HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Streptococcus intermedius (GCA_003944005.1)

Select a Genome:
BAKTA Annotations for GCA_003944005.1
Genome Selected: Streptococcus intermedius
ContigsBases CDSrRNA tmRNAtRNA
26 1,992,918 1929 4 1 54
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4025 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:8]    |    Number of Records Found: 4025 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3501 RJOK01000008.1 GCA003944005_01767 CDS open 44699-44929 _na     76_aa Cytoplasmic protein
3502 RJOK01000008.1 GCA003944005_01768 CDS open 45098-45598 _na     166_aa Ferrous iron transport protein A
3503 RJOK01000008.1 GCA003944005_01769 CDS open 45564-47708 _na     714_aa feoB ferrous iron transport protein B
3504 RJOK01000008.1 GCA003944005_01770 CDS open 47717-47851 _na     44_aa FeoB-associated Cys-rich membrane protein
3505 RJOK01000008.1 GCA003944005_01771 CDS open 47983-48525 _na     180_aa Cytosolic protein
3506 RJOK01000008.1 GCA003944005_01772 CDS open 48969-50357 _na     462_aa ABC superfamily ATP binding cassette transporter
3507 RJOK01000008.1 GCA003944005_01773 CDS open 50381-51028 _na     215_aa ABC transporter ATP-binding protein
3508 RJOK01000008.1 GCA003944005_01774 CDS open 51040-52332 _na     430_aa ABC3 transporter permease protein domain-containing protein
3509 RJOK01000008.1 GCA003944005_01775 CDS open 52601-53455 _na     284_aa bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase
3510 RJOK01000008.1 GCA003944005_01776 CDS open 53561-54400 _na     279_aa ADP-dependent (S)-NAD(P)H-hydrate dehydratase
3511 RJOK01000008.1 GCA003944005_01777 CDS open 54493-55833 _na     446_aa xseA exodeoxyribonuclease VII large subunit
3512 RJOK01000008.1 GCA003944005_01778 CDS open 55811-56023 _na     70_aa xseB exodeoxyribonuclease VII small subunit
3513 RJOK01000008.1 GCA003944005_01779 CDS open 56020-56922 _na     300_aa Putative synthase or transferase
3514 RJOK01000008.1 GCA003944005_01780 CDS open 56888-57703 _na     271_aa Ribosomal RNA large subunit methyltransferase J
3515 RJOK01000008.1 GCA003944005_01781 CDS open 57696-58127 _na     143_aa Arginine repressor
3516 RJOK01000008.1 GCA003944005_01782 CDS open 58135-59793 _na     552_aa recN DNA repair protein RecN
3517 RJOK01000008.1 GCA003944005_01783 CDS open 60104-60835 _na     243_aa Putative serine/threonine protein phosphatase 1
3518 RJOK01000008.1 GCA003944005_01784 CDS open 60898-61869 _na     323_aa Putative ABC transporter%2C periplasmic component
3519 RJOK01000008.1 GCA003944005_01785 CDS open 61891-62643 _na     250_aa Iron complex transport system ATP-binding protein
3520 RJOK01000008.1 GCA003944005_01786 CDS open 62644-63606 _na     320_aa Putative ABC transporter permease
3521 RJOK01000008.1 GCA003944005_01787 CDS open 63599-64552 _na     317_aa Iron compound ABC transporter permease protein
3522 RJOK01000008.1 GCA003944005_01788 CDS open 64788-65621 _na     277_aa degV DegV family protein
3523 RJOK01000008.1 GCA003944005_01789 CDS open 65750-66025 _na     91_aa hupA DNA-binding protein HU-beta
3524 RJOK01000008.1 GCA003944005_01790 CDS open 66193-66654 _na     153_aa Fe/Zn uptake regulation protein
3525 RJOK01000008.1 GCA003944005_01791 CDS open 66792-67484 _na     230_aa gpmA phosphoglycerate mutase
3526 RJOK01000008.1 GCA003944005_01792 CDS open 67653-69701 _na     682_aa pbp2b penicillin-binding protein PBP2B
3527 RJOK01000008.1 GCA003944005_01793 CDS open 69712-70308 _na     198_aa recR recombination mediator RecR
3528 RJOK01000008.1 GCA003944005_01794 CDS open 70433-71485 _na     350_aa D-alanine--D-alanine ligase
3529 RJOK01000008.1 GCA003944005_01795 CDS open 71739-73109 _na     456_aa UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase
3530 RJOK01000008.1 GCA003944005_01796 CDS open 73099-73647 _na     182_aa DUF1697 domain-containing protein
3531 RJOK01000008.1 GCA003944005_01797 CDS open 73654-74358 _na     234_aa Major facilitator superfamily permease
3532 RJOK01000008.1 GCA003944005_01798 CDS open 74362-75039 _na     225_aa Major facilitator superfamily permease
3533 RJOK01000008.1 GCA003944005_01716 gene open 30-278
3534 RJOK01000008.1 GCA003944005_01717 gene open 296-1111
3535 RJOK01000008.1 GCA003944005_01718 gene open 1163-1645
3536 RJOK01000008.1 GCA003944005_01719 gene open 1844-2317 nrdR
3537 RJOK01000008.1 GCA003944005_01720 gene open 2318-3469
3538 RJOK01000008.1 GCA003944005_01721 gene open 3470-4369 dnaI
3539 RJOK01000008.1 GCA003944005_01722 gene open 4401-6008
3540 RJOK01000008.1 GCA003944005_01723 gene open 6047-6718
3541 RJOK01000008.1 GCA003944005_01724 gene open 6769-7455
3542 RJOK01000008.1 GCA003944005_01725 gene open 7485-7916
3543 RJOK01000008.1 GCA003944005_01726 gene open 7918-8364
3544 RJOK01000008.1 GCA003944005_01727 gene open 8492-9802 der
3545 RJOK01000008.1 GCA003944005_01728 gene open 10015-13125
3546 RJOK01000008.1 GCA003944005_01729 gene open 13167-13805
3547 RJOK01000008.1 GCA003944005_01730 gene open 13888-15219 murC
3548 RJOK01000008.1 GCA003944005_01731 gene open 15209-15733
3549 RJOK01000008.1 GCA003944005_01732 gene open 15730-16227
3550 RJOK01000008.1 GCA003944005_01733 gene open 16336-17940
