BAKTAGenome Explorer: Corynebacterium amycolatum (GCA_008726175.1)
Select a Genome:
|
BAKTA Annotations for GCA_008726175.1
|
Search & Sort all 4584 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 3001 | VYVD01000016.1 | GCA008726175_00415 | gene | open | 43249-44307 | hemB | ||
| 3002 | VYVD01000016.1 | GCA008726175_00416 | gene | open | 44355-46022 | hemD | ||
| 3003 | VYVD01000016.1 | GCA008726175_00417 | gene | open | 46227-47159 | hemC | ||
| 3004 | VYVD01000016.1 | GCA008726175_00418 | gene | open | 47175-48611 | |||
| 3005 | VYVD01000016.1 | GCA008726175_00419 | gene | open | 48842-49084 | |||
| 3006 | VYVD01000016.1 | GCA008726175_00420 | gene | open | 49249-50373 | |||
| 3007 | VYVD01000017.1 | GCA008726175_00421 | gene | open | 321-415 | Bacteria_small_SRP | ||
| 3008 | VYVD01000017.1 | GCA008726175_00421 | ncRNA | open | 321-415 | Bacterial small signal recognition particle RNA | ||
| 3009 | VYVD01000017.1 | GCA008726175_00422 | CDS | open | 734-2203 | _na 489_aa | Sulfate transporter family protein | |
| 3010 | VYVD01000017.1 | GCA008726175_00423 | CDS | open | 2299-3600 | _na 433_aa | Aspartate aminotransferase | |
| 3011 | VYVD01000017.1 | GCA008726175_00424 | CDS | open | 3635-4360 | _na 241_aa | Suppressor of fused-like domain-containing protein | |
| 3012 | VYVD01000017.1 | GCA008726175_00425 | CDS | open | 4391-7231 | _na 946_aa | DNA polymerase III subunit gamma and tau | |
| 3013 | VYVD01000017.1 | GCA008726175_00426 | CDS | open | 7346-7669 | _na 107_aa | YbaB/EbfC family nucleoid-associated protein | |
| 3014 | VYVD01000017.1 | GCA008726175_00427 | CDS | open | 7707-8333 | _na 208_aa | recR | recombination mediator RecR |
| 3015 | VYVD01000017.1 | GCA008726175_00428 | CDS | open | 8367-9179 | _na 270_aa | gatD | Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit GatD |
| 3016 | VYVD01000017.1 | GCA008726175_00429 | CDS | open | 9180-10610 | _na 476_aa | murT | Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit MurT |
| 3017 | VYVD01000017.1 | GCA008726175_00430 | CDS | open | 10879-11217 | _na 112_aa | Helix-turn-helix transcriptional regulator | |
| 3018 | VYVD01000017.1 | GCA008726175_00431 | CDS | open | 11230-12129 | _na 299_aa | ImmA/IrrE family metallo-endopeptidase | |
| 3019 | VYVD01000017.1 | GCA008726175_00432 | CDS | open | 12133-12729 | _na 198_aa | hypothetical protein | |
| 3020 | VYVD01000017.1 | GCA008726175_00433 | CDS | open | 12726-13172 | _na 148_aa | DCC1-like thiol-disulfide oxidoreductase family protein | |
| 3021 | VYVD01000017.1 | GCA008726175_00434 | CDS | open | 13232-14599 | _na 455_aa | Exonuclease family protein | |
| 3022 | VYVD01000017.1 | GCA008726175_00435 | CDS | open | 15002-16042 | _na 346_aa | DUF559 domain-containing protein | |
| 3023 | VYVD01000017.1 | GCA008726175_00436 | CDS | open | 16177-17994 | _na 605_aa | leuA | 2-isopropylmalate synthase |
| 3024 | VYVD01000017.1 | GCA008726175_00437 | CDS | open | 18272-20905 | _na 877_aa | ABC-2 type transporter transmembrane domain-containing protein | |
