HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Veillonella sp. HMT-780 (GCA_003992185.1)

Select a Genome:
BAKTA Annotations for GCA_003992185.1
Genome Selected: Veillonella sp. HMT-780
ContigsBases CDSrRNA tmRNAtRNA
51 1,776,932 1554 3 1 44
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3242 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:7]    |    Number of Records Found: 3242 [7 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3001 RQVH01000029.1 GCA003992185_01492 gene open 6432-6755
3002 RQVH01000029.1 GCA003992185_01493 gene open 7063-8181
3003 RQVH01000029.1 GCA003992185_01494 gene open 8301-8660
3004 RQVH01000029.1 GCA003992185_01495 gene open 8915-9022
3005 RQVH01000029.1 GCA003992185_01496 gene open 9052-9450
3006 RQVH01000029.1 GCA003992185_01497 gene open 9457-11481 abc-f
3007 RQVH01000029.1 GCA003992185_01498 gene open 11776-13113
3008 RQVH01000029.1 GCA003992185_01499 gene open 13636-14844
3009 RQVH01000029.1 GCA003992185_01485 gene open 185-260 trnW
3010 RQVH01000029.1 GCA003992185_01486 gene open 275-351 trnR
3011 RQVH01000029.1 GCA003992185_01487 gene open 358-441 trnL
3012 RQVH01000029.1 GCA003992185_01485 tRNA open 185-260 trnW tRNA-Trp(cca)
3013 RQVH01000029.1 GCA003992185_01486 tRNA open 275-351 trnR tRNA-Arg(acg)
3014 RQVH01000029.1 GCA003992185_01487 tRNA open 358-441 trnL tRNA-Leu(tag)
3015 RQVH01000030.1 GCA003992185_01500 CDS open 43-1326 _na     427_aa PepSY domain protein
3016 RQVH01000030.1 GCA003992185_01502 CDS open 2041-2355 _na     104_aa hypothetical protein
3017 RQVH01000030.1 GCA003992185_01503 CDS open 2475-3824 _na     449_aa Membrane protein%2C PF01595 family
3018 RQVH01000030.1 GCA003992185_01504 CDS open 4038-4355 _na     105_aa UPF0145 protein HMPREF9200_0825
3019 RQVH01000030.1 GCA003992185_01505 CDS open 4439-4768 _na     109_aa azlD Branched-chain amino acid transport protein AzlD
3020 RQVH01000030.1 GCA003992185_01506 CDS open 4765-5475 _na     236_aa azlC Putative azaleucine resistance protein AzlC
3021 RQVH01000030.1 GCA003992185_01507 CDS open 5783-7225 _na     480_aa Amino acid permease
3022 RQVH01000030.1 GCA003992185_01508 CDS open 7237-9138 _na     633_aa gyrB DNA topoisomerase (ATP-hydrolyzing) subunit B
3023 RQVH01000030.1 GCA003992185_01509 CDS open 9247-10140 _na     297_aa PF05258 family protein
3024 RQVH01000030.1 GCA003992185_01510 CDS open 10130-11221 _na     363_aa recF DNA replication/repair protein RecF
3025 RQVH01000030.1 GCA003992185_01511 CDS open 11224-11448 _na     74_aa S4 domain protein
3026 RQVH01000030.1 GCA003992185_01512 CDS open 11465-12577 _na     370_aa dnaN DNA polymerase III subunit beta
3027 RQVH01000030.1 GCA003992185_01513 CDS open 12845-14494 _na     549_aa dnaA chromosomal replication initiator protein DnaA
3028 RQVH01000030.1 GCA003992185_01500 gene open 43-1326
3029 RQVH01000030.1 GCA003992185_01502 gene open 2041-2355
