HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Streptococcus cristatus (GCA_003944305.1)

Select a Genome:
BAKTA Annotations for GCA_003944305.1
Genome Selected: Streptococcus cristatus
ContigsBases CDSrRNA tmRNAtRNA
68 2294401 2239 6 1 47
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4636 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:4]    |    Number of Records Found: 4636 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1501 RJPO01000003.1 GCA003944305_00732 gene open 131996-133342 glnA
1502 RJPO01000003.1 GCA003944305_00733 gene open 133373-133738
1503 RJPO01000003.1 GCA003944305_00734 gene open 133815-134339
1504 RJPO01000003.1 GCA003944305_00735 gene open 134771-135970 pgk
1505 RJPO01000003.1 GCA003944305_00736 gene open 136082-136189
1506 RJPO01000003.1 GCA003944305_00737 gene open 136216-137223 gap
1507 RJPO01000003.1 GCA003944305_00738 gene open 137462-139540 fusA
1508 RJPO01000003.1 GCA003944305_00739 gene open 139819-140289 rpsG
1509 RJPO01000003.1 GCA003944305_00740 gene open 140309-140722 rpsL
1510 RJPO01000003.1 GCA003944305_00741 gene open 141026-141643
1511 RJPO01000003.1 GCA003944305_00742 gene open 141659-142450 purR
1512 RJPO01000003.1 GCA003944305_00743 gene open 142675-143619
1513 RJPO01000003.1 GCA003944305_00744 gene open 143609-144865 rmuC
1514 RJPO01000003.1 GCA003944305_00745 gene open 144867-145499
1515 RJPO01000003.1 GCA003944305_00746 gene open 145492-146151 rpe
1516 RJPO01000003.1 GCA003944305_00747 gene open 146166-147044 rsgA
1517 RJPO01000003.1 GCA003944305_00749 gene open 147344-148216 rsmA
1518 RJPO01000003.1 GCA003944305_00750 gene open 148213-148548
1519 RJPO01000003.1 GCA003944305_00751 gene open 148766-149620
1520 RJPO01000003.1 GCA003944305_00752 gene open 149632-150201 rnmV
1521 RJPO01000003.1 GCA003944305_00753 gene open 150348-150689
1522 RJPO01000003.1 GCA003944305_00754 gene open 150700-151482 tatD
1523 RJPO01000003.1 GCA003944305_00755 gene open 151617-152756
1524 RJPO01000003.1 GCA003944305_00756 gene open 152823-153086
1525 RJPO01000003.1 GCA003944305_00757 gene open 153083-154456
1526 RJPO01000003.1 GCA003944305_00758 gene open 155021-155563
1527 RJPO01000003.1 GCA003944305_00759 gene open 155563-155901
1528 RJPO01000003.1 GCA003944305_00760 gene open 156053-157282
1529 RJPO01000003.1 GCA003944305_00761 gene open 157401-157826
1530 RJPO01000003.1 GCA003944305_00762 gene open 157848-158786
1531 RJPO01000003.1 GCA003944305_00763 gene open 158932-159264 puuR
1532 RJPO01000003.1 GCA003944305_00764 gene open 159302-160252
1533 RJPO01000003.1 GCA003944305_00641 gene open 40846-40918 trnT
1534 RJPO01000003.1 GCA003944305_00748 gene open 147144-147226 trnL
1535 RJPO01000003.1 GCA003944305_00641 tRNA open 40846-40918 trnT tRNA-Thr(cgt)
1536 RJPO01000003.1 GCA003944305_00748 tRNA open 147144-147226 trnL tRNA-Leu(cag)
1537 RJPO01000004.1 GCA003944305_00948 gene open 199378-199483 SSRC10
1538 RJPO01000004.1 GCA003944305_00948 ncRNA open 199378-199483 Streptococcus sRNA 10
1539 RJPO01000004.1 regulatory_region open 21761-21916 M-box riboswitch aptamer (ykoK leader)
1540 RJPO01000004.1 repeat_region open 142944-143848 CRISPR array with 14 repeats of length 36%2C consensus sequence GTTTTTGTACTCTCAAGATTTAAGTAACTGTACAAC and spacer length 30
1541 RJPO01000004.1 GCA003944305_00769 CDS open 640-1770 _na     376_aa yjbE YjbE family integral membrane protein
1542 RJPO01000004.1 GCA003944305_00770 CDS open 1789-3513 _na     574_aa tcaA TcaA second domain-containing protein
1543 RJPO01000004.1 GCA003944305_00771 CDS open 3523-4305 _na     260_aa ldcB LD-carboxypeptidase LdcB/DacB
1544 RJPO01000004.1 GCA003944305_00772 CDS open 4505-5299 _na     264_aa Peptidyl-prolyl cis-trans isomerase
1545 RJPO01000004.1 GCA003944305_00773 CDS open 5355-5774 _na     139_aa Nudix hydrolase family protein
1546 RJPO01000004.1 GCA003944305_00774 CDS open 6342-6524 _na     60_aa pspC DNA-binding transcriptional activator PspC
1547 RJPO01000004.1 GCA003944305_00775 CDS open 6596-8893 _na     765_aa ftsK DNA translocase FtsK
1548 RJPO01000004.1 GCA003944305_00776 CDS open 8999-9385 _na     128_aa Lactoylglutathione lyase
1549 RJPO01000004.1 GCA003944305_00777 CDS open 9487-9834 _na     115_aa DUF3397 domain-containing protein
1550 RJPO01000004.1 GCA003944305_00778 CDS open 9984-10409 _na     141_aa Large ribosomal subunit protein uL11
1551 RJPO01000004.1 GCA003944305_00779 CDS open 10507-11196 _na     229_aa rplA 50S ribosomal protein L1
1552 RJPO01000004.1 GCA003944305_00780 CDS open 11217-11381 _na     54_aa hypothetical protein
1553 RJPO01000004.1 GCA003944305_00781 CDS open 11326-12774 _na     482_aa Amino acid permease family protein
1554 RJPO01000004.1 GCA003944305_00782 CDS open 13086-14021 _na     311_aa ppaC manganese-dependent inorganic pyrophosphatase
1555 RJPO01000004.1 GCA003944305_00783 CDS open 14108-14620 _na     170_aa UDP-N-acetylmuramoylalanyl-D-glutamate--2%2C 6-diaminopimelate ligase
1556 RJPO01000004.1 GCA003944305_00784 CDS open 14613-15266 _na     217_aa DUF1803 domain-containing protein
1557 RJPO01000004.1 GCA003944305_00785 CDS open 15363-16112 _na     249_aa CAAX amino terminal protease self-immunity
1558 RJPO01000004.1 GCA003944305_00786 CDS open 16136-17581 _na     481_aa UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L-lysine ligase
1559 RJPO01000004.1 GCA003944305_00787 CDS open 17668-19296 _na     542_aa Membrane protein involved in the export of O-antigen%2C teichoic acid lipoteichoic acid
1560 RJPO01000004.1 GCA003944305_00788 CDS open 19446-20540 _na     364_aa cystathionine gamma-synthase
