BAKTAGenome Explorer: Acidovorax temperans (GCA_006716905.1)
Select a Genome:
|
BAKTA Annotations for GCA_006716905.1
|
Search & Sort all 8779 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 7001 | VFPV01000003.1 | GCA006716905_03308 | gene | open | 378847-380490 | |||
| 7002 | VFPV01000003.1 | GCA006716905_03309 | gene | open | 380659-382149 | selO | ||
| 7003 | VFPV01000003.1 | GCA006716905_03310 | gene | open | 382146-382559 | |||
| 7004 | VFPV01000003.1 | GCA006716905_03311 | gene | open | 382589-383128 | |||
| 7005 | VFPV01000003.1 | GCA006716905_03312 | gene | open | 383153-383413 | bolA | ||
| 7006 | VFPV01000003.1 | GCA006716905_03313 | gene | open | 383481-384266 | surA | ||
| 7007 | VFPV01000003.1 | GCA006716905_03314 | gene | open | 384332-385639 | |||
| 7008 | VFPV01000003.1 | GCA006716905_03315 | gene | open | 385869-386642 | |||
| 7009 | VFPV01000003.1 | GCA006716905_03317 | gene | open | 387075-387329 | infA | ||
| 7010 | VFPV01000003.1 | GCA006716905_03318 | gene | open | 387767-388627 | asd | ||
| 7011 | VFPV01000003.1 | GCA006716905_03319 | gene | open | 388684-388893 | |||
| 7012 | VFPV01000003.1 | GCA006716905_03320 | gene | open | 389077-389892 | hutG | ||
| 7013 | VFPV01000003.1 | GCA006716905_03321 | gene | open | 389933-391315 | |||
| 7014 | VFPV01000003.1 | GCA006716905_03322 | gene | open | 391312-392589 | hutI | ||
| 7015 | VFPV01000003.1 | GCA006716905_03323 | gene | open | 392679-393302 | hutD | ||
| 7016 | VFPV01000003.1 | GCA006716905_03324 | gene | open | 393308-394198 | |||
| 7017 | VFPV01000003.1 | GCA006716905_03325 | gene | open | 394260-395054 | |||
| 7018 | VFPV01000003.1 | GCA006716905_03326 | gene | open | 395051-395719 | hisM | ||
| 7019 | VFPV01000003.1 | GCA006716905_03327 | gene | open | 395746-396498 | |||
| 7020 | VFPV01000003.1 | GCA006716905_03328 | gene | open | 396530-397306 | allR | ||
| 7021 | VFPV01000003.1 | GCA006716905_03329 | gene | open | 397382-399106 | hutU | ||
| 7022 | VFPV01000003.1 | GCA006716905_03330 | gene | open | 399146-400684 | hutH | ||
| 7023 | VFPV01000003.1 | GCA006716905_03331 | gene | open | 400749-401573 | hutC | ||
| 7024 | VFPV01000003.1 | GCA006716905_03332 | gene | open | 401604-402383 | |||
| 7025 | VFPV01000003.1 | GCA006716905_03333 | gene | open | 402380-403216 | |||
| 7026 | VFPV01000003.1 | GCA006716905_03334 | gene | open | 403239-404204 | |||
| 7027 | VFPV01000003.1 | GCA006716905_03335 | gene | open | 404895-406421 | |||
| 7028 | VFPV01000003.1 | GCA006716905_03337 | gene | open | 406761-407711 | |||
| 7029 | VFPV01000003.1 | GCA006716905_03338 | gene | open | 407868-408845 | accA | ||
| 7030 | VFPV01000003.1 | GCA006716905_03339 | gene | open | 408933-409607 | |||
| 7031 | VFPV01000003.1 | GCA006716905_03340 | gene | open | 409653-411029 | cysS | ||
| 7032 | VFPV01000003.1 | GCA006716905_03341 | gene | open | 411134-412345 | |||
| 7033 | VFPV01000003.1 | GCA006716905_03342 | gene | open | 412472-413800 | |||
| 7034 | VFPV01000003.1 | GCA006716905_03343 | gene | open | 413797-414378 | |||
| 7035 | VFPV01000003.1 | GCA006716905_03344 | gene | open | 414400-414927 | |||
| 7036 | VFPV01000003.1 | GCA006716905_03345 | gene | open | 415111-415890 | |||
| 7037 | VFPV01000003.1 | GCA006716905_03346 | gene | open | 415944-416774 | |||
| 7038 | VFPV01000003.1 | GCA006716905_03347 | gene | open | 416896-419556 | mdeB | ||
| 7039 | VFPV01000003.1 | GCA006716905_03348 | gene | open | 419660-420133 | lrp | ||
| 7040 | VFPV01000003.1 | GCA006716905_03349 | gene | open | 420081-421373 | |||
| 7041 | VFPV01000003.1 | GCA006716905_03350 | gene | open | 421523-421990 | asnC | ||
| 7042 | VFPV01000003.1 | GCA006716905_03351 | gene | open | 422022-422918 | |||
| 7043 | VFPV01000003.1 | GCA006716905_03352 | gene | open | 423074-423745 | |||
| 7044 | VFPV01000003.1 | GCA006716905_03353 | gene | open | 423829-424662 | ligB | ||
| 7045 | VFPV01000003.1 | GCA006716905_03354 | gene | open | 424814-425233 | arfB | ||
| 7046 | VFPV01000003.1 | GCA006716905_03355 | gene | open | 425458-425814 | |||
| 7047 | VFPV01000003.1 | GCA006716905_03356 | gene | open | 425988-427856 | |||
| 7048 | VFPV01000003.1 | GCA006716905_03357 | gene | open | 427908-428681 | |||
| 7049 | VFPV01000003.1 | GCA006716905_03358 | gene | open | 428762-429874 | |||
| 7050 | VFPV01000003.1 | GCA006716905_03359 | gene | open | 430997-431233 | |||
| 7051 | VFPV01000003.1 | GCA006716905_03360 | gene | open | 431285-431518 | |||
| 7052 | VFPV01000003.1 | GCA006716905_03361 | gene | open | 431515-431808 | parE | ||
| 7053 | VFPV01000003.1 | GCA006716905_03362 | gene | open | 431920-432231 | |||
| 7054 | VFPV01000003.1 | GCA006716905_03363 | gene | open | 432830-433819 | |||
| 7055 | VFPV01000003.1 | GCA006716905_03364 | gene | open | 433882-434826 | |||
| 7056 | VFPV01000003.1 | GCA006716905_03365 | gene | open | 435015-435797 | |||
| 7057 | VFPV01000003.1 | GCA006716905_03366 | gene | open | 436025-438250 | katG | ||
| 7058 | VFPV01000003.1 | GCA006716905_03367 | gene | open | 438406-438726 | |||
| 7059 | VFPV01000003.1 | GCA006716905_03368 | gene | open | 438920-439168 | |||
| 7060 | VFPV01000003.1 | GCA006716905_03369 | gene | open | 439282-440160 | |||
| 7061 | VFPV01000003.1 | GCA006716905_03370 | gene | open | 440325-440477 | |||
| 7062 | VFPV01000003.1 | GCA006716905_03371 | gene | open | 440503-441174 | |||
| 7063 | VFPV01000003.1 | GCA006716905_03372 | gene | open | 441273-441644 | |||
| 7064 | VFPV01000003.1 | GCA006716905_03373 | gene | open | 441711-442130 | |||
| 7065 | VFPV01000003.1 | GCA006716905_03374 | gene | open | 442239-442817 | |||
| 7066 | VFPV01000003.1 | GCA006716905_03375 | gene | open | 443048-443467 | |||
| 7067 | VFPV01000003.1 | GCA006716905_03376 | gene | open | 443570-444841 | |||
| 7068 | VFPV01000003.1 | GCA006716905_03377 | gene | open | 444887-445366 | |||
