BAKTAGenome Explorer: Acidovorax temperans (GCA_006716905.1)
Select a Genome:
|
BAKTA Annotations for GCA_006716905.1
|
Search & Sort all 8779 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 8001 | VFPV01000004.1 | GCA006716905_03828 | gene | open | 150278-152515 | |||
| 8002 | VFPV01000004.1 | GCA006716905_03829 | gene | open | 152617-154452 | recQ | ||
| 8003 | VFPV01000004.1 | GCA006716905_03830 | gene | open | 154753-155016 | |||
| 8004 | VFPV01000004.1 | GCA006716905_03831 | gene | open | 155032-155475 | |||
| 8005 | VFPV01000004.1 | GCA006716905_03832 | gene | open | 155472-156542 | |||
| 8006 | VFPV01000004.1 | GCA006716905_03833 | gene | open | 156551-157846 | |||
| 8007 | VFPV01000004.1 | GCA006716905_03834 | gene | open | 157901-158098 | |||
| 8008 | VFPV01000004.1 | GCA006716905_03835 | gene | open | 158129-158911 | |||
| 8009 | VFPV01000004.1 | GCA006716905_03836 | gene | open | 159022-159402 | |||
| 8010 | VFPV01000004.1 | GCA006716905_03837 | gene | open | 159452-159823 | |||
| 8011 | VFPV01000004.1 | GCA006716905_03838 | gene | open | 160124-160282 | |||
| 8012 | VFPV01000004.1 | GCA006716905_03839 | gene | open | 160353-161279 | yafY | ||
| 8013 | VFPV01000004.1 | GCA006716905_03840 | gene | open | 161423-162487 | metH1 | ||
| 8014 | VFPV01000004.1 | GCA006716905_03841 | gene | open | 162693-163646 | ttcA | ||
| 8015 | VFPV01000004.1 | GCA006716905_03842 | gene | open | 163683-165119 | yegQ | ||
| 8016 | VFPV01000004.1 | GCA006716905_03843 | gene | open | 165367-166464 | |||
| 8017 | VFPV01000004.1 | GCA006716905_03844 | gene | open | 166711-168018 | |||
| 8018 | VFPV01000004.1 | GCA006716905_03845 | gene | open | 168330-169844 | |||
| 8019 | VFPV01000004.1 | GCA006716905_03846 | gene | open | 169917-171146 | |||
| 8020 | VFPV01000004.1 | GCA006716905_03847 | gene | open | 171210-172121 | |||
| 8021 | VFPV01000004.1 | GCA006716905_03848 | gene | open | 172253-173194 | lysR | ||
| 8022 | VFPV01000004.1 | GCA006716905_03849 | gene | open | 173265-173729 | |||
| 8023 | VFPV01000004.1 | GCA006716905_03850 | gene | open | 173887-176622 | metH | ||
| 8024 | VFPV01000004.1 | GCA006716905_03851 | gene | open | 176849-177118 | |||
| 8025 | VFPV01000004.1 | GCA006716905_03852 | gene | open | 177124-178470 | hipA | ||
| 8026 | VFPV01000004.1 | GCA006716905_03853 | gene | open | 178794-181931 | cas9 | ||
| 8027 | VFPV01000004.1 | GCA006716905_03854 | gene | open | 181937-182866 | cas1 | ||
| 8028 | VFPV01000004.1 | GCA006716905_03855 | gene | open | 182918-183223 | cas2 | ||
| 8029 | VFPV01000004.1 | GCA006716905_03856 | gene | open | 183345-183776 | tnpA | ||
| 8030 | VFPV01000004.1 | GCA006716905_03857 | gene | open | 184819-185208 | ridA | ||
| 8031 | VFPV01000004.1 | GCA006716905_03858 | gene | open | 185342-186250 | lysR | ||
| 8032 | VFPV01000004.1 | GCA006716905_03859 | gene | open | 186424-186783 | |||
| 8033 | VFPV01000004.1 | GCA006716905_03860 | gene | open | 186803-187066 | |||
| 8034 | VFPV01000004.1 | GCA006716905_03861 | gene | open | 187302-188462 | |||
| 8035 | VFPV01000004.1 | GCA006716905_03862 | gene | open | 188602-189165 | |||
| 8036 | VFPV01000004.1 | GCA006716905_03863 | gene | open | 189391-190203 | |||
| 8037 | VFPV01000004.1 | GCA006716905_03864 | gene | open | 190283-191614 | |||
| 8038 | VFPV01000004.1 | GCA006716905_03865 | gene | open | 191756-192676 | |||
| 8039 | VFPV01000004.1 | GCA006716905_03866 | gene | open | 192717-193925 | |||
| 8040 | VFPV01000004.1 | GCA006716905_03867 | gene | open | 193944-195836 | |||
| 8041 | VFPV01000004.1 | GCA006716905_03868 | gene | open | 195833-196600 | |||
| 8042 | VFPV01000004.1 | GCA006716905_03869 | gene | open | 196597-197334 | |||
| 8043 | VFPV01000004.1 | GCA006716905_03870 | gene | open | 197510-199045 | |||
| 8044 | VFPV01000004.1 | GCA006716905_03871 | gene | open | 199271-200002 | |||
| 8045 | VFPV01000004.1 | GCA006716905_03872 | gene | open | 200046-200384 | glnK | ||
| 8046 | VFPV01000004.1 | GCA006716905_03873 | gene | open | 200416-201939 | |||
| 8047 | VFPV01000004.1 | GCA006716905_03874 | gene | open | 202135-203256 | glcE | ||
| 8048 | VFPV01000004.1 | GCA006716905_03875 | gene | open | 203267-204079 | |||
| 8049 | VFPV01000004.1 | GCA006716905_03876 | gene | open | 204131-205384 | glcF | ||
| 8050 | VFPV01000004.1 | GCA006716905_03877 | gene | open | 205588-207330 | |||
| 8051 | VFPV01000004.1 | GCA006716905_03878 | gene | open | 207601-210111 | |||
| 8052 | VFPV01000004.1 | GCA006716905_03879 | gene | open | 210108-210332 | |||
| 8053 | VFPV01000004.1 | GCA006716905_03880 | gene | open | 210384-211118 | |||
| 8054 | VFPV01000004.1 | GCA006716905_03881 | gene | open | 211323-212120 | |||
| 8055 | VFPV01000004.1 | GCA006716905_03882 | gene | open | 212240-213241 | tnp | ||
| 8056 | VFPV01000004.1 | GCA006716905_03883 | gene | open | 213308-213811 | |||
| 8057 | VFPV01000004.1 | GCA006716905_03884 | gene | open | 214076-214591 | |||
| 8058 | VFPV01000004.1 | GCA006716905_03885 | gene | open | 214772-215824 | |||
| 8059 | VFPV01000004.1 | GCA006716905_03886 | gene | open | 215828-216181 | |||
| 8060 | VFPV01000004.1 | GCA006716905_03887 | gene | open | 216226-216864 | |||
| 8061 | VFPV01000004.1 | GCA006716905_03888 | gene | open | 217798-218286 | |||
| 8062 | VFPV01000004.1 | GCA006716905_03889 | gene | open | 218360-219244 | |||
| 8063 | VFPV01000004.1 | GCA006716905_03890 | gene | open | 219357-220661 | lplT | ||
| 8064 | VFPV01000004.1 | GCA006716905_03891 | gene | open | 220799-221905 | alr | ||
| 8065 | VFPV01000004.1 | GCA006716905_03892 | gene | open | 221985-222782 | |||
| 8066 | VFPV01000004.1 | GCA006716905_03893 | gene | open | 222797-222904 | |||
| 8067 | VFPV01000004.1 | GCA006716905_03894 | gene | open | 222942-224786 | |||
| 8068 | VFPV01000004.1 | GCA006716905_03895 | gene | open | 224809-225699 | |||
| 8069 | VFPV01000004.1 | GCA006716905_03896 | gene | open | 225767-226384 | |||
| 8070 | VFPV01000004.1 | GCA006716905_03897 | gene | open | 226459-228039 | |||
| 8071 | VFPV01000004.1 | GCA006716905_03898 | gene | open | 228244-228852 | |||
