HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Actinomyces viscosus (GCA_004525795.1)

Select a Genome:
BAKTA Annotations for GCA_004525795.1
Genome Selected: Actinomyces viscosus
ContigsBases CDSrRNA tmRNAtRNA
107 3336376 2761 3 1 51
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 5659 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:12]    |    Number of Records Found: 5659 [12 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  12  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
5501 SPDW01000061.1 GCA004525795_02399 CDS open 1816-2001 _na     61_aa Transposase
5502 SPDW01000061.1 GCA004525795_02400 CDS open 2009-2275 _na     88_aa tRNA (Cytidine(34)-2'-O)-methyltransferase
5503 SPDW01000061.1 GCA004525795_02401 CDS open 2343-2996 _na     217_aa N-acetyltransferase domain-containing protein
5504 SPDW01000061.1 GCA004525795_02402 CDS open 3002-3595 _na     197_aa putative conserved protein
5505 SPDW01000061.1 GCA004525795_02403 CDS open 3646-5145 _na     499_aa lpd Mercuric reductase
5506 SPDW01000061.1 GCA004525795_02404 CDS open 5355-5942 _na     195_aa tetR Bacterial regulatory proteins%2C tetR family
5507 SPDW01000061.1 GCA004525795_02405 CDS open 5944-6843 _na     299_aa Acetoin dehydrogenase E2 subunit dihydrolipoyllysine-residue acetyltransferase
5508 SPDW01000061.1 GCA004525795_02398 gene open 337-1488
5509 SPDW01000061.1 GCA004525795_02399 gene open 1816-2001
5510 SPDW01000061.1 GCA004525795_02400 gene open 2009-2275
5511 SPDW01000061.1 GCA004525795_02401 gene open 2343-2996
5512 SPDW01000061.1 GCA004525795_02402 gene open 3002-3595
5513 SPDW01000061.1 GCA004525795_02403 gene open 3646-5145 lpd
5514 SPDW01000061.1 GCA004525795_02404 gene open 5355-5942 tetR
5515 SPDW01000061.1 GCA004525795_02405 gene open 5944-6843
5516 SPDW01000062.1 GCA004525795_02406 CDS open 246-1214 _na     322_aa CAAX amino terminal protease self- immunity
5517 SPDW01000062.1 GCA004525795_02407 CDS open 1318-4257 _na     979_aa uvrD DNA 3'-5' helicase
5518 SPDW01000062.1 GCA004525795_02408 CDS open 4432-5067 _na     211_aa ydeA putative protease ydeA
5519 SPDW01000062.1 GCA004525795_02409 CDS open 5048-5533 _na     161_aa marR MarR family
5520 SPDW01000062.1 GCA004525795_02410 CDS open 5562-6683 _na     373_aa Dihydroorotate dehydrogenase electron transfer subunit
5521 SPDW01000062.1 GCA004525795_02406 gene open 246-1214
5522 SPDW01000062.1 GCA004525795_02407 gene open 1318-4257 uvrD
5523 SPDW01000062.1 GCA004525795_02408 gene open 4432-5067 ydeA
5524 SPDW01000062.1 GCA004525795_02409 gene open 5048-5533 marR
5525 SPDW01000062.1 GCA004525795_02410 gene open 5562-6683
5526 SPDW01000063.1 GCA004525795_02411 CDS open 3019-4500 _na     493_aa gltD ferredoxin--NADP(+) reductase
5527 SPDW01000063.1 GCA004525795_02412 CDS open 5215-6156 _na     313_aa Molybdenum cofactor biosynthesis protein A
5528 SPDW01000063.1 GCA004525795_02411 gene open 3019-4500 gltD
5529 SPDW01000063.1 GCA004525795_02412 gene open 5215-6156
5530 SPDW01000064.1 GCA004525795_02413 CDS open 129-449 _na     106_aa hypothetical protein
5531 SPDW01000064.1 GCA004525795_02414 CDS open 591-1796 _na     401_aa 2%2C6-dihydropseudooxynicotine hydrolase
5532 SPDW01000064.1 GCA004525795_02415 CDS open 1892-2536 _na     214_aa tetR Bacterial regulatory proteins%2C tetR family
5533 SPDW01000064.1 GCA004525795_02416 CDS open 3054-3437 _na     127_aa hypothetical protein