| 7069 | VFPV01000003.1 | GCA006716905_03378 | gene | open | 445442-446272 | |||
| 7070 | VFPV01000003.1 | GCA006716905_03379 | gene | open | 446371-449844 | mfd | ||
| 7071 | VFPV01000003.1 | GCA006716905_03380 | gene | open | 449881-450537 | |||
| 7072 | VFPV01000003.1 | GCA006716905_03381 | gene | open | 450637-450822 | |||
| 7073 | VFPV01000003.1 | GCA006716905_03382 | gene | open | 451084-451800 | serB | ||
| 7074 | VFPV01000003.1 | GCA006716905_03383 | gene | open | 451960-452448 | |||
| 7075 | VFPV01000003.1 | GCA006716905_03384 | gene | open | 452655-453380 | ytfE | ||
| 7076 | VFPV01000003.1 | GCA006716905_03385 | gene | open | 453399-453824 | |||
| 7077 | VFPV01000003.1 | GCA006716905_03386 | gene | open | 453917-454090 | |||
| 7078 | VFPV01000003.1 | GCA006716905_03387 | gene | open | 454175-454402 | |||
| 7079 | VFPV01000003.1 | GCA006716905_03388 | gene | open | 454407-454778 | |||
| 7080 | VFPV01000003.1 | GCA006716905_03389 | gene | open | 454782-455240 | |||
| 7081 | VFPV01000003.1 | GCA006716905_03390 | gene | open | 455544-456800 | |||
| 7082 | VFPV01000003.1 | GCA006716905_03391 | gene | open | 456946-458214 | |||
| 7083 | VFPV01000003.1 | GCA006716905_03392 | gene | open | 458299-459273 | ylqF | ||
| 7084 | VFPV01000003.1 | GCA006716905_03393 | gene | open | 459399-459653 | |||
| 7085 | VFPV01000003.1 | GCA006716905_03394 | gene | open | 459719-459892 | |||
| 7086 | VFPV01000003.1 | GCA006716905_03395 | gene | open | 460009-461088 | |||
| 7087 | VFPV01000003.1 | GCA006716905_03396 | gene | open | 461286-461717 | tnpA | ||
| 7088 | VFPV01000003.1 | GCA006716905_03397 | gene | open | 461938-463479 | gshA | ||
| 7089 | VFPV01000003.1 | GCA006716905_03398 | gene | open | 463645-464553 | |||
| 7090 | VFPV01000003.1 | GCA006716905_03399 | gene | open | 465182-465808 | |||
| 7091 | VFPV01000003.1 | GCA006716905_03400 | gene | open | 465870-466160 | |||
| 7092 | VFPV01000003.1 | GCA006716905_03401 | gene | open | 466457-467578 | ribBA | ||
| 7093 | VFPV01000003.1 | GCA006716905_03402 | gene | open | 467581-468045 | ribH | ||
| 7094 | VFPV01000003.1 | GCA006716905_03403 | gene | open | 468042-468608 | nusB | ||
| 7095 | VFPV01000003.1 | GCA006716905_03404 | gene | open | 468734-469918 | |||
| 7096 | VFPV01000003.1 | GCA006716905_03405 | gene | open | 469938-470354 | ybgC | ||
| 7097 | VFPV01000003.1 | GCA006716905_03406 | gene | open | 470351-471055 | tolQ | ||
| 7098 | VFPV01000003.1 | GCA006716905_03407 | gene | open | 471065-471487 | tolR | ||
| 7099 | VFPV01000003.1 | GCA006716905_03408 | gene | open | 471512-472549 | tolA | ||
| 7100 | VFPV01000003.1 | GCA006716905_03409 | gene | open | 472626-473594 | tnp | ||
| 7101 | VFPV01000003.1 | GCA006716905_03410 | gene | open | 473661-474992 | |||
| 7102 | VFPV01000003.1 | GCA006716905_03411 | gene | open | 475220-477751 | |||
| 7103 | VFPV01000003.1 | GCA006716905_03412 | gene | open | 477944-479275 | |||
| 7104 | VFPV01000003.1 | GCA006716905_03413 | gene | open | 479326-481917 | acnB | ||
| 7105 | VFPV01000003.1 | GCA006716905_03414 | gene | open | 482006-482635 | |||
| 7106 | VFPV01000003.1 | GCA006716905_03415 | gene | open | 482658-483674 | |||
| 7107 | VFPV01000003.1 | GCA006716905_03416 | gene | open | 483859-484845 | mdh | ||
| 7108 | VFPV01000003.1 | GCA006716905_03417 | gene | open | 485044-485829 | gntR | ||
| 7109 | VFPV01000003.1 | GCA006716905_03418 | gene | open | 485964-486398 | sdhC | ||
| 7110 | VFPV01000003.1 | GCA006716905_03419 | gene | open | 486463-486828 | sdhD | ||
| 7111 | VFPV01000003.1 | GCA006716905_03420 | gene | open | 486851-488659 | sdhA | ||
| 7112 | VFPV01000003.1 | GCA006716905_03421 | gene | open | 488685-489389 | |||
| 7113 | VFPV01000003.1 | GCA006716905_03422 | gene | open | 489408-489728 | sdhE | ||
| 7114 | VFPV01000003.1 | GCA006716905_03423 | gene | open | 489785-491095 | |||
| 7115 | VFPV01000003.1 | GCA006716905_03424 | gene | open | 491569-491907 | |||
| 7116 | VFPV01000003.1 | GCA006716905_03425 | gene | open | 492168-492434 | frmR | ||
| 7117 | VFPV01000003.1 | GCA006716905_03426 | gene | open | 492469-493584 | frmA | ||
| 7118 | VFPV01000003.1 | GCA006716905_03427 | gene | open | 493700-494563 | fghA | ||
| 7119 | VFPV01000003.1 | GCA006716905_03428 | gene | open | 494649-496577 | |||
| 7120 | VFPV01000003.1 | GCA006716905_03429 | gene | open | 496908-498437 | |||
| 7121 | VFPV01000003.1 | GCA006716905_03430 | gene | open | 498477-498908 | tnpA | ||
| 7122 | VFPV01000003.1 | GCA006716905_03431 | gene | open | 499057-500550 | |||
| 7123 | VFPV01000003.1 | GCA006716905_03432 | gene | open | 500607-500819 | |||
| 7124 | VFPV01000003.1 | GCA006716905_03433 | gene | open | 500816-501694 | |||
| 7125 | VFPV01000003.1 | GCA006716905_03434 | gene | open | 501691-502653 | |||
| 7126 | VFPV01000003.1 | GCA006716905_03435 | gene | open | 502708-504051 | rpfG | ||
| 7127 | VFPV01000003.1 | GCA006716905_03436 | gene | open | 504095-505849 | |||
| 7128 | VFPV01000003.1 | GCA006716905_03437 | gene | open | 505861-506760 | lysR | ||
| 7129 | VFPV01000003.1 | GCA006716905_03438 | gene | open | 506856-507923 | |||
| 7130 | VFPV01000003.1 | GCA006716905_03439 | gene | open | 508105-509340 | |||
| 7131 | VFPV01000003.1 | GCA006716905_03440 | gene | open | 509396-510397 | tnp | ||
| 7132 | VFPV01000003.1 | GCA006716905_03441 | gene | open | 510643-511056 | rnk | ||
| 7133 | VFPV01000003.1 | GCA006716905_03442 | gene | open | 511105-512088 | |||
| 7134 | VFPV01000003.1 | GCA006716905_03443 | gene | open | 512140-512571 | tnpA | ||
| 7135 | VFPV01000003.1 | GCA006716905_03444 | gene | open | 512642-512887 | |||
| 7136 | VFPV01000003.1 | GCA006716905_03445 | gene | open | 513142-514095 | |||
| 7137 | VFPV01000003.1 | GCA006716905_03446 | gene | open | 514239-516029 | |||
| 7138 | VFPV01000003.1 | GCA006716905_03447 | gene | open | 516105-517037 | |||