| 8072 | VFPV01000004.1 | GCA006716905_03899 | gene | open | 228926-229909 | |||
| 8073 | VFPV01000004.1 | GCA006716905_03900 | gene | open | 229963-230814 | hpaI | ||
| 8074 | VFPV01000004.1 | GCA006716905_03901 | gene | open | 230919-232301 | radA | ||
| 8075 | VFPV01000004.1 | GCA006716905_03902 | gene | open | 232383-232796 | |||
| 8076 | VFPV01000004.1 | GCA006716905_03903 | gene | open | 232895-233845 | |||
| 8077 | VFPV01000004.1 | GCA006716905_03904 | gene | open | 233848-234054 | |||
| 8078 | VFPV01000004.1 | GCA006716905_03905 | gene | open | 234070-234885 | |||
| 8079 | VFPV01000004.1 | GCA006716905_03906 | gene | open | 234933-236165 | |||
| 8080 | VFPV01000004.1 | GCA006716905_03907 | gene | open | 236178-237152 | |||
| 8081 | VFPV01000004.1 | GCA006716905_03908 | gene | open | 237356-238477 | |||
| 8082 | VFPV01000004.1 | GCA006716905_03909 | gene | open | 238509-239399 | lysR | ||
| 8083 | VFPV01000004.1 | GCA006716905_03910 | gene | open | 239502-240746 | |||
| 8084 | VFPV01000004.1 | GCA006716905_03911 | gene | open | 240763-242049 | |||
| 8085 | VFPV01000004.1 | GCA006716905_03912 | gene | open | 242053-242772 | ompR | ||
| 8086 | VFPV01000004.1 | GCA006716905_03913 | gene | open | 242927-244300 | |||
| 8087 | VFPV01000004.1 | GCA006716905_03914 | gene | open | 244333-245184 | |||
| 8088 | VFPV01000004.1 | GCA006716905_03915 | gene | open | 245204-246298 | |||
| 8089 | VFPV01000004.1 | GCA006716905_03916 | gene | open | 246575-247213 | gloB | ||
| 8090 | VFPV01000004.1 | GCA006716905_03917 | gene | open | 247327-247662 | |||
| 8091 | VFPV01000004.1 | GCA006716905_03918 | gene | open | 247739-248740 | iS5 | ||
| 8092 | VFPV01000004.1 | GCA006716905_03919 | gene | open | 249282-250253 | |||
| 8093 | VFPV01000004.1 | GCA006716905_03920 | gene | open | 250271-251071 | phnE | ||
| 8094 | VFPV01000004.1 | GCA006716905_03921 | gene | open | 251068-251943 | |||
| 8095 | VFPV01000004.1 | GCA006716905_03922 | gene | open | 252000-252785 | phnC | ||
| 8096 | VFPV01000004.1 | GCA006716905_03923 | gene | open | 252975-253862 | lysR | ||
| 8097 | VFPV01000004.1 | GCA006716905_03925 | gene | open | 254512-254811 | |||
| 8098 | VFPV01000004.1 | GCA006716905_03926 | gene | open | 254944-256068 | |||
| 8099 | VFPV01000004.1 | GCA006716905_03927 | gene | open | 256157-257164 | lhpH | ||
| 8100 | VFPV01000004.1 | GCA006716905_03928 | gene | open | 257194-258135 | lhpI | ||
| 8101 | VFPV01000004.1 | GCA006716905_03929 | gene | open | 258484-259206 | gntR | ||
| 8102 | VFPV01000004.1 | GCA006716905_03930 | gene | open | 259213-261168 | |||
| 8103 | VFPV01000004.1 | GCA006716905_03931 | gene | open | 261178-261981 | |||
| 8104 | VFPV01000004.1 | GCA006716905_03932 | gene | open | 261992-262690 | |||
| 8105 | VFPV01000004.1 | GCA006716905_03933 | gene | open | 262696-263394 | |||
| 8106 | VFPV01000004.1 | GCA006716905_03934 | gene | open | 263501-264949 | gatB | ||
| 8107 | VFPV01000004.1 | GCA006716905_03935 | gene | open | 265059-266552 | gatA | ||
| 8108 | VFPV01000004.1 | GCA006716905_03936 | gene | open | 266561-266860 | gatC | ||
| 8109 | VFPV01000004.1 | GCA006716905_03937 | gene | open | 267077-268120 | mreB | ||
| 8110 | VFPV01000004.1 | GCA006716905_03938 | gene | open | 268251-269168 | mreC | ||
| 8111 | VFPV01000004.1 | GCA006716905_03939 | gene | open | 269224-269742 | mreD | ||
| 8112 | VFPV01000004.1 | GCA006716905_03940 | gene | open | 269846-271786 | mrdA | ||
| 8113 | VFPV01000004.1 | GCA006716905_03941 | gene | open | 271976-272875 | |||
| 8114 | VFPV01000004.1 | GCA006716905_03942 | gene | open | 272961-273713 | |||
| 8115 | VFPV01000004.1 | GCA006716905_03943 | gene | open | 273710-274492 | |||
| 8116 | VFPV01000004.1 | GCA006716905_03944 | gene | open | 274688-275449 | |||
| 8117 | VFPV01000004.1 | GCA006716905_03945 | gene | open | 275666-276424 | |||
| 8118 | VFPV01000004.1 | GCA006716905_03946 | gene | open | 276765-277109 | |||
| 8119 | VFPV01000004.1 | GCA006716905_03947 | gene | open | 277215-278894 | |||
| 8120 | VFPV01000004.1 | GCA006716905_03948 | gene | open | 279056-280279 | |||
| 8121 | VFPV01000004.1 | GCA006716905_03949 | gene | open | 280283-281161 | |||
| 8122 | VFPV01000004.1 | GCA006716905_03950 | gene | open | 281161-282138 | |||
| 8123 | VFPV01000004.1 | GCA006716905_03951 | gene | open | 282157-282861 | |||
| 8124 | VFPV01000004.1 | GCA006716905_03952 | gene | open | 282898-283104 | |||
| 8125 | VFPV01000004.1 | GCA006716905_03953 | gene | open | 283101-283538 | |||
| 8126 | VFPV01000004.1 | GCA006716905_03954 | gene | open | 283876-284094 | csbD | ||
| 8127 | VFPV01000004.1 | GCA006716905_03955 | gene | open | 284167-284748 | tolA | ||
| 8128 | VFPV01000004.1 | GCA006716905_03956 | gene | open | 284917-285423 | |||
| 8129 | VFPV01000004.1 | GCA006716905_03957 | gene | open | 285505-285759 | |||
| 8130 | VFPV01000004.1 | GCA006716905_03958 | gene | open | 285756-287264 | creD | ||
| 8131 | VFPV01000004.1 | GCA006716905_03959 | gene | open | 287492-287641 | |||
| 8132 | VFPV01000004.1 | GCA006716905_03960 | gene | open | 287676-289121 | creC | ||
| 8133 | VFPV01000004.1 | GCA006716905_03961 | gene | open | 289194-289895 | creB | ||
| 8134 | VFPV01000004.1 | GCA006716905_03962 | gene | open | 289902-290537 | marC | ||
| 8135 | VFPV01000004.1 | GCA006716905_03963 | gene | open | 290705-291394 | |||
| 8136 | VFPV01000004.1 | GCA006716905_03964 | gene | open | 291482-291763 | |||
| 8137 | VFPV01000004.1 | GCA006716905_03965 | gene | open | 291848-292459 | |||
| 8138 | VFPV01000004.1 | GCA006716905_03966 | gene | open | 292496-294061 | |||
| 8139 | VFPV01000004.1 | GCA006716905_03967 | gene | open | 294370-295560 | corA | ||
| 8140 | VFPV01000004.1 | GCA006716905_03968 | gene | open | 295571-296578 | hemB | ||
| 8141 | VFPV01000004.1 | GCA006716905_03970 | gene | open | 296902-297333 | |||
| 8142 | VFPV01000004.1 | GCA006716905_03971 | gene | open | 297355-298452 | vanZ | ||
| 8143 | VFPV01000004.1 | GCA006716905_03972 | gene | open | 298462-298821 | |||
| 8144 | VFPV01000004.1 | GCA006716905_03973 | gene | open | 298895-299548 | |||