3030 RQVH01000030.1 GCA003992185_01503 gene open 2475-3824
3031 RQVH01000030.1 GCA003992185_01504 gene open 4038-4355
3032 RQVH01000030.1 GCA003992185_01505 gene open 4439-4768 azlD
3033 RQVH01000030.1 GCA003992185_01506 gene open 4765-5475 azlC
3034 RQVH01000030.1 GCA003992185_01507 gene open 5783-7225
3035 RQVH01000030.1 GCA003992185_01508 gene open 7237-9138 gyrB
3036 RQVH01000030.1 GCA003992185_01509 gene open 9247-10140
3037 RQVH01000030.1 GCA003992185_01510 gene open 10130-11221 recF
3038 RQVH01000030.1 GCA003992185_01511 gene open 11224-11448
3039 RQVH01000030.1 GCA003992185_01512 gene open 11465-12577 dnaN
3040 RQVH01000030.1 GCA003992185_01513 gene open 12845-14494 dnaA
3041 RQVH01000030.1 GCA003992185_01501 gene open 1410-1486 trnR
3042 RQVH01000030.1 GCA003992185_01501 tRNA open 1410-1486 trnR tRNA-Arg(cct)
3043 RQVH01000031.1 GCA003992185_01514 CDS open 708-1646 _na     312_aa Glycosyltransferase%2C group 2 family protein
3044 RQVH01000031.1 GCA003992185_01515 CDS open 1669-2517 _na     282_aa NlpC/P60 family protein
3045 RQVH01000031.1 GCA003992185_01516 CDS open 2593-3303 _na     236_aa ABC transporter%2C ATP-binding protein
3046 RQVH01000031.1 GCA003992185_01517 CDS open 3305-4108 _na     267_aa Iron chelate uptake ABC transporter%2C FeCT family%2C permease protein
3047 RQVH01000031.1 GCA003992185_01518 CDS open 4236-6845 _na     869_aa alaS alanine--tRNA ligase
3048 RQVH01000031.1 GCA003992185_01519 CDS open 6899-7159 _na     86_aa ireB IreB family regulatory phosphoprotein
3049 RQVH01000031.1 GCA003992185_01520 CDS open 7159-7569 _na     136_aa ruvX Holliday junction resolvase RuvX
3050 RQVH01000031.1 GCA003992185_01521 CDS open 7580-7852 _na     90_aa DUF1292 domain-containing protein
3051 RQVH01000031.1 GCA003992185_01522 CDS open 8086-9093 _na     335_aa Endolytic murein transglycosylase
3052 RQVH01000031.1 GCA003992185_01523 CDS open 9083-9691 _na     202_aa O-methyltransferase
3053 RQVH01000031.1 GCA003992185_01524 CDS open 9684-10916 _na     410_aa Peptidase%2C U32 family
3054 RQVH01000031.1 GCA003992185_01525 CDS open 10944-11168 _na     74_aa DUF4911 domain-containing protein
3055 RQVH01000031.1 GCA003992185_01526 CDS open 11247-13334 _na     695_aa DUF4261 domain-containing protein
3056 RQVH01000031.1 GCA003992185_01514 gene open 708-1646
3057 RQVH01000031.1 GCA003992185_01515 gene open 1669-2517
3058 RQVH01000031.1 GCA003992185_01516 gene open 2593-3303
3059 RQVH01000031.1 GCA003992185_01517 gene open 3305-4108
3060 RQVH01000031.1 GCA003992185_01518 gene open 4236-6845 alaS
3061 RQVH01000031.1 GCA003992185_01519 gene open 6899-7159 ireB
3062 RQVH01000031.1 GCA003992185_01520 gene open 7159-7569 ruvX
3063 RQVH01000031.1 GCA003992185_01521 gene open 7580-7852
3064 RQVH01000031.1 GCA003992185_01522 gene open 8086-9093
3065 RQVH01000031.1 GCA003992185_01523 gene open 9083-9691
3066 RQVH01000031.1 GCA003992185_01524 gene open 9684-10916