| 7139 | VFPV01000003.1 | GCA006716905_03448 | gene | open | 517038-517787 | fixA | ||
| 7140 | VFPV01000003.1 | GCA006716905_03449 | gene | open | 517987-519333 | |||
| 7141 | VFPV01000003.1 | GCA006716905_03450 | gene | open | 519333-520124 | |||
| 7142 | VFPV01000003.1 | GCA006716905_03451 | gene | open | 520212-521117 | |||
| 7143 | VFPV01000003.1 | GCA006716905_03452 | gene | open | 521219-522139 | mMP0363 | ||
| 7144 | VFPV01000003.1 | GCA006716905_03453 | gene | open | 522139-523179 | |||
| 7145 | VFPV01000003.1 | GCA006716905_03454 | gene | open | 523327-525432 | |||
| 7146 | VFPV01000003.1 | GCA006716905_03455 | gene | open | 525442-526533 | mltB | ||
| 7147 | VFPV01000003.1 | GCA006716905_03456 | gene | open | 526579-527841 | |||
| 7148 | VFPV01000003.1 | GCA006716905_03457 | gene | open | 528018-528413 | |||
| 7149 | VFPV01000003.1 | GCA006716905_03458 | gene | open | 528515-529723 | salY | ||
| 7150 | VFPV01000003.1 | GCA006716905_03459 | gene | open | 529723-530517 | |||
| 7151 | VFPV01000003.1 | GCA006716905_03460 | gene | open | 530514-531869 | |||
| 7152 | VFPV01000003.1 | GCA006716905_03461 | gene | open | 531950-532699 | |||
| 7153 | VFPV01000003.1 | GCA006716905_03462 | gene | open | 532878-533159 | copK | ||
| 7154 | VFPV01000003.1 | GCA006716905_03463 | gene | open | 534205-535254 | tsaD | ||
| 7155 | VFPV01000003.1 | GCA006716905_03464 | gene | open | 535323-536483 | |||
| 7156 | VFPV01000003.1 | GCA006716905_03465 | gene | open | 536728-537366 | amiR | ||
| 7157 | VFPV01000003.1 | GCA006716905_03466 | gene | open | 537869-539113 | |||
| 7158 | VFPV01000003.1 | GCA006716905_03467 | gene | open | 539177-540136 | ntrB | ||
| 7159 | VFPV01000003.1 | GCA006716905_03468 | gene | open | 540133-540969 | |||
| 7160 | VFPV01000003.1 | GCA006716905_03469 | gene | open | 541154-541591 | |||
| 7161 | VFPV01000003.1 | GCA006716905_03470 | gene | open | 541686-541862 | |||
| 7162 | VFPV01000003.1 | GCA006716905_03471 | gene | open | 541912-542880 | tnp | ||
| 7163 | VFPV01000003.1 | GCA006716905_03472 | gene | open | 543207-544421 | |||
| 7164 | VFPV01000003.1 | GCA006716905_03473 | gene | open | 544922-546682 | prpC | ||
| 7165 | VFPV01000003.1 | GCA006716905_03474 | gene | open | 546994-549450 | |||
| 7166 | VFPV01000003.1 | GCA006716905_03475 | gene | open | 549522-549905 | |||
| 7167 | VFPV01000003.1 | GCA006716905_03476 | gene | open | 549964-550692 | |||
| 7168 | VFPV01000003.1 | GCA006716905_03477 | gene | open | 550775-553666 | bfd | ||
| 7169 | VFPV01000003.1 | GCA006716905_03478 | gene | open | 553726-554634 | ybiB | ||
| 7170 | VFPV01000003.1 | GCA006716905_03479 | gene | open | 554647-555477 | |||
| 7171 | VFPV01000003.1 | GCA006716905_03480 | gene | open | 555534-555995 | |||
| 7172 | VFPV01000003.1 | GCA006716905_03481 | gene | open | 556164-557297 | |||
| 7173 | VFPV01000003.1 | GCA006716905_03482 | gene | open | 557522-559747 | |||
| 7174 | VFPV01000003.1 | GCA006716905_03483 | gene | open | 559789-561195 | |||
| 7175 | VFPV01000003.1 | GCA006716905_03484 | gene | open | 561404-561616 | rpsU | ||
| 7176 | VFPV01000003.1 | GCA006716905_03485 | gene | open | 561809-562255 | |||
| 7177 | VFPV01000003.1 | GCA006716905_03486 | gene | open | 562361-563296 | |||
| 7178 | VFPV01000003.1 | GCA006716905_03487 | gene | open | 563293-564228 | lysR | ||
| 7179 | VFPV01000003.1 | GCA006716905_03488 | gene | open | 564325-565413 | leuB | ||
| 7180 | VFPV01000003.1 | GCA006716905_03489 | gene | open | 565561-566994 | pmbA | ||
| 7181 | VFPV01000003.1 | GCA006716905_03490 | gene | open | 567059-567724 | yjgA | ||
| 7182 | VFPV01000003.1 | GCA006716905_03491 | gene | open | 567717-568325 | mog | ||
| 7183 | VFPV01000003.1 | GCA006716905_03492 | gene | open | 568418-568774 | pilZ | ||
| 7184 | VFPV01000003.1 | GCA006716905_03493 | gene | open | 568857-569636 | cysE | ||
| 7185 | VFPV01000003.1 | GCA006716905_03494 | gene | open | 569670-570488 | |||
| 7186 | VFPV01000003.1 | GCA006716905_03495 | gene | open | 570659-571573 | |||
| 7187 | VFPV01000003.1 | GCA006716905_03496 | gene | open | 571628-572758 | cheY | ||
| 7188 | VFPV01000003.1 | GCA006716905_03497 | gene | open | 572783-577090 | |||
| 7189 | VFPV01000003.1 | GCA006716905_03498 | gene | open | 577143-577700 | |||
| 7190 | VFPV01000003.1 | GCA006716905_03499 | gene | open | 577841-580336 | |||
| 7191 | VFPV01000003.1 | GCA006716905_03500 | gene | open | 580612-583233 | mutS | ||
| 7192 | VFPV01000003.1 | GCA006716905_03501 | gene | open | 583292-586327 | |||
| 7193 | VFPV01000003.1 | GCA006716905_03502 | gene | open | 586329-586592 | |||
| 7194 | VFPV01000003.1 | GCA006716905_03503 | gene | open | 586611-587819 | |||
| 7195 | VFPV01000003.1 | GCA006716905_03504 | gene | open | 588296-589123 | |||
| 7196 | VFPV01000003.1 | GCA006716905_03505 | gene | open | 589162-590001 | |||
| 7197 | VFPV01000003.1 | GCA006716905_03506 | gene | open | 590596-592185 | |||
| 7198 | VFPV01000003.1 | GCA006716905_03507 | gene | open | 592238-593173 | |||
| 7199 | VFPV01000003.1 | GCA006716905_03508 | gene | open | 593170-593994 | |||
| 7200 | VFPV01000003.1 | GCA006716905_03509 | gene | open | 594406-594687 | |||
| 7201 | VFPV01000003.1 | GCA006716905_03510 | gene | open | 594835-596103 | |||
| 7202 | VFPV01000003.1 | GCA006716905_03511 | gene | open | 596169-597653 | |||
| 7203 | VFPV01000003.1 | GCA006716905_03512 | gene | open | 597653-600802 | acrB | ||
| 7204 | VFPV01000003.1 | GCA006716905_03513 | gene | open | 600799-601653 | |||
| 7205 | VFPV01000003.1 | GCA006716905_03514 | gene | open | 601653-604760 | |||
| 7206 | VFPV01000003.1 | GCA006716905_03515 | gene | open | 604827-606248 | |||
| 7207 | VFPV01000003.1 | GCA006716905_03516 | gene | open | 606445-607083 | |||
| 7208 | VFPV01000003.1 | GCA006716905_03517 | gene | open | 607192-607560 | |||