1561 RJPO01000004.1 GCA003944305_00789 CDS open 20542-21708 _na     388_aa cysteine-S-conjugate beta-lyase
1562 RJPO01000004.1 GCA003944305_00790 CDS open 22065-22676 _na     203_aa Glutathione S-transferase%2C theta
1563 RJPO01000004.1 GCA003944305_00791 CDS open 22834-25494 _na     886_aa mgtA magnesium-translocating P-type ATPase
1564 RJPO01000004.1 GCA003944305_00792 CDS open 25558-27021 _na     487_aa zwf glucose-6-phosphate dehydrogenase
1565 RJPO01000004.1 GCA003944305_00793 CDS open 27143-28507 _na     454_aa emrB Multidrug export protein EmrB
1566 RJPO01000004.1 GCA003944305_00794 CDS open 28701-29516 _na     271_aa TIGR03943 family putative permease subunit
1567 RJPO01000004.1 GCA003944305_00795 CDS open 29513-30418 _na     301_aa Permease
1568 RJPO01000004.1 GCA003944305_00796 CDS open 30415-30552 _na     45_aa dpnI Type II restriction endonuclease DpnI
1569 RJPO01000004.1 GCA003944305_00797 CDS open 30723-32855 _na     710_aa S1 motif domain-containing protein
1570 RJPO01000004.1 GCA003944305_00798 CDS open 32842-33291 _na     149_aa sprT SprT family protein
1571 RJPO01000004.1 GCA003944305_00799 CDS open 33394-33666 _na     90_aa pspC DNA-binding transcriptional activator PspC
1572 RJPO01000004.1 GCA003944305_00800 CDS open 33939-34373 _na     144_aa Preprotein translocase
1573 RJPO01000004.1 GCA003944305_00801 CDS open 34421-34912 _na     163_aa NTP pyrophosphohydrolase
1574 RJPO01000004.1 GCA003944305_00802 CDS open 35056-35991 _na     311_aa hprK HPr(Ser) kinase/phosphatase
1575 RJPO01000004.1 GCA003944305_00803 CDS open 35984-36763 _na     259_aa lgt prolipoprotein diacylglyceryl transferase
1576 RJPO01000004.1 GCA003944305_00804 CDS open 36776-37171 _na     131_aa General stress protein
1577 RJPO01000004.1 GCA003944305_00805 CDS open 37187-37618 _na     143_aa YtxH-like protein
1578 RJPO01000004.1 GCA003944305_00806 CDS open 37799-38641 _na     280_aa Peptidase C39-like domain-containing protein
1579 RJPO01000004.1 GCA003944305_00807 CDS open 38693-38980 _na     95_aa DUF3270 domain-containing protein
1580 RJPO01000004.1 GCA003944305_00808 CDS open 39110-40039 _na     309_aa yhbU Putative protease YhbU
1581 RJPO01000004.1 GCA003944305_00809 CDS open 40169-40732 _na     187_aa Tetracycline repressor protein class H
1582 RJPO01000004.1 GCA003944305_00810 CDS open 40875-41576 _na     233_aa Lipoprotein ABC superfamily ATP binding cassette transporter%2C ABC protein
1583 RJPO01000004.1 GCA003944305_00811 CDS open 41578-44301 _na     907_aa Chromosome partition protein Smc
1584 RJPO01000004.1 GCA003944305_00812 CDS open 44392-45240 _na     282_aa Ser/Thr protein phosphatase
1585 RJPO01000004.1 GCA003944305_00813 CDS open 45297-45746 _na     149_aa ywnA HTH-type transcriptional regulator YwnA
1586 RJPO01000004.1 GCA003944305_00814 CDS open 45975-46832 _na     285_aa Catechol-2%2C3-dioxygenase
1587 RJPO01000004.1 GCA003944305_00815 CDS open 46795-47373 _na     192_aa 6-O-methylguanine-DNA methyltransferase%2C putative
1588 RJPO01000004.1 GCA003944305_00816 CDS open 47426-48508 _na     360_aa Proline dipeptidase%2C putative
1589 RJPO01000004.1 GCA003944305_00817 CDS open 48771-49472 _na     233_aa yycF response regulator YycF
1590 RJPO01000004.1 GCA003944305_00818 CDS open 49465-50829 _na     454_aa vicK cell wall metabolism sensor histidine kinase VicK
1591 RJPO01000004.1 GCA003944305_00819 CDS open 50822-51622 _na     266_aa Beta-lactamase superfamily I metal-dependent hydrolase
1592 RJPO01000004.1 GCA003944305_00820 CDS open 51935-52294 _na     119_aa ybaN Inner membrane protein YbaN
1593 RJPO01000004.1 GCA003944305_00821 CDS open 52440-53129 _na     229_aa rnc ribonuclease III
1594 RJPO01000004.1 GCA003944305_00822 CDS open 53129-56665 _na     1178_aa smc chromosome segregation protein SMC
1595 RJPO01000004.1 GCA003944305_00823 CDS open 56694-57461 _na     255_aa Cof-type HAD-IIB family hydrolase
1596 RJPO01000004.1 GCA003944305_00824 CDS open 57461-58279 _na     272_aa Haloacid dehalogenase
1597 RJPO01000004.1 GCA003944305_00825 CDS open 58283-59809 _na     508_aa ftsY signal recognition particle-docking protein FtsY
1598 RJPO01000004.1 GCA003944305_00826 CDS open 59966-60595 _na     209_aa upp uracil phosphoribosyltransferase
1599 RJPO01000004.1 GCA003944305_00827 CDS open 60766-61356 _na     196_aa clpP ATP-dependent Clp protease proteolytic subunit
1600 RJPO01000004.1 GCA003944305_00828 CDS open 61444-61713 _na     89_aa DUF2129 domain-containing protein
1601 RJPO01000004.1 GCA003944305_00829 CDS open 61813-62973 _na     386_aa Branched-chain amino acid ABC transporter substrate-binding protein
1602 RJPO01000004.1 GCA003944305_00830 CDS open 63113-63994 _na     293_aa Branched-chain amino acid ABC transporter permease
1603 RJPO01000004.1 GCA003944305_00831 CDS open 63998-64951 _na     317_aa Branched-chain amino acid ABC transporter permease
1604 RJPO01000004.1 GCA003944305_00832 CDS open 64951-65715 _na     254_aa livG ATP-binding cassette domain-containing protein
1605 RJPO01000004.1 GCA003944305_00833 CDS open 65715-66425 _na     236_aa livF ABC transporter%2C ATP-binding protein
1606 RJPO01000004.1 GCA003944305_00834 CDS open 67187-68029 _na     280_aa ADP-dependent (S)-NAD(P)H-hydrate dehydratase
1607 RJPO01000004.1 GCA003944305_00835 CDS open 68251-68472 _na     73_aa HTH cro/C1-type domain-containing protein
1608 RJPO01000004.1 GCA003944305_00836 CDS open 68576-69916 _na     446_aa xseA exodeoxyribonuclease VII large subunit
1609 RJPO01000004.1 GCA003944305_00837 CDS open 69894-70106 _na     70_aa exodeoxyribonuclease VII small subunit
1610 RJPO01000004.1 GCA003944305_00838 CDS open 70103-70978 _na     291_aa Octaprenyl-diphosphate synthase
