01000003.1 GCA003943125_01284 gene open 300703-301791
2599 RJOO01000003.1 GCA003943125_01285 gene open 301788-302735
2600 RJOO01000003.1 GCA003943125_01286 gene open 302748-303575
2601 RJOO01000003.1 GCA003943125_01287 gene open 303819-305747
2602 RJOO01000003.1 GCA003943125_01288 gene open 305806-307353 purH
2603 RJOO01000003.1 GCA003943125_01289 gene open 307373-307966
2604 RJOO01000003.1 GCA003943125_01290 gene open 307959-308522 purN
2605 RJOO01000003.1 GCA003943125_01291 gene open 308522-309544 purM
2606 RJOO01000003.1 GCA003943125_01292 gene open 309603-311042 purF
2607 RJOO01000003.1 GCA003943125_01293 gene open 311068-311688
2608 RJOO01000003.1 GCA003943125_01294 gene open 311710-315435 purL2
2609 RJOO01000003.1 GCA003943125_01295 gene open 315445-316152 purC
2610 RJOO01000003.1 GCA003943125_01296 gene open 316298-316543
2611 RJOO01000003.1 GCA003943125_01297 gene open 316540-317538 plsX
2612 RJOO01000003.1 GCA003943125_01298 gene open 317535-318308 recO
2613 RJOO01000003.1 GCA003943125_01299 gene open 318286-319473
2614 RJOO01000003.1 GCA003943125_01300 gene open 319637-320605 prs1
2615 RJOO01000003.1 GCA003943125_01301 gene open 320739-321920 pcsB
2616 RJOO01000003.1 GCA003943125_01302 gene open 322030-322530 mreD
2617 RJOO01000003.1 GCA003943125_01303 gene open 322532-323338 mreC
2618 RJOO01000003.1 GCA003943125_01088 gene open 119134-119216 trnL
2619 RJOO01000003.1 GCA003943125_01089 gene open 119349-119437 trnS
2620 RJOO01000003.1 GCA003943125_01140 gene open 163759-163829 trnC
2621 RJOO01000003.1 GCA003943125_01304 gene open 323420-323507 trnS
2622 RJOO01000003.1 GCA003943125_01305 gene open 323518-323591 trnI
2623 RJOO01000003.1 GCA003943125_01306 gene open 323627-323697 trnG
2624 RJOO01000003.1 GCA003943125_01307 gene open 323715-323787 trnF
2625 RJOO01000003.1 GCA003943125_01308 gene open 323794-323867 trnfM
2626 RJOO01000003.1 GCA003943125_01309 gene open 323880-323969 trnS
2627 RJOO01000003.1 GCA003943125_01310 gene open 323978-324049 trnE
2628 RJOO01000003.1 GCA003943125_01311 gene open 324065-324138 trnI
2629 RJOO01000003.1 GCA003943125_01088 tRNA open 119134-119216 trnL tRNA-Leu(cag)
2630 RJOO01000003.1 GCA003943125_01089 tRNA open 119349-119437 trnS tRNA-Ser(cga)
2631 RJOO01000003.1 GCA003943125_01140 tRNA open 163759-163829 trnC tRNA-Cys(gca)
2632 RJOO01000003.1 GCA003943125_01304 tRNA open 323420-323507 trnS tRNA-Ser(gct)
2633 RJOO01000003.1 GCA003943125_01305 tRNA open 323518-323591 trnI tRNA-Ile(gat)
2634 RJOO01000003.1 GCA003943125_01306 tRNA open 323627-323697 trnG tRNA-Gly(tcc)
2635 RJOO01000003.1 GCA003943125_01307 tRNA open 323715-323787 trnF tRNA-Phe(gaa)
2636 RJOO01000003.1 GCA003943125_01308 tRNA open 323794-323867 trnfM tRNA-fMet(cat)
2637 RJOO01000003.1 GCA003943125_01309 tRNA open 323880-323969 trnS tRNA-Ser(tga)
2638 RJOO01000003.1 GCA003943125_01310 tRNA open 323978-324049 trnE tRNA-Glu(ttc)
2639 RJOO01000003.1 GCA003943125_01311 tRNA open 324065-324138 trnI tRNA-Ile(gat)
2640 RJOO01000004.1 GCA003943125_01312 gene open 140-255 rrf
2641 RJOO01000004.1 GCA003943125_01367 gene open 60182-60326 SpR19_sRNA
2642 RJOO01000004.1 GCA003943125_01452 gene open 142551-142916 RNaseP_bact_b
2643 RJOO01000004.1 GCA003943125_01505 gene open 196678-196774 csRNA
2644 RJOO01000004.1 GCA003943125_01367 ncRNA open 60182-60326 Streptococcus sRNA SpR19
2645 RJOO01000004.1 GCA003943125_01452 ncRNA open 142551-142916 Bacterial RNase P class B
2646 RJOO01000004.1 GCA003943125_01505 ncRNA open 196678-196774 Cia-dependent small RNA csRNA1
2647 RJOO01000004.1 regulatory_region open 210002-210209 T-box leader
2648 RJOO01000004.1 regulatory_region open 235702-235854 M-box riboswitch aptamer (ykoK leader)
2649 RJOO01000004.1 GCA003943125_01312 rRNA open 140-255 rrf 5S ribosomal RNA
2650 RJOO01000004.1 repeat_region open 184593-185956 CRISPR array with 21 repeats of length 32%2C consensus sequence GTCGCACCCTTCGCGGGTGCGTGGATTGAAAT and spacer length 34
2651 RJOO01000004.1 GCA003943125_01314 CDS open 728-2077 _na     449_aa aspartate kinase
2652 RJOO01000004.1 GCA003943125_01315 CDS open 2244-3035 _na     263_aa enoyl-CoA hydratase
2653 RJOO01000004.1 GCA003943125_01316 CDS open 3126-3560 _na     144_aa Transcriptional regulator
2654 RJOO01000004.1 GCA003943125_01317 CDS open 3560-4534 _na     324_aa Beta-ketoacyl-[acyl-carrier-protein] synthase III
2655 RJOO01000004.1 GCA003943125_01318 CDS open 4588-4812 _na     74_aa Acyl carrier protein
2656 RJOO01000004.1 GCA003943125_01319 CDS open 5078-6052 _na     324_aa fabK enoyl-[acyl-carrier-protein] reductase FabK
2657 RJOO01000004.1 GCA003943125_01320 CDS open 6045-6971 _na     308_aa fabD ACP S-malonyltransferase
2658 RJOO01000004.1 GCA003943125_01321 CDS open 6974-7705 _na     243_aa fabG 3-oxoacyl-[acyl-carrier-protein] reductase
2659 RJOO01000004.1 GCA003943125_01322 CDS open 7786-9018 _na     410_aa fabF beta-ketoacyl-ACP synthase II