| 3025 | VYVD01000017.1 | GCA008726175_00438 | CDS | open | 20905-23247 | _na 780_aa | ABC-2 type transporter transmembrane domain-containing protein | |
| 3026 | VYVD01000017.1 | GCA008726175_00439 | CDS | open | 23254-24306 | _na 350_aa | Sortase family protein | |
| 3027 | VYVD01000017.1 | GCA008726175_00440 | CDS | open | 24463-25527 | _na 354_aa | DMT family transporter | |
| 3028 | VYVD01000017.1 | GCA008726175_00441 | CDS | open | 25969-27234 | _na 421_aa | aspartate kinase | |
| 3029 | VYVD01000017.1 | GCA008726175_00442 | CDS | open | 27244-28284 | _na 346_aa | aspartate-semialdehyde dehydrogenase | |
| 3030 | VYVD01000017.1 | GCA008726175_00443 | CDS | open | 29099-30055 | _na 318_aa | Putative iron ABC transport system%2C solute-binding protein | |
| 3031 | VYVD01000017.1 | GCA008726175_00444 | CDS | open | 30092-31102 | _na 336_aa | Iron ABC transporter permease | |
| 3032 | VYVD01000017.1 | GCA008726175_00445 | CDS | open | 31099-32151 | _na 350_aa | Putative iron ABC transport system%2C permease protein | |
| 3033 | VYVD01000017.1 | GCA008726175_00446 | CDS | open | 32148-32942 | _na 264_aa | Putative iron ABC transport system%2C ATP-binding protein | |
| 3034 | VYVD01000017.1 | GCA008726175_00447 | CDS | open | 32939-33862 | _na 307_aa | NADPH-dependent ferric siderophore reductase | |
| 3035 | VYVD01000017.1 | GCA008726175_00448 | CDS | open | 33974-35155 | _na 393_aa | IS3 family transposase | |
| 3036 | VYVD01000017.1 | GCA008726175_00449 | CDS | open | 35684-36331 | _na 215_aa | hypothetical protein | |
| 3037 | VYVD01000017.1 | GCA008726175_00450 | CDS | open | 37271-40192 | _na 973_aa | VaFE repeat-containing surface-anchored protein | |
| 3038 | VYVD01000017.1 | GCA008726175_00451 | CDS | open | 40202-40957 | _na 251_aa | Sortase | |
| 3039 | VYVD01000017.1 | GCA008726175_00452 | CDS | open | 41133-41492 | _na 119_aa | Secreted protein | |
| 3040 | VYVD01000017.1 | GCA008726175_00453 | CDS | open | 42163-43797 | _na 544_aa | SpaH/EbpB family LPXTG-anchored major pilin | |
| 3041 | VYVD01000017.1 | GCA008726175_00454 | CDS | open | 44011-45048 | _na 345_aa | Sortase family protein | |
| 3042 | VYVD01000017.1 | GCA008726175_00455 | CDS | open | 45041-45973 | _na 310_aa | Surface anchored protein | |
| 3043 | VYVD01000017.1 | GCA008726175_00456 | CDS | open | 45973-49191 | _na 1072_aa | LPXTG cell wall anchor domain-containing protein | |
| 3044 | VYVD01000017.1 | GCA008726175_00422 | gene | open | 734-2203 | |||
| 3045 | VYVD01000017.1 | GCA008726175_00423 | gene | open | 2299-3600 | |||
| 3046 | VYVD01000017.1 | GCA008726175_00424 | gene | open | 3635-4360 | |||
| 3047 | VYVD01000017.1 | GCA008726175_00425 | gene | open | 4391-7231 | |||
| 3048 | VYVD01000017.1 | GCA008726175_00426 | gene | open | 7346-7669 | |||
| 3049 | VYVD01000017.1 | GCA008726175_00427 | gene | open | 7707-8333 | recR | ||