3551 RJOK01000008.1 GCA003944005_01734 gene open 18144-18626 greA
3552 RJOK01000008.1 GCA003944005_01735 gene open 18703-19167
3553 RJOK01000008.1 GCA003944005_01736 gene open 19299-20216 yidC
3554 RJOK01000008.1 GCA003944005_01737 gene open 20296-20574
3555 RJOK01000008.1 GCA003944005_01738 gene open 20605-21345
3556 RJOK01000008.1 GCA003944005_01739 gene open 21391-21882
3557 RJOK01000008.1 GCA003944005_01740 gene open 21909-22592
3558 RJOK01000008.1 GCA003944005_01741 gene open 22701-23951
3559 RJOK01000008.1 GCA003944005_01742 gene open 24006-24254
3560 RJOK01000008.1 GCA003944005_01743 gene open 24347-25141 racE
3561 RJOK01000008.1 GCA003944005_01744 gene open 25138-26124
3562 RJOK01000008.1 GCA003944005_01745 gene open 26100-26621
3563 RJOK01000008.1 GCA003944005_01746 gene open 26618-27079 cbpB
3564 RJOK01000008.1 GCA003944005_01747 gene open 27076-27807 xerD
3565 RJOK01000008.1 GCA003944005_01748 gene open 27807-28517
3566 RJOK01000008.1 GCA003944005_01749 gene open 28510-29076 scpB
3567 RJOK01000008.1 GCA003944005_01750 gene open 29063-29788
3568 RJOK01000008.1 GCA003944005_01751 gene open 29788-30042 yidD
3569 RJOK01000008.1 GCA003944005_01752 gene open 30075-31514
3570 RJOK01000008.1 GCA003944005_01753 gene open 31518-32867 trkA
3571 RJOK01000008.1 GCA003944005_01754 gene open 33191-33703
3572 RJOK01000008.1 GCA003944005_01755 gene open 34136-34699
3573 RJOK01000008.1 GCA003944005_01756 gene open 34689-35339 bcrC
3574 RJOK01000008.1 GCA003944005_01757 gene open 35361-35684
3575 RJOK01000008.1 GCA003944005_01758 gene open 35734-36669
3576 RJOK01000008.1 GCA003944005_01759 gene open 36663-37211
3577 RJOK01000008.1 GCA003944005_01760 gene open 37224-37478
3578 RJOK01000008.1 GCA003944005_01761 gene open 37490-39544
3579 RJOK01000008.1 GCA003944005_01762 gene open 39618-39917
3580 RJOK01000008.1 GCA003944005_01763 gene open 39981-40430
3581 RJOK01000008.1 GCA003944005_01764 gene open 40587-41480
3582 RJOK01000008.1 GCA003944005_01765 gene open 41540-42145
3583 RJOK01000008.1 GCA003944005_01766 gene open 42192-44459
3584 RJOK01000008.1 GCA003944005_01767 gene open 44699-44929
3585 RJOK01000008.1 GCA003944005_01768 gene open 45098-45598
3586 RJOK01000008.1 GCA003944005_01769 gene open 45564-47708 feoB
3587 RJOK01000008.1 GCA003944005_01770 gene open 47717-47851
3588 RJOK01000008.1 GCA003944005_01771 gene open 47983-48525
3589 RJOK01000008.1 GCA003944005_01772 gene open 48969-50357
3590 RJOK01000008.1 GCA003944005_01773 gene open 50381-51028
3591 RJOK01000008.1 GCA003944005_01774 gene open 51040-52332
3592 RJOK01000008.1 GCA003944005_01775 gene open 52601-53455
3593 RJOK01000008.1 GCA003944005_01776 gene open 53561-54400
3594 RJOK01000008.1 GCA003944005_01777 gene open 54493-55833 xseA
3595 RJOK01000008.1 GCA003944005_01778 gene open 55811-56023 xseB
3596 RJOK01000008.1 GCA003944005_01779 gene open 56020-56922
3597 RJOK01000008.1 GCA003944005_01780 gene open 56888-57703
3598 RJOK01000008.1 GCA003944005_01781 gene open 57696-58127
3599 RJOK01000008.1 GCA003944005_01782 gene open 58135-59793 recN
3600 RJOK01000008.1 GCA003944005_01783 gene open 60104-60835
3601 RJOK01000008.1 GCA003944005_01784 gene open 60898-61869
3602 RJOK01000008.1 GCA003944005_01785 gene open 61891-62643
3603 RJOK01000008.1 GCA003944005_01786 gene open 62644-63606
3604 RJOK01000008.1 GCA003944005_01787 gene open 63599-64552
3605 RJOK01000008.1 GCA003944005_01788 gene open 64788-65621 degV
3606 RJOK01000008.1 GCA003944005_01789 gene open 65750-66025 hupA
3607 RJOK01000008.1 GCA003944005_01790 gene open 66193-66654
3608 RJOK01000008.1 GCA003944005_01791 gene open 66792-67484 gpmA
3609 RJOK01000008.1 GCA003944005_01792 gene open 67653-69701 pbp2b
3610 RJOK01000008.1 GCA003944005_01793 gene open 69712-70308 recR
3611 RJOK01000008.1 GCA003944005_01794 gene open 70433-71485
3612 RJOK01000008.1 GCA003944005_01795 gene open 71739-73109
3613 RJOK01000008.1 GCA003944005_01796 gene open 73099-73647
3614 RJOK01000008.1 GCA003944005_01797 gene open 73654-74358
3615 RJOK01000008.1 GCA003944005_01798 gene open 74362-75039
3616 RJOK01000009.1 regulatory_region open 31684-31793 PreQ1-II (pre queuosine) riboswitch aptamer
3617 RJOK01000009.1 repeat_region open 7223-8718 CRISPR array with 23 repeats of length 36%2C consensus sequence GTTTTACAGTTACTTAAATCTTGAGAGTACAAAAAC and spacer length 29
3618 RJOK01000009.1 GCA003944005_01799 CDS open 271-990 _na     239_aa DUF4176 domain-containing protein
3619 RJOK01000009.1 GCA003944005_01800 CDS open 987-1277 _na     96_aa hypothetical protein
3620 RJOK01000009.1 GCA003944005_01801 CDS open 1292-1699 _na     135_aa DUF5082 domain-containing protein
3621 RJOK01000009.1 GCA003944005_01802 CDS open 1808-2575 _na     255_aa ribonuclease HII
3622 RJOK01000009.1 GCA003944005_01803 CDS open 2562-3413 _na     283_aa ylqF ribosome biogenesis GTPase YlqF
3623 RJOK01000009.1 GCA003944005_01804 CDS open 3817-3993 _na     58_aa rpsU 30S ribosomal protein S21
3624 RJOK01000009.1 GCA003944005_01805 CDS open 4142-4480 _na     112_aa ATP cone domain protein
3625 RJOK01000009.1 GCA003944005_01806 CDS open 4729-7062 _na     777_aa Gram-positive cocci surface proteins LPxTG domain-containing protein