| 7209 | VFPV01000003.1 | GCA006716905_03518 | gene | open | 607702-608670 | |||
| 7210 | VFPV01000003.1 | GCA006716905_03519 | gene | open | 608838-609008 | |||
| 7211 | VFPV01000003.1 | GCA006716905_03520 | gene | open | 609116-611650 | |||
| 7212 | VFPV01000003.1 | GCA006716905_03521 | gene | open | 611653-612447 | |||
| 7213 | VFPV01000003.1 | GCA006716905_03522 | gene | open | 612551-612922 | |||
| 7214 | VFPV01000003.1 | GCA006716905_03523 | gene | open | 613046-613735 | |||
| 7215 | VFPV01000003.1 | GCA006716905_03524 | gene | open | 613732-614511 | |||
| 7216 | VFPV01000003.1 | GCA006716905_03525 | gene | open | 614646-615335 | |||
| 7217 | VFPV01000003.1 | GCA006716905_03526 | gene | open | 615340-616404 | |||
| 7218 | VFPV01000003.1 | GCA006716905_03527 | gene | open | 616435-617064 | |||
| 7219 | VFPV01000003.1 | GCA006716905_03528 | gene | open | 617107-618372 | |||
| 7220 | VFPV01000003.1 | GCA006716905_03529 | gene | open | 618369-619280 | |||
| 7221 | VFPV01000003.1 | GCA006716905_03530 | gene | open | 619610-620404 | |||
| 7222 | VFPV01000003.1 | GCA006716905_03531 | gene | open | 620417-622804 | coxL | ||
| 7223 | VFPV01000003.1 | GCA006716905_03532 | gene | open | 622826-623296 | cutS | ||
| 7224 | VFPV01000003.1 | GCA006716905_03533 | gene | open | 623533-624642 | |||
| 7225 | VFPV01000003.1 | GCA006716905_03534 | gene | open | 624725-625480 | modE | ||
| 7226 | VFPV01000003.1 | GCA006716905_03535 | gene | open | 625589-626353 | modA | ||
| 7227 | VFPV01000003.1 | GCA006716905_03536 | gene | open | 626436-627116 | modB | ||
| 7228 | VFPV01000003.1 | GCA006716905_03537 | gene | open | 627119-628231 | modC | ||
| 7229 | VFPV01000003.1 | GCA006716905_03538 | gene | open | 628490-630166 | |||
| 7230 | VFPV01000003.1 | GCA006716905_03539 | gene | open | 630288-631412 | |||
| 7231 | VFPV01000003.1 | GCA006716905_03540 | gene | open | 631420-631956 | |||
| 7232 | VFPV01000003.1 | GCA006716905_03541 | gene | open | 631953-632381 | |||
| 7233 | VFPV01000003.1 | GCA006716905_03542 | gene | open | 632392-632868 | |||
| 7234 | VFPV01000003.1 | GCA006716905_03543 | gene | open | 632925-634622 | ubiB | ||
| 7235 | VFPV01000003.1 | GCA006716905_03544 | gene | open | 634717-635565 | |||
| 7236 | VFPV01000003.1 | GCA006716905_03545 | gene | open | 635571-636398 | |||
| 7237 | VFPV01000003.1 | GCA006716905_03546 | gene | open | 636395-637135 | |||
| 7238 | VFPV01000003.1 | GCA006716905_03547 | gene | open | 637132-637869 | |||
| 7239 | VFPV01000003.1 | GCA006716905_03548 | gene | open | 637920-639047 | lysR | ||
| 7240 | VFPV01000003.1 | GCA006716905_03549 | gene | open | 639229-639846 | |||
| 7241 | VFPV01000003.1 | GCA006716905_03550 | gene | open | 639865-641634 | dctM | ||
| 7242 | VFPV01000003.1 | GCA006716905_03551 | gene | open | 642142-643221 | |||
| 7243 | VFPV01000003.1 | GCA006716905_03552 | gene | open | 643364-644446 | |||
| 7244 | VFPV01000003.1 | GCA006716905_03553 | gene | open | 644788-646683 | dxs | ||
| 7245 | VFPV01000003.1 | GCA006716905_03554 | gene | open | 646785-647741 | |||
| 7246 | VFPV01000003.1 | GCA006716905_03555 | gene | open | 647738-647980 | xseB | ||
| 7247 | VFPV01000003.1 | GCA006716905_03556 | gene | open | 648289-649428 | |||
| 7248 | VFPV01000003.1 | GCA006716905_03557 | gene | open | 649606-650517 | |||
| 7249 | VFPV01000003.1 | GCA006716905_03558 | gene | open | 650617-651516 | |||
| 7250 | VFPV01000003.1 | GCA006716905_03559 | gene | open | 651700-652074 | flhD | ||
| 7251 | VFPV01000003.1 | GCA006716905_03560 | gene | open | 652132-652680 | flhC | ||
| 7252 | VFPV01000003.1 | GCA006716905_03561 | gene | open | 652793-653341 | flgO | ||
| 7253 | VFPV01000003.1 | GCA006716905_03562 | gene | open | 653352-654119 | |||
| 7254 | VFPV01000003.1 | GCA006716905_03563 | gene | open | 654259-655488 | |||
| 7255 | VFPV01000003.1 | GCA006716905_03564 | gene | open | 655709-656992 | perM | ||
| 7256 | VFPV01000003.1 | GCA006716905_03565 | gene | open | 657227-658339 | |||
| 7257 | VFPV01000003.1 | GCA006716905_03566 | gene | open | 658513-660858 | |||
| 7258 | VFPV01000003.1 | GCA006716905_03567 | gene | open | 660919-663708 | ppc | ||
| 7259 | VFPV01000003.1 | GCA006716905_03568 | gene | open | 663847-664791 | hemC | ||
| 7260 | VFPV01000003.1 | GCA006716905_03569 | gene | open | 664809-665618 | |||
| 7261 | VFPV01000003.1 | GCA006716905_03570 | gene | open | 665615-666727 | |||
| 7262 | VFPV01000003.1 | GCA006716905_03571 | gene | open | 666742-668022 | hemY | ||
| 7263 | VFPV01000003.1 | GCA006716905_03572 | gene | open | 668366-668941 | |||
| 7264 | VFPV01000003.1 | GCA006716905_03573 | gene | open | 669031-669600 | |||
| 7265 | VFPV01000003.1 | GCA006716905_03574 | gene | open | 669678-670253 | |||
| 7266 | VFPV01000003.1 | GCA006716905_03575 | gene | open | 670391-671014 | |||
| 7267 | VFPV01000003.1 | GCA006716905_03576 | gene | open | 671175-672056 | |||
| 7268 | VFPV01000003.1 | GCA006716905_03577 | gene | open | 672206-673165 | |||
| 7269 | VFPV01000003.1 | GCA006716905_03578 | gene | open | 673347-674543 | caiA | ||
| 7270 | VFPV01000003.1 | GCA006716905_03579 | gene | open | 674614-675873 | |||
| 7271 | VFPV01000003.1 | GCA006716905_03580 | gene | open | 675971-676939 | |||
| 7272 | VFPV01000003.1 | GCA006716905_03581 | gene | open | 677220-678803 | |||
| 7273 | VFPV01000003.1 | GCA006716905_03582 | gene | open | 678846-680018 | ppk2 | ||
| 7274 | VFPV01000003.1 | GCA006716905_03583 | gene | open | 680773-681732 | |||
| 7275 | VFPV01000003.1 | GCA006716905_03584 | gene | open | 681925-682431 | |||
| 7276 | VFPV01000003.1 | GCA006716905_03585 | gene | open | 682453-683178 | |||
| 7277 | VFPV01000003.1 | GCA006716905_03586 | gene | open | 683163-684140 | |||
| 7278 | VFPV01000003.1 | GCA006716905_03587 | gene | open | 684339-685409 | |||