1611 RJPO01000004.1 GCA003944305_00839 CDS open 70971-71795 _na     274_aa Ribosomal RNA large subunit methyltransferase J
1612 RJPO01000004.1 GCA003944305_00840 CDS open 71779-72210 _na     143_aa Arginine repressor
1613 RJPO01000004.1 GCA003944305_00841 CDS open 72219-73877 _na     552_aa recN DNA repair protein RecN
1614 RJPO01000004.1 GCA003944305_00842 CDS open 73930-74658 _na     242_aa Serine/threonine protein phosphatase%2C putative
1615 RJPO01000004.1 GCA003944305_00843 CDS open 74948-81991 _na     2347_aa Translation initiation factor IF-1A
1616 RJPO01000004.1 GCA003944305_00844 CDS open 81988-82539 _na     183_aa SHIRT domain-containing protein
1617 RJPO01000004.1 GCA003944305_00845 CDS open 82725-83558 _na     277_aa degV DegV domain-containing protein
1618 RJPO01000004.1 GCA003944305_00846 CDS open 83669-83944 _na     91_aa hupA DNA-binding protein HU-beta
1619 RJPO01000004.1 GCA003944305_00847 CDS open 84141-84842 _na     233_aa DUF4947 domain-containing protein
1620 RJPO01000004.1 GCA003944305_00848 CDS open 84913-86184 _na     423_aa TRZ/ATZ family protein
1621 RJPO01000004.1 GCA003944305_00849 CDS open 86306-87499 _na     397_aa Oxalate:formate antiporter
1622 RJPO01000004.1 GCA003944305_00850 CDS open 87841-88293 _na     150_aa Transcriptional repressor
1623 RJPO01000004.1 GCA003944305_00851 CDS open 88445-89137 _na     230_aa gpmA phosphoglycerate mutase
1624 RJPO01000004.1 GCA003944305_00852 CDS open 89279-91324 _na     681_aa pbp2b penicillin-binding protein PBP2B
1625 RJPO01000004.1 GCA003944305_00853 CDS open 91378-91974 _na     198_aa recR recombination mediator RecR
1626 RJPO01000004.1 GCA003944305_00854 CDS open 92123-93169 _na     348_aa D-alanine--D-alanine ligase
1627 RJPO01000004.1 GCA003944305_00855 CDS open 93274-94647 _na     457_aa UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase
1628 RJPO01000004.1 GCA003944305_00856 CDS open 94634-95245 _na     203_aa Mutator protein
1629 RJPO01000004.1 GCA003944305_00857 CDS open 95439-96131 _na     230_aa Putative Membrane protein
1630 RJPO01000004.1 GCA003944305_00858 CDS open 96240-96920 _na     226_aa Integral membrane protein
1631 RJPO01000004.1 GCA003944305_00859 CDS open 97016-97180 _na     54_aa hypothetical protein
1632 RJPO01000004.1 GCA003944305_00860 CDS open 97216-98760 _na     514_aa prfC peptide chain release factor 3
1633 RJPO01000004.1 GCA003944305_00861 CDS open 99173-100084 _na     303_aa corA Magnesium and cobalt transport protein CorA
1634 RJPO01000004.1 GCA003944305_00862 CDS open 100264-101157 _na     297_aa Sodium ABC transporter ATP-binding protein
1635 RJPO01000004.1 GCA003944305_00863 CDS open 101154-102368 _na     404_aa Sodium ABC transporter permease
1636 RJPO01000004.1 GCA003944305_00864 CDS open 102498-103223 _na     241_aa pyrH UMP kinase
1637 RJPO01000004.1 GCA003944305_00865 CDS open 103242-103799 _na     185_aa frr ribosome recycling factor
1638 RJPO01000004.1 GCA003944305_00866 CDS open 103899-104753 _na     284_aa cvfB RNA-binding virulence regulatory protein CvfB
1639 RJPO01000004.1 GCA003944305_00867 CDS open 104754-104969 _na     71_aa UPF0346 protein SSA_1617
1640 RJPO01000004.1 GCA003944305_00868 CDS open 105061-106059 _na     332_aa PhoH-like protein
1641 RJPO01000004.1 GCA003944305_00869 CDS open 106122-107087 _na     321_aa nrdF class 1b ribonucleoside-diphosphate reductase subunit beta
1642 RJPO01000004.1 GCA003944305_00870 CDS open 107221-109380 _na     719_aa nrdE class 1b ribonucleoside-diphosphate reductase subunit alpha
1643 RJPO01000004.1 GCA003944305_00871 CDS open 109475-109693 _na     72_aa nrdH Glutaredoxin-like protein NrdH
1644 RJPO01000004.1 GCA003944305_00872 CDS open 110136-110399 _na     87_aa ptsH phosphocarrier protein HPr
1645 RJPO01000004.1 GCA003944305_00873 CDS open 110404-112137 _na     577_aa ptsI Phosphoenolpyruvate-protein phosphotransferase
1646 RJPO01000004.1 GCA003944305_00874 CDS open 112372-113796 _na     474_aa NADP-dependent glyceraldehyde-3-phosphate dehydrogenase%2C putative
1647 RJPO01000004.1 GCA003944305_00875 CDS open 114185-116098 _na     637_aa glgB 1%2C4-alpha-glucan branching protein GlgB
1648 RJPO01000004.1 GCA003944305_00876 CDS open 116102-117244 _na     380_aa glgC glucose-1-phosphate adenylyltransferase
1649 RJPO01000004.1 GCA003944305_00877 CDS open 117234-118373 _na     379_aa glgD glucose-1-phosphate adenylyltransferase subunit GlgD
1650 RJPO01000004.1 GCA003944305_00878 CDS open 118370-119800 _na     476_aa glgA glycogen synthase GlgA
1651 RJPO01000004.1 GCA003944305_00879 CDS open 119934-122330 _na     798_aa Alpha-1%2C4 glucan phosphorylase
1652 RJPO01000004.1 GCA003944305_00880 CDS open 122473-122973 _na     166_aa Phosphatidylglycerophosphatase B
1653 RJPO01000004.1 GCA003944305_00881 CDS open 123123-124064 _na     313_aa manA mannose-6-phosphate isomerase%2C class I
1654 RJPO01000004.1 GCA003944305_00882 CDS open 124407-125576 _na     389_aa Permease
1655 RJPO01000004.1 GCA003944305_00883 CDS open 125569-126798 _na     409_aa Tetratricopeptide repeat protein
1656 RJPO01000004.1 GCA003944305_00884 CDS open 126898-127203 _na     101_aa DUF4298 domain-containing protein
1657 RJPO01000004.1 GCA003944305_00885 CDS open 127356-128105 _na     249_aa Histidinol-phosphatase
1658 RJPO01000004.1 GCA003944305_00886 CDS open 128220-128939 _na     239_aa budA acetolactate decarboxylase
1659 RJPO01000004.1 GCA003944305_00887 CDS open 129107-130756 _na     549_aa fbpA Rqc2 family fibronectin-binding protein FbpA
1660 RJPO01000004.1 GCA003944305_00888 CDS open 131285-132292 _na     335_aa trpX tryptophan ABC transporter substrate-binding protein