3626 RJOK01000009.1 GCA003944005_01807 CDS open 8781-9824 _na     347_aa CRISPR-associated protein Cas7
3627 RJOK01000009.1 GCA003944005_01808 CDS open 9821-10144 _na     107_aa cas2 CRISPR-associated endonuclease Cas2
3628 RJOK01000009.1 GCA003944005_01809 CDS open 10144-11055 _na     303_aa cas1 type II CRISPR-associated endonuclease Cas1
3629 RJOK01000009.1 GCA003944005_01810 CDS open 11216-14593 _na     1125_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
3630 RJOK01000009.1 GCA003944005_01811 CDS open 14817-16088 _na     423_aa Putative transcriptional regulator
3631 RJOK01000009.1 GCA003944005_01812 CDS open 16119-17861 _na     580_aa ABC-type multidrug transport system%2C permease component
3632 RJOK01000009.1 GCA003944005_01813 CDS open 17861-19603 _na     580_aa ABC transporter permease/ATPase
3633 RJOK01000009.1 GCA003944005_01814 CDS open 19699-20370 _na     223_aa mmcQ MmcQ family protein
3634 RJOK01000009.1 GCA003944005_01815 CDS open 20383-21015 _na     210_aa cutC PF03932 family protein CutC
3635 RJOK01000009.1 GCA003944005_01816 CDS open 21774-22298 _na     174_aa niaX Niacin transporter NiaX
3636 RJOK01000009.1 GCA003944005_01817 CDS open 22337-22846 _na     169_aa nadR Transcription repressor NadR
3637 RJOK01000009.1 GCA003944005_01818 CDS open 22906-23145 _na     79_aa khpA RNA-binding protein KhpA
3638 RJOK01000009.1 GCA003944005_01819 CDS open 23165-23437 _na     90_aa rpsP 30S ribosomal protein S16
3639 RJOK01000009.1 GCA003944005_01820 CDS open 23554-25854 _na     766_aa pulA type I pullulanase
3640 RJOK01000009.1 GCA003944005_01821 CDS open 25868-26827 _na     319_aa Diacylglycerol kinase family lipid kinase
3641 RJOK01000009.1 GCA003944005_01822 CDS open 26836-28782 _na     648_aa ligA NAD-dependent DNA ligase LigA
3642 RJOK01000009.1 GCA003944005_01823 CDS open 29099-30046 _na     315_aa 2-dehydropantoate 2-reductase
3643 RJOK01000009.1 GCA003944005_01824 CDS open 30071-31120 _na     349_aa Putative membrane protein%2C putative toxin regulator
3644 RJOK01000009.1 GCA003944005_01825 CDS open 31177-31686 _na     169_aa queT QueT transporter
3645 RJOK01000009.1 GCA003944005_01826 CDS open 31822-32265 _na     147_aa gtrA GtrA family protein
3646 RJOK01000009.1 GCA003944005_01827 CDS open 33022-33729 _na     235_aa B3/B4 tRNA-binding domain-containing protein
3647 RJOK01000009.1 GCA003944005_01828 CDS open 33740-34189 _na     149_aa Transcriptional regulator
3648 RJOK01000009.1 GCA003944005_01829 CDS open 34259-35167 _na     302_aa Putative ribonuclease BN
3649 RJOK01000009.1 GCA003944005_01830 CDS open 35218-36075 _na     285_aa methionyl aminopeptidase
3650 RJOK01000009.1 GCA003944005_01831 CDS open 36100-37377 _na     425_aa spxR CBS-HotDog domain-containing transcription factor SpxR
3651 RJOK01000009.1 GCA003944005_01832 CDS open 37370-37921 _na     183_aa [ribosomal protein uS5]-alanine N-acetyltransferase
3652 RJOK01000009.1 GCA003944005_01833 CDS open 38000-39259 _na     419_aa UDP-N-acetylglucosamine 1-carboxyvinyltransferase
3653 RJOK01000009.1 GCA003944005_01834 CDS open 39596-40786 _na     396_aa metK methionine adenosyltransferase
3654 RJOK01000009.1 GCA003944005_01835 CDS open 41057-42331 _na     424_aa dihydroorotase
3655 RJOK01000009.1 GCA003944005_01836 CDS open 42343-42813 _na     156_aa mutT Mutator MutT protein
3656 RJOK01000009.1 GCA003944005_01837 CDS open 42840-43493 _na     217_aa uracil-DNA glycosylase
3657 RJOK01000009.1 GCA003944005_01838 CDS open 43518-44504 _na     328_aa Gfo family oxidoreductase
3658 RJOK01000009.1 GCA003944005_01839 CDS open 44943-45656 _na     237_aa DUF805 domain-containing protein
3659 RJOK01000009.1 GCA003944005_01840 CDS open 45734-47968 _na     744_aa DNA internalization-related competence protein ComEC/Rec2
3660 RJOK01000009.1 GCA003944005_01841 CDS open 47952-48656 _na     234_aa Putative competance protein
3661 RJOK01000009.1 GCA003944005_01842 CDS open 48824-49291 _na     155_aa smpB SsrA-binding protein SmpB
3662 RJOK01000009.1 GCA003944005_01843 CDS open 49254-51593 _na     779_aa rnr ribonuclease R
3663 RJOK01000009.1 GCA003944005_01844 CDS open 51684-51917 _na     77_aa secG preprotein translocase subunit SecG
3664 RJOK01000009.1 GCA003944005_01845 CDS open 52090-53235 _na     381_aa MFS-type transporter
3665 RJOK01000009.1 GCA003944005_01846 CDS open 53312-53905 _na     197_aa coaE dephospho-CoA kinase
3666 RJOK01000009.1 GCA003944005_01847 CDS open 53909-54733 _na     274_aa mutM DNA-formamidopyrimidine glycosylase
3667 RJOK01000009.1 GCA003944005_01848 CDS open 54871-55311 _na     146_aa ABC-2 family transporter protein
3668 RJOK01000009.1 GCA003944005_01849 CDS open 55355-55714 _na     119_aa MutT/nudix family protein
3669 RJOK01000009.1 GCA003944005_01850 CDS open 55653-55922 _na     89_aa hypothetical protein
3670 RJOK01000009.1 GCA003944005_01851 CDS open 55944-58187 _na     747_aa Serine protease
3671 RJOK01000009.1 GCA003944005_01852 CDS open 58189-59223 _na     344_aa ftsH ATP-dependent zinc metalloprotease FtsH 4
3672 RJOK01000009.1 GCA003944005_01853 CDS open 59780-61216 _na     478_aa recombinase family protein
3673 RJOK01000009.1 GCA003944005_01854 CDS open 61428-62825 _na     465_aa recombinase family protein