3067 RQVH01000031.1 GCA003992185_01525 gene open 10944-11168
3068 RQVH01000031.1 GCA003992185_01526 gene open 11247-13334
3069 RQVH01000031.1 GCA003992185_01527 gene open 13584-13660 trnP
3070 RQVH01000031.1 GCA003992185_01528 gene open 13672-13745 trnG
3071 RQVH01000031.1 GCA003992185_01529 gene open 13852-13928 trnR
3072 RQVH01000031.1 GCA003992185_01527 tRNA open 13584-13660 trnP tRNA-Pro(tgg)
3073 RQVH01000031.1 GCA003992185_01528 tRNA open 13672-13745 trnG tRNA-Gly(tcc)
3074 RQVH01000031.1 GCA003992185_01529 tRNA open 13852-13928 trnR tRNA-Arg(tct)
3075 RQVH01000032.1 GCA003992185_01530 CDS open 39-413 _na     124_aa hypothetical protein
3076 RQVH01000032.1 GCA003992185_01532 CDS open 910-2451 _na     513_aa cshA DEAD-box ATP-dependent RNA helicase CshA
3077 RQVH01000032.1 GCA003992185_01533 CDS open 2585-3004 _na     139_aa Ferric uptake regulator family protein
3078 RQVH01000032.1 GCA003992185_01534 CDS open 3139-3984 _na     281_aa putative endonuclease 4
3079 RQVH01000032.1 GCA003992185_01535 CDS open 3987-5345 _na     452_aa Nuclease SbcCD subunit D
3080 RQVH01000032.1 GCA003992185_01536 CDS open 5342-8506 _na     1054_aa Nuclease SbcCD subunit C
3081 RQVH01000032.1 GCA003992185_01537 CDS open 8570-8944 _na     124_aa Glyoxalase family protein
3082 RQVH01000032.1 GCA003992185_01538 CDS open 8946-9647 _na     233_aa thiF ThiF family protein
3083 RQVH01000032.1 GCA003992185_01539 CDS open 9647-10078 _na     143_aa Peptidyl-prolyl cis-trans isomerase
3084 RQVH01000032.1 GCA003992185_01540 CDS open 10078-10722 _na     214_aa Peptidase C39-like domain-containing protein
3085 RQVH01000032.1 GCA003992185_01541 CDS open 10726-11574 _na     282_aa speE polyamine aminopropyltransferase
3086 RQVH01000032.1 GCA003992185_01542 CDS open 11908-13233 _na     441_aa FAD-containing oxidoreductase
3087 RQVH01000032.1 GCA003992185_01530 gene open 39-413
3088 RQVH01000032.1 GCA003992185_01532 gene open 910-2451 cshA
3089 RQVH01000032.1 GCA003992185_01533 gene open 2585-3004
3090 RQVH01000032.1 GCA003992185_01534 gene open 3139-3984
3091 RQVH01000032.1 GCA003992185_01535 gene open 3987-5345
3092 RQVH01000032.1 GCA003992185_01536 gene open 5342-8506
3093 RQVH01000032.1 GCA003992185_01537 gene open 8570-8944
3094 RQVH01000032.1 GCA003992185_01538 gene open 8946-9647 thiF
3095 RQVH01000032.1 GCA003992185_01539 gene open 9647-10078
3096 RQVH01000032.1 GCA003992185_01540 gene open 10078-10722
3097 RQVH01000032.1 GCA003992185_01541 gene open 10726-11574 speE
3098 RQVH01000032.1 GCA003992185_01542 gene open 11908-13233
3099 RQVH01000032.1 GCA003992185_01531 gene open 657-731 trnR
3100 RQVH01000032.1 GCA003992185_01543 gene open 13587-13662 trnH
3101 RQVH01000032.1 GCA003992185_01544 gene open 13669-13743 trnQ
3102 RQVH01000032.1 GCA003992185_01545 gene open 13750-13825 trnK
3103 RQVH01000032.1 GCA003992185_01546 gene open 13836-13910 trnE