1661 RJPO01000004.1 GCA003944305_00889 CDS open 132605-133651 _na     348_aa pheS phenylalanine--tRNA ligase subunit alpha
1662 RJPO01000004.1 GCA003944305_00890 CDS open 133818-134330 _na     170_aa Protease synthase and sporulation negative regulatory protein PAI 1
1663 RJPO01000004.1 GCA003944305_00891 CDS open 134365-136878 _na     837_aa pheT phenylalanine--tRNA ligase subunit beta
1664 RJPO01000004.1 GCA003944305_00892 CDS open 137032-140424 _na     1130_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
1665 RJPO01000004.1 GCA003944305_00893 CDS open 140636-141508 _na     290_aa cas1 type II CRISPR-associated endonuclease Cas1
1666 RJPO01000004.1 GCA003944305_00894 CDS open 141525-141833 _na     102_aa cas2 CRISPR-associated endonuclease Cas2
1667 RJPO01000004.1 GCA003944305_00895 CDS open 141830-142873 _na     347_aa CRISPR-associated protein Cas7
1668 RJPO01000004.1 GCA003944305_00896 CDS open 143974-144390 _na     138_aa DUF1722 domain-containing protein
1669 RJPO01000004.1 GCA003944305_00897 CDS open 144551-144982 _na     143_aa SP_0198 family lipoprotein
1670 RJPO01000004.1 GCA003944305_00898 CDS open 145254-146315 _na     353_aa hrtB Putative hemin transport system permease protein HrtB
1671 RJPO01000004.1 GCA003944305_00899 CDS open 146316-146981 _na     221_aa hrtA Putative hemin import ATP-binding protein HrtA
1672 RJPO01000004.1 GCA003944305_00900 CDS open 147276-148856 _na     526_aa mnmE tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE
1673 RJPO01000004.1 GCA003944305_00901 CDS open 148891-149508 _na     205_aa CD20-like family protein
1674 RJPO01000004.1 GCA003944305_00902 CDS open 149735-150412 _na     225_aa rpiA ribose-5-phosphate isomerase RpiA
1675 RJPO01000004.1 GCA003944305_00903 CDS open 150426-151637 _na     403_aa deoB phosphopentomutase
1676 RJPO01000004.1 GCA003944305_00904 CDS open 151664-152476 _na     270_aa purine-nucleoside phosphorylase
1677 RJPO01000004.1 GCA003944305_00905 CDS open 152636-153343 _na     235_aa deoD purine-nucleoside phosphorylase
1678 RJPO01000004.1 GCA003944305_00906 CDS open 153346-154122 _na     258_aa Csm6 HEPN domain-containing protein
1679 RJPO01000004.1 GCA003944305_00907 CDS open 154115-154846 _na     243_aa NAD-dependent protein deacylase
1680 RJPO01000004.1 GCA003944305_00908 CDS open 154896-155804 _na     302_aa lysR HTH lysR-type domain-containing protein
1681 RJPO01000004.1 GCA003944305_00909 CDS open 155992-156798 _na     268_aa dihydroorotate dehydrogenase electron transfer subunit
1682 RJPO01000004.1 GCA003944305_00910 CDS open 156811-157749 _na     312_aa dihydroorotate dehydrogenase
1683 RJPO01000004.1 GCA003944305_00911 CDS open 157953-158645 _na     230_aa pyrF orotidine-5'-phosphate decarboxylase
1684 RJPO01000004.1 GCA003944305_00912 CDS open 158713-159342 _na     209_aa pyrE Orotate phosphoribosyltransferase
1685 RJPO01000004.1 GCA003944305_00913 CDS open 159455-160993 _na     512_aa Glycosyltransferase RgtA/B/C/D-like domain-containing protein
1686 RJPO01000004.1 GCA003944305_00914 CDS open 160990-161742 _na     250_aa DUF4336 domain-containing protein
1687 RJPO01000004.1 GCA003944305_00915 CDS open 161794-162426 _na     210_aa hypothetical protein
1688 RJPO01000004.1 GCA003944305_00916 CDS open 162437-163090 _na     217_aa ung uracil-DNA glycosylase
1689 RJPO01000004.1 GCA003944305_00917 CDS open 163099-163563 _na     154_aa mutX 8-oxo-dGTP diphosphatase
1690 RJPO01000004.1 GCA003944305_00918 CDS open 163576-164844 _na     422_aa dihydroorotase
1691 RJPO01000004.1 GCA003944305_00919 CDS open 164985-167243 _na     752_aa nt5e cell surface ecto-5'-nucleotidase Nt5e
1692 RJPO01000004.1 GCA003944305_00920 CDS open 167425-168069 _na     214_aa plsY glycerol-3-phosphate 1-O-acyltransferase PlsY
1693 RJPO01000004.1 GCA003944305_00921 CDS open 168292-170235 _na     647_aa parE DNA topoisomerase IV subunit B
1694 RJPO01000004.1 GCA003944305_00922 CDS open 170248-170700 _na     150_aa Glycosyltransferase
1695 RJPO01000004.1 GCA003944305_00923 CDS open 170829-171647 _na     272_aa Aminoglycoside 6-adenylyltransferase
1696 RJPO01000004.1 GCA003944305_00924 CDS open 171901-174315 _na     804_aa parC DNA topoisomerase IV subunit A
1697 RJPO01000004.1 GCA003944305_00925 CDS open 174456-175481 _na     341_aa branched-chain amino acid aminotransferase
1698 RJPO01000004.1 GCA003944305_00926 CDS open 175575-175805 _na     76_aa Branched-chain amino acid aminotransferase
1699 RJPO01000004.1 GCA003944305_00929 CDS open 176180-177382 _na     400_aa rpsA 30S ribosomal protein S1
1700 RJPO01000004.1 GCA003944305_00930 CDS open 177552-178271 _na     239_aa Matrixin
1701 RJPO01000004.1 GCA003944305_00931 CDS open 178276-178641 _na     121_aa Phosphatase PAP2 family protein
1702 RJPO01000004.1 GCA003944305_00932 CDS open 179067-179900 _na     277_aa licT Transcription antiterminator LicT
1703 RJPO01000004.1 GCA003944305_00933 CDS open 179925-180242 _na     105_aa PTS system lactose-specific EIIA component
1704 RJPO01000004.1 GCA003944305_00934 CDS open 180242-181948 _na     568_aa lactose-specific PTS transporter subunit EIIC
1705 RJPO01000004.1 GCA003944305_00935 CDS open 182180-183586 _na     468_aa lacG 6-phospho-beta-galactosidase
1706 RJPO01000004.1 GCA003944305_00936 CDS open 183789-185720 _na     643_aa abc-f ribosomal protection-like ABC-F family protein
1707 RJPO01000004.1 GCA003944305_00937 CDS open 186201-187064 _na     287_aa rggC Transcriptional regulator RggC
1708 RJPO01000004.1 GCA003944305_00938 CDS open 187143-188321 _na     392_aa FMN adenylyltransferase
1709 RJPO01000004.1 GCA003944305_00939 CDS open 188577-188981 _na     134_aa paaI Acyl-coenzyme A thioesterase PaaI