3674 RJOK01000009.1 GCA003944005_01855 CDS open 62838-63776 _na     312_aa recombinase family protein
3675 RJOK01000009.1 GCA003944005_01856 CDS open 64082-64345 _na     87_aa transposase
3676 RJOK01000009.1 GCA003944005_01857 CDS open 64366-65229 _na     287_aa IS3 family transposase
3677 RJOK01000009.1 GCA003944005_01858 CDS open 65807-67321 _na     504_aa hypothetical protein
3678 RJOK01000009.1 GCA003944005_01859 CDS open 67483-67674 _na     63_aa hypothetical protein
3679 RJOK01000009.1 GCA003944005_01799 gene open 271-990
3680 RJOK01000009.1 GCA003944005_01800 gene open 987-1277
3681 RJOK01000009.1 GCA003944005_01801 gene open 1292-1699
3682 RJOK01000009.1 GCA003944005_01802 gene open 1808-2575
3683 RJOK01000009.1 GCA003944005_01803 gene open 2562-3413 ylqF
3684 RJOK01000009.1 GCA003944005_01804 gene open 3817-3993 rpsU
3685 RJOK01000009.1 GCA003944005_01805 gene open 4142-4480
3686 RJOK01000009.1 GCA003944005_01806 gene open 4729-7062
3687 RJOK01000009.1 GCA003944005_01807 gene open 8781-9824
3688 RJOK01000009.1 GCA003944005_01808 gene open 9821-10144 cas2
3689 RJOK01000009.1 GCA003944005_01809 gene open 10144-11055 cas1
3690 RJOK01000009.1 GCA003944005_01810 gene open 11216-14593 cas9
3691 RJOK01000009.1 GCA003944005_01811 gene open 14817-16088
3692 RJOK01000009.1 GCA003944005_01812 gene open 16119-17861
3693 RJOK01000009.1 GCA003944005_01813 gene open 17861-19603
3694 RJOK01000009.1 GCA003944005_01814 gene open 19699-20370 mmcQ
3695 RJOK01000009.1 GCA003944005_01815 gene open 20383-21015 cutC
3696 RJOK01000009.1 GCA003944005_01816 gene open 21774-22298 niaX
3697 RJOK01000009.1 GCA003944005_01817 gene open 22337-22846 nadR
3698 RJOK01000009.1 GCA003944005_01818 gene open 22906-23145 khpA
3699 RJOK01000009.1 GCA003944005_01819 gene open 23165-23437 rpsP
3700 RJOK01000009.1 GCA003944005_01820 gene open 23554-25854 pulA
3701 RJOK01000009.1 GCA003944005_01821 gene open 25868-26827
3702 RJOK01000009.1 GCA003944005_01822 gene open 26836-28782 ligA
3703 RJOK01000009.1 GCA003944005_01823 gene open 29099-30046
3704 RJOK01000009.1 GCA003944005_01824 gene open 30071-31120
3705 RJOK01000009.1 GCA003944005_01825 gene open 31177-31686 queT
3706 RJOK01000009.1 GCA003944005_01826 gene open 31822-32265 gtrA
3707 RJOK01000009.1 GCA003944005_01827 gene open 33022-33729
3708 RJOK01000009.1 GCA003944005_01828 gene open 33740-34189
3709 RJOK01000009.1 GCA003944005_01829 gene open 34259-35167
3710 RJOK01000009.1 GCA003944005_01830 gene open 35218-36075
3711 RJOK01000009.1 GCA003944005_01831 gene open 36100-37377 spxR
3712 RJOK01000009.1 GCA003944005_01832 gene open 37370-37921
3713 RJOK01000009.1 GCA003944005_01833 gene open 38000-39259
3714 RJOK01000009.1 GCA003944005_01834 gene open 39596-40786 metK
3715 RJOK01000009.1 GCA003944005_01835 gene open 41057-42331
3716 RJOK01000009.1 GCA003944005_01836 gene open 42343-42813 mutT
3717 RJOK01000009.1 GCA003944005_01837 gene open 42840-43493
3718 RJOK01000009.1 GCA003944005_01838 gene open 43518-44504
3719 RJOK01000009.1 GCA003944005_01839 gene open 44943-45656
3720 RJOK01000009.1 GCA003944005_01840 gene open 45734-47968
3721 RJOK01000009.1 GCA003944005_01841 gene open 47952-48656
3722 RJOK01000009.1 GCA003944005_01842 gene open 48824-49291 smpB
3723 RJOK01000009.1 GCA003944005_01843 gene open 49254-51593 rnr
3724 RJOK01000009.1 GCA003944005_01844 gene open 51684-51917 secG
3725 RJOK01000009.1 GCA003944005_01845 gene open 52090-53235
3726 RJOK01000009.1 GCA003944005_01846 gene open 53312-53905 coaE
3727 RJOK01000009.1 GCA003944005_01847 gene open 53909-54733 mutM
3728 RJOK01000009.1 GCA003944005_01848 gene open 54871-55311
3729 RJOK01000009.1 GCA003944005_01849 gene open 55355-55714
3730 RJOK01000009.1 GCA003944005_01850 gene open 55653-55922
3731 RJOK01000009.1 GCA003944005_01851 gene open 55944-58187
3732 RJOK01000009.1 GCA003944005_01852 gene open 58189-59223 ftsH
3733 RJOK01000009.1 GCA003944005_01853 gene open 59780-61216
3734 RJOK01000009.1 GCA003944005_01854 gene open 61428-62825
3735 RJOK01000009.1 GCA003944005_01855 gene open 62838-63776
3736 RJOK01000009.1 GCA003944005_01856 gene open 64082-64345
3737 RJOK01000009.1 GCA003944005_01857 gene open 64366-65229
3738 RJOK01000009.1 GCA003944005_01858 gene open 65807-67321
3739 RJOK01000009.1 GCA003944005_01859 gene open 67483-67674
3740 RJOK01000010.1 GCA003944005_01872 CDS open 1171-1977 _na     268_aa mreC rod shape-determining protein MreC
3741 RJOK01000010.1 GCA003944005_01873 CDS open 1979-2479 _na     166_aa mreD rod shape-determining protein MreD
3742 RJOK01000010.1 GCA003944005_01874 CDS open 2589-3770 _na     393_aa pcsB peptidoglycan hydrolase PcsB
3743 RJOK01000010.1 GCA003944005_01875 CDS open 3904-4872 _na     322_aa prs1 ribose-phosphate diphosphokinase
3744 RJOK01000010.1 GCA003944005_01876 CDS open 5036-6223 _na     395_aa pyridoxal phosphate-dependent aminotransferase
3745 RJOK01000010.1 GCA003944005_01877 CDS open 6201-6974 _na     257_aa recO DNA repair protein RecO
3746 RJOK01000010.1 GCA003944005_01878 CDS open 6971-7969 _na     332_aa plsX phosphate acyltransferase PlsX
3747 RJOK01000010.1 GCA003944005_01879 CDS open 7966-8211 _na     81_aa Acyl carrier protein
3748 RJOK01000010.1 GCA003944005_01880 CDS open 8357-9064 _na     235_aa purC phosphoribosylaminoimidazolesuccinocarboxamide synthase