2660 RJOO01000004.1 GCA003943125_01323 CDS open 9019-9498 _na     159_aa accB acetyl-CoA carboxylase biotin carboxyl carrier protein
2661 RJOO01000004.1 GCA003943125_01324 CDS open 9495-9917 _na     140_aa fabZ 3-hydroxyacyl-ACP dehydratase FabZ
2662 RJOO01000004.1 GCA003943125_01325 CDS open 9933-11300 _na     455_aa acetyl-CoA carboxylase biotin carboxylase subunit
2663 RJOO01000004.1 GCA003943125_01326 CDS open 11320-12183 _na     287_aa accD acetyl-CoA carboxylase%2C carboxyltransferase subunit beta
2664 RJOO01000004.1 GCA003943125_01327 CDS open 12180-12950 _na     256_aa acetyl-CoA carboxylase carboxyl transferase subunit alpha
2665 RJOO01000004.1 GCA003943125_01328 CDS open 13286-13945 _na     219_aa VTT domain-containing protein
2666 RJOO01000004.1 GCA003943125_01329 CDS open 13987-15264 _na     425_aa serS serine--tRNA ligase
2667 RJOO01000004.1 GCA003943125_01330 CDS open 15477-15848 _na     123_aa manO PTS mannose transporter accessory protein ManO
2668 RJOO01000004.1 GCA003943125_01331 CDS open 16126-17037 _na     303_aa PTS system%2C mannose-specific IID component
2669 RJOO01000004.1 GCA003943125_01332 CDS open 17057-17860 _na     267_aa Mannose permease IIC component
2670 RJOO01000004.1 GCA003943125_01333 CDS open 17878-18867 _na     329_aa agaB PTS system mannose-specific EIIAB component
2671 RJOO01000004.1 GCA003943125_01334 CDS open 19139-20161 _na     340_aa adhP alcohol dehydrogenase AdhP
2672 RJOO01000004.1 GCA003943125_01335 CDS open 20384-21196 _na     270_aa Putative hydrolase
2673 RJOO01000004.1 GCA003943125_01336 CDS open 21303-21902 _na     199_aa DUF1361 domain-containing protein
2674 RJOO01000004.1 GCA003943125_01337 CDS open 22020-23459 _na     479_aa Putative xanthine/uracil permease
2675 RJOO01000004.1 GCA003943125_01338 CDS open 23796-24236 _na     146_aa tsaE tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE
2676 RJOO01000004.1 GCA003943125_01339 CDS open 24229-24750 _na     173_aa Putative N-acetyltransferase
2677 RJOO01000004.1 GCA003943125_01340 CDS open 24758-25861 _na     367_aa brpA biofilm formation/cell division transcriptional regulator BrpA
2678 RJOO01000004.1 GCA003943125_01341 CDS open 25905-26192 _na     95_aa Methyl-accepting chemotaxis protein
2679 RJOO01000004.1 GCA003943125_01342 CDS open 26202-26612 _na     136_aa HIT family protein
2680 RJOO01000004.1 GCA003943125_01343 CDS open 26681-27412 _na     243_aa ABC transporter ATP-binding protein
2681 RJOO01000004.1 GCA003943125_01344 CDS open 27409-28455 _na     348_aa ABC transporter permease protein
2682 RJOO01000004.1 GCA003943125_01345 CDS open 28506-29303 _na     265_aa ccrZ cell cycle regulator CcrZ
2683 RJOO01000004.1 GCA003943125_01346 CDS open 29300-29935 _na     211_aa trmB tRNA (guanosine(46)-N7)-methyltransferase TrmB
2684 RJOO01000004.1 GCA003943125_01347 CDS open 30335-31027 _na     230_aa Integral membrane protein
2685 RJOO01000004.1 GCA003943125_01348 CDS open 31239-31727 _na     162_aa rimP ribosome maturation factor RimP
2686 RJOO01000004.1 GCA003943125_01349 CDS open 31791-32972 _na     393_aa nusA Transcription termination/antitermination protein NusA
2687 RJOO01000004.1 GCA003943125_01350 CDS open 32983-33279 _na     98_aa rnpM RNase P modulator RnpM
2688 RJOO01000004.1 GCA003943125_01351 CDS open 33272-33571 _na     99_aa YlxQ-related RNA-binding protein
2689 RJOO01000004.1 GCA003943125_01352 CDS open 33588-36425 _na     945_aa infB translation initiation factor IF-2
2690 RJOO01000004.1 GCA003943125_01353 CDS open 36504-36854 _na     116_aa rbfA 30S ribosome-binding factor RbfA
2691 RJOO01000004.1 GCA003943125_01354 CDS open 37013-38644 _na     543_aa phoU PhoU domain-containing protein
2692 RJOO01000004.1 GCA003943125_01355 CDS open 38836-39987 _na     383_aa nagA N-acetylglucosamine-6-phosphate deacetylase
2693 RJOO01000004.1 GCA003943125_01356 CDS open 40139-43126 _na     995_aa Type I restriction enzyme endonuclease subunit
2694 RJOO01000004.1 GCA003943125_01357 CDS open 43562-44314 _na     250_aa Hemagglutinin
2695 RJOO01000004.1 GCA003943125_01358 CDS open 44565-48641 _na     1358_aa YobI-like P-loop NTPase domain-containing protein
2696 RJOO01000004.1 GCA003943125_01359 CDS open 48607-49809 _na     400_aa Type I restriction modification DNA specificity domain protein
2697 RJOO01000004.1 GCA003943125_01360 CDS open 49839-51014 _na     391_aa Haloacid dehalogenase-like hydrolase
2698 RJOO01000004.1 GCA003943125_01361 CDS open 51039-51791 _na     250_aa PD-(D/E)XK endonuclease-like domain-containing protein
2699 RJOO01000004.1 GCA003943125_01362 CDS open 51838-53445 _na     535_aa type I restriction-modification system subunit M
2700 RJOO01000004.1 GCA003943125_01363 CDS open 53841-58304 _na     1487_aa C5a peptidase
2701 RJOO01000004.1 GCA003943125_01364 CDS open 58851-59267 _na     138_aa Polyketide cyclase