| 8145 | VFPV01000004.1 | GCA006716905_03974 | gene | open | 299620-300855 | |||
| 8146 | VFPV01000004.1 | GCA006716905_03975 | gene | open | 301022-301399 | rpsL | ||
| 8147 | VFPV01000004.1 | GCA006716905_03976 | gene | open | 301574-302047 | rpsG | ||
| 8148 | VFPV01000004.1 | GCA006716905_03977 | gene | open | 302196-304298 | fusA | ||
| 8149 | VFPV01000004.1 | GCA006716905_03978 | gene | open | 304475-305665 | tuf | ||
| 8150 | VFPV01000004.1 | GCA006716905_03979 | gene | open | 305691-306002 | rpsJ | ||
| 8151 | VFPV01000004.1 | GCA006716905_03980 | gene | open | 306204-306878 | rplC | ||
| 8152 | VFPV01000004.1 | GCA006716905_03981 | gene | open | 306878-307498 | rplD | ||
| 8153 | VFPV01000004.1 | GCA006716905_03982 | gene | open | 307495-307809 | rplW | ||
| 8154 | VFPV01000004.1 | GCA006716905_03983 | gene | open | 307812-308636 | rplB | ||
| 8155 | VFPV01000004.1 | GCA006716905_03984 | gene | open | 308647-308925 | rpsS | ||
| 8156 | VFPV01000004.1 | GCA006716905_03985 | gene | open | 308935-309267 | rplV | ||
| 8157 | VFPV01000004.1 | GCA006716905_03986 | gene | open | 309282-310163 | rpsC | ||
| 8158 | VFPV01000004.1 | GCA006716905_03987 | gene | open | 310166-310582 | rplP | ||
| 8159 | VFPV01000004.1 | GCA006716905_03988 | gene | open | 310599-310793 | rpmC | ||
| 8160 | VFPV01000004.1 | GCA006716905_03989 | gene | open | 310803-311072 | rpsQ | ||
| 8161 | VFPV01000004.1 | GCA006716905_03990 | gene | open | 311185-311691 | aHP1 | ||
| 8162 | VFPV01000004.1 | GCA006716905_03991 | gene | open | 311763-313073 | |||
| 8163 | VFPV01000004.1 | GCA006716905_03992 | gene | open | 313527-313970 | |||
| 8164 | VFPV01000004.1 | GCA006716905_03993 | gene | open | 314301-314972 | |||
| 8165 | VFPV01000004.1 | GCA006716905_03994 | gene | open | 315164-315619 | |||
| 8166 | VFPV01000004.1 | GCA006716905_03995 | gene | open | 315742-316239 | |||
| 8167 | VFPV01000004.1 | GCA006716905_03996 | gene | open | 316476-317036 | |||
| 8168 | VFPV01000004.1 | GCA006716905_03997 | gene | open | 317152-317601 | |||
| 8169 | VFPV01000004.1 | GCA006716905_03998 | gene | open | 317570-317839 | |||
| 8170 | VFPV01000004.1 | GCA006716905_03999 | gene | open | 317895-319634 | |||
| 8171 | VFPV01000004.1 | GCA006716905_04000 | gene | open | 319736-320608 | rhaT | ||
| 8172 | VFPV01000004.1 | GCA006716905_04001 | gene | open | 320697-321464 | araC | ||
| 8173 | VFPV01000004.1 | GCA006716905_04002 | gene | open | 321492-322472 | lipA | ||
| 8174 | VFPV01000004.1 | GCA006716905_04003 | gene | open | 322498-323193 | lipB | ||
| 8175 | VFPV01000004.1 | GCA006716905_04004 | gene | open | 323197-323514 | |||
| 8176 | VFPV01000004.1 | GCA006716905_04005 | gene | open | 323791-324264 | |||
| 8177 | VFPV01000004.1 | GCA006716905_04006 | gene | open | 324284-325162 | atpB | ||
| 8178 | VFPV01000004.1 | GCA006716905_04007 | gene | open | 325224-325493 | atpE | ||
| 8179 | VFPV01000004.1 | GCA006716905_04008 | gene | open | 325529-325999 | |||
| 8180 | VFPV01000004.1 | GCA006716905_04009 | gene | open | 326009-326551 | |||
| 8181 | VFPV01000004.1 | GCA006716905_04010 | gene | open | 326596-328149 | atpA | ||
| 8182 | VFPV01000004.1 | GCA006716905_04011 | gene | open | 328168-329034 | atpG | ||
| 8183 | VFPV01000004.1 | GCA006716905_04012 | gene | open | 329068-330474 | atpD | ||
| 8184 | VFPV01000004.1 | GCA006716905_04013 | gene | open | 330550-330966 | atpC | ||
| 8185 | VFPV01000004.1 | GCA006716905_04014 | gene | open | 331022-332329 | |||
| 8186 | VFPV01000004.1 | GCA006716905_04015 | gene | open | 332720-333169 | |||
| 8187 | VFPV01000004.1 | GCA006716905_04016 | gene | open | 333241-333627 | |||
| 8188 | VFPV01000004.1 | GCA006716905_04017 | gene | open | 333947-335035 | tnp | ||
| 8189 | VFPV01000004.1 | GCA006716905_04018 | gene | open | 335066-335320 | |||
| 8190 | VFPV01000004.1 | GCA006716905_04019 | gene | open | 335464-336543 | |||
| 8191 | VFPV01000004.1 | GCA006716905_04020 | gene | open | 336736-337692 | |||
| 8192 | VFPV01000004.1 | GCA006716905_04021 | gene | open | 337709-338236 | |||
| 8193 | VFPV01000004.1 | GCA006716905_04022 | gene | open | 338389-338904 | |||
| 8194 | VFPV01000004.1 | GCA006716905_04023 | gene | open | 338983-340389 | |||
| 8195 | VFPV01000004.1 | GCA006716905_04024 | gene | open | 340382-343537 | |||
| 8196 | VFPV01000004.1 | GCA006716905_04025 | gene | open | 343549-344799 | |||
| 8197 | VFPV01000004.1 | GCA006716905_04026 | gene | open | 344987-345622 | tetR | ||
| 8198 | VFPV01000004.1 | GCA006716905_04028 | gene | open | 346192-347673 | istA | ||
| 8199 | VFPV01000004.1 | GCA006716905_04029 | gene | open | 347712-348497 | dnaC | ||
| 8200 | VFPV01000004.1 | GCA006716905_04030 | gene | open | 348795-350891 | |||
| 8201 | VFPV01000004.1 | GCA006716905_04031 | gene | open | 351181-351966 | dnaC | ||
| 8202 | VFPV01000004.1 | GCA006716905_04032 | gene | open | 352005-353486 | istA | ||
| 8203 | VFPV01000004.1 | GCA006716905_04033 | gene | open | 353598-354611 | |||
| 8204 | VFPV01000004.1 | GCA006716905_04034 | gene | open | 354608-356353 | |||
| 8205 | VFPV01000004.1 | GCA006716905_04035 | gene | open | 356786-357025 | |||
| 8206 | VFPV01000004.1 | GCA006716905_04036 | gene | open | 357018-358289 | |||
| 8207 | VFPV01000004.1 | GCA006716905_04037 | gene | open | 358447-359064 | |||
| 8208 | VFPV01000004.1 | GCA006716905_04038 | gene | open | 359085-359345 | |||
| 8209 | VFPV01000004.1 | GCA006716905_04039 | gene | open | 359488-359832 | |||
| 8210 | VFPV01000004.1 | GCA006716905_04040 | gene | open | 360268-360864 | |||
| 8211 | VFPV01000004.1 | GCA006716905_04041 | gene | open | 360886-362172 | |||
| 8212 | VFPV01000004.1 | GCA006716905_04042 | gene | open | 362191-363471 | |||
| 8213 | VFPV01000004.1 | GCA006716905_04043 | gene | open | 363487-364194 | |||
| 8214 | VFPV01000004.1 | GCA006716905_04044 | gene | open | 364191-364979 | |||
| 8215 | VFPV01000004.1 | GCA006716905_04045 | gene | open | 364976-366106 | |||
| 8216 | VFPV01000004.1 | GCA006716905_04046 | gene | open | 366138-367067 | |||