3104 RQVH01000032.1 GCA003992185_01531 tRNA open 657-731 trnR tRNA-Arg(ccg)
3105 RQVH01000032.1 GCA003992185_01543 tRNA open 13587-13662 trnH tRNA-His(gtg)
3106 RQVH01000032.1 GCA003992185_01544 tRNA open 13669-13743 trnQ tRNA-Gln(ttg)
3107 RQVH01000032.1 GCA003992185_01545 tRNA open 13750-13825 trnK tRNA-Lys(ttt)
3108 RQVH01000032.1 GCA003992185_01546 tRNA open 13836-13910 trnE tRNA-Glu(ttc)
3109 RQVH01000033.1 GCA003992185_01548 CDS open 324-1703 _na     459_aa cobyrinate a%2Cc-diamide synthase
3110 RQVH01000033.1 GCA003992185_01549 CDS open 1714-2421 _na     235_aa cobI precorrin-2 C(20)-methyltransferase
3111 RQVH01000033.1 GCA003992185_01550 CDS open 2584-3408 _na     274_aa cbiK Cobalt chelatase CbiK
3112 RQVH01000033.1 GCA003992185_01551 CDS open 3552-5978 _na     808_aa Negative regulator of genetic competence ClpC/MecB
3113 RQVH01000033.1 GCA003992185_01552 CDS open 5975-7048 _na     357_aa protein arginine kinase
3114 RQVH01000033.1 GCA003992185_01553 CDS open 7058-7576 _na     172_aa UVR domain-containing protein
3115 RQVH01000033.1 GCA003992185_01554 CDS open 7580-8056 _na     158_aa Firmicute transcriptional repressor of class III stress
3116 RQVH01000033.1 GCA003992185_01555 CDS open 8517-9002 _na     161_aa Ferritin
3117 RQVH01000033.1 GCA003992185_01556 CDS open 9278-10318 _na     346_aa CobW/P47K family protein
3118 RQVH01000033.1 GCA003992185_01557 CDS open 10324-11811 _na     495_aa Permease domain protein
3119 RQVH01000033.1 GCA003992185_01558 CDS open 11808-12566 _na     252_aa TIGR03943 family putative permease subunit
3120 RQVH01000033.1 GCA003992185_01559 CDS open 12724-13110 _na     128_aa hypothetical protein
3121 RQVH01000033.1 GCA003992185_01548 gene open 324-1703
3122 RQVH01000033.1 GCA003992185_01549 gene open 1714-2421 cobI
3123 RQVH01000033.1 GCA003992185_01550 gene open 2584-3408 cbiK
3124 RQVH01000033.1 GCA003992185_01551 gene open 3552-5978
3125 RQVH01000033.1 GCA003992185_01552 gene open 5975-7048
3126 RQVH01000033.1 GCA003992185_01553 gene open 7058-7576
3127 RQVH01000033.1 GCA003992185_01554 gene open 7580-8056
3128 RQVH01000033.1 GCA003992185_01555 gene open 8517-9002
3129 RQVH01000033.1 GCA003992185_01556 gene open 9278-10318
3130 RQVH01000033.1 GCA003992185_01557 gene open 10324-11811
3131 RQVH01000033.1 GCA003992185_01558 gene open 11808-12566
3132 RQVH01000033.1 GCA003992185_01559 gene open 12724-13110
3133 RQVH01000033.1 GCA003992185_01547 gene open 128-211 trnL
3134 RQVH01000033.1 GCA003992185_01547 tRNA open 128-211 trnL tRNA-Leu(caa)
3135 RQVH01000034.1 repeat_region open 72-260 CRISPR array with 3 repeats of length 39%2C consensus sequence TAGTTTCAGTCCCCTCAATGGGGAAGTAATTCTAAAGGG and spacer length 30
3136 RQVH01000034.1 GCA003992185_01560 CDS open 636-1490 _na     284_aa cas1 CRISPR-associated endonuclease Cas1
3137 RQVH01000034.1 GCA003992185_01561 CDS open 1660-3198 _na     512_aa TATA-binding-like protein domain of the TOTE conflict systems