3749 RJOK01000010.1 GCA003944005_01881 CDS open 9074-12799 _na     1241_aa purL2 phosphoribosylformylglycinamidine synthase
3750 RJOK01000010.1 GCA003944005_01882 CDS open 12821-12961 _na     46_aa hypothetical protein
3751 RJOK01000010.1 GCA003944005_01883 CDS open 12983-13441 _na     152_aa DNA alkylation repair enzyme
3752 RJOK01000010.1 GCA003944005_01884 CDS open 13467-14906 _na     479_aa purF amidophosphoribosyltransferase
3753 RJOK01000010.1 GCA003944005_01885 CDS open 15158-16177 _na     339_aa purM Phosphoribosylformylglycinamidine cyclo-ligase
3754 RJOK01000010.1 GCA003944005_01886 CDS open 16177-16731 _na     184_aa purN phosphoribosylglycinamide formyltransferase
3755 RJOK01000010.1 GCA003944005_01887 CDS open 16749-17252 _na     167_aa fliG Flagellar motor switch protein FliG C-terminal domain-containing protein
3756 RJOK01000010.1 GCA003944005_01888 CDS open 17448-18995 _na     515_aa purH bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase
3757 RJOK01000010.1 GCA003944005_01889 CDS open 19054-20982 _na     642_aa N-acetylmuramoyl-L-alanine amidase
3758 RJOK01000010.1 GCA003944005_01890 CDS open 21178-22440 _na     420_aa purD Phosphoribosylamine--glycine ligase
3759 RJOK01000010.1 GCA003944005_01891 CDS open 22739-23227 _na     162_aa N5-carboxyaminoimidazole ribonucleotide mutase
3760 RJOK01000010.1 GCA003944005_01892 CDS open 23214-24305 _na     363_aa purK 5-(carboxyamino)imidazole ribonucleotide synthase
3761 RJOK01000010.1 GCA003944005_01893 CDS open 24305-24967 _na     220_aa DUF4760 domain-containing protein
3762 RJOK01000010.1 GCA003944005_01894 CDS open 24983-25210 _na     75_aa Phosphoribosylaminoimidazole carboxylase
3763 RJOK01000010.1 GCA003944005_01895 CDS open 25215-25967 _na     250_aa SMODS-associating 2TM beta-strand rich effector domain-containing protein
3764 RJOK01000010.1 GCA003944005_01896 CDS open 26233-26670 _na     145_aa racX Aspartate racemase
3765 RJOK01000010.1 GCA003944005_01897 CDS open 26764-27375 _na     203_aa CPBP family intramembrane metalloprotease
3766 RJOK01000010.1 GCA003944005_01898 CDS open 27498-29573 _na     691_aa AAA family ATPase
3767 RJOK01000010.1 GCA003944005_01899 CDS open 29570-30352 _na     260_aa hypothetical protein
3768 RJOK01000010.1 GCA003944005_01900 CDS open 30356-31651 _na     431_aa purB adenylosuccinate lyase
3769 RJOK01000010.1 GCA003944005_01901 CDS open 31916-32632 _na     238_aa dasR HTH-type transcriptional repressor DasR
3770 RJOK01000010.1 GCA003944005_01902 CDS open 32795-34582 _na     595_aa Beta-galactosidase
3771 RJOK01000010.1 GCA003944005_01903 CDS open 34579-35055 _na     158_aa Putative phosphotransferase system sugar-specific EIIB component
3772 RJOK01000010.1 GCA003944005_01904 CDS open 35074-35967 _na     297_aa Putative PTS phosphotransferase system sugar-specific EIIC component
3773 RJOK01000010.1 GCA003944005_01905 CDS open 35954-36781 _na     275_aa PTS fructose transporter subunit IID
3774 RJOK01000010.1 GCA003944005_01906 CDS open 36799-37203 _na     134_aa Putative PTS system%2C mannose-specific IIA component
3775 RJOK01000010.1 GCA003944005_01907 CDS open 37355-38524 _na     389_aa Putative sugar isomerase domain protein
3776 RJOK01000010.1 GCA003944005_01908 CDS open 38535-39536 _na     333_aa lacD tagatose-bisphosphate aldolase
3777 RJOK01000010.1 GCA003944005_01909 CDS open 39579-40625 _na     348_aa Aldose 1-epimerase
3778 RJOK01000010.1 GCA003944005_01910 CDS open 40727-41488 _na     253_aa Autolysin
3779 RJOK01000010.1 GCA003944005_01911 CDS open 41744-42895 _na     383_aa ruvB Holliday junction branch migration DNA helicase RuvB
3780 RJOK01000010.1 GCA003944005_01912 CDS open 42901-43467 _na     188_aa Prolyl-tRNA synthetase
3781 RJOK01000010.1 GCA003944005_01913 CDS open 44151-44501 _na     116_aa DNA repair protein
3782 RJOK01000010.1 GCA003944005_01914 CDS open 44633-45232 _na     199_aa lepB signal peptidase I
3783 RJOK01000010.1 GCA003944005_01915 CDS open 45250-49032 _na     1260_aa Cna protein B-type domain protein
3784 RJOK01000010.1 GCA003944005_01916 CDS open 49191-50573 _na     460_aa isopeptide-forming domain-containing fimbrial protein
3785 RJOK01000010.1 GCA003944005_01917 CDS open 50788-51627 _na     279_aa Sortase
3786 RJOK01000010.1 GCA003944005_01918 CDS open 51659-52204 _na     181_aa Class C sortase
3787 RJOK01000010.1 GCA003944005_01919 CDS open 52454-52882 _na     142_aa protein-tyrosine-phosphatase
3788 RJOK01000010.1 GCA003944005_01920 CDS open 52882-53304 _na     140_aa MORN repeat protein
3789 RJOK01000010.1 GCA003944005_01921 CDS open 53294-55111 _na     605_aa Acyltransferase 3 domain-containing protein
3790 RJOK01000010.1 GCA003944005_01922 CDS open 55485-58136 _na     883_aa adhE bifunctional acetaldehyde-CoA/alcohol dehydrogenase
3791 RJOK01000010.1 GCA003944005_01923 CDS open 58435-58725 _na     96_aa ESAT-6-like protein
3792 RJOK01000010.1 GCA003944005_01924 CDS open 58795-59253 _na     152_aa essA type VII secretion protein EssA
3793 RJOK01000010.1 GCA003944005_01925 CDS open 59216-59464 _na     82_aa yukD YukD
3794 RJOK01000010.1 GCA003944005_01926 CDS open 59484-60641 _na     385_aa essB type VII secretion protein EssB