1710 RJPO01000004.1 GCA003944305_00940 CDS open 188962-189723 _na     253_aa yihX Alpha-D-glucose-1-phosphate phosphatase YihX
1711 RJPO01000004.1 GCA003944305_00941 CDS open 189882-190640 _na     252_aa tpiA triose-phosphate isomerase
1712 RJPO01000004.1 GCA003944305_00942 CDS open 190705-194202 _na     1165_aa Lysozyme
1713 RJPO01000004.1 GCA003944305_00943 CDS open 194234-195469 _na     411_aa femA Aminoacyltransferase FemA
1714 RJPO01000004.1 GCA003944305_00944 CDS open 195484-196698 _na     404_aa Serine/alanine adding enzyme
1715 RJPO01000004.1 GCA003944305_00945 CDS open 196698-197507 _na     269_aa yidA sugar-phosphatase
1716 RJPO01000004.1 GCA003944305_00946 CDS open 197509-198810 _na     433_aa HD/PDEase domain-containing protein
1717 RJPO01000004.1 GCA003944305_00947 CDS open 198928-199317 _na     129_aa DUF1934 domain-containing protein
1718 RJPO01000004.1 GCA003944305_00949 CDS open 199524-202220 _na     898_aa Calcium-transporting ATPase
1719 RJPO01000004.1 GCA003944305_00950 CDS open 202309-203100 _na     263_aa DUF2785 domain-containing protein
1720 RJPO01000004.1 GCA003944305_00951 CDS open 203094-203954 _na     286_aa Calcineurin-like phosphoesterase domain-containing protein
1721 RJPO01000004.1 GCA003944305_00953 CDS open 204353-205330 _na     325_aa prfB peptide chain release factor 2
1722 RJPO01000004.1 GCA003944305_00954 CDS open 205385-206077 _na     230_aa ftsE cell division ATP-binding protein FtsE
1723 RJPO01000004.1 GCA003944305_00955 CDS open 206070-206996 _na     308_aa ftsX permease-like cell division protein FtsX
1724 RJPO01000004.1 GCA003944305_00956 CDS open 207128-207325 _na     65_aa Bacteriocin immunity protein
1725 RJPO01000004.1 GCA003944305_00957 CDS open 207511-208143 _na     210_aa Hydroxyacylglutathione hydrolase
1726 RJPO01000004.1 GCA003944305_00958 CDS open 208276-210720 _na     814_aa dnaQ bifunctional DnaQ family exonuclease/ATP-dependent helicase
1727 RJPO01000004.1 GCA003944305_00959 CDS open 210835-211809 _na     324_aa yeiH Membrane protein YeiH
1728 RJPO01000004.1 GCA003944305_00960 CDS open 211822-213054 _na     410_aa rodA Rod shape-determining protein RodA
1729 RJPO01000004.1 GCA003944305_00961 CDS open 213091-213639 _na     182_aa DJ-1 family glyoxalase III
1730 RJPO01000004.1 GCA003944305_00962 CDS open 213762-214340 _na     192_aa Hydrolase%2C haloacid dehalogenase-like family
1731 RJPO01000004.1 GCA003944305_00963 CDS open 214342-216291 _na     649_aa gyrB DNA topoisomerase (ATP-hydrolyzing) subunit B
1732 RJPO01000004.1 GCA003944305_00964 CDS open 216377-218101 _na     574_aa ezrA septation ring formation regulator EzrA
1733 RJPO01000004.1 GCA003944305_00965 CDS open 218201-218848 _na     215_aa serB phosphoserine phosphatase SerB
1734 RJPO01000004.1 GCA003944305_00966 CDS open 218857-219990 _na     377_aa Glycerate kinase
1735 RJPO01000004.1 GCA003944305_00769 gene open 640-1770 yjbE
1736 RJPO01000004.1 GCA003944305_00770 gene open 1789-3513 tcaA
1737 RJPO01000004.1 GCA003944305_00771 gene open 3523-4305 ldcB
1738 RJPO01000004.1 GCA003944305_00772 gene open 4505-5299
1739 RJPO01000004.1 GCA003944305_00773 gene open 5355-5774
1740 RJPO01000004.1 GCA003944305_00774 gene open 6342-6524 pspC
1741 RJPO01000004.1 GCA003944305_00775 gene open 6596-8893 ftsK
1742 RJPO01000004.1 GCA003944305_00776 gene open 8999-9385
1743 RJPO01000004.1 GCA003944305_00777 gene open 9487-9834
1744 RJPO01000004.1 GCA003944305_00778 gene open 9984-10409
1745 RJPO01000004.1 GCA003944305_00779 gene open 10507-11196 rplA
1746 RJPO01000004.1 GCA003944305_00780 gene open 11217-11381
1747 RJPO01000004.1 GCA003944305_00781 gene open 11326-12774
1748 RJPO01000004.1 GCA003944305_00782 gene open 13086-14021 ppaC
1749 RJPO01000004.1 GCA003944305_00783 gene open 14108-14620
1750 RJPO01000004.1 GCA003944305_00784 gene open 14613-15266
1751 RJPO01000004.1 GCA003944305_00785 gene open 15363-16112
1752 RJPO01000004.1 GCA003944305_00786 gene open 16136-17581
1753 RJPO01000004.1 GCA003944305_00787 gene open 17668-19296
1754 RJPO01000004.1 GCA003944305_00788 gene open 19446-20540
1755 RJPO01000004.1 GCA003944305_00789 gene open 20542-21708
1756 RJPO01000004.1 GCA003944305_00790 gene open 22065-22676
1757 RJPO01000004.1 GCA003944305_00791 gene open 22834-25494 mgtA
1758 RJPO01000004.1 GCA003944305_00792 gene open 25558-27021 zwf
1759 RJPO01000004.1 GCA003944305_00793 gene open 27143-28507 emrB
1760 RJPO01000004.1 GCA003944305_00794 gene open 28701-29516
1761 RJPO01000004.1 GCA003944305_00795 gene open 29513-30418
1762 RJPO01000004.1 GCA003944305_00796 gene open 30415-30552 dpnI
1763 RJPO01000004.1 GCA003944305_00797 gene open 30723-32855
1764 RJPO01000004.1 GCA003944305_00798 gene open 32842-33291 sprT
1765 RJPO01000004.1 GCA003944305_00799 gene open 33394-33666 pspC
1766 RJPO01000004.1 GCA003944305_00800 gene open 33939-34373
1767 RJPO01000004.1 GCA003944305_00801 gene open 34421-34912
1768 RJPO01000004.1 GCA003944305_00802 gene open 35056-35991 hprK
1769 RJPO01000004.1 GCA003944305_00803 gene open 35984-36763 lgt
1770 RJPO01000004.1 GCA003944305_00804 gene open 36776-37171
1771 RJPO01000004.1 GCA003944305_00805 gene open 37187-37618
1772 RJPO01000004.1 GCA003944305_00806 gene open 37799-38641
1773 RJPO01000004.1 GCA003944305_00807 gene open 38693-38980
1774 RJPO01000004.1 GCA003944305_00808 gene open 39110-40039 yhbU
1775 RJPO01000004.1 GCA003944305_00809 gene open 40169-40732
1776 RJPO01000004.1 GCA003944305_00810 gene open 40875-41576
1777 RJPO01000004.1 GCA003944305_00811 gene open 41578-44301
1778 RJPO01000004.1 GCA003944305_00812 gene open 44392-45240