3138 RQVH01000034.1 GCA003992185_01562 CDS open 3297-5336 _na     679_aa DUF7017 domain-containing protein
3139 RQVH01000034.1 GCA003992185_01563 CDS open 5432-6028 _na     198_aa infC translation initiation factor IF-3
3140 RQVH01000034.1 GCA003992185_01564 CDS open 6040-6237 _na     65_aa rpmI 50S ribosomal protein L35
3141 RQVH01000034.1 GCA003992185_01565 CDS open 6285-6635 _na     116_aa rplT 50S ribosomal protein L20
3142 RQVH01000034.1 GCA003992185_01566 CDS open 6844-8400 _na     518_aa Putative stage V sporulation protein B
3143 RQVH01000034.1 GCA003992185_01567 CDS open 8600-9529 _na     309_aa fba class II fructose-1%2C6-bisphosphate aldolase
3144 RQVH01000034.1 GCA003992185_01568 CDS open 9686-9868 _na     60_aa hypothetical protein
3145 RQVH01000034.1 GCA003992185_01569 CDS open 9870-10178 _na     102_aa type II toxin-antitoxin system RelE/ParE family toxin
3146 RQVH01000034.1 GCA003992185_01570 CDS open 10416-11279 _na     287_aa Pseudouridine synthase
3147 RQVH01000034.1 GCA003992185_01571 CDS open 11564-11914 _na     116_aa CRISPR-associated protein
3148 RQVH01000034.1 GCA003992185_01560 gene open 636-1490 cas1
3149 RQVH01000034.1 GCA003992185_01561 gene open 1660-3198
3150 RQVH01000034.1 GCA003992185_01562 gene open 3297-5336
3151 RQVH01000034.1 GCA003992185_01563 gene open 5432-6028 infC
3152 RQVH01000034.1 GCA003992185_01564 gene open 6040-6237 rpmI
3153 RQVH01000034.1 GCA003992185_01565 gene open 6285-6635 rplT
3154 RQVH01000034.1 GCA003992185_01566 gene open 6844-8400
3155 RQVH01000034.1 GCA003992185_01567 gene open 8600-9529 fba
3156 RQVH01000034.1 GCA003992185_01568 gene open 9686-9868
3157 RQVH01000034.1 GCA003992185_01569 gene open 9870-10178
3158 RQVH01000034.1 GCA003992185_01570 gene open 10416-11279
3159 RQVH01000034.1 GCA003992185_01571 gene open 11564-11914
3160 RQVH01000035.1 GCA003992185_01572 CDS open 1230-2240 _na     336_aa ilvC ketol-acid reductoisomerase
3161 RQVH01000035.1 GCA003992185_01573 CDS open 2405-3208 _na     267_aa ABC transporter%2C ATP-binding protein
3162 RQVH01000035.1 GCA003992185_01574 CDS open 3208-3702 _na     164_aa ilvN acetolactate synthase small subunit
3163 RQVH01000035.1 GCA003992185_01575 CDS open 3695-5416 _na     573_aa ilvB biosynthetic-type acetolactate synthase large subunit
3164 RQVH01000035.1 GCA003992185_01576 CDS open 5449-6675 _na     408_aa ilvA threonine ammonia-lyase
3165 RQVH01000035.1 GCA003992185_01577 CDS open 6757-8427 _na     556_aa ilvD dihydroxy-acid dehydratase
3166 RQVH01000035.1 GCA003992185_01578 CDS open 9492-10826 _na     444_aa Putative glutamate synthase (NADPH)%2C homotetrameric
3167 RQVH01000035.1 GCA003992185_01579 CDS open 11159-11962 _na     267_aa Lipoprotein
3168 RQVH01000035.1 GCA003992185_01572 gene open 1230-2240 ilvC
3169 RQVH01000035.1 GCA003992185_01573 gene open 2405-3208
3170 RQVH01000035.1 GCA003992185_01574 gene open 3208-3702 ilvN