3795 RJOK01000010.1 GCA003944005_01927 CDS open 60589-65082 _na     1497_aa essC type VII secretion protein EssC
3796 RJOK01000010.1 GCA003944005_01928 CDS open 65200-65625 _na     141_aa DUF5082 domain-containing protein
3797 RJOK01000010.1 GCA003944005_01929 CDS open 65640-65918 _na     92_aa hypothetical protein
3798 RJOK01000010.1 GCA003944005_01930 CDS open 65915-66571 _na     218_aa DUF4176 domain-containing protein
3799 RJOK01000010.1 GCA003944005_01872 gene open 1171-1977 mreC
3800 RJOK01000010.1 GCA003944005_01873 gene open 1979-2479 mreD
3801 RJOK01000010.1 GCA003944005_01874 gene open 2589-3770 pcsB
3802 RJOK01000010.1 GCA003944005_01875 gene open 3904-4872 prs1
3803 RJOK01000010.1 GCA003944005_01876 gene open 5036-6223
3804 RJOK01000010.1 GCA003944005_01877 gene open 6201-6974 recO
3805 RJOK01000010.1 GCA003944005_01878 gene open 6971-7969 plsX
3806 RJOK01000010.1 GCA003944005_01879 gene open 7966-8211
3807 RJOK01000010.1 GCA003944005_01880 gene open 8357-9064 purC
3808 RJOK01000010.1 GCA003944005_01881 gene open 9074-12799 purL2
3809 RJOK01000010.1 GCA003944005_01882 gene open 12821-12961
3810 RJOK01000010.1 GCA003944005_01883 gene open 12983-13441
3811 RJOK01000010.1 GCA003944005_01884 gene open 13467-14906 purF
3812 RJOK01000010.1 GCA003944005_01885 gene open 15158-16177 purM
3813 RJOK01000010.1 GCA003944005_01886 gene open 16177-16731 purN
3814 RJOK01000010.1 GCA003944005_01887 gene open 16749-17252 fliG
3815 RJOK01000010.1 GCA003944005_01888 gene open 17448-18995 purH
3816 RJOK01000010.1 GCA003944005_01889 gene open 19054-20982
3817 RJOK01000010.1 GCA003944005_01890 gene open 21178-22440 purD
3818 RJOK01000010.1 GCA003944005_01891 gene open 22739-23227
3819 RJOK01000010.1 GCA003944005_01892 gene open 23214-24305 purK
3820 RJOK01000010.1 GCA003944005_01893 gene open 24305-24967
3821 RJOK01000010.1 GCA003944005_01894 gene open 24983-25210
3822 RJOK01000010.1 GCA003944005_01895 gene open 25215-25967
3823 RJOK01000010.1 GCA003944005_01896 gene open 26233-26670 racX
3824 RJOK01000010.1 GCA003944005_01897 gene open 26764-27375
3825 RJOK01000010.1 GCA003944005_01898 gene open 27498-29573
3826 RJOK01000010.1 GCA003944005_01899 gene open 29570-30352
3827 RJOK01000010.1 GCA003944005_01900 gene open 30356-31651 purB
3828 RJOK01000010.1 GCA003944005_01901 gene open 31916-32632 dasR
3829 RJOK01000010.1 GCA003944005_01902 gene open 32795-34582
3830 RJOK01000010.1 GCA003944005_01903 gene open 34579-35055
3831 RJOK01000010.1 GCA003944005_01904 gene open 35074-35967
3832 RJOK01000010.1 GCA003944005_01905 gene open 35954-36781
3833 RJOK01000010.1 GCA003944005_01906 gene open 36799-37203
3834 RJOK01000010.1 GCA003944005_01907 gene open 37355-38524
3835 RJOK01000010.1 GCA003944005_01908 gene open 38535-39536 lacD
3836 RJOK01000010.1 GCA003944005_01909 gene open 39579-40625
3837 RJOK01000010.1 GCA003944005_01910 gene open 40727-41488
3838 RJOK01000010.1 GCA003944005_01911 gene open 41744-42895 ruvB
3839 RJOK01000010.1 GCA003944005_01912 gene open 42901-43467
3840 RJOK01000010.1 GCA003944005_01913 gene open 44151-44501
3841 RJOK01000010.1 GCA003944005_01914 gene open 44633-45232 lepB
3842 RJOK01000010.1 GCA003944005_01915 gene open 45250-49032
3843 RJOK01000010.1 GCA003944005_01916 gene open 49191-50573
3844 RJOK01000010.1 GCA003944005_01917 gene open 50788-51627
3845 RJOK01000010.1 GCA003944005_01918 gene open 51659-52204
3846 RJOK01000010.1 GCA003944005_01919 gene open 52454-52882
3847 RJOK01000010.1 GCA003944005_01920 gene open 52882-53304
3848 RJOK01000010.1 GCA003944005_01921 gene open 53294-55111
3849 RJOK01000010.1 GCA003944005_01922 gene open 55485-58136 adhE
3850 RJOK01000010.1 GCA003944005_01923 gene open 58435-58725
3851 RJOK01000010.1 GCA003944005_01924 gene open 58795-59253 essA
3852 RJOK01000010.1 GCA003944005_01925 gene open 59216-59464 yukD
3853 RJOK01000010.1 GCA003944005_01926 gene open 59484-60641 essB
3854 RJOK01000010.1 GCA003944005_01927 gene open 60589-65082 essC
3855 RJOK01000010.1 GCA003944005_01928 gene open 65200-65625
3856 RJOK01000010.1 GCA003944005_01929 gene open 65640-65918
3857 RJOK01000010.1 GCA003944005_01930 gene open 65915-66571
3858 RJOK01000010.1 GCA003944005_01860 gene open 3-65 trnG
3859 RJOK01000010.1 GCA003944005_01861 gene open 76-161 trnL
3860 RJOK01000010.1 GCA003944005_01862 gene open 174-247 trnR
3861 RJOK01000010.1 GCA003944005_01863 gene open 286-359 trnP
3862 RJOK01000010.1 GCA003944005_01864 gene open 366-439 trnM
3863 RJOK01000010.1 GCA003944005_01865 gene open 453-526 trnI
3864 RJOK01000010.1 GCA003944005_01866 gene open 541-630 trnS
3865 RJOK01000010.1 GCA003944005_01867 gene open 643-716 trnfM
3866 RJOK01000010.1 GCA003944005_01868 gene open 723-795 trnF
3867 RJOK01000010.1 GCA003944005_01869 gene open 813-883 trnG
3868 RJOK01000010.1 GCA003944005_01870 gene open 919-992 trnI
3869 RJOK01000010.1 GCA003944005_01871 gene open 1002-1089 trnS
3870 RJOK01000010.1 GCA003944005_01860 tRNA open 3-65 trnG tRNA-Gly(gcc)
3871 RJOK01000010.1 GCA003944005_01861 tRNA open 76-161 trnL tRNA-Leu(taa)
3872 RJOK01000010.1 GCA003944005_01862 tRNA open 174-247 trnR tRNA-Arg(acg)
3873 RJOK01000010.1 GCA003944005_01863 tRNA open 286-359 trnP tRNA-Pro(tgg)