5534 SPDW01000064.1 GCA004525795_02417 CDS open 4888-6090 _na     400_aa hypothetical protein
5535 SPDW01000064.1 GCA004525795_02413 gene open 129-449
5536 SPDW01000064.1 GCA004525795_02414 gene open 591-1796
5537 SPDW01000064.1 GCA004525795_02415 gene open 1892-2536 tetR
5538 SPDW01000064.1 GCA004525795_02416 gene open 3054-3437
5539 SPDW01000064.1 GCA004525795_02417 gene open 4888-6090
5540 SPDW01000065.1 GCA004525795_02418 CDS open 110-622 _na     170_aa ydaF Ribosomal N-acetyltransferase YdaF
5541 SPDW01000065.1 GCA004525795_02419 CDS open 727-942 _na     71_aa Anaerobic benzoate catabolism transcriptional regulator
5542 SPDW01000065.1 GCA004525795_02420 CDS open 1186-1908 _na     240_aa HNH endonuclease
5543 SPDW01000065.1 GCA004525795_02421 CDS open 1956-2825 _na     289_aa hypothetical protein
5544 SPDW01000065.1 GCA004525795_02422 CDS open 2887-3774 _na     295_aa Abortive infection protein-like C-terminal domain-containing protein
5545 SPDW01000065.1 GCA004525795_02423 CDS open 3845-4903 _na     352_aa Virulence protein
5546 SPDW01000065.1 GCA004525795_02424 CDS open 4958-5407 _na     149_aa Transposase and inactivated derivatives%2C IS30 family
5547 SPDW01000065.1 GCA004525795_02418 gene open 110-622 ydaF
5548 SPDW01000065.1 GCA004525795_02419 gene open 727-942
5549 SPDW01000065.1 GCA004525795_02420 gene open 1186-1908
5550 SPDW01000065.1 GCA004525795_02421 gene open 1956-2825
5551 SPDW01000065.1 GCA004525795_02422 gene open 2887-3774
5552 SPDW01000065.1 GCA004525795_02423 gene open 3845-4903
5553 SPDW01000065.1 GCA004525795_02424 gene open 4958-5407
5554 SPDW01000066.1 GCA004525795_02425 gene open 1-3073 rrl
5555 SPDW01000066.1 GCA004525795_02426 gene open 3478-5018 rrs
5556 SPDW01000066.1 GCA004525795_02425 rRNA open 1-3073 rrl 23S ribosomal RNA
5557 SPDW01000066.1 GCA004525795_02426 rRNA open 3478-5018 rrs 16S ribosomal RNA
5558 SPDW01000067.1 GCA004525795_02427 CDS open 196-1461 _na     421_aa rmuC DNA recombination protein rmuC
5559 SPDW01000067.1 GCA004525795_02428 CDS open 1672-3465 _na     597_aa putative hydrolase of the alpha/beta superfamily
5560 SPDW01000067.1 GCA004525795_02429 CDS open 3505-4659 _na     384_aa ychF redox-regulated ATPase YchF
5561 SPDW01000067.1 GCA004525795_02427 gene open 196-1461 rmuC
5562 SPDW01000067.1 GCA004525795_02428 gene open 1672-3465
5563 SPDW01000067.1 GCA004525795_02429 gene open 3505-4659 ychF
5564 SPDW01000068.1 GCA004525795_02430 CDS open 1072-1386 _na     104_aa hypothetical protein
5565 SPDW01000068.1 GCA004525795_02431 CDS open 1373-2830 _na     485_aa ABC-2 family transporter protein
5566 SPDW01000068.1 GCA004525795_02432 CDS open 2823-3761 _na     312_aa drrA Daunorubicin/doxorubicin resistance ATP-binding protein DrrA
5567 SPDW01000068.1 GCA004525795_02430 gene open 1072-1386
5568 SPDW01000068.1 GCA004525795_02431 gene open 1373-2830
5569 SPDW01000068.1 GCA004525795_02432 gene open 2823-3761 drrA
5570 SPDW01000069.1 GCA004525795_02433 CDS open 7-279 _na     90_aa hypothetical protein
5571 SPDW01000069.1 GCA004525795_02434 CDS open 582-1658 _na     358_aa Calpain catalytic domain-containing protein
5572 SPDW01000069.1 GCA004525795_02435 CDS open 1685-2224 _na     179_aa hypothetical protein
5573 SPDW01000069.1 GCA004525795_02433 gene open 7-279
5574 SPDW01000069.1 GCA004525795_02434 gene open 582-1658
5575 SPDW01000069.1 GCA004525795_02435 gene open 1685-2224