3171 RQVH01000035.1 GCA003992185_01575 gene open 3695-5416 ilvB
3172 RQVH01000035.1 GCA003992185_01576 gene open 5449-6675 ilvA
3173 RQVH01000035.1 GCA003992185_01577 gene open 6757-8427 ilvD
3174 RQVH01000035.1 GCA003992185_01578 gene open 9492-10826
3175 RQVH01000035.1 GCA003992185_01579 gene open 11159-11962
3176 RQVH01000036.1 GCA003992185_01580 CDS open 81-662 _na     193_aa DNA adenine methylase
3177 RQVH01000036.1 GCA003992185_01581 CDS open 893-1735 _na     280_aa DUF362 domain-containing protein
3178 RQVH01000036.1 GCA003992185_01583 CDS open 2480-3364 _na     294_aa ispE 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase
3179 RQVH01000036.1 GCA003992185_01584 CDS open 3361-4050 _na     229_aa FCD domain protein
3180 RQVH01000036.1 GCA003992185_01585 CDS open 4107-9260 _na     1717_aa TonB-dependent siderophore receptor
3181 RQVH01000036.1 GCA003992185_01580 gene open 81-662
3182 RQVH01000036.1 GCA003992185_01581 gene open 893-1735
3183 RQVH01000036.1 GCA003992185_01583 gene open 2480-3364 ispE
3184 RQVH01000036.1 GCA003992185_01584 gene open 3361-4050
3185 RQVH01000036.1 GCA003992185_01585 gene open 4107-9260
3186 RQVH01000036.1 GCA003992185_01582 gene open 1802-1892 trnS
3187 RQVH01000036.1 GCA003992185_01582 tRNA open 1802-1892 trnS tRNA-Ser(cga)
3188 RQVH01000037.1 GCA003992185_01586 CDS open 37-1233 _na     398_aa S-layer-like y domain-containing protein
3189 RQVH01000037.1 GCA003992185_01587 CDS open 1407-1997 _na     196_aa PAP2 family protein
3190 RQVH01000037.1 GCA003992185_01588 CDS open 2102-2416 _na     104_aa hypothetical protein
3191 RQVH01000037.1 GCA003992185_01589 CDS open 2606-3478 _na     290_aa cbiK Cobalt chelatase CbiK
3192 RQVH01000037.1 GCA003992185_01590 CDS open 3635-5590 _na     651_aa Arylsulfatase
3193 RQVH01000037.1 GCA003992185_01591 CDS open 5621-6571 _na     316_aa rfbB dTDP-glucose 4%2C6-dehydratase
3194 RQVH01000037.1 GCA003992185_01592 CDS open 6606-8555 _na     649_aa LTA synthase family protein
3195 RQVH01000037.1 GCA003992185_01586 gene open 37-1233
3196 RQVH01000037.1 GCA003992185_01587 gene open 1407-1997
3197 RQVH01000037.1 GCA003992185_01588 gene open 2102-2416
3198 RQVH01000037.1 GCA003992185_01589 gene open 2606-3478 cbiK
3199 RQVH01000037.1 GCA003992185_01590 gene open 3635-5590
3200 RQVH01000037.1 GCA003992185_01591 gene open 5621-6571 rfbB
3201 RQVH01000037.1 GCA003992185_01592 gene open 6606-8555
3202 RQVH01000038.1 GCA003992185_01593 CDS open 1888-3453 _na     521_aa hcp hydroxylamine reductase
3203 RQVH01000038.1 GCA003992185_01594 CDS open 3708-4418 _na     236_aa Cyclic nucleotide-binding domain protein
3204 RQVH01000038.1 GCA003992185_01595 CDS open 4569-5942 _na     457_aa LPO_1073/Vpar_1526 family protein
3205 RQVH01000038.1 GCA003992185_01593 gene open 1888-3453 hcp
3206 RQVH01000038.1 GCA003992185_01594 gene open 3708-4418