1779 RJPO01000004.1 GCA003944305_00813 gene open 45297-45746 ywnA
1780 RJPO01000004.1 GCA003944305_00814 gene open 45975-46832
1781 RJPO01000004.1 GCA003944305_00815 gene open 46795-47373
1782 RJPO01000004.1 GCA003944305_00816 gene open 47426-48508
1783 RJPO01000004.1 GCA003944305_00817 gene open 48771-49472 yycF
1784 RJPO01000004.1 GCA003944305_00818 gene open 49465-50829 vicK
1785 RJPO01000004.1 GCA003944305_00819 gene open 50822-51622
1786 RJPO01000004.1 GCA003944305_00820 gene open 51935-52294 ybaN
1787 RJPO01000004.1 GCA003944305_00821 gene open 52440-53129 rnc
1788 RJPO01000004.1 GCA003944305_00822 gene open 53129-56665 smc
1789 RJPO01000004.1 GCA003944305_00823 gene open 56694-57461
1790 RJPO01000004.1 GCA003944305_00824 gene open 57461-58279
1791 RJPO01000004.1 GCA003944305_00825 gene open 58283-59809 ftsY
1792 RJPO01000004.1 GCA003944305_00826 gene open 59966-60595 upp
1793 RJPO01000004.1 GCA003944305_00827 gene open 60766-61356 clpP
1794 RJPO01000004.1 GCA003944305_00828 gene open 61444-61713
1795 RJPO01000004.1 GCA003944305_00829 gene open 61813-62973
1796 RJPO01000004.1 GCA003944305_00830 gene open 63113-63994
1797 RJPO01000004.1 GCA003944305_00831 gene open 63998-64951
1798 RJPO01000004.1 GCA003944305_00832 gene open 64951-65715 livG
1799 RJPO01000004.1 GCA003944305_00833 gene open 65715-66425 livF
1800 RJPO01000004.1 GCA003944305_00834 gene open 67187-68029
1801 RJPO01000004.1 GCA003944305_00835 gene open 68251-68472
1802 RJPO01000004.1 GCA003944305_00836 gene open 68576-69916 xseA
1803 RJPO01000004.1 GCA003944305_00837 gene open 69894-70106
1804 RJPO01000004.1 GCA003944305_00838 gene open 70103-70978
1805 RJPO01000004.1 GCA003944305_00839 gene open 70971-71795
1806 RJPO01000004.1 GCA003944305_00840 gene open 71779-72210
1807 RJPO01000004.1 GCA003944305_00841 gene open 72219-73877 recN
1808 RJPO01000004.1 GCA003944305_00842 gene open 73930-74658
1809 RJPO01000004.1 GCA003944305_00843 gene open 74948-81991
1810 RJPO01000004.1 GCA003944305_00844 gene open 81988-82539
1811 RJPO01000004.1 GCA003944305_00845 gene open 82725-83558 degV
1812 RJPO01000004.1 GCA003944305_00846 gene open 83669-83944 hupA
1813 RJPO01000004.1 GCA003944305_00847 gene open 84141-84842
1814 RJPO01000004.1 GCA003944305_00848 gene open 84913-86184
1815 RJPO01000004.1 GCA003944305_00849 gene open 86306-87499
1816 RJPO01000004.1 GCA003944305_00850 gene open 87841-88293
1817 RJPO01000004.1 GCA003944305_00851 gene open 88445-89137 gpmA
1818 RJPO01000004.1 GCA003944305_00852 gene open 89279-91324 pbp2b
1819 RJPO01000004.1 GCA003944305_00853 gene open 91378-91974 recR
1820 RJPO01000004.1 GCA003944305_00854 gene open 92123-93169
1821 RJPO01000004.1 GCA003944305_00855 gene open 93274-94647
1822 RJPO01000004.1 GCA003944305_00856 gene open 94634-95245
1823 RJPO01000004.1 GCA003944305_00857 gene open 95439-96131
1824 RJPO01000004.1 GCA003944305_00858 gene open 96240-96920
1825 RJPO01000004.1 GCA003944305_00859 gene open 97016-97180
1826 RJPO01000004.1 GCA003944305_00860 gene open 97216-98760 prfC
1827 RJPO01000004.1 GCA003944305_00861 gene open 99173-100084 corA
1828 RJPO01000004.1 GCA003944305_00862 gene open 100264-101157
1829 RJPO01000004.1 GCA003944305_00863 gene open 101154-102368
1830 RJPO01000004.1 GCA003944305_00864 gene open 102498-103223 pyrH
1831 RJPO01000004.1 GCA003944305_00865 gene open 103242-103799 frr
1832 RJPO01000004.1 GCA003944305_00866 gene open 103899-104753 cvfB
1833 RJPO01000004.1 GCA003944305_00867 gene open 104754-104969
1834 RJPO01000004.1 GCA003944305_00868 gene open 105061-106059
1835 RJPO01000004.1 GCA003944305_00869 gene open 106122-107087 nrdF
1836 RJPO01000004.1 GCA003944305_00870 gene open 107221-109380 nrdE
1837 RJPO01000004.1 GCA003944305_00871 gene open 109475-109693 nrdH
1838 RJPO01000004.1 GCA003944305_00872 gene open 110136-110399 ptsH
1839 RJPO01000004.1 GCA003944305_00873 gene open 110404-112137 ptsI
1840 RJPO01000004.1 GCA003944305_00874 gene open 112372-113796
1841 RJPO01000004.1 GCA003944305_00875 gene open 114185-116098 glgB
1842 RJPO01000004.1 GCA003944305_00876 gene open 116102-117244 glgC
1843 RJPO01000004.1 GCA003944305_00877 gene open 117234-118373 glgD
1844 RJPO01000004.1 GCA003944305_00878 gene open 118370-119800 glgA
1845 RJPO01000004.1 GCA003944305_00879 gene open 119934-122330
1846 RJPO01000004.1 GCA003944305_00880 gene open 122473-122973
1847 RJPO01000004.1 GCA003944305_00881 gene open 123123-124064 manA
1848 RJPO01000004.1 GCA003944305_00882 gene open 124407-125576
1849 RJPO01000004.1 GCA003944305_00883 gene open 125569-126798
1850 RJPO01000004.1 GCA003944305_00884 gene open 126898-127203
1851 RJPO01000004.1 GCA003944305_00885 gene open 127356-128105
1852 RJPO01000004.1 GCA003944305_00886 gene open 128220-128939 budA
1853 RJPO01000004.1 GCA003944305_00887 gene open 129107-130756 fbpA
1854 RJPO01000004.1 GCA003944305_00888 gene open 131285-132292 trpX
1855 RJPO01000004.1 GCA003944305_00889 gene open 132605-133651 pheS
1856 RJPO01000004.1 GCA003944305_00890 gene open 133818-134330
1857 RJPO01000004.1 GCA003944305_00891 gene open 134365-136878 pheT
1858 RJPO01000004.1 GCA003944305_00892 gene open 137032-140424 cas9
1859 RJPO01000004.1 GCA003944305_00893 gene open 140636-141508 cas1
1860 RJPO01000004.1 GCA003944305_00894 gene open 141525-141833 cas2
1861 RJPO01000004.1 GCA003944305_00895 gene open 141830-142873
1862 RJPO01000004.1 GCA003944305_00896 gene open 143974-144390
1863 RJPO01000004.1 GCA003944305_00897 gene open 144551-144982
1864 RJPO01000004.1 GCA003944305_00898 gene open 145254-146315 hrtB
1865 RJPO01000004.1 GCA003944305_00899 gene open 146316-146981 hrtA