| 8217 | VFPV01000004.1 | GCA006716905_04047 | gene | open | 367119-368288 | |||
| 8218 | VFPV01000004.1 | GCA006716905_04048 | gene | open | 368666-368986 | |||
| 8219 | VFPV01000004.1 | GCA006716905_04049 | gene | open | 368999-369109 | |||
| 8220 | VFPV01000004.1 | GCA006716905_04050 | gene | open | 369167-369469 | |||
| 8221 | VFPV01000004.1 | GCA006716905_04051 | gene | open | 369808-370278 | |||
| 8222 | VFPV01000004.1 | GCA006716905_04052 | gene | open | 370427-370738 | |||
| 8223 | VFPV01000004.1 | GCA006716905_04053 | gene | open | 371040-372209 | |||
| 8224 | VFPV01000004.1 | GCA006716905_04054 | gene | open | 372288-373703 | |||
| 8225 | VFPV01000004.1 | GCA006716905_04055 | gene | open | 373708-374325 | nthB | ||
| 8226 | VFPV01000004.1 | GCA006716905_04056 | gene | open | 374329-374949 | |||
| 8227 | VFPV01000004.1 | GCA006716905_04057 | gene | open | 374976-376013 | |||
| 8228 | VFPV01000004.1 | GCA006716905_04058 | gene | open | 376010-376804 | |||
| 8229 | VFPV01000004.1 | GCA006716905_04059 | gene | open | 376836-377597 | |||
| 8230 | VFPV01000004.1 | GCA006716905_04060 | gene | open | 377620-378366 | trmB | ||
| 8231 | VFPV01000004.1 | GCA006716905_04061 | gene | open | 378788-379660 | |||
| 8232 | VFPV01000004.1 | GCA006716905_04062 | gene | open | 380118-380996 | |||
| 8233 | VFPV01000004.1 | GCA006716905_04063 | gene | open | 380996-382219 | |||
| 8234 | VFPV01000004.1 | GCA006716905_04064 | gene | open | 382261-383193 | tnp | ||
| 8235 | VFPV01000004.1 | GCA006716905_04065 | gene | open | 383699-384700 | iS5 | ||
| 8236 | VFPV01000004.1 | GCA006716905_04066 | gene | open | 384714-384824 | |||
| 8237 | VFPV01000004.1 | GCA006716905_04067 | gene | open | 384958-385932 | lysR | ||
| 8238 | VFPV01000004.1 | GCA006716905_04068 | gene | open | 386061-387392 | |||
| 8239 | VFPV01000004.1 | GCA006716905_04069 | gene | open | 387448-389031 | |||
| 8240 | VFPV01000004.1 | GCA006716905_04070 | gene | open | 389065-390006 | |||
| 8241 | VFPV01000004.1 | GCA006716905_04071 | gene | open | 390018-390917 | |||
| 8242 | VFPV01000004.1 | GCA006716905_04072 | gene | open | 390957-392642 | nikD | ||
| 8243 | VFPV01000004.1 | GCA006716905_04073 | gene | open | 392699-394201 | |||
| 8244 | VFPV01000004.1 | GCA006716905_04074 | gene | open | 394707-394970 | hicB | ||
| 8245 | VFPV01000004.1 | GCA006716905_04075 | gene | open | 395364-395687 | |||
| 8246 | VFPV01000004.1 | GCA006716905_04076 | gene | open | 395754-396029 | |||
| 8247 | VFPV01000004.1 | GCA006716905_04077 | gene | open | 396257-397363 | |||
| 8248 | VFPV01000004.1 | GCA006716905_04078 | gene | open | 397518-398300 | |||
| 8249 | VFPV01000004.1 | GCA006716905_04079 | gene | open | 398297-399232 | |||
| 8250 | VFPV01000004.1 | GCA006716905_04080 | gene | open | 399229-400662 | |||
| 8251 | VFPV01000004.1 | GCA006716905_04081 | gene | open | 400641-401933 | |||
| 8252 | VFPV01000004.1 | GCA006716905_04082 | gene | open | 401930-402550 | |||
| 8253 | VFPV01000004.1 | GCA006716905_04083 | gene | open | 402615-403676 | |||
| 8254 | VFPV01000004.1 | GCA006716905_04084 | gene | open | 403742-405154 | hydA | ||
| 8255 | VFPV01000004.1 | GCA006716905_04085 | gene | open | 405377-406099 | |||
| 8256 | VFPV01000004.1 | GCA006716905_04086 | gene | open | 406089-406904 | gntR | ||
| 8257 | VFPV01000004.1 | GCA006716905_04087 | gene | open | 406901-407605 | |||
| 8258 | VFPV01000004.1 | GCA006716905_04088 | gene | open | 407617-407970 | |||
| 8259 | VFPV01000004.1 | GCA006716905_04089 | gene | open | 407931-408647 | |||
| 8260 | VFPV01000004.1 | GCA006716905_04090 | gene | open | 409628-409843 | |||
| 8261 | VFPV01000004.1 | GCA006716905_04091 | gene | open | 410111-410887 | |||
| 8262 | VFPV01000004.1 | GCA006716905_04092 | gene | open | 410880-413606 | |||
| 8263 | VFPV01000004.1 | GCA006716905_04093 | gene | open | 413603-415633 | |||
| 8264 | VFPV01000004.1 | GCA006716905_04094 | gene | open | 416372-416758 | |||
| 8265 | VFPV01000004.1 | GCA006716905_04095 | gene | open | 416776-417126 | |||
| 8266 | VFPV01000004.1 | GCA006716905_04096 | gene | open | 417469-419352 | |||
| 8267 | VFPV01000004.1 | GCA006716905_04097 | gene | open | 419621-420583 | |||
| 8268 | VFPV01000004.1 | GCA006716905_04098 | gene | open | 420769-421233 | |||
| 8269 | VFPV01000004.1 | GCA006716905_04099 | gene | open | 422148-422663 | |||
| 8270 | VFPV01000004.1 | GCA006716905_04100 | gene | open | 422671-423588 | rpiR | ||
| 8271 | VFPV01000004.1 | GCA006716905_04101 | gene | open | 423626-425155 | hydA | ||
| 8272 | VFPV01000004.1 | GCA006716905_04102 | gene | open | 425184-426419 | |||
| 8273 | VFPV01000004.1 | GCA006716905_04103 | gene | open | 426433-427167 | |||
| 8274 | VFPV01000004.1 | GCA006716905_04104 | gene | open | 427193-427864 | |||
| 8275 | VFPV01000004.1 | GCA006716905_04105 | gene | open | 427903-428697 | |||
| 8276 | VFPV01000004.1 | GCA006716905_04106 | gene | open | 428910-429647 | |||
| 8277 | VFPV01000004.1 | GCA006716905_04107 | gene | open | 429644-430666 | |||
| 8278 | VFPV01000004.1 | GCA006716905_04108 | gene | open | 430663-430992 | |||
| 8279 | VFPV01000004.1 | GCA006716905_04109 | gene | open | 431014-431895 | |||
| 8280 | VFPV01000004.1 | GCA006716905_04110 | gene | open | 431929-432816 | |||
| 8281 | VFPV01000004.1 | GCA006716905_04111 | gene | open | 432820-433734 | |||
| 8282 | VFPV01000004.1 | GCA006716905_04112 | gene | open | 433759-435042 | |||
| 8283 | VFPV01000004.1 | GCA006716905_04113 | gene | open | 435102-436142 | |||
| 8284 | VFPV01000004.1 | GCA006716905_04114 | gene | open | 436349-438925 | urtE | ||
| 8285 | VFPV01000004.1 | GCA006716905_04115 | gene | open | 438922-439800 | |||
| 8286 | VFPV01000004.1 | GCA006716905_04116 | gene | open | 439891-441075 | |||
| 8287 | VFPV01000004.1 | GCA006716905_04117 | gene | open | 441301-441711 | |||
| 8288 | VFPV01000004.1 | GCA006716905_04118 | gene | open | 441721-442644 | |||
| 8289 | VFPV01000004.1 | GCA006716905_04119 | gene | open | 442641-443867 | |||
| 8290 | VFPV01000004.1 | GCA006716905_04120 | gene | open | 443851-444636 | gntR | ||