2702 RJOO01000004.1 GCA003943125_01365 CDS open 59264-59722 _na     152_aa marR Transcriptional regulator
2703 RJOO01000004.1 GCA003943125_01366 CDS open 59715-60125 _na     136_aa UPF0310 protein SIR_1399
2704 RJOO01000004.1 GCA003943125_01368 CDS open 60477-61391 _na     304_aa glyQ glycine--tRNA ligase subunit alpha
2705 RJOO01000004.1 GCA003943125_01369 CDS open 61394-63433 _na     679_aa Glycine--tRNA ligase beta subunit
2706 RJOO01000004.1 GCA003943125_01370 CDS open 63449-63706 _na     85_aa ynzC DUF896 domain-containing protein
2707 RJOO01000004.1 GCA003943125_01371 CDS open 63758-64423 _na     221_aa Trk family potassium uptake protein
2708 RJOO01000004.1 GCA003943125_01372 CDS open 64434-65789 _na     451_aa trkH Potassium uptake protein%2C TrkH family
2709 RJOO01000004.1 GCA003943125_01373 CDS open 66056-66253 _na     65_aa Putative transcriptional regulator
2710 RJOO01000004.1 GCA003943125_01374 CDS open 66402-67352 _na     316_aa rsmH 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH
2711 RJOO01000004.1 GCA003943125_01375 CDS open 67361-67678 _na     105_aa ftsL cell division protein FtsL
2712 RJOO01000004.1 GCA003943125_01376 CDS open 67682-69940 _na     752_aa pbp2X penicillin-binding protein PBP2X
2713 RJOO01000004.1 GCA003943125_01377 CDS open 69942-70925 _na     327_aa mraY phospho-N-acetylmuramoyl-pentapeptide-transferase
2714 RJOO01000004.1 GCA003943125_01378 CDS open 71329-73287 _na     652_aa Peptide ABC transporter ATP-binding protein
2715 RJOO01000004.1 GCA003943125_01380 CDS open 73616-74113 _na     165_aa CTP synthase (glutamine hydrolyzing)
2716 RJOO01000004.1 GCA003943125_01381 CDS open 74164-74574 _na     136_aa Integron-associated effector binding protein domain-containing protein
2717 RJOO01000004.1 GCA003943125_01383 CDS open 74987-75868 _na     293_aa fba class II fructose-bisphosphate aldolase
2718 RJOO01000004.1 GCA003943125_01384 CDS open 76063-76230 _na     55_aa hypothetical protein
2719 RJOO01000004.1 GCA003943125_01385 CDS open 76233-77168 _na     311_aa Replication initiator A N-terminal domain-containing protein
2720 RJOO01000004.1 GCA003943125_01386 CDS open 77182-77985 _na     267_aa site-specific DNA-methyltransferase (adenine-specific)
2721 RJOO01000004.1 GCA003943125_01387 CDS open 78052-78318 _na     88_aa Thiopurine S-methyltransferase
2722 RJOO01000004.1 GCA003943125_01388 CDS open 78340-78666 _na     108_aa doxX DoxX
2723 RJOO01000004.1 GCA003943125_01389 CDS open 78982-79302 _na     106_aa DUF4258 domain-containing protein
2724 RJOO01000004.1 GCA003943125_01390 CDS open 79497-81878 _na     793_aa Cell surface antigen I/II
2725 RJOO01000004.1 GCA003943125_01391 CDS open 81951-82739 _na     262_aa Gram-positive cocci surface proteins LPxTG domain-containing protein
2726 RJOO01000004.1 GCA003943125_01392 CDS open 82810-83283 _na     157_aa Conjugal transfer protein
2727 RJOO01000004.1 GCA003943125_01393 CDS open 83374-83601 _na     75_aa DUF4190 domain-containing protein
2728 RJOO01000004.1 GCA003943125_01394 CDS open 83620-84366 _na     248_aa trbL Conjugal transfer protein TrbL
2729 RJOO01000004.1 GCA003943125_01395 CDS open 84378-84734 _na     118_aa prgI PrgI family protein
2730 RJOO01000004.1 GCA003943125_01396 CDS open 84685-87048 _na     787_aa VirB4-like conjugal transfer ATPase%2C CD1110 family
2731 RJOO01000004.1 GCA003943125_01397 CDS open 87068-89704 _na     878_aa Peptidase C51 domain-containing protein
2732 RJOO01000004.1 GCA003943125_01398 CDS open 89729-90367 _na     212_aa Parvulin-like peptidyl-prolyl isomerase
2733 RJOO01000004.1 GCA003943125_01399 CDS open 90354-90617 _na     87_aa hypothetical protein
2734 RJOO01000004.1 GCA003943125_01400 CDS open 90580-91410 _na     276_aa Conjugal transfer protein
2735 RJOO01000004.1 GCA003943125_01401 CDS open 91461-91970 _na     169_aa DUF3801 domain-containing protein
2736 RJOO01000004.1 GCA003943125_01402 CDS open 91967-93772 _na     601_aa VirD4-like conjugal transfer protein%2C CD1115 family
2737 RJOO01000004.1 GCA003943125_01403 CDS open 93794-94066 _na     90_aa hypothetical protein
2738 RJOO01000004.1 GCA003943125_01404 CDS open 94057-99027 _na     1656_aa DNA primase
2739 RJOO01000004.1 GCA003943125_01405 CDS open 99098-99523 _na     141_aa hypothetical protein
2740 RJOO01000004.1 GCA003943125_01406 CDS open 99761-100153 _na     130_aa mobC Plasmid mobilization relaxosome protein MobC
2741 RJOO01000004.1 GCA003943125_01407 CDS open 100147-101790 _na     547_aa Relaxase
2742 RJOO01000004.1 GCA003943125_01408 CDS open 102029-102223 _na     64_aa hypothetical protein
2743 RJOO01000004.1 GCA003943125_01409 CDS open 102254-102469 _na     71_aa hypothetical protein
2744 RJOO01000004.1 GCA003943125_01410 CDS open 102626-102796 _na     56_aa TMhelix containing protein