1866 RJPO01000004.1 GCA003944305_00900 gene open 147276-148856 mnmE
1867 RJPO01000004.1 GCA003944305_00901 gene open 148891-149508
1868 RJPO01000004.1 GCA003944305_00902 gene open 149735-150412 rpiA
1869 RJPO01000004.1 GCA003944305_00903 gene open 150426-151637 deoB
1870 RJPO01000004.1 GCA003944305_00904 gene open 151664-152476
1871 RJPO01000004.1 GCA003944305_00905 gene open 152636-153343 deoD
1872 RJPO01000004.1 GCA003944305_00906 gene open 153346-154122
1873 RJPO01000004.1 GCA003944305_00907 gene open 154115-154846
1874 RJPO01000004.1 GCA003944305_00908 gene open 154896-155804 lysR
1875 RJPO01000004.1 GCA003944305_00909 gene open 155992-156798
1876 RJPO01000004.1 GCA003944305_00910 gene open 156811-157749
1877 RJPO01000004.1 GCA003944305_00911 gene open 157953-158645 pyrF
1878 RJPO01000004.1 GCA003944305_00912 gene open 158713-159342 pyrE
1879 RJPO01000004.1 GCA003944305_00913 gene open 159455-160993
1880 RJPO01000004.1 GCA003944305_00914 gene open 160990-161742
1881 RJPO01000004.1 GCA003944305_00915 gene open 161794-162426
1882 RJPO01000004.1 GCA003944305_00916 gene open 162437-163090 ung
1883 RJPO01000004.1 GCA003944305_00917 gene open 163099-163563 mutX
1884 RJPO01000004.1 GCA003944305_00918 gene open 163576-164844
1885 RJPO01000004.1 GCA003944305_00919 gene open 164985-167243 nt5e
1886 RJPO01000004.1 GCA003944305_00920 gene open 167425-168069 plsY
1887 RJPO01000004.1 GCA003944305_00921 gene open 168292-170235 parE
1888 RJPO01000004.1 GCA003944305_00922 gene open 170248-170700
1889 RJPO01000004.1 GCA003944305_00923 gene open 170829-171647
1890 RJPO01000004.1 GCA003944305_00924 gene open 171901-174315 parC
1891 RJPO01000004.1 GCA003944305_00925 gene open 174456-175481
1892 RJPO01000004.1 GCA003944305_00926 gene open 175575-175805
1893 RJPO01000004.1 GCA003944305_00929 gene open 176180-177382 rpsA
1894 RJPO01000004.1 GCA003944305_00930 gene open 177552-178271
1895 RJPO01000004.1 GCA003944305_00931 gene open 178276-178641
1896 RJPO01000004.1 GCA003944305_00932 gene open 179067-179900 licT
1897 RJPO01000004.1 GCA003944305_00933 gene open 179925-180242
1898 RJPO01000004.1 GCA003944305_00934 gene open 180242-181948
1899 RJPO01000004.1 GCA003944305_00935 gene open 182180-183586 lacG
1900 RJPO01000004.1 GCA003944305_00936 gene open 183789-185720 abc-f
1901 RJPO01000004.1 GCA003944305_00937 gene open 186201-187064 rggC
1902 RJPO01000004.1 GCA003944305_00938 gene open 187143-188321
1903 RJPO01000004.1 GCA003944305_00939 gene open 188577-188981 paaI
1904 RJPO01000004.1 GCA003944305_00940 gene open 188962-189723 yihX
1905 RJPO01000004.1 GCA003944305_00941 gene open 189882-190640 tpiA
1906 RJPO01000004.1 GCA003944305_00942 gene open 190705-194202
1907 RJPO01000004.1 GCA003944305_00943 gene open 194234-195469 femA
1908 RJPO01000004.1 GCA003944305_00944 gene open 195484-196698
1909 RJPO01000004.1 GCA003944305_00945 gene open 196698-197507 yidA
1910 RJPO01000004.1 GCA003944305_00946 gene open 197509-198810
1911 RJPO01000004.1 GCA003944305_00947 gene open 198928-199317
1912 RJPO01000004.1 GCA003944305_00949 gene open 199524-202220
1913 RJPO01000004.1 GCA003944305_00950 gene open 202309-203100
1914 RJPO01000004.1 GCA003944305_00951 gene open 203094-203954
1915 RJPO01000004.1 GCA003944305_00953 gene open 204353-205330 prfB
1916 RJPO01000004.1 GCA003944305_00954 gene open 205385-206077 ftsE
1917 RJPO01000004.1 GCA003944305_00955 gene open 206070-206996 ftsX
1918 RJPO01000004.1 GCA003944305_00956 gene open 207128-207325
1919 RJPO01000004.1 GCA003944305_00957 gene open 207511-208143
1920 RJPO01000004.1 GCA003944305_00958 gene open 208276-210720 dnaQ
1921 RJPO01000004.1 GCA003944305_00959 gene open 210835-211809 yeiH
1922 RJPO01000004.1 GCA003944305_00960 gene open 211822-213054 rodA
1923 RJPO01000004.1 GCA003944305_00961 gene open 213091-213639
1924 RJPO01000004.1 GCA003944305_00962 gene open 213762-214340
1925 RJPO01000004.1 GCA003944305_00963 gene open 214342-216291 gyrB
1926 RJPO01000004.1 GCA003944305_00964 gene open 216377-218101 ezrA
1927 RJPO01000004.1 GCA003944305_00965 gene open 218201-218848 serB
1928 RJPO01000004.1 GCA003944305_00966 gene open 218857-219990
1929 RJPO01000004.1 GCA003944305_00765 gene open 2-62 trnG
1930 RJPO01000004.1 GCA003944305_00766 gene open 71-156 trnL
1931 RJPO01000004.1 GCA003944305_00767 gene open 175-248 trnR
1932 RJPO01000004.1 GCA003944305_00768 gene open 291-364 trnP
1933 RJPO01000004.1 GCA003944305_00927 gene open 175856-175936 trnY
1934 RJPO01000004.1 GCA003944305_00928 gene open 175946-176017 trnQ
1935 RJPO01000004.1 GCA003944305_00765 tRNA open 2-62 trnG tRNA-Gly(gcc)
1936 RJPO01000004.1 GCA003944305_00766 tRNA open 71-156 trnL tRNA-Leu(taa)
1937 RJPO01000004.1 GCA003944305_00767 tRNA open 175-248 trnR tRNA-Arg(acg)
1938 RJPO01000004.1 GCA003944305_00768 tRNA open 291-364 trnP tRNA-Pro(tgg)
1939 RJPO01000004.1 GCA003944305_00927 tRNA open 175856-175936 trnY tRNA-Tyr(gta)
1940 RJPO01000004.1 GCA003944305_00928 tRNA open 175946-176017 trnQ tRNA-Gln(ttg)
1941 RJPO01000005.1 GCA003944305_01064 gene open 89088-89184 csRNA
1942 RJPO01000005.1 GCA003944305_01064 ncRNA open 89088-89184 Cia-dependent small RNA csRNA1
1943 RJPO01000005.1 regulatory_region open 41332-41535 T-box leader
1944 RJPO01000005.1 regulatory_region open 98633-98862 T-box leader
1945 RJPO01000005.1 GCA003944305_00967 CDS open 221-424 _na     67_aa hypothetical protein
1946 RJPO01000005.1 GCA003944305_00968 CDS open 704-907 _na     67_aa hypothetical protein
1947 RJPO01000005.1 GCA003944305_00969 CDS open 1013-1156 _na     47_aa hypothetical protein
1948 RJPO01000005.1 GCA003944305_00970 CDS open 2984-3316 _na     110_aa DUF983 domain-containing protein