| 7279 | VFPV01000003.1 | GCA006716905_03588 | gene | open | 685586-686563 | |||
| 7280 | VFPV01000003.1 | GCA006716905_03589 | gene | open | 686616-687125 | folK | ||
| 7281 | VFPV01000003.1 | GCA006716905_03590 | gene | open | 687122-688708 | |||
| 7282 | VFPV01000003.1 | GCA006716905_03591 | gene | open | 688763-689482 | |||
| 7283 | VFPV01000003.1 | GCA006716905_03592 | gene | open | 689555-690253 | hda | ||
| 7284 | VFPV01000003.1 | GCA006716905_03593 | gene | open | 690429-691481 | purM | ||
| 7285 | VFPV01000003.1 | GCA006716905_03594 | gene | open | 691508-692635 | |||
| 7286 | VFPV01000003.1 | GCA006716905_03595 | gene | open | 692842-694437 | |||
| 7287 | VFPV01000003.1 | GCA006716905_03596 | gene | open | 694515-695606 | |||
| 7288 | VFPV01000003.1 | GCA006716905_03597 | gene | open | 695978-696892 | ppk2 | ||
| 7289 | VFPV01000003.1 | GCA006716905_03598 | gene | open | 697049-698119 | corA | ||
| 7290 | VFPV01000003.1 | GCA006716905_03599 | gene | open | 698196-699062 | |||
| 7291 | VFPV01000003.1 | GCA006716905_03600 | gene | open | 699089-699940 | |||
| 7292 | VFPV01000003.1 | GCA006716905_03601 | gene | open | 700036-701601 | murJ | ||
| 7293 | VFPV01000003.1 | GCA006716905_03602 | gene | open | 701708-701839 | |||
| 7294 | VFPV01000003.1 | GCA006716905_03603 | gene | open | 701826-702125 | rpsT | ||
| 7295 | VFPV01000003.1 | GCA006716905_03604 | gene | open | 702349-702672 | |||
| 7296 | VFPV01000003.1 | GCA006716905_03605 | gene | open | 702913-704109 | |||
| 7297 | VFPV01000003.1 | GCA006716905_03606 | gene | open | 704147-705067 | argF | ||
| 7298 | VFPV01000003.1 | GCA006716905_03607 | gene | open | 705064-705228 | |||
| 7299 | VFPV01000003.1 | GCA006716905_03608 | gene | open | 705241-705918 | |||
| 7300 | VFPV01000003.1 | GCA006716905_03609 | gene | open | 706043-706276 | |||
| 7301 | VFPV01000003.1 | GCA006716905_03610 | gene | open | 706276-708207 | feoB | ||
| 7302 | VFPV01000003.1 | GCA006716905_03611 | gene | open | 708204-708545 | |||
| 7303 | VFPV01000003.1 | GCA006716905_03612 | gene | open | 708862-709908 | |||
| 7304 | VFPV01000003.1 | GCA006716905_03613 | gene | open | 710191-710832 | kynB | ||
| 7305 | VFPV01000003.1 | GCA006716905_03614 | gene | open | 710923-712272 | kynU | ||
| 7306 | VFPV01000003.1 | GCA006716905_03615 | gene | open | 712291-713178 | kynA | ||
| 7307 | VFPV01000003.1 | GCA006716905_03616 | gene | open | 713311-714300 | |||
| 7308 | VFPV01000003.1 | GCA006716905_03617 | gene | open | 714604-715797 | |||
| 7309 | VFPV01000003.1 | GCA006716905_03618 | gene | open | 715863-717101 | |||
| 7310 | VFPV01000003.1 | GCA006716905_03619 | gene | open | 717192-720119 | acnA | ||
| 7311 | VFPV01000003.1 | GCA006716905_03620 | gene | open | 720729-721016 | |||
| 7312 | VFPV01000003.1 | GCA006716905_03621 | gene | open | 721377-722222 | |||
| 7313 | VFPV01000003.1 | GCA006716905_03622 | gene | open | 722286-723326 | |||
| 7314 | VFPV01000003.1 | GCA006716905_03623 | gene | open | 723337-723753 | |||
| 7315 | VFPV01000003.1 | GCA006716905_03624 | gene | open | 724077-724367 | |||
| 7316 | VFPV01000003.1 | GCA006716905_03625 | gene | open | 724357-726279 | nosZ | ||
| 7317 | VFPV01000003.1 | GCA006716905_03626 | gene | open | 726509-729130 | |||
| 7318 | VFPV01000003.1 | GCA006716905_03627 | gene | open | 729130-730407 | nosD | ||
| 7319 | VFPV01000003.1 | GCA006716905_03628 | gene | open | 730442-731332 | |||
| 7320 | VFPV01000003.1 | GCA006716905_03629 | gene | open | 731336-732151 | |||
| 7321 | VFPV01000003.1 | GCA006716905_03630 | gene | open | 732148-732726 | nosL | ||
| 7322 | VFPV01000003.1 | GCA006716905_03631 | gene | open | 732729-733397 | nosL | ||
| 7323 | VFPV01000003.1 | GCA006716905_03632 | gene | open | 733513-735006 | |||
| 7324 | VFPV01000003.1 | GCA006716905_03633 | gene | open | 735210-736085 | ypfJ | ||
| 7325 | VFPV01000003.1 | GCA006716905_03634 | gene | open | 736370-738082 | |||
| 7326 | VFPV01000003.1 | GCA006716905_03635 | gene | open | 738138-738710 | dcd | ||
| 7327 | VFPV01000003.1 | GCA006716905_03636 | gene | open | 738831-739307 | |||
| 7328 | VFPV01000003.1 | GCA006716905_03637 | gene | open | 739476-740777 | guaD | ||
| 7329 | VFPV01000003.1 | GCA006716905_03638 | gene | open | 740809-741888 | |||
| 7330 | VFPV01000003.1 | GCA006716905_03639 | gene | open | 742071-743165 | |||
| 7331 | VFPV01000003.1 | GCA006716905_03640 | gene | open | 743310-743759 | |||
| 7332 | VFPV01000003.1 | GCA006716905_03641 | gene | open | 743769-744818 | |||
| 7333 | VFPV01000003.1 | GCA006716905_03642 | gene | open | 744944-746107 | med | ||
| 7334 | VFPV01000003.1 | GCA006716905_03643 | gene | open | 746163-747083 | |||
| 7335 | VFPV01000003.1 | GCA006716905_03644 | gene | open | 747083-748153 | nupP | ||
| 7336 | VFPV01000003.1 | GCA006716905_03645 | gene | open | 748146-749741 | nupO | ||
| 7337 | VFPV01000003.1 | GCA006716905_03646 | gene | open | 749832-750764 | lysR | ||
| 7338 | VFPV01000003.1 | GCA006716905_03647 | gene | open | 750864-752399 | xdhA | ||
| 7339 | VFPV01000003.1 | GCA006716905_03648 | gene | open | 752396-754747 | xdhB | ||
| 7340 | VFPV01000003.1 | GCA006716905_03649 | gene | open | 754768-756813 | |||
| 7341 | VFPV01000003.1 | GCA006716905_03650 | gene | open | 757222-757845 | |||
| 7342 | VFPV01000003.1 | GCA006716905_03651 | gene | open | 758214-758873 | |||
| 7343 | VFPV01000003.1 | GCA006716905_03652 | gene | open | 758821-759252 | |||
| 7344 | VFPV01000003.1 | GCA006716905_03653 | gene | open | 759596-761395 | |||
| 7345 | VFPV01000003.1 | GCA006716905_03654 | gene | open | 761440-762666 | |||
| 7346 | VFPV01000003.1 | GCA006716905_03655 | gene | open | 762884-763690 | xdhC | ||
| 7347 | VFPV01000003.1 | GCA006716905_03656 | gene | open | 763774-764310 | tonB | ||
| 7348 | VFPV01000003.1 | GCA006716905_03657 | gene | open | 764448-764798 | uraH | ||