2745 RJOO01000004.1 GCA003943125_01411 CDS open 102797-103618 _na     273_aa Sporulation initiation inhibitor protein Soj
2746 RJOO01000004.1 GCA003943125_01412 CDS open 103699-103932 _na     77_aa hypothetical protein
2747 RJOO01000004.1 GCA003943125_01413 CDS open 104156-105508 _na     450_aa ISLre2 family transposase
2748 RJOO01000004.1 GCA003943125_01415 CDS open 106137-106583 _na     148_aa LytR/AlgR family transcriptional regulator
2749 RJOO01000004.1 GCA003943125_01416 CDS open 106589-107251 _na     220_aa liaF LiaF transmembrane domain-containing protein
2750 RJOO01000004.1 GCA003943125_01417 CDS open 107386-107574 _na     62_aa rpmB 50S ribosomal protein L28
2751 RJOO01000004.1 GCA003943125_01418 CDS open 107749-108114 _na     121_aa yloU Asp23/Gls24 family envelope stress response protein
2752 RJOO01000004.1 GCA003943125_01419 CDS open 108117-109784 _na     555_aa dhaL DhaL domain-containing protein
2753 RJOO01000004.1 GCA003943125_01420 CDS open 110176-111051 _na     291_aa yxlF ABC transporter ATP-binding protein YxlF
2754 RJOO01000004.1 GCA003943125_01421 CDS open 111065-111796 _na     243_aa Transport permease protein
2755 RJOO01000004.1 GCA003943125_01422 CDS open 111801-112901 _na     366_aa histidine kinase
2756 RJOO01000004.1 GCA003943125_01423 CDS open 112898-113497 _na     199_aa degU Transcriptional regulatory protein DegU
2757 RJOO01000004.1 GCA003943125_01424 CDS open 113627-114514 _na     295_aa hflK Modulator of FtsH protease HflK
2758 RJOO01000004.1 GCA003943125_01425 CDS open 114623-114838 _na     71_aa Spermidine synthase
2759 RJOO01000004.1 GCA003943125_01426 CDS open 115205-115945 _na     246_aa Polar amino acid transport system%2C ATP-binding protein
2760 RJOO01000004.1 GCA003943125_01427 CDS open 115942-117507 _na     521_aa ABC uptake transporter substrate binding protein /membrane-spanning protein
2761 RJOO01000004.1 GCA003943125_01428 CDS open 117634-119523 _na     629_aa DUF2207 domain-containing protein
2762 RJOO01000004.1 GCA003943125_01429 CDS open 119590-120432 _na     280_aa undecaprenyl-diphosphate phosphatase
2763 RJOO01000004.1 GCA003943125_01430 CDS open 120559-121308 _na     249_aa mecA adaptor protein MecA
2764 RJOO01000004.1 GCA003943125_01431 CDS open 121305-122471 _na     388_aa Putative undecaprenyl-phosphate N-acetylglucosaminyl 1-phosphate transferase
2765 RJOO01000004.1 GCA003943125_01432 CDS open 122562-123332 _na     256_aa sufC Fe-S cluster assembly ATPase SufC
2766 RJOO01000004.1 GCA003943125_01433 CDS open 123372-124634 _na     420_aa sufD Fe-S cluster assembly protein SufD
2767 RJOO01000004.1 GCA003943125_01434 CDS open 124651-125883 _na     410_aa Cysteine desulfurase
2768 RJOO01000004.1 GCA003943125_01435 CDS open 125870-126319 _na     149_aa sufU Fe-S cluster assembly sulfur transfer protein SufU
2769 RJOO01000004.1 GCA003943125_01436 CDS open 126409-127650 _na     413_aa pbp3 D-alanyl-D-alanine carboxypeptidase PBP3
2770 RJOO01000004.1 GCA003943125_01437 CDS open 127807-129150 _na     447_aa cshB DEAD-box ATP-dependent RNA helicase CshB
2771 RJOO01000004.1 GCA003943125_01438 CDS open 129311-130120 _na     269_aa Inner membrane amino-acid ABC transporter permease protein
2772 RJOO01000004.1 GCA003943125_01439 CDS open 130120-130863 _na     247_aa ABC transport system%2C ATP-binding protein
2773 RJOO01000004.1 GCA003943125_01440 CDS open 130958-131182 _na     74_aa Amino acid transporter%2C AAT family
2774 RJOO01000004.1 GCA003943125_01441 CDS open 131245-132156 _na     303_aa trxB thioredoxin-disulfide reductase
2775 RJOO01000004.1 GCA003943125_01442 CDS open 132335-133711 _na     458_aa D-serine/D-alanine/glycine transporter
2776 RJOO01000004.1 GCA003943125_01443 CDS open 133824-134243 _na     139_aa DUF1310 domain-containing protein
2777 RJOO01000004.1 GCA003943125_01444 CDS open 134243-134419 _na     58_aa Transposase
2778 RJOO01000004.1 GCA003943125_01445 CDS open 134828-136288 _na     486_aa nicotinate phosphoribosyltransferase
2779 RJOO01000004.1 GCA003943125_01446 CDS open 136285-137109 _na     274_aa nadE ammonia-dependent NAD(+) synthetase
2780 RJOO01000004.1 GCA003943125_01447 CDS open 137257-138594 _na     445_aa pepC aminopeptidase C
2781 RJOO01000004.1 GCA003943125_01448 CDS open 138764-140935 _na     723_aa pbp1a penicillin-binding protein PBP1A
2782 RJOO01000004.1 GCA003943125_01449 CDS open 140928-141530 _na     200_aa recU Holliday junction resolvase RecU
2783 RJOO01000004.1 GCA003943125_01450 CDS open 141599-142120 _na     173_aa UPF0398 protein D8827_07215
2784 RJOO01000004.1 GCA003943125_01451 CDS open 142196-142537 _na     113_aa gpsB cell division regulator GpsB
2785 RJOO01000004.1 GCA003943125_01453 CDS open 142972-144126 _na     384_aa THUMP domain-containing protein
2786 RJOO01000004.1 GCA003943125_01454 CDS open 144139-145581 _na     480_aa Mid-cell-anchored protein Z