3874 RJOK01000010.1 GCA003944005_01864 tRNA open 366-439 trnM tRNA-Met(cat)
3875 RJOK01000010.1 GCA003944005_01865 tRNA open 453-526 trnI tRNA-Ile2(cat)
3876 RJOK01000010.1 GCA003944005_01866 tRNA open 541-630 trnS tRNA-Ser(tga)
3877 RJOK01000010.1 GCA003944005_01867 tRNA open 643-716 trnfM tRNA-fMet(cat)
3878 RJOK01000010.1 GCA003944005_01868 tRNA open 723-795 trnF tRNA-Phe(gaa)
3879 RJOK01000010.1 GCA003944005_01869 tRNA open 813-883 trnG tRNA-Gly(tcc)
3880 RJOK01000010.1 GCA003944005_01870 tRNA open 919-992 trnI tRNA-Ile(gat)
3881 RJOK01000010.1 GCA003944005_01871 tRNA open 1002-1089 trnS tRNA-Ser(gct)
3882 RJOK01000011.1 GCA003944005_01931 CDS open 12-389 _na     125_aa hypothetical protein
3883 RJOK01000011.1 GCA003944005_01932 CDS open 579-1268 _na     229_aa arlR Response regulator ArlR
3884 RJOK01000011.1 GCA003944005_01933 CDS open 1277-2701 _na     474_aa gndA NADP-dependent phosphogluconate dehydrogenase
3885 RJOK01000011.1 GCA003944005_01934 CDS open 2793-3329 _na     178_aa Metal-binding%2C possibly nucleic acid-binding protein
3886 RJOK01000011.1 GCA003944005_01935 CDS open 3517-4743 _na     408_aa Permease
3887 RJOK01000011.1 GCA003944005_01936 CDS open 4846-5742 _na     298_aa htpX zinc metalloprotease HtpX
3888 RJOK01000011.1 GCA003944005_01937 CDS open 5744-6304 _na     186_aa lemA LemA family protein
3889 RJOK01000011.1 GCA003944005_01938 CDS open 6452-7165 _na     237_aa rsmG 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG
3890 RJOK01000011.1 GCA003944005_01939 CDS open 7217-7555 _na     112_aa Glycosyl transferase family 8
3891 RJOK01000011.1 GCA003944005_01940 CDS open 7598-8038 _na     146_aa General stress protein A
3892 RJOK01000011.1 GCA003944005_01941 CDS open 8057-8809 _na     250_aa Putative short chain dehydrogenase
3893 RJOK01000011.1 GCA003944005_01942 CDS open 8842-9678 _na     278_aa ABC transporter permease protein
3894 RJOK01000011.1 GCA003944005_01943 CDS open 9671-11350 _na     559_aa energy-coupling factor transporter ATPase
3895 RJOK01000011.1 GCA003944005_01944 CDS open 11362-12123 _na     253_aa Uridine phosphorylase
3896 RJOK01000011.1 GCA003944005_01945 CDS open 12482-12961 _na     159_aa CAAX amino terminal protease self-immunity
3897 RJOK01000011.1 GCA003944005_01946 CDS open 12975-13460 _na     161_aa DUF6773 domain-containing protein
3898 RJOK01000011.1 GCA003944005_01947 CDS open 13474-13950 _na     158_aa Membrane protein
3899 RJOK01000011.1 GCA003944005_01948 CDS open 13940-14152 _na     70_aa HTH cro/C1-type domain-containing protein
3900 RJOK01000011.1 GCA003944005_01949 CDS open 14136-14342 _na     68_aa Lipoprotein
3901 RJOK01000011.1 GCA003944005_01950 CDS open 14487-15032 _na     181_aa ECF-type riboflavin transporter substrate-binding protein
3902 RJOK01000011.1 GCA003944005_01951 CDS open 15047-15895 _na     282_aa Adenosyl-chloride synthase
3903 RJOK01000011.1 GCA003944005_01931 gene open 12-389
3904 RJOK01000011.1 GCA003944005_01932 gene open 579-1268 arlR
3905 RJOK01000011.1 GCA003944005_01933 gene open 1277-2701 gndA
3906 RJOK01000011.1 GCA003944005_01934 gene open 2793-3329
3907 RJOK01000011.1 GCA003944005_01935 gene open 3517-4743
3908 RJOK01000011.1 GCA003944005_01936 gene open 4846-5742 htpX
3909 RJOK01000011.1 GCA003944005_01937 gene open 5744-6304 lemA
3910 RJOK01000011.1 GCA003944005_01938 gene open 6452-7165 rsmG
3911 RJOK01000011.1 GCA003944005_01939 gene open 7217-7555
3912 RJOK01000011.1 GCA003944005_01940 gene open 7598-8038
3913 RJOK01000011.1 GCA003944005_01941 gene open 8057-8809
3914 RJOK01000011.1 GCA003944005_01942 gene open 8842-9678
3915 RJOK01000011.1 GCA003944005_01943 gene open 9671-11350
3916 RJOK01000011.1 GCA003944005_01944 gene open 11362-12123
3917 RJOK01000011.1 GCA003944005_01945 gene open 12482-12961
3918 RJOK01000011.1 GCA003944005_01946 gene open 12975-13460
3919 RJOK01000011.1 GCA003944005_01947 gene open 13474-13950
3920 RJOK01000011.1 GCA003944005_01948 gene open 13940-14152
3921 RJOK01000011.1 GCA003944005_01949 gene open 14136-14342
3922 RJOK01000011.1 GCA003944005_01950 gene open 14487-15032
3923 RJOK01000011.1 GCA003944005_01951 gene open 15047-15895
3924 RJOK01000011.1 GCA003944005_01952 gene open 16706-16779 trnP
3925 RJOK01000011.1 GCA003944005_01953 gene open 16818-16891 trnR
3926 RJOK01000011.1 GCA003944005_01954 gene open 16949-17022 trnR
3927 RJOK01000011.1 GCA003944005_01955 gene open 17035-17120 trnL
3928 RJOK01000011.1 GCA003944005_01952 tRNA open 16706-16779 trnP tRNA-Pro(tgg)
3929 RJOK01000011.1 GCA003944005_01953 tRNA open 16818-16891 trnR tRNA-Arg(acg)
3930 RJOK01000011.1 GCA003944005_01954 tRNA open 16949-17022 trnR tRNA-Arg(acg)
3931 RJOK01000011.1 GCA003944005_01955 tRNA open 17035-17120 trnL tRNA-Leu(taa)
3932 RJOK01000012.1 GCA003944005_01956 CDS open 118-2058 _na     646_aa condensation domain-containing protein
3933 RJOK01000012.1 GCA003944005_01957 CDS open 2263-4044 _na     593_aa ABC transporter ATP-binding protein
3934 RJOK01000012.1 GCA003944005_01958 CDS open 4045-5814 _na     589_aa ABC transporter ATP-binding protein
3935 RJOK01000012.1 GCA003944005_01959 CDS open 5811-6485 _na     224_aa 4'-phosphopantetheinyl transferase superfamily protein