| 7349 | VFPV01000003.1 | GCA006716905_03658 | gene | open | 765009-766793 | ggt | ||
| 7350 | VFPV01000003.1 | GCA006716905_03659 | gene | open | 767106-768314 | |||
| 7351 | VFPV01000003.1 | GCA006716905_03660 | gene | open | 768437-768727 | |||
| 7352 | VFPV01000003.1 | GCA006716905_03661 | gene | open | 768786-770102 | |||
| 7353 | VFPV01000003.1 | GCA006716905_03662 | gene | open | 770144-771133 | tctC | ||
| 7354 | VFPV01000003.1 | GCA006716905_03663 | gene | open | 771226-772305 | leuB | ||
| 7355 | VFPV01000003.1 | GCA006716905_03664 | gene | open | 772426-773340 | lysR | ||
| 7356 | VFPV01000003.1 | GCA006716905_03665 | gene | open | 773392-774066 | gntR | ||
| 7357 | VFPV01000003.1 | GCA006716905_03666 | gene | open | 774090-775040 | puuE | ||
| 7358 | VFPV01000003.1 | GCA006716905_03667 | gene | open | 775105-776883 | |||
| 7359 | VFPV01000003.1 | GCA006716905_03668 | gene | open | 776880-778115 | argE | ||
| 7360 | VFPV01000003.1 | GCA006716905_03669 | gene | open | 778510-780819 | |||
| 7361 | VFPV01000003.1 | GCA006716905_03670 | gene | open | 780905-781171 | |||
| 7362 | VFPV01000003.1 | GCA006716905_03671 | gene | open | 781577-782605 | tauA | ||
| 7363 | VFPV01000003.1 | GCA006716905_03672 | gene | open | 782686-783510 | tauB | ||
| 7364 | VFPV01000003.1 | GCA006716905_03673 | gene | open | 783535-784302 | |||
| 7365 | VFPV01000003.1 | GCA006716905_03674 | gene | open | 784464-785516 | |||
| 7366 | VFPV01000003.1 | GCA006716905_03675 | gene | open | 785745-786725 | tctC | ||
| 7367 | VFPV01000003.1 | GCA006716905_03676 | gene | open | 786828-787610 | gntR | ||
| 7368 | VFPV01000003.1 | GCA006716905_03677 | gene | open | 787815-789182 | gntT | ||
| 7369 | VFPV01000003.1 | GCA006716905_03678 | gene | open | 789220-790134 | ltnD | ||
| 7370 | VFPV01000003.1 | GCA006716905_03679 | gene | open | 790131-791408 | otnK | ||
| 7371 | VFPV01000003.1 | GCA006716905_03680 | gene | open | 791405-792115 | araD | ||
| 7372 | VFPV01000003.1 | GCA006716905_03681 | gene | open | 792150-792947 | otnI | ||
| 7373 | VFPV01000003.1 | GCA006716905_03682 | gene | open | 792963-793958 | cpdA | ||
| 7374 | VFPV01000003.1 | GCA006716905_03683 | gene | open | 793964-795025 | |||
| 7375 | VFPV01000003.1 | GCA006716905_03684 | gene | open | 795356-796186 | |||
| 7376 | VFPV01000003.1 | GCA006716905_03685 | gene | open | 796198-797925 | pccA | ||
| 7377 | VFPV01000003.1 | GCA006716905_03686 | gene | open | 798105-799721 | pxpB | ||
| 7378 | VFPV01000003.1 | GCA006716905_03687 | gene | open | 799768-800580 | |||
| 7379 | VFPV01000003.1 | GCA006716905_03688 | gene | open | 800613-801380 | |||
| 7380 | VFPV01000003.1 | GCA006716905_03689 | gene | open | 801742-801906 | |||
| 7381 | VFPV01000003.1 | GCA006716905_03107 | gene | open | 153997-154071 | trnV | ||
| 7382 | VFPV01000003.1 | GCA006716905_03108 | gene | open | 154119-154193 | trnV | ||
| 7383 | VFPV01000003.1 | GCA006716905_03249 | gene | open | 317490-317563 | trnG | ||
| 7384 | VFPV01000003.1 | GCA006716905_03316 | gene | open | 386833-386909 | trnP | ||
| 7385 | VFPV01000003.1 | GCA006716905_03336 | gene | open | 406603-406695 | trnS | ||
| 7386 | VFPV01000003.1 | GCA006716905_03107 | tRNA | open | 153997-154071 | trnV | tRNA-Val(cac) | |
| 7387 | VFPV01000003.1 | GCA006716905_03108 | tRNA | open | 154119-154193 | trnV | tRNA-Val(cac) | |
| 7388 | VFPV01000003.1 | GCA006716905_03249 | tRNA | open | 317490-317563 | trnG | tRNA-Gly(ccc) | |
| 7389 | VFPV01000003.1 | GCA006716905_03316 | tRNA | open | 386833-386909 | trnP | tRNA-Pro(tgg) | |
| 7390 | VFPV01000003.1 | GCA006716905_03336 | tRNA | open | 406603-406695 | trnS | tRNA-Ser(gct) | |
| 7391 | VFPV01000004.1 | GCA006716905_03969 | gene | open | 296734-296824 | anti-hemB | ||
| 7392 | VFPV01000004.1 | GCA006716905_03969 | ncRNA | open | 296734-296824 | Burkholderia RNA 7 (anti-hemB) | ||
| 7393 | VFPV01000004.1 | regulatory_region | open | 64225-64461 | Cobalamin riboswitch aptamer | |||
| 7394 | VFPV01000004.1 | regulatory_region | open | 173748-173857 | SAH (S-adenosyl-L-homocysteine) riboswitch aptamer | |||
| 7395 | VFPV01000004.1 | repeat_region | open | 183958-184788 | CRISPR array with 13 repeats of length 31%2C consensus sequence AGTCTAGATCACTGGGATATGCGCACTGGCC and spacer length 34 | |||
| 7396 | VFPV01000004.1 | GCA006716905_03690 | CDS | open | 25-1689 | _na 554_aa | hypothetical protein | |
| 7397 | VFPV01000004.1 | GCA006716905_03691 | CDS | open | 2050-2481 | _na 143_aa | tnpA | IS200/IS605 family transposase |
| 7398 | VFPV01000004.1 | GCA006716905_03692 | CDS | open | 2669-4681 | _na 670_aa | Iron complex outermembrane receptor protein | |
| 7399 | VFPV01000004.1 | GCA006716905_03693 | CDS | open | 4685-5227 | _na 180_aa | Membrane protein | |
| 7400 | VFPV01000004.1 | GCA006716905_03694 | CDS | open | 5224-7131 | _na 635_aa | Diguanylate cyclase | |
| 7401 | VFPV01000004.1 | GCA006716905_03695 | CDS | open | 7496-9184 | _na 562_aa | leuA | 2-isopropylmalate synthase |
| 7402 | VFPV01000004.1 | GCA006716905_03696 | CDS | open | 9323-9826 | _na 167_aa | Hydrolase Nlp/P60 | |
| 7403 | VFPV01000004.1 | GCA006716905_03697 | CDS | open | 9875-10984 | _na 369_aa | aroG1 | 3-deoxy-7-phosphoheptulonate synthase |
| 7404 | VFPV01000004.1 | GCA006716905_03698 | CDS | open | 11220-15770 | _na 1516_aa | Diguanylate cyclase/phosphodiesterase with PAS/PAC sensor(S) | |
| 7405 | VFPV01000004.1 | GCA006716905_03699 | CDS | open | 16892-17446 | _na 184_aa | LTXXQ motif family protein | |
| 7406 | VFPV01000004.1 | GCA006716905_03700 | CDS | open | 17810-18850 | _na 346_aa | rdgC | Recombination-associated protein RdgC |
| 7407 | VFPV01000004.1 | GCA006716905_03701 | CDS | open | 18937-20055 | _na 372_aa | glycerophosphodiester phosphodiesterase | |
| 7408 | VFPV01000004.1 | GCA006716905_03702 | CDS | open | 20195-21361 | _na 388_aa | mbtN | Acyl-[acyl-carrier-protein] dehydrogenase MbtN |