| 8291 | VFPV01000004.1 | GCA006716905_04121 | gene | open | 444664-446472 | |||
| 8292 | VFPV01000004.1 | GCA006716905_04122 | gene | open | 446393-446821 | |||
| 8293 | VFPV01000004.1 | GCA006716905_04123 | gene | open | 447082-447510 | vapC | ||
| 8294 | VFPV01000004.1 | GCA006716905_04124 | gene | open | 447507-447761 | |||
| 8295 | VFPV01000004.1 | GCA006716905_04125 | gene | open | 447842-448009 | |||
| 8296 | VFPV01000004.1 | GCA006716905_04130 | gene | open | 448982-450172 | tuf | ||
| 8297 | VFPV01000004.1 | GCA006716905_04132 | gene | open | 450352-450738 | secE | ||
| 8298 | VFPV01000004.1 | GCA006716905_04133 | gene | open | 450735-451328 | nusG | ||
| 8299 | VFPV01000004.1 | GCA006716905_04134 | gene | open | 451458-451889 | rplK | ||
| 8300 | VFPV01000004.1 | GCA006716905_04135 | gene | open | 451890-452585 | rplA | ||
| 8301 | VFPV01000004.1 | GCA006716905_04136 | gene | open | 452819-453325 | rplJ | ||
| 8302 | VFPV01000004.1 | GCA006716905_04137 | gene | open | 453368-453745 | rplL | ||
| 8303 | VFPV01000004.1 | GCA006716905_04138 | gene | open | 454035-458147 | rpoB | ||
| 8304 | VFPV01000004.1 | GCA006716905_04139 | gene | open | 458279-462511 | rpoC | ||
| 8305 | VFPV01000004.1 | GCA006716905_04140 | gene | open | 462662-463198 | lemA | ||
| 8306 | VFPV01000004.1 | GCA006716905_04141 | gene | open | 463290-464750 | rsmB | ||
| 8307 | VFPV01000004.1 | GCA006716905_04142 | gene | open | 464758-465360 | |||
| 8308 | VFPV01000004.1 | GCA006716905_04143 | gene | open | 465378-467678 | |||
| 8309 | VFPV01000004.1 | GCA006716905_04144 | gene | open | 467883-468563 | |||
| 8310 | VFPV01000004.1 | GCA006716905_04146 | gene | open | 468838-470124 | |||
| 8311 | VFPV01000004.1 | GCA006716905_04147 | gene | open | 470258-471199 | rsmI | ||
| 8312 | VFPV01000004.1 | GCA006716905_04148 | gene | open | 471238-471600 | yraN | ||
| 8313 | VFPV01000004.1 | GCA006716905_04149 | gene | open | 471726-472325 | |||
| 8314 | VFPV01000004.1 | GCA006716905_04150 | gene | open | 472325-472981 | osmY | ||
| 8315 | VFPV01000004.1 | GCA006716905_04151 | gene | open | 473124-474038 | |||
| 8316 | VFPV01000004.1 | GCA006716905_04152 | gene | open | 474137-475273 | pilU | ||
| 8317 | VFPV01000004.1 | GCA006716905_04153 | gene | open | 475340-475975 | crp | ||
| 8318 | VFPV01000004.1 | GCA006716905_04154 | gene | open | 476042-477085 | pilT | ||
| 8319 | VFPV01000004.1 | GCA006716905_04155 | gene | open | 477124-477852 | |||
| 8320 | VFPV01000004.1 | GCA006716905_04156 | gene | open | 477869-478939 | ltaE | ||
| 8321 | VFPV01000004.1 | GCA006716905_04157 | gene | open | 479083-480219 | pucG | ||
| 8322 | VFPV01000004.1 | GCA006716905_04158 | gene | open | 480256-481581 | |||
| 8323 | VFPV01000004.1 | GCA006716905_04159 | gene | open | 481659-482384 | |||
| 8324 | VFPV01000004.1 | GCA006716905_04160 | gene | open | 482368-482730 | lrgA | ||
| 8325 | VFPV01000004.1 | GCA006716905_04161 | gene | open | 482740-484236 | glcD | ||
| 8326 | VFPV01000004.1 | GCA006716905_04162 | gene | open | 484444-485358 | lysR | ||
| 8327 | VFPV01000004.1 | GCA006716905_04163 | gene | open | 485382-486230 | purU | ||
| 8328 | VFPV01000004.1 | GCA006716905_04164 | gene | open | 486317-487216 | chaN | ||
| 8329 | VFPV01000004.1 | GCA006716905_04165 | gene | open | 487267-489291 | |||
| 8330 | VFPV01000004.1 | GCA006716905_04027 | gene | open | 345781-345856 | trnR | ||
| 8331 | VFPV01000004.1 | GCA006716905_04126 | gene | open | 448421-448496 | trnR | ||
| 8332 | VFPV01000004.1 | GCA006716905_04127 | gene | open | 448564-448649 | trnY | ||
| 8333 | VFPV01000004.1 | GCA006716905_04128 | gene | open | 448705-448778 | trnG | ||
| 8334 | VFPV01000004.1 | GCA006716905_04129 | gene | open | 448833-448907 | trnT | ||
| 8335 | VFPV01000004.1 | GCA006716905_04131 | gene | open | 450186-450261 | trnW | ||
| 8336 | VFPV01000004.1 | GCA006716905_04145 | gene | open | 468616-468691 | trnF | ||
| 8337 | VFPV01000004.1 | GCA006716905_04027 | tRNA | open | 345781-345856 | trnR | tRNA-Arg(ccg) | |
| 8338 | VFPV01000004.1 | GCA006716905_04126 | tRNA | open | 448421-448496 | trnR | tRNA-Arg(ccg) | |
| 8339 | VFPV01000004.1 | GCA006716905_04127 | tRNA | open | 448564-448649 | trnY | tRNA-Tyr(gta) | |
| 8340 | VFPV01000004.1 | GCA006716905_04128 | tRNA | open | 448705-448778 | trnG | tRNA-Gly(tcc) | |
| 8341 | VFPV01000004.1 | GCA006716905_04129 | tRNA | open | 448833-448907 | trnT | tRNA-Thr(ggt) | |
| 8342 | VFPV01000004.1 | GCA006716905_04131 | tRNA | open | 450186-450261 | trnW | tRNA-Trp(cca) | |
| 8343 | VFPV01000004.1 | GCA006716905_04145 | tRNA | open | 468616-468691 | trnF | tRNA-Phe(gaa) | |
| 8344 | VFPV01000005.1 | repeat_region | open | 124282-124657 | CRISPR array with 6 repeats of length 36%2C consensus sequence GTTGTAGCTCCCGCTCTCACCCCGGATAGCTACACT and spacer length 30 | |||
| 8345 | VFPV01000005.1 | GCA006716905_04166 | CDS | open | 146-796 | _na 216_aa | DUF1364 domain-containing protein | |
| 8346 | VFPV01000005.1 | GCA006716905_04167 | CDS | open | 850-1938 | _na 362_aa | orfB | IS605 OrfB family transposase |
| 8347 | VFPV01000005.1 | GCA006716905_04168 | CDS | open | 2006-2374 | _na 122_aa | tnpA | IS200/IS605 family transposase |
| 8348 | VFPV01000005.1 | GCA006716905_04169 | CDS | open | 2915-3577 | _na 220_aa | hypothetical protein | |
| 8349 | VFPV01000005.1 | GCA006716905_04170 | CDS | open | 4280-4522 | _na 80_aa | abrB | Transcriptional regulator%2C AbrB family |
| 8350 | VFPV01000005.1 | GCA006716905_04171 | CDS | open | 4519-4914 | _na 131_aa | vapC | VapC toxin family PIN domain ribonuclease |
| 8351 | VFPV01000005.1 | GCA006716905_04172 | CDS | open | 4988-5134 | _na 48_aa | hypothetical protein | |
| 8352 | VFPV01000005.1 | GCA006716905_04173 | CDS | open | 5254-5436 | _na 60_aa | vapB | Antitoxin VapB |
| 8353 | VFPV01000005.1 | GCA006716905_04174 | CDS | open | 5445-5849 | _na 134_aa | PIN domain-containing protein | |
| 8354 | VFPV01000005.1 | GCA006716905_04175 | CDS | open | 5860-6045 | _na 61_aa | hypothetical protein | |
| 8355 | VFPV01000005.1 | GCA006716905_04176 | CDS | open | 6450-7382 | _na 310_aa | tnp | IS5 family ISAav2 transposase |