3936 RJOK01000012.1 GCA003944005_01956 gene open 118-2058
3937 RJOK01000012.1 GCA003944005_01957 gene open 2263-4044
3938 RJOK01000012.1 GCA003944005_01958 gene open 4045-5814
3939 RJOK01000012.1 GCA003944005_01959 gene open 5811-6485
3940 RJOK01000013.1 GCA003944005_01960 CDS open 19-336 _na     105_aa bceA Bacitracin export ATP-binding protein BceA
3941 RJOK01000013.1 GCA003944005_01961 CDS open 317-2296 _na     659_aa yxdM ABC transporter permease protein YxdM
3942 RJOK01000013.1 GCA003944005_01962 CDS open 2445-3311 _na     288_aa drrA Daunorubicin/doxorubicin resistance ATP-binding protein DrrA
3943 RJOK01000013.1 GCA003944005_01963 CDS open 3313-4176 _na     287_aa ABC-2 type transporter transmembrane domain-containing protein
3944 RJOK01000013.1 GCA003944005_01964 CDS open 4203-4658 _na     151_aa HTH LytTR-type domain-containing protein
3945 RJOK01000013.1 GCA003944005_01965 CDS open 4671-5060 _na     129_aa DUF3021 domain-containing protein
3946 RJOK01000013.1 GCA003944005_01966 CDS open 5132-6097 _na     321_aa hypothetical protein
3947 RJOK01000013.1 GCA003944005_01967 CDS open 6528-6623 _na     31_aa hypothetical protein
3948 RJOK01000013.1 GCA003944005_01968 CDS open 6604-6732 _na     42_aa hypothetical protein
3949 RJOK01000013.1 GCA003944005_01960 gene open 19-336 bceA
3950 RJOK01000013.1 GCA003944005_01961 gene open 317-2296 yxdM
3951 RJOK01000013.1 GCA003944005_01962 gene open 2445-3311 drrA
3952 RJOK01000013.1 GCA003944005_01963 gene open 3313-4176
3953 RJOK01000013.1 GCA003944005_01964 gene open 4203-4658
3954 RJOK01000013.1 GCA003944005_01965 gene open 4671-5060
3955 RJOK01000013.1 GCA003944005_01966 gene open 5132-6097
3956 RJOK01000013.1 GCA003944005_01967 gene open 6528-6623
3957 RJOK01000013.1 GCA003944005_01968 gene open 6604-6732
3958 RJOK01000014.1 GCA003944005_01969 CDS open 208-558 _na     116_aa Phage protein
3959 RJOK01000014.1 GCA003944005_01970 CDS open 837-1028 _na     63_aa hypothetical protein
3960 RJOK01000014.1 GCA003944005_01971 CDS open 1162-1491 _na     109_aa Phage protein
3961 RJOK01000014.1 GCA003944005_01972 CDS open 1495-1830 _na     111_aa Immunity protein 35 domain-containing protein
3962 RJOK01000014.1 GCA003944005_01973 CDS open 2138-2467 _na     109_aa Immunity protein 59
3963 RJOK01000014.1 GCA003944005_01974 CDS open 2464-4011 _na     515_aa TNT domain-containing protein
3964 RJOK01000014.1 GCA003944005_01969 gene open 208-558
3965 RJOK01000014.1 GCA003944005_01970 gene open 837-1028
3966 RJOK01000014.1 GCA003944005_01971 gene open 1162-1491
3967 RJOK01000014.1 GCA003944005_01972 gene open 1495-1830
3968 RJOK01000014.1 GCA003944005_01973 gene open 2138-2467
3969 RJOK01000014.1 GCA003944005_01974 gene open 2464-4011
3970 RJOK01000015.1 GCA003944005_01975 CDS open 28-393 _na     121_aa Phage protein
3971 RJOK01000015.1 GCA003944005_01976 CDS open 413-763 _na     116_aa DUF3601 domain-containing protein
3972 RJOK01000015.1 GCA003944005_01977 CDS open 750-1376 _na     208_aa hypothetical protein
3973 RJOK01000015.1 GCA003944005_01978 CDS open 1511-1678 _na     55_aa hypothetical protein
3974 RJOK01000015.1 GCA003944005_01979 CDS open 1805-1981 _na     58_aa hypothetical protein
3975 RJOK01000015.1 GCA003944005_01980 CDS open 1968-2243 _na     91_aa hypothetical protein
3976 RJOK01000015.1 GCA003944005_01981 CDS open 2240-2791 _na     183_aa hypothetical protein
3977 RJOK01000015.1 GCA003944005_01982 CDS open 3039-3353 _na     104_aa DUF3601 domain-containing protein
3978 RJOK01000015.1 GCA003944005_01983 CDS open 3727-3972 _na     81_aa Imm59 family immunity protein
3979 RJOK01000015.1 GCA003944005_01984 CDS open 4293-4625 _na     110_aa Immunity protein 59
3980 RJOK01000015.1 GCA003944005_01985 CDS open 4622-5314 _na     230_aa glycohydrolase toxin TNT-related protein
3981 RJOK01000015.1 GCA003944005_01986 CDS open 5360-5710 _na     116_aa Phage protein
3982 RJOK01000015.1 GCA003944005_01987 CDS open 5730-6080 _na     116_aa DUF3601 domain-containing protein
3983 RJOK01000015.1 GCA003944005_01988 CDS open 6067-6429 _na     120_aa hypothetical protein
3984 RJOK01000015.1 GCA003944005_01975 gene open 28-393
3985 RJOK01000015.1 GCA003944005_01976 gene open 413-763
3986 RJOK01000015.1 GCA003944005_01977 gene open 750-1376
3987 RJOK01000015.1 GCA003944005_01978 gene open 1511-1678
3988 RJOK01000015.1 GCA003944005_01979 gene open 1805-1981
3989 RJOK01000015.1 GCA003944005_01980 gene open 1968-2243
3990 RJOK01000015.1 GCA003944005_01981 gene open 2240-2791
3991 RJOK01000015.1 GCA003944005_01982 gene open 3039-3353
3992 RJOK01000015.1 GCA003944005_01983 gene open 3727-3972
3993 RJOK01000015.1 GCA003944005_01984 gene open 4293-4625
3994 RJOK01000015.1 GCA003944005_01985 gene open 4622-5314
3995 RJOK01000015.1 GCA003944005_01986 gene open 5360-5710
3996 RJOK01000015.1 GCA003944005_01987 gene open 5730-6080
3997 RJOK01000015.1 GCA003944005_01988 gene open 6067-6429
3998 RJOK01000016.1 GCA003944005_01989 CDS open 2-1546 _na     514_aa T7SS effector LXG polymorphic toxin
3999 RJOK01000016.1 GCA003944005_01990 CDS open 1552-2460 _na     302_aa DUF975 domain-containing protein
4000 RJOK01000016.1 GCA003944005_01991 CDS open 2447-2746 _na     99_aa DUF4176 domain-containing protein