HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Corynebacterium aurimucosum clade-034 (GCA_007786375.1)

Select a Genome:
BAKTA Annotations for GCA_007786375.1
Genome Selected: Corynebacterium aurimucosum clade-034
ContigsBases CDSrRNA tmRNAtRNA
111 2632856 2696 5 1 48
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 5513 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:12]    |    Number of Records Found: 5513 [12 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  12  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
5501 VMTY01000095.1 GCA007786375_02668 CDS open 155-829 _na     224_aa Sugar ABC transporter permease
5502 VMTY01000095.1 GCA007786375_02668 gene open 155-829
5503 VMTY01000096.1 GCA007786375_02669 CDS open 94-741 _na     215_aa HNH endonuclease signature motif containing protein
5504 VMTY01000096.1 GCA007786375_02669 gene open 94-741
5505 VMTY01000098.1 GCA007786375_02670 CDS open 1-423 _na     140_aa hypothetical protein
5506 VMTY01000098.1 GCA007786375_02670 gene open 1-423
5507 VMTY01000101.1 repeat_region open 13-537 CRISPR array with 9 repeats of length 28%2C consensus sequence GGCTCATCCCCGCTTACGCGGGGAGCAC and spacer length 33
5508 VMTY01000102.1 GCA007786375_00001 CDS open 81-533 _na     150_aa HNH endonuclease signature motif containing protein
5509 VMTY01000102.1 GCA007786375_00001 gene open 81-533
5510 VMTY01000103.1 GCA007786375_00002 CDS open 66-371 _na     101_aa hypothetical protein
5511 VMTY01000103.1 GCA007786375_00002 gene open 66-371
5512 VMTY01000104.1 GCA007786375_00003 CDS open 79-444 _na     121_aa hypothetical protein
5513 VMTY01000104.1 GCA007786375_00003 gene open 79-444