2787 RJOO01000004.1 GCA003943125_01455 CDS open 145685-146251 _na     188_aa ahpC alkyl hydroperoxide reductase subunit C
2788 RJOO01000004.1 GCA003943125_01456 CDS open 146263-147795 _na     510_aa ahpF alkyl hydroperoxide reductase subunit F
2789 RJOO01000004.1 GCA003943125_01457 CDS open 147843-148325 _na     160_aa S-ribosylhomocysteine lyase
2790 RJOO01000004.1 GCA003943125_01458 CDS open 148541-150148 _na     535_aa rny ribonuclease Y
2791 RJOO01000004.1 GCA003943125_01459 CDS open 150330-150956 _na     208_aa gmk guanylate kinase
2792 RJOO01000004.1 GCA003943125_01460 CDS open 150982-151296 _na     104_aa rpoZ DNA-directed RNA polymerase subunit omega
2793 RJOO01000004.1 GCA003943125_01461 CDS open 151355-153736 _na     793_aa primosomal protein N'
2794 RJOO01000004.1 GCA003943125_01462 CDS open 153797-154732 _na     311_aa fmt methionyl-tRNA formyltransferase
2795 RJOO01000004.1 GCA003943125_01463 CDS open 154722-156035 _na     437_aa rsmB 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB
2796 RJOO01000004.1 GCA003943125_01464 CDS open 156054-156794 _na     246_aa Stp1/IreP family PP2C-type Ser/Thr phosphatase
2797 RJOO01000004.1 GCA003943125_01465 CDS open 156791-158665 _na     624_aa pknB Stk1 family PASTA domain-containing Ser/Thr kinase
2798 RJOO01000004.1 GCA003943125_01466 CDS open 158928-159626 _na     232_aa Cell wall-active antibiotics response LiaF-like C-terminal domain-containing protein
2799 RJOO01000004.1 GCA003943125_01467 CDS open 159623-160618 _na     331_aa Sensor histidine kinase
2800 RJOO01000004.1 GCA003943125_01468 CDS open 160620-161252 _na     210_aa Response regulator transcription factor
2801 RJOO01000004.1 GCA003943125_01469 CDS open 161292-161831 _na     179_aa Bifunctional phosphatase/peptidyl-prolyl cis-trans isomerase
2802 RJOO01000004.1 GCA003943125_01470 CDS open 161910-162692 _na     260_aa Peptidyl-prolyl cis-trans isomerase
2803 RJOO01000004.1 GCA003943125_01471 CDS open 162694-163086 _na     130_aa S1 RNA-binding domain-containing protein
2804 RJOO01000004.1 GCA003943125_01472 CDS open 163206-163523 _na     105_aa GTP cyclohydrolase
2805 RJOO01000004.1 GCA003943125_01473 CDS open 163643-164176 _na     177_aa Nucleoside triphosphate/diphosphate phosphatase
2806 RJOO01000004.1 GCA003943125_01474 CDS open 164263-165039 _na     258_aa recX recombination regulator RecX
2807 RJOO01000004.1 GCA003943125_01475 CDS open 165103-165558 _na     151_aa Aminoglycoside 3'-phosphotransferase
2808 RJOO01000004.1 GCA003943125_01476 CDS open 165936-167315 _na     459_aa rlmD 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD
2809 RJOO01000004.1 GCA003943125_01477 CDS open 167928-168161 _na     77_aa DUF1858 domain-containing protein
2810 RJOO01000004.1 GCA003943125_01478 CDS open 168161-169522 _na     453_aa Hemerythrin HHE cation binding domain subfamily
2811 RJOO01000004.1 GCA003943125_01479 CDS open 169533-169787 _na     84_aa Aldose 1-epimerase
2812 RJOO01000004.1 GCA003943125_01480 CDS open 170038-170757 _na     239_aa DUF1868 domain-containing protein
2813 RJOO01000004.1 GCA003943125_01481 CDS open 170931-171569 _na     212_aa Lipoprotein
2814 RJOO01000004.1 GCA003943125_01482 CDS open 171612-172187 _na     191_aa [ribosomal protein uS5]-alanine N-acetyltransferase
2815 RJOO01000004.1 GCA003943125_01483 CDS open 172184-173482 _na     432_aa ABC transporter permease
2816 RJOO01000004.1 GCA003943125_01484 CDS open 173504-176155 _na     883_aa valine--tRNA ligase
2817 RJOO01000004.1 GCA003943125_01485 CDS open 176327-178717 _na     796_aa CRISPR-associated nuclease/helicase Cas3
2818 RJOO01000004.1 GCA003943125_01486 CDS open 178963-179691 _na     242_aa cas5c type I-C CRISPR-associated protein Cas5c
2819 RJOO01000004.1 GCA003943125_01487 CDS open 179691-181592 _na     633_aa cas8c type I-C CRISPR-associated protein Cas8c/Csd1
2820 RJOO01000004.1 GCA003943125_01488 CDS open 181596-182447 _na     283_aa cas7c type I-C CRISPR-associated protein Cas7/Csd2
2821 RJOO01000004.1 GCA003943125_01489 CDS open 182449-183120 _na     223_aa cas4 CRISPR-associated protein Cas4
2822 RJOO01000004.1 GCA003943125_01490 CDS open 183117-184142 _na     341_aa cas1c type I-C CRISPR-associated endonuclease Cas1c
2823 RJOO01000004.1 GCA003943125_01491 CDS open 184153-184446 _na     97_aa cas2 CRISPR-associated endonuclease Cas2
2824 RJOO01000004.1 GCA003943125_01492 CDS open 186217-187146 _na     309_aa cysK cysteine synthase A
2825 RJOO01000004.1 GCA003943125_01493 CDS open 187245-187880 _na     211_aa Xaa-Pro dipeptidase
2826 RJOO01000004.1 GCA003943125_01494 CDS open 187937-189238 _na     433_aa Putative ATP-dependent RNA helicase
2827 RJOO01000004.1 GCA003943125_01495 CDS open 189235-189900 _na     221_aa Putative competence protein FC
2828 RJOO01000004.1 GCA003943125_01496 CDS open 189979-190521 _na     180_aa hpf ribosome hibernation-promoting factor%2C HPF/YfiA family