| 7409 | VFPV01000004.1 | GCA006716905_03703 | CDS | open | 21423-22610 | _na 395_aa | paaJ | Acetyl-CoA acetyltransferase |
| 7410 | VFPV01000004.1 | GCA006716905_03704 | CDS | open | 22638-23441 | _na 267_aa | Enoyl-CoA hydratase | |
| 7411 | VFPV01000004.1 | GCA006716905_03705 | CDS | open | 23512-25347 | _na 611_aa | fAA1 | Long-chain-fatty-acid--CoA ligase |
| 7412 | VFPV01000004.1 | GCA006716905_03706 | CDS | open | 25344-26165 | _na 273_aa | Amino acid/amide ABC transporter ATP-binding protein 2%2C HAAT family | |
| 7413 | VFPV01000004.1 | GCA006716905_03707 | CDS | open | 26299-27489 | _na 396_aa | livK | Amino acid ABC transporter substrate-binding protein |
| 7414 | VFPV01000004.1 | GCA006716905_03708 | CDS | open | 27568-28605 | _na 345_aa | livM | ABC-type transporter%2C integral membrane subunit |
| 7415 | VFPV01000004.1 | GCA006716905_03709 | CDS | open | 28618-29499 | _na 293_aa | livH | Branched-chain amino acid ABC transporter permease |
| 7416 | VFPV01000004.1 | GCA006716905_03710 | CDS | open | 29496-30368 | _na 290_aa | livG | Sulfate-transporting ATPase |
| 7417 | VFPV01000004.1 | GCA006716905_03711 | CDS | open | 30500-31258 | _na 252_aa | tetR | TetR family transcriptional regulator |
| 7418 | VFPV01000004.1 | GCA006716905_03712 | CDS | open | 31283-32284 | _na 333_aa | iS5 | IS5 family transposase |
| 7419 | VFPV01000004.1 | GCA006716905_03713 | CDS | open | 32409-35888 | _na 1159_aa | type I site-specific deoxyribonuclease | |
| 7420 | VFPV01000004.1 | GCA006716905_03714 | CDS | open | 35885-36139 | _na 84_aa | Helix-turn-helix protein | |
| 7421 | VFPV01000004.1 | GCA006716905_03715 | CDS | open | 36652-36777 | _na 41_aa | hypothetical protein | |
| 7422 | VFPV01000004.1 | GCA006716905_03716 | CDS | open | 36774-37142 | _na 122_aa | DUF86 domain-containing protein | |
| 7423 | VFPV01000004.1 | GCA006716905_03717 | CDS | open | 37139-37429 | _na 96_aa | Polymerase nucleotidyl transferase domain-containing protein | |
| 7424 | VFPV01000004.1 | GCA006716905_03718 | CDS | open | 37464-38633 | _na 389_aa | Type I restriction enzyme S subunit | |
| 7425 | VFPV01000004.1 | GCA006716905_03719 | CDS | open | 38630-40192 | _na 520_aa | site-specific DNA-methyltransferase (adenine-specific) | |
| 7426 | VFPV01000004.1 | GCA006716905_03720 | CDS | open | 40322-40810 | _na 162_aa | cueR | Cu(I)-responsive transcriptional regulator |
| 7427 | VFPV01000004.1 | GCA006716905_03721 | CDS | open | 40807-41007 | _na 66_aa | Copper chaperone | |
| 7428 | VFPV01000004.1 | GCA006716905_03722 | CDS | open | 41142-43463 | _na 773_aa | Metal ABC transporter ATPase | |
| 7429 | VFPV01000004.1 | GCA006716905_03723 | CDS | open | 43584-45239 | _na 551_aa | Chemotaxis protein | |
| 7430 | VFPV01000004.1 | GCA006716905_03724 | CDS | open | 45379-45714 | _na 111_aa | Hemerythrin-like domain-containing protein | |
| 7431 | VFPV01000004.1 | GCA006716905_03725 | CDS | open | 45746-46849 | _na 367_aa | N-ethylmaleimide reductase | |
| 7432 | VFPV01000004.1 | GCA006716905_03726 | CDS | open | 47101-47706 | _na 201_aa | gstA | glutathione transferase GstA |
| 7433 | VFPV01000004.1 | GCA006716905_03727 | CDS | open | 47819-48808 | _na 329_aa | Roadblock/LAMTOR2 domain-containing protein | |
| 7434 | VFPV01000004.1 | GCA006716905_03728 | CDS | open | 48858-49052 | _na 64_aa | ykgJ | YkgJ family cysteine cluster protein |
| 7435 | VFPV01000004.1 | GCA006716905_03729 | CDS | open | 49186-49791 | _na 201_aa | NADPH-dependent FMN reductase | |
| 7436 | VFPV01000004.1 | GCA006716905_03730 | CDS | open | 50000-51976 | _na 658_aa | mnmG | tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG |
| 7437 | VFPV01000004.1 | GCA006716905_03731 | CDS | open | 51973-52659 | _na 228_aa | rsmG | 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG |
| 7438 | VFPV01000004.1 | GCA006716905_03732 | CDS | open | 52703-54148 | _na 481_aa | Putative ATP-binding protein involved in virulence | |
| 7439 | VFPV01000004.1 | GCA006716905_03733 | CDS | open | 54148-55053 | _na 301_aa | DUF4435 domain-containing protein | |
| 7440 | VFPV01000004.1 | GCA006716905_03734 | CDS | open | 55068-55682 | _na 204_aa | lysE | Amino acid transporter LysE |
| 7441 | VFPV01000004.1 | GCA006716905_03735 | CDS | open | 55698-56498 | _na 266_aa | parA | Chromosome segregation ATPase |
| 7442 | VFPV01000004.1 | GCA006716905_03736 | CDS | open | 56524-57072 | _na 182_aa | Alpha/beta hydrolase | |
| 7443 | VFPV01000004.1 | GCA006716905_03737 | CDS | open | 57108-58025 | _na 305_aa | parB | Chromosome partitioning protein ParB |
| 7444 | VFPV01000004.1 | GCA006716905_03738 | CDS | open | 58331-59077 | _na 248_aa | Methyltransferase type 12 | |
| 7445 | VFPV01000004.1 | GCA006716905_03739 | CDS | open | 59414-60934 | _na 506_aa | Lipoprotein | |
| 7446 | VFPV01000004.1 | GCA006716905_03740 | CDS | open | 60992-61387 | _na 131_aa | DUF1425 domain-containing protein | |
| 7447 | VFPV01000004.1 | GCA006716905_03741 | CDS | open | 61564-62196 | _na 210_aa | lpoB | penicillin-binding protein activator LpoB |
| 7448 | VFPV01000004.1 | GCA006716905_03742 | CDS | open | 62208-63173 | _na 321_aa | csgG | Curli production assembly/transport component CsgG |
| 7449 | VFPV01000004.1 | GCA006716905_03743 | CDS | open | 63207-64208 | _na 333_aa | Alpha/beta hydrolase | |
| 7450 | VFPV01000004.1 | GCA006716905_03744 | CDS | open | 64618-65424 | _na 268_aa | cobM | precorrin-4 C(11)-methyltransferase |
| 7451 | VFPV01000004.1 | GCA006716905_03745 | CDS | open | 65424-66479 | _na 351_aa | cbiX | Cobalamin biosynthesis protein CbiX |
| 7452 | VFPV01000004.1 | GCA006716905_03746 | CDS | open | 66476-67162 | _na 228_aa | Precorrin-8X methylmutase | |
| 7453 | VFPV01000004.1 | GCA006716905_03747 | CDS | open | 67170-68312 | _na 380_aa | cobalt-precorrin-5B (C(1))-methyltransferase | |