5576 SPDW01000070.1 GCA004525795_02515 CDS open 543-980 _na     145_aa xkdM Phage-like element PBSX protein xkdM
5577 SPDW01000070.1 GCA004525795_02516 CDS open 1110-2291 _na     393_aa hypothetical protein
5578 SPDW01000070.1 GCA004525795_02517 CDS open 2603-3025 _na     140_aa DUF4265 domain-containing protein
5579 SPDW01000070.1 GCA004525795_02518 CDS open 3046-3222 _na     58_aa hypothetical protein
5580 SPDW01000070.1 GCA004525795_02515 gene open 543-980 xkdM
5581 SPDW01000070.1 GCA004525795_02516 gene open 1110-2291
5582 SPDW01000070.1 GCA004525795_02517 gene open 2603-3025
5583 SPDW01000070.1 GCA004525795_02518 gene open 3046-3222
5584 SPDW01000071.1 repeat_region open 77-1759 CRISPR array with 28 repeats of length 28%2C consensus sequence GTAAACCCCGCGCGAGCGGGGATGATCC and spacer length 32
5585 SPDW01000071.1 repeat_region open 1979-3055 CRISPR array with 18 repeats of length 28%2C consensus sequence GTAAACCCCGCGCGAGCGGGGATGATCC and spacer length 33
5586 SPDW01000071.1 repeat_region open 3340-3567 CRISPR array with 4 repeats of length 34%2C consensus sequence GTGCTGTAAACCCCGCGCGAGCGGGGATGATCCG and spacer length 27
5587 SPDW01000072.1 GCA004525795_02519 CDS open 7-423 _na     138_aa ABC-2 type transporter
5588 SPDW01000072.1 GCA004525795_02520 CDS open 391-3099 _na     902_aa acnA aconitate hydratase AcnA
5589 SPDW01000072.1 GCA004525795_02519 gene open 7-423
5590 SPDW01000072.1 GCA004525795_02520 gene open 391-3099 acnA
5591 SPDW01000073.1 GCA004525795_02522 CDS open 369-1718 _na     449_aa yihS N-acylglucosamine 2-epimerase
5592 SPDW01000073.1 GCA004525795_02523 CDS open 1983-2816 _na     277_aa Transposase
5593 SPDW01000073.1 GCA004525795_02522 gene open 369-1718 yihS
5594 SPDW01000073.1 GCA004525795_02523 gene open 1983-2816
5595 SPDW01000073.1 GCA004525795_02521 gene open 78-163 trnS
5596 SPDW01000073.1 GCA004525795_02521 tRNA open 78-163 trnS tRNA-Ser(tga)
5597 SPDW01000074.1 GCA004525795_02524 CDS open 7-303 _na     98_aa Cell motility protein
5598 SPDW01000074.1 GCA004525795_02525 CDS open 300-1763 _na     487_aa Calpain catalytic domain-containing protein
5599 SPDW01000074.1 GCA004525795_02524 gene open 7-303
5600 SPDW01000074.1 GCA004525795_02525 gene open 300-1763
5601 SPDW01000075.1 GCA004525795_02526 CDS open 596-1339 _na     247_aa DUF4230 domain-containing protein
5602 SPDW01000075.1 GCA004525795_02526 gene open 596-1339
5603 SPDW01000076.1 GCA004525795_02527 CDS open 159-284 _na     41_aa hypothetical protein
5604 SPDW01000076.1 GCA004525795_02528 CDS open 621-1286 _na     221_aa Knr4/Smi1-like domain-containing protein
5605 SPDW01000076.1 GCA004525795_02527 gene open 159-284
5606 SPDW01000076.1 GCA004525795_02528 gene open 621-1286
5607 SPDW01000077.1 GCA004525795_02529 CDS open 36-497 _na     153_aa hypothetical protein
5608 SPDW01000077.1 GCA004525795_02530 CDS open 510-755 _na     81_aa hypothetical protein
5609 SPDW01000077.1 GCA004525795_02531 CDS open 1211-1714 _na     167_aa NTP pyrophosphohydrolase
5610 SPDW01000077.1 GCA004525795_02529 gene open 36-497
5611 SPDW01000077.1 GCA004525795_02530 gene open 510-755
5612 SPDW01000077.1 GCA004525795_02531 gene open 1211-1714
5613 SPDW01000078.1 GCA004525795_02532 CDS open 963-1670 _na     235_aa hypothetical protein
5614 SPDW01000078.1 GCA004525795_02532 gene open 963-1670
5615 SPDW01000079.1 GCA004525795_02533 CDS open 24-1232 _na     402_aa IS110 family transposase