2829 RJOO01000004.1 GCA003943125_01497 CDS open 190720-191259 _na     179_aa rsmD 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD
2830 RJOO01000004.1 GCA003943125_01498 CDS open 191249-191746 _na     165_aa coaD pantetheine-phosphate adenylyltransferase
2831 RJOO01000004.1 GCA003943125_01499 CDS open 191727-192782 _na     351_aa sepM SepM family pheromone-processing serine protease
2832 RJOO01000004.1 GCA003943125_01500 CDS open 193064-193621 _na     185_aa Transcriptional regulator
2833 RJOO01000004.1 GCA003943125_01501 CDS open 193655-194737 _na     360_aa rlmN 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN
2834 RJOO01000004.1 GCA003943125_01502 CDS open 194730-195224 _na     164_aa VanZ-like domain-containing protein
2835 RJOO01000004.1 GCA003943125_01503 CDS open 195233-195916 _na     227_aa Putative type 4 prepilin peptidase
2836 RJOO01000004.1 GCA003943125_01504 CDS open 196066-196593 _na     175_aa Putative DNA-binding ferritin-like protein
2837 RJOO01000004.1 GCA003943125_01506 CDS open 196856-197080 _na     74_aa DUF910 domain-containing protein
2838 RJOO01000004.1 GCA003943125_01507 CDS open 197074-197454 _na     126_aa Rhodanese-like protein
2839 RJOO01000004.1 GCA003943125_01508 CDS open 197475-198200 _na     241_aa Pseudouridine synthase
2840 RJOO01000004.1 GCA003943125_01509 CDS open 198381-200222 _na     613_aa typA translational GTPase TypA
2841 RJOO01000004.1 GCA003943125_01510 CDS open 200285-200569 _na     94_aa DUF3165 domain-containing protein
2842 RJOO01000004.1 GCA003943125_01511 CDS open 200643-201995 _na     450_aa murD UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase
2843 RJOO01000004.1 GCA003943125_01512 CDS open 201997-203067 _na     356_aa UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase
2844 RJOO01000004.1 GCA003943125_01513 CDS open 203064-204113 _na     349_aa Cell division protein DivIB
2845 RJOO01000004.1 GCA003943125_01514 CDS open 204236-205621 _na     461_aa ftsA cell division protein FtsA
2846 RJOO01000004.1 GCA003943125_01515 CDS open 205639-206913 _na     424_aa ftsZ cell division protein FtsZ
2847 RJOO01000004.1 GCA003943125_01516 CDS open 206915-207586 _na     223_aa Pyridoxal phosphate homeostasis protein
2848 RJOO01000004.1 GCA003943125_01517 CDS open 207596-208141 _na     181_aa sepF Cell division protein SepF
2849 RJOO01000004.1 GCA003943125_01518 CDS open 208146-208409 _na     87_aa yggT YggT family protein
2850 RJOO01000004.1 GCA003943125_01519 CDS open 208413-209204 _na     263_aa RNA-binding S4 domain-containing protein
2851 RJOO01000004.1 GCA003943125_01520 CDS open 209214-209999 _na     261_aa DivIVA domain-containing protein
2852 RJOO01000004.1 GCA003943125_01521 CDS open 210265-213057 _na     930_aa ileS isoleucine--tRNA ligase
2853 RJOO01000004.1 GCA003943125_01522 CDS open 214055-215179 _na     374_aa Permease
2854 RJOO01000004.1 GCA003943125_01523 CDS open 215402-217048 _na     548_aa phosphoenolpyruvate carboxykinase (ATP)
2855 RJOO01000004.1 GCA003943125_01524 CDS open 217137-218477 _na     446_aa HlyC/CorC family transporter
2856 RJOO01000004.1 GCA003943125_01525 CDS open 218532-219245 _na     237_aa treR trehalose operon repressor
2857 RJOO01000004.1 GCA003943125_01526 CDS open 219424-221436 _na     670_aa treB PTS trehalose transporter subunit IIBC
2858 RJOO01000004.1 GCA003943125_01527 CDS open 221604-223247 _na     547_aa treC alpha%2Calpha-phosphotrehalase
2859 RJOO01000004.1 GCA003943125_01528 CDS open 223395-225569 _na     724_aa Putative nuclease
2860 RJOO01000004.1 GCA003943125_01529 CDS open 225738-226535 _na     265_aa pflA pyruvate formate-lyase-activating protein
2861 RJOO01000004.1 GCA003943125_01530 CDS open 226680-227615 _na     311_aa ppaC manganese-dependent inorganic pyrophosphatase
2862 RJOO01000004.1 GCA003943125_01531 CDS open 228116-228628 _na     170_aa UDP-N-acetylmuramoylalanyl-D-glutamate--2%2C 6-diaminopimelate ligase
2863 RJOO01000004.1 GCA003943125_01532 CDS open 228612-229295 _na     227_aa DUF1803 domain-containing protein
2864 RJOO01000004.1 GCA003943125_01533 CDS open 229630-230388 _na     252_aa CAAX amino protease family protein
2865 RJOO01000004.1 GCA003943125_01534 CDS open 230512-231957 _na     481_aa UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L-lysine ligase
2866 RJOO01000004.1 GCA003943125_01535 CDS open 232043-233671 _na     542_aa ytgP Putative cell division protein YtgP
2867 RJOO01000004.1 GCA003943125_01536 CDS open 233890-234009 _na     39_aa hypothetical protein
2868 RJOO01000004.1 GCA003943125_01537 CDS open 234467-235633 _na     388_aa cysteine-S-conjugate beta-lyase
2869 RJOO01000004.1 GCA003943125_01538 CDS open 236115-238769 _na     884_aa mgtA magnesium-translocating P-type ATPase
2870 RJOO01000004.1 GCA003943125_01539 CDS open 238867-239496 _na     209_aa upp uracil phosphoribosyltransferase