| 8356 | VFPV01000005.1 | GCA006716905_04177 | CDS | open | 7644-7943 | _na 99_aa | hypothetical protein | |
| 8357 | VFPV01000005.1 | GCA006716905_04178 | CDS | open | 7989-8387 | _na 132_aa | ParE-like toxin of type II ParDE toxin-antitoxin system | |
| 8358 | VFPV01000005.1 | GCA006716905_04179 | CDS | open | 8404-8697 | _na 97_aa | Antitoxin | |
| 8359 | VFPV01000005.1 | GCA006716905_04180 | CDS | open | 8931-9206 | _na 91_aa | hypothetical protein | |
| 8360 | VFPV01000005.1 | GCA006716905_04181 | CDS | open | 9289-9441 | _na 50_aa | hypothetical protein | |
| 8361 | VFPV01000005.1 | GCA006716905_04182 | CDS | open | 9478-9765 | _na 95_aa | hypothetical protein | |
| 8362 | VFPV01000005.1 | GCA006716905_04183 | CDS | open | 9897-10328 | _na 143_aa | tnpA | IS200/IS605 family transposase |
| 8363 | VFPV01000005.1 | GCA006716905_04184 | CDS | open | 10486-10647 | _na 53_aa | Transposase | |
| 8364 | VFPV01000005.1 | GCA006716905_04185 | CDS | open | 11113-11463 | _na 116_aa | IS5 family transposase | |
| 8365 | VFPV01000005.1 | GCA006716905_04186 | CDS | open | 11481-11867 | _na 128_aa | IS5 family transposase | |
| 8366 | VFPV01000005.1 | GCA006716905_04187 | CDS | open | 11912-12013 | _na 33_aa | hypothetical protein | |
| 8367 | VFPV01000005.1 | GCA006716905_04188 | CDS | open | 12194-12886 | _na 230_aa | parF | Plasmid segregation oscillating ATPase ParF |
| 8368 | VFPV01000005.1 | GCA006716905_04189 | CDS | open | 12889-13968 | _na 359_aa | ParB/Sulfiredoxin domain-containing protein | |
| 8369 | VFPV01000005.1 | GCA006716905_04190 | CDS | open | 14030-14188 | _na 52_aa | Transposase family protein | |
| 8370 | VFPV01000005.1 | GCA006716905_04191 | CDS | open | 14360-15235 | _na 291_aa | IS3 family transposase | |
| 8371 | VFPV01000005.1 | GCA006716905_04192 | CDS | open | 16626-17933 | _na 435_aa | Initiator Rep protein WH1 domain-containing protein | |
| 8372 | VFPV01000005.1 | GCA006716905_04193 | CDS | open | 18266-19018 | _na 250_aa | Transposase IS4-like domain-containing protein | |
| 8373 | VFPV01000005.1 | GCA006716905_04194 | CDS | open | 19335-19652 | _na 105_aa | Helix-turn-helix protein | |
| 8374 | VFPV01000005.1 | GCA006716905_04195 | CDS | open | 19689-21011 | _na 440_aa | hipA | Serine/threonine-protein kinase HipA |
| 8375 | VFPV01000005.1 | GCA006716905_04196 | CDS | open | 21055-21219 | _na 54_aa | hypothetical protein | |
| 8376 | VFPV01000005.1 | GCA006716905_04197 | CDS | open | 21300-24179 | _na 959_aa | Phospholipase D-like protein | |
| 8377 | VFPV01000005.1 | GCA006716905_04198 | CDS | open | 24213-24884 | _na 223_aa | Putative zinc-or iron-chelating protein | |
| 8378 | VFPV01000005.1 | GCA006716905_04199 | CDS | open | 25100-25948 | _na 282_aa | iS5 | IS5 family transposase |
| 8379 | VFPV01000005.1 | GCA006716905_04200 | CDS | open | 26087-26434 | _na 115_aa | DNA-binding protein H-NS | |
| 8380 | VFPV01000005.1 | GCA006716905_04201 | CDS | open | 26551-26688 | _na 45_aa | hypothetical protein | |
| 8381 | VFPV01000005.1 | GCA006716905_04202 | CDS | open | 26685-26867 | _na 60_aa | RES family NAD+ phosphorylase | |
| 8382 | VFPV01000005.1 | GCA006716905_04203 | CDS | open | 26981-27712 | _na 243_aa | hypothetical protein | |
| 8383 | VFPV01000005.1 | GCA006716905_04204 | CDS | open | 27742-28302 | _na 186_aa | Zinc ribbon domain-containing protein | |
| 8384 | VFPV01000005.1 | GCA006716905_04205 | CDS | open | 28442-29218 | _na 258_aa | hypothetical protein | |
| 8385 | VFPV01000005.1 | GCA006716905_04206 | CDS | open | 29922-30707 | _na 261_aa | ATP-binding protein | |
| 8386 | VFPV01000005.1 | GCA006716905_04207 | CDS | open | 30700-32226 | _na 508_aa | istA | IS21 family transposase |
| 8387 | VFPV01000005.1 | GCA006716905_04208 | CDS | open | 33415-34086 | _na 223_aa | DUF1845 domain-containing protein | |
| 8388 | VFPV01000005.1 | GCA006716905_04209 | CDS | open | 34476-34712 | _na 78_aa | Transcriptional regulator | |
| 8389 | VFPV01000005.1 | GCA006716905_04210 | CDS | open | 35210-36052 | _na 280_aa | panC | pantoate--beta-alanine ligase |
| 8390 | VFPV01000005.1 | GCA006716905_04211 | CDS | open | 36181-36702 | _na 173_aa | GCN5 family acetyltransferase | |
| 8391 | VFPV01000005.1 | GCA006716905_04212 | CDS | open | 37021-38022 | _na 333_aa | iS5 | IS5 family transposase |
| 8392 | VFPV01000005.1 | GCA006716905_04213 | CDS | open | 38674-39279 | _na 201_aa | tripartite tricarboxylate transporter substrate binding protein | |
| 8393 | VFPV01000005.1 | GCA006716905_04214 | CDS | open | 39517-40056 | _na 179_aa | tetR | TetR family transcriptional regulator |
| 8394 | VFPV01000005.1 | GCA006716905_04215 | CDS | open | 40439-42184 | _na 581_aa | DUF1302 domain-containing protein | |
| 8395 | VFPV01000005.1 | GCA006716905_04216 | CDS | open | 42203-43567 | _na 454_aa | DUF1329 domain-containing protein | |
| 8396 | VFPV01000005.1 | GCA006716905_04217 | CDS | open | 43606-44703 | _na 365_aa | Photosynthesis system II assembly factor Ycf48/Hcf136-like domain-containing protein | |
| 8397 | VFPV01000005.1 | GCA006716905_04218 | CDS | open | 44770-47181 | _na 803_aa | SSD domain-containing protein | |
| 8398 | VFPV01000005.1 | GCA006716905_04219 | CDS | open | 47224-48174 | _na 316_aa | Lactoylglutathione lyase | |
| 8399 | VFPV01000005.1 | GCA006716905_04220 | CDS | open | 48179-49018 | _na 279_aa | Enoyl-CoA hydratase | |
| 8400 | VFPV01000005.1 | GCA006716905_04221 | CDS | open | 49049-49879 | _na 276_aa | Short-chain dehydrogenase | |
| 8401 | VFPV01000005.1 | GCA006716905_04222 | CDS | open | 49902-50414 | _na 170_aa | DUF1993 domain-containing protein | |
| 8402 | VFPV01000005.1 | GCA006716905_04223 | CDS | open | 50955-52589 | _na 544_aa | Chemotaxis protein | |
| 8403 | VFPV01000005.1 | GCA006716905_04224 | CDS | open | 52686-53924 | _na 412_aa | 3-phenylpropionate/trans-cinnamate dioxygenase ferredoxin reductase subunit | |
| 8404 | VFPV01000005.1 | GCA006716905_04225 | CDS | open | 53936-55237 | _na 433_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 8405 | VFPV01000005.1 | GCA006716905_04226 | CDS | open | 55286-56479 | _na 397_aa | ditF | DitF protein |