3207 RQVH01000038.1 GCA003992185_01595 gene open 4569-5942
3208 RQVH01000038.1 GCA003992185_01596 gene open 6077-6152 trnV
3209 RQVH01000038.1 GCA003992185_01596 tRNA open 6077-6152 trnV tRNA-Val(tac)
3210 RQVH01000039.1 GCA003992185_01597 CDS open 185-1219 _na     344_aa N-acetylneuraminate synthase family protein
3211 RQVH01000039.1 GCA003992185_01598 CDS open 1224-2342 _na     372_aa neuC UDP-N-acetylglucosamine 2-epimerase
3212 RQVH01000039.1 GCA003992185_01599 CDS open 2356-3051 _na     231_aa cytidylyltransferase domain-containing protein
3213 RQVH01000039.1 GCA003992185_01600 CDS open 3264-4022 _na     252_aa glycosyltransferase family 2 protein
3214 RQVH01000039.1 GCA003992185_01601 CDS open 4056-5195 _na     379_aa glycosyltransferase
3215 RQVH01000039.1 GCA003992185_01597 gene open 185-1219
3216 RQVH01000039.1 GCA003992185_01598 gene open 1224-2342 neuC
3217 RQVH01000039.1 GCA003992185_01599 gene open 2356-3051
3218 RQVH01000039.1 GCA003992185_01600 gene open 3264-4022
3219 RQVH01000039.1 GCA003992185_01601 gene open 4056-5195
3220 RQVH01000040.1 GCA003992185_01602 gene open 175-1735 rrs
3221 RQVH01000040.1 GCA003992185_01602 rRNA open 175-1735 rrs 16S ribosomal RNA
3222 RQVH01000041.1 GCA003992185_01603 gene open 135-3061 rrl
3223 RQVH01000041.1 GCA003992185_01604 gene open 3126-3242 rrf
3224 RQVH01000041.1 GCA003992185_01603 rRNA open 135-3061 rrl 23S ribosomal RNA
3225 RQVH01000041.1 GCA003992185_01604 rRNA open 3126-3242 rrf 5S ribosomal RNA
3226 RQVH01000042.1 GCA003992185_01605 CDS open 142-588 _na     148_aa mscL large-conductance mechanosensitive channel protein MscL
3227 RQVH01000042.1 GCA003992185_01606 CDS open 767-1522 _na     251_aa deoR Transcriptional regulator%2C DeoR family
3228 RQVH01000042.1 GCA003992185_01607 CDS open 1739-2578 _na     279_aa dapF diaminopimelate epimerase
3229 RQVH01000042.1 GCA003992185_01608 CDS open 2665-3822 _na     385_aa SLH domain-containing protein
3230 RQVH01000042.1 GCA003992185_01605 gene open 142-588 mscL
3231 RQVH01000042.1 GCA003992185_01606 gene open 767-1522 deoR
3232 RQVH01000042.1 GCA003992185_01607 gene open 1739-2578 dapF
3233 RQVH01000042.1 GCA003992185_01608 gene open 2665-3822
3234 RQVH01000043.1 GCA003992185_01609 CDS open 2-1045 _na     347_aa tuf elongation factor Tu
3235 RQVH01000043.1 GCA003992185_01609 gene open 2-1045 tuf
3236 RQVH01000046.1 GCA003992185_01610 gene open 149-225 trnI
3237 RQVH01000046.1 GCA003992185_01611 gene open 327-402 trnA
3238 RQVH01000046.1 GCA003992185_01610 tRNA open 149-225 trnI tRNA-Ile(gat)
3239 RQVH01000046.1 GCA003992185_01611 tRNA open 327-402 trnA tRNA-Ala(tgc)
3240 RQVH01000047.1 repeat_region open 93-277 CRISPR array with 3 repeats of length 36%2C consensus sequence ACTTTAGAATTACTTCCCCATTGAGGGGACTGAAAC and spacer length 33
3241 RQVH01000050.1 GCA003992185_01612 gene open 194-251 trnI
3242 RQVH01000050.1 GCA003992185_01612 tRNA open 194-251 trnI tRNA-Ile(gat)