1949 RJPO01000005.1 GCA003944305_00971 CDS open 4437-4613 _na     58_aa XRE family transcriptional regulator
1950 RJPO01000005.1 GCA003944305_00972 CDS open 4685-6013 _na     442_aa gtfB accessory Sec system glycosylation chaperone GtfB
1951 RJPO01000005.1 GCA003944305_00973 CDS open 6044-7573 _na     509_aa gtfA accessory Sec system glycosyltransferase GtfA
1952 RJPO01000005.1 GCA003944305_00974 CDS open 7588-8442 _na     284_aa DivIVA protein
1953 RJPO01000005.1 GCA003944305_00975 CDS open 8710-9885 _na     391_aa bglA 6-phospho-beta-glucosidase BglA
1954 RJPO01000005.1 GCA003944305_00976 CDS open 9949-12864 _na     971_aa sasA Cell-wall-anchored protein SasA (LPXTG motif)
1955 RJPO01000005.1 GCA003944305_00977 CDS open 12934-15321 _na     795_aa secA2 accessory Sec system translocase SecA2
1956 RJPO01000005.1 GCA003944305_00978 CDS open 15311-16345 _na     344_aa asp3 accessory Sec system protein Asp3
1957 RJPO01000005.1 GCA003944305_00979 CDS open 16342-17901 _na     519_aa asp2 accessory Sec system protein Asp2
1958 RJPO01000005.1 GCA003944305_00980 CDS open 17888-19489 _na     533_aa asp1 accessory Sec system protein Asp1
1959 RJPO01000005.1 GCA003944305_00981 CDS open 19496-20755 _na     419_aa secY2 accessory Sec system protein translocase subunit SecY2
1960 RJPO01000005.1 GCA003944305_00982 CDS open 20922-22145 _na     407_aa Glycosyltransferase-stabilizing protein Gtf2
1961 RJPO01000005.1 GCA003944305_00983 CDS open 22494-23291 _na     265_aa pflA pyruvate formate-lyase-activating protein
1962 RJPO01000005.1 GCA003944305_00984 CDS open 23670-25295 _na     541_aa treC alpha%2Calpha-phosphotrehalase
1963 RJPO01000005.1 GCA003944305_00985 CDS open 25358-27325 _na     655_aa treB PTS trehalose transporter subunit IIBC
1964 RJPO01000005.1 GCA003944305_00986 CDS open 27511-28224 _na     237_aa treR trehalose operon repressor
1965 RJPO01000005.1 GCA003944305_00987 CDS open 28617-28958 _na     113_aa Cingulin
1966 RJPO01000005.1 GCA003944305_00988 CDS open 28967-29260 _na     97_aa Phage protein
1967 RJPO01000005.1 GCA003944305_00989 CDS open 29269-30780 _na     503_aa Lipase
1968 RJPO01000005.1 GCA003944305_00990 CDS open 30771-31379 _na     202_aa DUF4230 domain-containing protein
1969 RJPO01000005.1 GCA003944305_00991 CDS open 31424-32032 _na     202_aa DUF4230 domain-containing protein
1970 RJPO01000005.1 GCA003944305_00992 CDS open 32271-32609 _na     112_aa Phage protein
1971 RJPO01000005.1 GCA003944305_00993 CDS open 32868-34205 _na     445_aa CBS domain protein
1972 RJPO01000005.1 GCA003944305_00994 CDS open 34296-35942 _na     548_aa phosphoenolpyruvate carboxykinase (ATP)
1973 RJPO01000005.1 GCA003944305_00995 CDS open 36040-37164 _na     374_aa tqsA AI-2 transport protein TqsA
1974 RJPO01000005.1 GCA003944305_00996 CDS open 37439-37741 _na     100_aa DUF1827 domain-containing protein
1975 RJPO01000005.1 GCA003944305_00997 CDS open 37841-38293 _na     150_aa Nudix hydrolase domain-containing protein
1976 RJPO01000005.1 GCA003944305_00998 CDS open 38487-41279 _na     930_aa ileS isoleucine--tRNA ligase
1977 RJPO01000005.1 GCA003944305_00999 CDS open 41532-42317 _na     261_aa Cell division protein DivIVA
1978 RJPO01000005.1 GCA003944305_01000 CDS open 42327-43112 _na     261_aa RNA-binding S4 domain-containing protein
1979 RJPO01000005.1 GCA003944305_01001 CDS open 43106-43381 _na     91_aa YGGT family protein
1980 RJPO01000005.1 GCA003944305_01002 CDS open 43385-43951 _na     188_aa sepF Cell division protein SepF
1981 RJPO01000005.1 GCA003944305_01003 CDS open 43961-44632 _na     223_aa Pyridoxal phosphate homeostasis protein
1982 RJPO01000005.1 GCA003944305_01004 CDS open 44637-45902 _na     421_aa ftsZ cell division protein FtsZ
1983 RJPO01000005.1 GCA003944305_01005 CDS open 45919-47283 _na     454_aa ftsA cell division protein FtsA
1984 RJPO01000005.1 GCA003944305_01006 CDS open 47407-48606 _na     399_aa Cell division protein DivIB
1985 RJPO01000005.1 GCA003944305_01007 CDS open 48603-49673 _na     356_aa UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase
1986 RJPO01000005.1 GCA003944305_01008 CDS open 49675-51027 _na     450_aa murD UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase
1987 RJPO01000005.1 GCA003944305_01009 CDS open 51389-51646 _na     85_aa Membrane protein
1988 RJPO01000005.1 GCA003944305_01010 CDS open 51681-53528 _na     615_aa typA translational GTPase TypA
1989 RJPO01000005.1 GCA003944305_01011 CDS open 53721-54446 _na     241_aa Pseudouridine synthase
1990 RJPO01000005.1 GCA003944305_01012 CDS open 54482-54718 _na     78_aa DUF4190 domain-containing protein
1991 RJPO01000005.1 GCA003944305_01013 CDS open 54802-55182 _na     126_aa moeZ Putative adenylyltransferase/sulfurtransferase MoeZ
1992 RJPO01000005.1 GCA003944305_01014 CDS open 55184-55402 _na     72_aa DUF910 domain-containing protein
1993 RJPO01000005.1 GCA003944305_01015 CDS open 55821-56561 _na     246_aa N-acetylmuramoyl-L-alanine amidase
1994 RJPO01000005.1 GCA003944305_01016 CDS open 56654-56914 _na     86_aa phage holin
1995 RJPO01000005.1 GCA003944305_01017 CDS open 56911-57318 _na     135_aa Phage protein
1996 RJPO01000005.1 GCA003944305_01018 CDS open 57331-57585 _na     84_aa Phage protein
1997 RJPO01000005.1 GCA003944305_01019 CDS open 57588-57779 _na     63_aa Phage protein
1998 RJPO01000005.1 GCA003944305_01020 CDS open 57789-61955 _na     1388_aa Collagen triple helix repeat (20 copies)
1999 RJPO01000005.1 GCA003944305_01021 CDS open 61955-63349 _na     464_aa Phage tail protein
2000 RJPO01000005.1 GCA003944305_01022 CDS open 63464-66430 _na     988_aa pblA PblA