| 8406 | VFPV01000005.1 | GCA006716905_04227 | CDS | open | 56476-56874 | _na 132_aa | DNA-binding protein | |
| 8407 | VFPV01000005.1 | GCA006716905_04228 | CDS | open | 57013-57708 | _na 231_aa | 3-ketoacyl-ACP reductase | |
| 8408 | VFPV01000005.1 | GCA006716905_04229 | CDS | open | 57744-58160 | _na 138_aa | hypothetical protein | |
| 8409 | VFPV01000005.1 | GCA006716905_04230 | CDS | open | 58299-59285 | _na 328_aa | Isomerase | |
| 8410 | VFPV01000005.1 | GCA006716905_04231 | CDS | open | 59410-61041 | _na 543_aa | ATP-dependent acyl-CoA ligase | |
| 8411 | VFPV01000005.1 | GCA006716905_04232 | CDS | open | 61054-61821 | _na 255_aa | Short-chain dehydrogenase | |
| 8412 | VFPV01000005.1 | GCA006716905_04233 | CDS | open | 61830-63467 | _na 545_aa | Acyl-CoA synthetase | |
| 8413 | VFPV01000005.1 | GCA006716905_04234 | CDS | open | 63471-64454 | _na 327_aa | Tripartite tricarboxylate transporter substrate binding protein | |
| 8414 | VFPV01000005.1 | GCA006716905_04235 | CDS | open | 64588-65736 | _na 382_aa | NADP-dependent oxidoreductase domain-containing protein | |
| 8415 | VFPV01000005.1 | GCA006716905_04236 | CDS | open | 65909-66856 | _na 315_aa | Hydrolase | |
| 8416 | VFPV01000005.1 | GCA006716905_04237 | CDS | open | 66853-67746 | _na 297_aa | Membrane protein | |
| 8417 | VFPV01000005.1 | GCA006716905_04238 | CDS | open | 67908-69308 | _na 466_aa | Phenylpropionate dioxygenase alpha subunit | |
| 8418 | VFPV01000005.1 | GCA006716905_04239 | CDS | open | 69346-69915 | _na 189_aa | 3-phenylpropionate/cinnamic acid dioxygenase subunit beta | |
| 8419 | VFPV01000005.1 | GCA006716905_04240 | CDS | open | 69949-71229 | _na 426_aa | Cytochrome P450 | |
| 8420 | VFPV01000005.1 | GCA006716905_04241 | CDS | open | 71383-72693 | _na 436_aa | Amidohydrolase | |
| 8421 | VFPV01000005.1 | GCA006716905_04242 | CDS | open | 72739-73668 | _na 309_aa | NADPH:quinone reductase-like Zn-dependent oxidoreductase | |
| 8422 | VFPV01000005.1 | GCA006716905_04243 | CDS | open | 73853-75253 | _na 466_aa | Ring hydroxylating enzyme alpha subunit | |
| 8423 | VFPV01000005.1 | GCA006716905_04244 | CDS | open | 75296-75832 | _na 178_aa | 3-phenylpropionate/cinnamic acid dioxygenase subunit beta | |
| 8424 | VFPV01000005.1 | GCA006716905_04245 | CDS | open | 75847-76587 | _na 246_aa | DUF2889 domain-containing protein | |
| 8425 | VFPV01000005.1 | GCA006716905_04246 | CDS | open | 76710-77510 | _na 266_aa | NAD(P)-dependent dehydrogenase (Short-subunit alcohol dehydrogenase family) | |
| 8426 | VFPV01000005.1 | GCA006716905_04247 | CDS | open | 77528-79159 | _na 543_aa | ATP-dependent acyl-CoA ligase | |
| 8427 | VFPV01000005.1 | GCA006716905_04248 | CDS | open | 79303-80082 | _na 259_aa | tetR | TetR family transcriptional regulator |
| 8428 | VFPV01000005.1 | GCA006716905_04249 | CDS | open | 80118-81137 | _na 339_aa | uspA | Universal stress protein UspA |
| 8429 | VFPV01000005.1 | GCA006716905_04250 | CDS | open | 81356-82444 | _na 362_aa | Amidohydrolase-related domain-containing protein | |
| 8430 | VFPV01000005.1 | GCA006716905_04251 | CDS | open | 82441-83286 | _na 281_aa | Hydrolase | |
| 8431 | VFPV01000005.1 | GCA006716905_04252 | CDS | open | 83306-84211 | _na 301_aa | 3-hydroxyacyl-CoA dehydrogenase | |
| 8432 | VFPV01000005.1 | GCA006716905_04253 | CDS | open | 84208-85383 | _na 391_aa | Acetyl-CoA acetyltransferase | |
| 8433 | VFPV01000005.1 | GCA006716905_04254 | CDS | open | 85380-85913 | _na 177_aa | Carboxymuconolactone decarboxylase | |
| 8434 | VFPV01000005.1 | GCA006716905_04255 | CDS | open | 85910-86458 | _na 182_aa | Glutathione peroxidase | |
| 8435 | VFPV01000005.1 | GCA006716905_04256 | CDS | open | 86463-87641 | _na 392_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 8436 | VFPV01000005.1 | GCA006716905_04257 | CDS | open | 87709-88287 | _na 192_aa | GST N-terminal domain-containing protein | |
| 8437 | VFPV01000005.1 | GCA006716905_04258 | CDS | open | 88348-89124 | _na 258_aa | SDR family oxidoreductase | |
| 8438 | VFPV01000005.1 | GCA006716905_04259 | CDS | open | 89126-89554 | _na 142_aa | dihydroneopterin aldolase | |
| 8439 | VFPV01000005.1 | GCA006716905_04260 | CDS | open | 89548-90768 | _na 406_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 8440 | VFPV01000005.1 | GCA006716905_04261 | CDS | open | 90824-91660 | _na 278_aa | NAD(P)-dependent dehydrogenase (Short-subunit alcohol dehydrogenase family) | |
| 8441 | VFPV01000005.1 | GCA006716905_04262 | CDS | open | 91657-92082 | _na 141_aa | SnoaL-like domain-containing protein | |
| 8442 | VFPV01000005.1 | GCA006716905_04263 | CDS | open | 92342-92692 | _na 116_aa | SnoaL-like domain-containing protein | |
| 8443 | VFPV01000005.1 | GCA006716905_04264 | CDS | open | 92708-93739 | _na 343_aa | attH | AttH domain-containing protein |
| 8444 | VFPV01000005.1 | GCA006716905_04265 | CDS | open | 93760-95049 | _na 429_aa | Cytochrome P450 | |
| 8445 | VFPV01000005.1 | GCA006716905_04266 | CDS | open | 95097-96674 | _na 525_aa | Pyridine nucleotide-disulfide oxidoreductase domain-containing protein 2 | |
| 8446 | VFPV01000005.1 | GCA006716905_04267 | CDS | open | 96704-97429 | _na 241_aa | HTH tetR-type domain-containing protein | |
| 8447 | VFPV01000005.1 | GCA006716905_04268 | CDS | open | 97767-99038 | _na 423_aa | Cytochrome P450 | |
| 8448 | VFPV01000005.1 | GCA006716905_04269 | CDS | open | 99049-100035 | _na 328_aa | Tat pathway signal protein | |
| 8449 | VFPV01000005.1 | GCA006716905_04270 | CDS | open | 100046-100825 | _na 259_aa | 3-oxoacyl-ACP reductase | |
| 8450 | VFPV01000005.1 | GCA006716905_04271 | CDS | open | 100822-101235 | _na 137_aa | Catechol 2%2C3-dioxygenase-like lactoylglutathione lyase family enzyme | |
| 8451 | VFPV01000005.1 | GCA006716905_04272 | CDS | open | 101355-101675 | _na 106_aa | 2Fe-2S ferredoxin-type domain-containing protein | |
| 8452 | VFPV01000005.1 | GCA006716905_04273 | CDS | open | 101703-102857 | _na 384_aa | mbtN | Acyl-[acyl-carrier-protein] dehydrogenase MbtN |