| 7454 | VFPV01000004.1 | GCA006716905_03748 | CDS | open | 68309-69649 | _na 446_aa | Precorrin-6Y C5%2C15-methyltransferase | |
| 7455 | VFPV01000004.1 | GCA006716905_03749 | CDS | open | 69646-70500 | _na 284_aa | cobI | precorrin-2 C(20)-methyltransferase |
| 7456 | VFPV01000004.1 | GCA006716905_03750 | CDS | open | 70497-71306 | _na 269_aa | Cobalt-precorrin 5A hydrolase | |
| 7457 | VFPV01000004.1 | GCA006716905_03751 | CDS | open | 71310-71780 | _na 156_aa | Cobalt-precorrin 5A hydrolase | |
| 7458 | VFPV01000004.1 | GCA006716905_03752 | CDS | open | 71794-72462 | _na 222_aa | cbiM | Cobalamin biosynthesis protein CbiM |
| 7459 | VFPV01000004.1 | GCA006716905_03753 | CDS | open | 72501-73490 | _na 329_aa | Precorrin-3B C17-methyltransferase | |
| 7460 | VFPV01000004.1 | GCA006716905_03754 | CDS | open | 73487-73882 | _na 131_aa | NADH dehydrogenase | |
| 7461 | VFPV01000004.1 | GCA006716905_03755 | CDS | open | 73968-74591 | _na 207_aa | rutF | Flavin reductase (DIM6/NTAB) family NADH-FMN oxidoreductase RutF |
| 7462 | VFPV01000004.1 | GCA006716905_03756 | CDS | open | 74712-75614 | _na 300_aa | Peptide ABC transporter ATP-binding protein | |
| 7463 | VFPV01000004.1 | GCA006716905_03757 | CDS | open | 75921-78515 | _na 864_aa | Diguanylate cyclase (GGDEF)-like protein | |
| 7464 | VFPV01000004.1 | GCA006716905_03758 | CDS | open | 78747-79664 | _na 305_aa | AraC-like DNA-binding protein | |
| 7465 | VFPV01000004.1 | GCA006716905_03759 | CDS | open | 79712-81007 | _na 431_aa | Sugar phosphate permease | |
| 7466 | VFPV01000004.1 | GCA006716905_03760 | CDS | open | 81435-82268 | _na 277_aa | TPR repeat protein | |
| 7467 | VFPV01000004.1 | GCA006716905_03761 | CDS | open | 82538-83911 | _na 457_aa | Alpha/beta hydrolase | |
| 7468 | VFPV01000004.1 | GCA006716905_03762 | CDS | open | 83916-84653 | _na 245_aa | Putative phosphoesterase | |
| 7469 | VFPV01000004.1 | GCA006716905_03763 | CDS | open | 84728-87520 | _na 930_aa | ligase-associated DNA damage response DEXH box helicase | |
| 7470 | VFPV01000004.1 | GCA006716905_03764 | CDS | open | 87517-89205 | _na 562_aa | ATP-dependent DNA ligase | |
| 7471 | VFPV01000004.1 | GCA006716905_03765 | CDS | open | 89202-90329 | _na 375_aa | ligase-associated DNA damage response exonuclease | |
| 7472 | VFPV01000004.1 | GCA006716905_03766 | CDS | open | 90473-90691 | _na 72_aa | Lipoprotein | |
| 7473 | VFPV01000004.1 | GCA006716905_03767 | CDS | open | 90891-90983 | _na 30_aa | hypothetical protein | |
| 7474 | VFPV01000004.1 | GCA006716905_03768 | CDS | open | 91013-92599 | _na 528_aa | ABC transporter substrate-binding protein | |
| 7475 | VFPV01000004.1 | GCA006716905_03769 | CDS | open | 92654-92977 | _na 107_aa | Small multidrug resistance family-3 protein | |
| 7476 | VFPV01000004.1 | GCA006716905_03770 | CDS | open | 93044-94003 | _na 319_aa | Diguanylate cyclase | |
| 7477 | VFPV01000004.1 | GCA006716905_03771 | CDS | open | 94198-95622 | _na 474_aa | glcD | D-lactate dehydrogenase (cytochrome) |
| 7478 | VFPV01000004.1 | GCA006716905_03772 | CDS | open | 95780-96133 | _na 117_aa | EF-hand domain-containing protein | |
| 7479 | VFPV01000004.1 | GCA006716905_03773 | CDS | open | 96644-96994 | _na 116_aa | hypothetical protein | |
| 7480 | VFPV01000004.1 | GCA006716905_03774 | CDS | open | 97043-97612 | _na 189_aa | Cobalamin adenosyltransferase | |
| 7481 | VFPV01000004.1 | GCA006716905_03775 | CDS | open | 97666-98007 | _na 113_aa | SDR family oxidoreductase | |
| 7482 | VFPV01000004.1 | GCA006716905_03776 | CDS | open | 98060-98185 | _na 41_aa | hypothetical protein | |
| 7483 | VFPV01000004.1 | GCA006716905_03777 | CDS | open | 98257-98391 | _na 44_aa | hypothetical protein | |
| 7484 | VFPV01000004.1 | GCA006716905_03778 | CDS | open | 98863-99180 | _na 105_aa | DUF4148 domain-containing protein | |
| 7485 | VFPV01000004.1 | GCA006716905_03779 | CDS | open | 99281-99706 | _na 141_aa | Esterase | |
| 7486 | VFPV01000004.1 | GCA006716905_03780 | CDS | open | 100198-101352 | _na 384_aa | ABC transporter substrate-binding protein | |
| 7487 | VFPV01000004.1 | GCA006716905_03781 | CDS | open | 101445-102599 | _na 384_aa | ABC transporter substrate-binding protein | |
| 7488 | VFPV01000004.1 | GCA006716905_03782 | CDS | open | 102746-103708 | _na 320_aa | IS110 family transposase | |
| 7489 | VFPV01000004.1 | GCA006716905_03783 | CDS | open | 103964-105478 | _na 504_aa | Succinyl-CoA:acetate CoA-transferase | |
| 7490 | VFPV01000004.1 | GCA006716905_03784 | CDS | open | 105709-106521 | _na 270_aa | pcaD | 3-oxoadipate enol-lactonase |
| 7491 | VFPV01000004.1 | GCA006716905_03785 | CDS | open | 106616-107029 | _na 137_aa | hypothetical protein | |
| 7492 | VFPV01000004.1 | GCA006716905_03786 | CDS | open | 107115-108050 | _na 311_aa | catA | catechol 1%2C2-dioxygenase |
| 7493 | VFPV01000004.1 | GCA006716905_03787 | CDS | open | 108114-109316 | _na 400_aa | Muconate cycloisomerase | |
| 7494 | VFPV01000004.1 | GCA006716905_03788 | CDS | open | 109460-110443 | _na 327_aa | lysR | DNA-binding transcriptional LysR family regulator |
| 7495 | VFPV01000004.1 | GCA006716905_03789 | CDS | open | 110498-111784 | _na 428_aa | Uracil-xanthine permease | |
| 7496 | VFPV01000004.1 | GCA006716905_03790 | CDS | open | 112135-112707 | _na 190_aa | hypothetical protein | |
| 7497 | VFPV01000004.1 | GCA006716905_03791 | CDS | open | 112732-113163 | _na 143_aa | Transmembrane protein | |
| 7498 | VFPV01000004.1 | GCA006716905_03792 | CDS | open | 113349-114650 | _na 433_aa | ubiM | 5-demethoxyubiquinol-8 5-hydroxylase UbiM |
| 7499 | VFPV01000004.1 | GCA006716905_03793 | CDS | open | 115056-115886 | _na 276_aa | Peptidase M48 | |
| 7500 | VFPV01000004.1 | GCA006716905_03794 | CDS | open | 116091-118319 | _na 742_aa | acetoacetate--CoA ligase |