2871 RJOO01000004.1 GCA003943125_01540 CDS open 239609-240199 _na     196_aa clpP ATP-dependent Clp protease proteolytic subunit
2872 RJOO01000004.1 GCA003943125_01541 CDS open 240290-240559 _na     89_aa UPF0298 protein SITYG_05430
2873 RJOO01000004.1 GCA003943125_01542 CDS open 240642-241805 _na     387_aa Leucine-binding protein domain-containing protein
2874 RJOO01000004.1 GCA003943125_01543 CDS open 242135-243058 _na     307_aa Branched-chain amino acid ABC transporter%2C permease protein
2875 RJOO01000004.1 GCA003943125_01544 CDS open 243062-244012 _na     316_aa livH High-affinity branched-chain amino acid transport system permease protein LivH
2876 RJOO01000004.1 GCA003943125_01545 CDS open 244012-244776 _na     254_aa Branched-chain amino acid ABC superfamily ATP binding cassette transporter%2C ABC protein
2877 RJOO01000004.1 GCA003943125_01546 CDS open 244776-245486 _na     236_aa Branched-chain amino acid transport protein
2878 RJOO01000004.1 GCA003943125_01547 CDS open 245634-246290 _na     218_aa acuB Putative acetoin utilization protein AcuB
2879 RJOO01000004.1 GCA003943125_01548 CDS open 246355-247218 _na     287_aa DUF2179 domain-containing protein
2880 RJOO01000004.1 GCA003943125_01549 CDS open 247383-248015 _na     210_aa tmk dTMP kinase
2881 RJOO01000004.1 GCA003943125_01550 CDS open 248017-248910 _na     297_aa DNA polymerase III subunit delta'
2882 RJOO01000004.1 GCA003943125_01551 CDS open 248939-249262 _na     107_aa yabA DNA replication initiation control protein YabA
2883 RJOO01000004.1 GCA003943125_01552 CDS open 249265-250128 _na     287_aa rsmI 16S rRNA (cytidine(1402)-2'-O)-methyltransferase
2884 RJOO01000004.1 GCA003943125_01553 CDS open 250140-250649 _na     169_aa Methylated-DNA--protein-cysteine methyltransferase
2885 RJOO01000004.1 GCA003943125_01554 CDS open 250667-251020 _na     117_aa Arsenate reductase
2886 RJOO01000004.1 GCA003943125_01555 CDS open 251193-251324 _na     43_aa hypothetical protein
2887 RJOO01000004.1 GCA003943125_01556 CDS open 251404-252033 _na     209_aa nth endonuclease III
2888 RJOO01000004.1 GCA003943125_01557 CDS open 252061-252447 _na     128_aa Bleomycin resistance protein
2889 RJOO01000004.1 GCA003943125_01558 CDS open 252459-253286 _na     275_aa exoA exodeoxyribonuclease III
2890 RJOO01000004.1 GCA003943125_01559 CDS open 253402-253635 _na     77_aa DUF5808 domain-containing protein
2891 RJOO01000004.1 GCA003943125_01560 CDS open 254086-254391 _na     101_aa DUF1648 domain-containing protein
2892 RJOO01000004.1 GCA003943125_01561 CDS open 254490-254945 _na     151_aa DUF3290 domain-containing protein
2893 RJOO01000004.1 GCA003943125_01562 CDS open 254942-255574 _na     210_aa yetF Membrane protein yetF
2894 RJOO01000004.1 GCA003943125_01563 CDS open 255937-256197 _na     86_aa Integral membrane protein
2895 RJOO01000004.1 GCA003943125_01564 CDS open 256443-258437 _na     664_aa metG methionine--tRNA ligase
2896 RJOO01000004.1 GCA003943125_01565 CDS open 258527-259708 _na     393_aa Lipase
2897 RJOO01000004.1 GCA003943125_01566 CDS open 259800-260486 _na     228_aa graR Response regulator protein GraR
2898 RJOO01000004.1 GCA003943125_01567 CDS open 260470-261450 _na     326_aa histidine kinase
2899 RJOO01000004.1 GCA003943125_01568 CDS open 261573-262331 _na     252_aa traX TraX family protein
2900 RJOO01000004.1 GCA003943125_01314 gene open 728-2077
2901 RJOO01000004.1 GCA003943125_01315 gene open 2244-3035
2902 RJOO01000004.1 GCA003943125_01316 gene open 3126-3560
2903 RJOO01000004.1 GCA003943125_01317 gene open 3560-4534
2904 RJOO01000004.1 GCA003943125_01318 gene open 4588-4812
2905 RJOO01000004.1 GCA003943125_01319 gene open 5078-6052 fabK
2906 RJOO01000004.1 GCA003943125_01320 gene open 6045-6971 fabD
2907 RJOO01000004.1 GCA003943125_01321 gene open 6974-7705 fabG
2908 RJOO01000004.1 GCA003943125_01322 gene open 7786-9018 fabF
2909 RJOO01000004.1 GCA003943125_01323 gene open 9019-9498 accB
2910 RJOO01000004.1 GCA003943125_01324 gene open 9495-9917 fabZ
2911 RJOO01000004.1 GCA003943125_01325 gene open 9933-11300
2912 RJOO01000004.1 GCA003943125_01326 gene open 11320-12183 accD
2913 RJOO01000004.1 GCA003943125_01327 gene open 12180-12950
2914 RJOO01000004.1 GCA003943125_01328 gene open 13286-13945
2915 RJOO01000004.1 GCA003943125_01329 gene open 13987-15264 serS
2916 RJOO01000004.1 GCA003943125_01330 gene open 15477-15848 manO
2917 RJOO01000004.1 GCA003943125_01331 gene open 16126-17037
2918 RJOO01000004.1 GCA003943125_01332 gene open 17057-17860
2919 RJOO01000004.1 GCA003943125_01333 gene open 17878-18867 agaB
2920 RJOO01000004.1 GCA003943125_01334 gene open 19139-20161 adhP
2921 RJOO01000004.1 GCA003943125_01335 gene open 20384-21196
2922 RJOO01000004.1 GCA003943125_01336 gene open 21303-21902
2923 RJOO01000004.1 GCA003943125_01337 gene open 22020-23459