| 8453 | VFPV01000005.1 | GCA006716905_04274 | CDS | open | 102857-103687 | _na 276_aa | Enoyl-CoA hydratase | |
| 8454 | VFPV01000005.1 | GCA006716905_04275 | CDS | open | 103684-104781 | _na 365_aa | Acyl-CoA dehydrogenase | |
| 8455 | VFPV01000005.1 | GCA006716905_04276 | CDS | open | 104792-105961 | _na 389_aa | Acyl-CoA dehydrogenase | |
| 8456 | VFPV01000005.1 | GCA006716905_04277 | CDS | open | 106001-107308 | _na 435_aa | Amidohydrolase | |
| 8457 | VFPV01000005.1 | GCA006716905_04278 | CDS | open | 107674-109473 | _na 599_aa | Diguanylate cyclase | |
| 8458 | VFPV01000005.1 | GCA006716905_04279 | CDS | open | 109621-110592 | _na 323_aa | tctC | Tripartite-type tricarboxylate transporter receptor subunit TctC |
| 8459 | VFPV01000005.1 | GCA006716905_04280 | CDS | open | 111329-112165 | _na 278_aa | iclR | IclR family transcriptional regulator |
| 8460 | VFPV01000005.1 | GCA006716905_04281 | CDS | open | 112498-112725 | _na 75_aa | Ferredoxin | |
| 8461 | VFPV01000005.1 | GCA006716905_04282 | CDS | open | 112844-113791 | _na 315_aa | 2%2C3-dihydroxybiphenyl 1%2C2-dioxygenase | |
| 8462 | VFPV01000005.1 | GCA006716905_04283 | CDS | open | 113845-114582 | _na 245_aa | Oxidoreductase | |
| 8463 | VFPV01000005.1 | GCA006716905_04284 | CDS | open | 114594-115448 | _na 284_aa | Short-chain dehydrogenase | |
| 8464 | VFPV01000005.1 | GCA006716905_04285 | CDS | open | 115515-116459 | _na 314_aa | HTH lysR-type domain-containing protein | |
| 8465 | VFPV01000005.1 | GCA006716905_04286 | CDS | open | 116574-120059 | _na 1161_aa | MFS transporter | |
| 8466 | VFPV01000005.1 | GCA006716905_04287 | CDS | open | 120103-120852 | _na 249_aa | fixA | Electron transfer flavoprotein subunit beta |
| 8467 | VFPV01000005.1 | GCA006716905_04288 | CDS | open | 120853-121788 | _na 311_aa | Electron transfer flavoprotein subunit alpha | |
| 8468 | VFPV01000005.1 | GCA006716905_04289 | CDS | open | 121803-122006 | _na 67_aa | hypothetical protein | |
| 8469 | VFPV01000005.1 | GCA006716905_04290 | CDS | open | 122294-123853 | _na 519_aa | Methyl-accepting chemotaxis sensory transducer with Pas/Pac sensor | |
| 8470 | VFPV01000005.1 | GCA006716905_04291 | CDS | open | 124829-126010 | _na 393_aa | Tn3 family transposase | |
| 8471 | VFPV01000005.1 | GCA006716905_04292 | CDS | open | 126172-127101 | _na 309_aa | IS5 family transposase | |
| 8472 | VFPV01000005.1 | GCA006716905_04293 | CDS | open | 127152-128405 | _na 417_aa | mgtC | Putative membrane protein |
| 8473 | VFPV01000005.1 | GCA006716905_04294 | CDS | open | 128581-128787 | _na 68_aa | hypothetical protein | |
| 8474 | VFPV01000005.1 | GCA006716905_04295 | CDS | open | 128960-129085 | _na 41_aa | Lipoprotein | |
| 8475 | VFPV01000005.1 | GCA006716905_04296 | CDS | open | 129228-129764 | _na 178_aa | Transposase | |
| 8476 | VFPV01000005.1 | GCA006716905_04297 | CDS | open | 129822-130157 | _na 111_aa | ata | HTH cro/C1-type domain-containing protein |
| 8477 | VFPV01000005.1 | GCA006716905_04298 | CDS | open | 130138-130404 | _na 88_aa | type II toxin-antitoxin system RelE/ParE family toxin | |
| 8478 | VFPV01000005.1 | GCA006716905_04299 | CDS | open | 130405-130515 | _na 36_aa | relE | Addiction module toxin RelE |
| 8479 | VFPV01000005.1 | GCA006716905_04300 | CDS | open | 130707-131300 | _na 197_aa | spoIVCA | Resolvase/invertase-type recombinase catalytic domain-containing protein |
| 8480 | VFPV01000005.1 | GCA006716905_04301 | CDS | open | 131297-134329 | _na 1010_aa | Tn3 family transposase | |
| 8481 | VFPV01000005.1 | GCA006716905_04302 | CDS | open | 134298-135695 | _na 465_aa | Tn3 family transposase | |
| 8482 | VFPV01000005.1 | GCA006716905_04303 | CDS | open | 135893-136957 | _na 354_aa | Methyltransferase family protein | |
| 8483 | VFPV01000005.1 | GCA006716905_04304 | CDS | open | 137253-140222 | _na 989_aa | Tn3 family transposase | |
| 8484 | VFPV01000005.1 | GCA006716905_04305 | CDS | open | 140716-141078 | _na 120_aa | hypothetical protein | |
| 8485 | VFPV01000005.1 | GCA006716905_04306 | CDS | open | 141342-141767 | _na 141_aa | vapC | Ribonuclease VapC |
| 8486 | VFPV01000005.1 | GCA006716905_04307 | CDS | open | 141764-142021 | _na 85_aa | Plasmid stability family protein | |
| 8487 | VFPV01000005.1 | GCA006716905_04308 | CDS | open | 142297-143976 | _na 559_aa | Integrase catalytic domain-containing protein | |
| 8488 | VFPV01000005.1 | GCA006716905_04309 | CDS | open | 143979-144887 | _na 302_aa | Putative ATP-binding protein | |
| 8489 | VFPV01000005.1 | GCA006716905_04310 | CDS | open | 144938-146101 | _na 387_aa | Transposase | |
| 8490 | VFPV01000005.1 | GCA006716905_04311 | CDS | open | 146162-146776 | _na 204_aa | spoIVCA | TniR |
| 8491 | VFPV01000005.1 | GCA006716905_04312 | CDS | open | 146784-147773 | _na 329_aa | EAL domain-containing protein | |
| 8492 | VFPV01000005.1 | GCA006716905_04313 | CDS | open | 147773-148009 | _na 78_aa | merE | broad-spectrum mercury transporter MerE |
| 8493 | VFPV01000005.1 | GCA006716905_04314 | CDS | open | 148006-148371 | _na 121_aa | merD | mercury resistance co-regulator MerD |
| 8494 | VFPV01000005.1 | GCA006716905_04315 | CDS | open | 148389-150074 | _na 561_aa | merA | mercury(II) reductase |
| 8495 | VFPV01000005.1 | GCA006716905_04316 | CDS | open | 150114-150536 | _na 140_aa | merC | organomercurial transporter MerC |
| 8496 | VFPV01000005.1 | GCA006716905_04317 | CDS | open | 150564-150839 | _na 91_aa | merP | mercury resistance system periplasmic binding protein MerP |
| 8497 | VFPV01000005.1 | GCA006716905_04318 | CDS | open | 150852-151202 | _na 116_aa | merT | mercuric transport protein MerT |
| 8498 | VFPV01000005.1 | GCA006716905_04319 | CDS | open | 151274-151708 | _na 144_aa | merR | mercury resistance transcriptional regulator MerR |
| 8499 | VFPV01000005.1 | GCA006716905_04320 | CDS | open | 151799-152095 | _na 98_aa | Resolvase | |
| 8500 | VFPV01000005.1 | GCA006716905_04321 | CDS | open | 152115-152330 | _na 71_aa | vbhA | Antitoxin VbhA domain-containing protein |