5616 SPDW01000079.1 GCA004525795_02533 gene open 24-1232
5617 SPDW01000080.1 GCA004525795_02627 CDS open 103-1350 _na     415_aa Integrase core domain protein
5618 SPDW01000080.1 GCA004525795_02627 gene open 103-1350
5619 SPDW01000081.1 GCA004525795_02628 CDS open 116-1330 _na     404_aa IS256 family transposase
5620 SPDW01000081.1 GCA004525795_02628 gene open 116-1330
5621 SPDW01000082.1 GCA004525795_02629 CDS open 213-623 _na     136_aa Amino acid permease/ SLC12A domain-containing protein
5622 SPDW01000082.1 GCA004525795_02630 CDS open 751-1110 _na     119_aa hypothetical protein
5623 SPDW01000082.1 GCA004525795_02629 gene open 213-623
5624 SPDW01000082.1 GCA004525795_02630 gene open 751-1110
5625 SPDW01000083.1 GCA004525795_02631 CDS open 20-982 _na     320_aa IS630 family transposase
5626 SPDW01000083.1 GCA004525795_02631 gene open 20-982
5627 SPDW01000084.1 GCA004525795_02632 CDS open 498-1055 _na     185_aa doxX DoxX
5628 SPDW01000084.1 GCA004525795_02632 gene open 498-1055 doxX
5629 SPDW01000086.1 GCA004525795_02633 CDS open 46-765 _na     239_aa Transposase and inactivated derivatives
5630 SPDW01000086.1 GCA004525795_02633 gene open 46-765
5631 SPDW01000087.1 GCA004525795_02634 CDS open 573-782 _na     69_aa hypothetical protein
5632 SPDW01000087.1 GCA004525795_02634 gene open 573-782
5633 SPDW01000088.1 GCA004525795_02635 CDS open 130-756 _na     208_aa Fluoroquinolones export ATP-binding protein Rv2688c/MT2762
5634 SPDW01000088.1 GCA004525795_02635 gene open 130-756
5635 SPDW01000089.1 GCA004525795_02636 CDS open 443-898 _na     151_aa hypothetical protein
5636 SPDW01000089.1 GCA004525795_02636 gene open 443-898
5637 SPDW01000090.1 GCA004525795_02723 CDS open 10-750 _na     246_aa DDE family endonuclease
5638 SPDW01000090.1 GCA004525795_02723 gene open 10-750
5639 SPDW01000092.1 GCA004525795_02724 CDS open 421-687 _na     88_aa hypothetical protein
5640 SPDW01000092.1 GCA004525795_02724 gene open 421-687
5641 SPDW01000093.1 GCA004525795_02725 CDS open 284-412 _na     42_aa hypothetical protein
5642 SPDW01000093.1 GCA004525795_02725 gene open 284-412
5643 SPDW01000094.1 GCA004525795_02726 CDS open 193-495 _na     100_aa Zinc transporter
5644 SPDW01000094.1 GCA004525795_02726 gene open 193-495
5645 SPDW01000097.1 GCA004525795_02727 CDS open 49-633 _na     194_aa HNH endonuclease
5646 SPDW01000097.1 GCA004525795_02727 gene open 49-633
5647 SPDW01000100.1 regulatory_region open 124-255 ALIL pseudoknot
5648 SPDW01000102.1 GCA004525795_00001 CDS open 106-531 _na     141_aa Transposase
5649 SPDW01000102.1 GCA004525795_00001 gene open 106-531
5650 SPDW01000103.1 GCA004525795_00002 CDS open 22-267 _na     81_aa Excreted virulence factor EspC%2C type VII ESX diderm
5651 SPDW01000103.1 GCA004525795_00003 CDS open 252-485 _na     77_aa hypothetical protein
5652 SPDW01000103.1 GCA004525795_00002 gene open 22-267
5653 SPDW01000103.1 GCA004525795_00003 gene open 252-485
5654 SPDW01000104.1 GCA004525795_00004 CDS open 45-404 _na     119_aa hypothetical protein
5655 SPDW01000104.1 GCA004525795_00004 gene open 45-404
5656 SPDW01000105.1 GCA004525795_00005 CDS open 153-485 _na     110_aa Transposase DDE domain-containing protein
5657 SPDW01000105.1 GCA004525795_00005 gene open 153-485
5658 SPDW01000107.1 GCA004525795_00006 CDS open 101-412 _na     103_aa hypothetical protein
5659 SPDW01000107.1 GCA004525795_00006 gene open 101-412