2924 RJOO01000004.1 GCA003943125_01338 gene open 23796-24236 tsaE
2925 RJOO01000004.1 GCA003943125_01339 gene open 24229-24750
2926 RJOO01000004.1 GCA003943125_01340 gene open 24758-25861 brpA
2927 RJOO01000004.1 GCA003943125_01341 gene open 25905-26192
2928 RJOO01000004.1 GCA003943125_01342 gene open 26202-26612
2929 RJOO01000004.1 GCA003943125_01343 gene open 26681-27412
2930 RJOO01000004.1 GCA003943125_01344 gene open 27409-28455
2931 RJOO01000004.1 GCA003943125_01345 gene open 28506-29303 ccrZ
2932 RJOO01000004.1 GCA003943125_01346 gene open 29300-29935 trmB
2933 RJOO01000004.1 GCA003943125_01347 gene open 30335-31027
2934 RJOO01000004.1 GCA003943125_01348 gene open 31239-31727 rimP
2935 RJOO01000004.1 GCA003943125_01349 gene open 31791-32972 nusA
2936 RJOO01000004.1 GCA003943125_01350 gene open 32983-33279 rnpM
2937 RJOO01000004.1 GCA003943125_01351 gene open 33272-33571
2938 RJOO01000004.1 GCA003943125_01352 gene open 33588-36425 infB
2939 RJOO01000004.1 GCA003943125_01353 gene open 36504-36854 rbfA
2940 RJOO01000004.1 GCA003943125_01354 gene open 37013-38644 phoU
2941 RJOO01000004.1 GCA003943125_01355 gene open 38836-39987 nagA
2942 RJOO01000004.1 GCA003943125_01356 gene open 40139-43126
2943 RJOO01000004.1 GCA003943125_01357 gene open 43562-44314
2944 RJOO01000004.1 GCA003943125_01358 gene open 44565-48641
2945 RJOO01000004.1 GCA003943125_01359 gene open 48607-49809
2946 RJOO01000004.1 GCA003943125_01360 gene open 49839-51014
2947 RJOO01000004.1 GCA003943125_01361 gene open 51039-51791
2948 RJOO01000004.1 GCA003943125_01362 gene open 51838-53445
2949 RJOO01000004.1 GCA003943125_01363 gene open 53841-58304
2950 RJOO01000004.1 GCA003943125_01364 gene open 58851-59267
2951 RJOO01000004.1 GCA003943125_01365 gene open 59264-59722 marR
2952 RJOO01000004.1 GCA003943125_01366 gene open 59715-60125
2953 RJOO01000004.1 GCA003943125_01368 gene open 60477-61391 glyQ
2954 RJOO01000004.1 GCA003943125_01369 gene open 61394-63433
2955 RJOO01000004.1 GCA003943125_01370 gene open 63449-63706 ynzC
2956 RJOO01000004.1 GCA003943125_01371 gene open 63758-64423
2957 RJOO01000004.1 GCA003943125_01372 gene open 64434-65789 trkH
2958 RJOO01000004.1 GCA003943125_01373 gene open 66056-66253
2959 RJOO01000004.1 GCA003943125_01374 gene open 66402-67352 rsmH
2960 RJOO01000004.1 GCA003943125_01375 gene open 67361-67678 ftsL
2961 RJOO01000004.1 GCA003943125_01376 gene open 67682-69940 pbp2X
2962 RJOO01000004.1 GCA003943125_01377 gene open 69942-70925 mraY
2963 RJOO01000004.1 GCA003943125_01378 gene open 71329-73287
2964 RJOO01000004.1 GCA003943125_01380 gene open 73616-74113
2965 RJOO01000004.1 GCA003943125_01381 gene open 74164-74574
2966 RJOO01000004.1 GCA003943125_01383 gene open 74987-75868 fba
2967 RJOO01000004.1 GCA003943125_01384 gene open 76063-76230
2968 RJOO01000004.1 GCA003943125_01385 gene open 76233-77168
2969 RJOO01000004.1 GCA003943125_01386 gene open 77182-77985
2970 RJOO01000004.1 GCA003943125_01387 gene open 78052-78318
2971 RJOO01000004.1 GCA003943125_01388 gene open 78340-78666 doxX
2972 RJOO01000004.1 GCA003943125_01389 gene open 78982-79302
2973 RJOO01000004.1 GCA003943125_01390 gene open 79497-81878
2974 RJOO01000004.1 GCA003943125_01391 gene open 81951-82739
2975 RJOO01000004.1 GCA003943125_01392 gene open 82810-83283
2976 RJOO01000004.1 GCA003943125_01393 gene open 83374-83601
2977 RJOO01000004.1 GCA003943125_01394 gene open 83620-84366 trbL
2978 RJOO01000004.1 GCA003943125_01395 gene open 84378-84734 prgI
2979 RJOO01000004.1 GCA003943125_01396 gene open 84685-87048
2980 RJOO01000004.1 GCA003943125_01397 gene open 87068-89704
2981 RJOO01000004.1 GCA003943125_01398 gene open 89729-90367
2982 RJOO01000004.1 GCA003943125_01399 gene open 90354-90617
2983 RJOO01000004.1 GCA003943125_01400 gene open 90580-91410
2984 RJOO01000004.1 GCA003943125_01401 gene open 91461-91970
2985 RJOO01000004.1 GCA003943125_01402 gene open 91967-93772
2986 RJOO01000004.1 GCA003943125_01403 gene open 93794-94066
2987 RJOO01000004.1 GCA003943125_01404 gene open 94057-99027
2988 RJOO01000004.1 GCA003943125_01405 gene open 99098-99523
2989 RJOO01000004.1 GCA003943125_01406 gene open 99761-100153 mobC
2990 RJOO01000004.1 GCA003943125_01407 gene open 100147-101790
2991 RJOO01000004.1 GCA003943125_01408 gene open 102029-102223
2992 RJOO01000004.1 GCA003943125_01409 gene open 102254-102469
2993 RJOO01000004.1 GCA003943125_01410 gene open 102626-102796
2994 RJOO01000004.1 GCA003943125_01411 gene open 102797-103618
2995 RJOO01000004.1 GCA003943125_01412 gene open 103699-103932
2996 RJOO01000004.1 GCA003943125_01413 gene open 104156-105508
2997 RJOO01000004.1 GCA003943125_01415 gene open 106137-106583
2998 RJOO01000004.1 GCA003943125_01416 gene open 106589-107251 liaF
2999 RJOO01000004.1 GCA003943125_01417 gene open 107386-107574 rpmB
3000 RJOO01000004.1 GCA003943125_01418 gene open 107749-108114 yloU