| 3050 | VYVD01000017.1 | GCA008726175_00428 | gene | open | 8367-9179 | gatD | ||
| 3051 | VYVD01000017.1 | GCA008726175_00429 | gene | open | 9180-10610 | murT | ||
| 3052 | VYVD01000017.1 | GCA008726175_00430 | gene | open | 10879-11217 | |||
| 3053 | VYVD01000017.1 | GCA008726175_00431 | gene | open | 11230-12129 | |||
| 3054 | VYVD01000017.1 | GCA008726175_00432 | gene | open | 12133-12729 | |||
| 3055 | VYVD01000017.1 | GCA008726175_00433 | gene | open | 12726-13172 | |||
| 3056 | VYVD01000017.1 | GCA008726175_00434 | gene | open | 13232-14599 | |||
| 3057 | VYVD01000017.1 | GCA008726175_00435 | gene | open | 15002-16042 | |||
| 3058 | VYVD01000017.1 | GCA008726175_00436 | gene | open | 16177-17994 | leuA | ||
| 3059 | VYVD01000017.1 | GCA008726175_00437 | gene | open | 18272-20905 | |||
| 3060 | VYVD01000017.1 | GCA008726175_00438 | gene | open | 20905-23247 | |||
| 3061 | VYVD01000017.1 | GCA008726175_00439 | gene | open | 23254-24306 | |||
| 3062 | VYVD01000017.1 | GCA008726175_00440 | gene | open | 24463-25527 | |||
| 3063 | VYVD01000017.1 | GCA008726175_00441 | gene | open | 25969-27234 | |||
| 3064 | VYVD01000017.1 | GCA008726175_00442 | gene | open | 27244-28284 | |||
| 3065 | VYVD01000017.1 | GCA008726175_00443 | gene | open | 29099-30055 | |||
| 3066 | VYVD01000017.1 | GCA008726175_00444 | gene | open | 30092-31102 | |||
| 3067 | VYVD01000017.1 | GCA008726175_00445 | gene | open | 31099-32151 | |||
| 3068 | VYVD01000017.1 | GCA008726175_00446 | gene | open | 32148-32942 | |||
| 3069 | VYVD01000017.1 | GCA008726175_00447 | gene | open | 32939-33862 | |||
| 3070 | VYVD01000017.1 | GCA008726175_00448 | gene | open | 33974-35155 | |||
| 3071 | VYVD01000017.1 | GCA008726175_00449 | gene | open | 35684-36331 | |||
| 3072 | VYVD01000017.1 | GCA008726175_00450 | gene | open | 37271-40192 | |||
| 3073 | VYVD01000017.1 | GCA008726175_00451 | gene | open | 40202-40957 | |||
| 3074 | VYVD01000017.1 | GCA008726175_00452 | gene | open | 41133-41492 | |||
| 3075 | VYVD01000017.1 | GCA008726175_00453 | gene | open | 42163-43797 | |||
| 3076 | VYVD01000017.1 | GCA008726175_00454 | gene | open | 44011-45048 | |||
| 3077 | VYVD01000017.1 | GCA008726175_00455 | gene | open | 45041-45973 | |||
| 3078 | VYVD01000017.1 | GCA008726175_00456 | gene | open | 45973-49191 | |||
| 3079 | VYVD01000018.1 | GCA008726175_00458 | CDS | open | 512-1084 | _na 190_aa | YbhB/YbcL family Raf kinase inhibitor-like protein | |
| 3080 | VYVD01000018.1 | GCA008726175_00459 | CDS | open | 1223-2323 | _na 366_aa | quinone-dependent dihydroorotate dehydrogenase | |
| 3081 | VYVD01000018.1 | GCA008726175_00460 | CDS | open | 2324-3373 | _na 349_aa | lppL | Prolipoprotein LppL |
| 3082 | VYVD01000018.1 | GCA008726175_00461 | CDS | open | 3596-4531 | _na 311_aa | Aldo/keto reductase family protein | |
| 3083 | VYVD01000018.1 | GCA008726175_00462 | CDS | open | 4553-5545 | _na 330_aa | undecaprenyl-diphosphate phosphatase | |
| 3084 | VYVD01000018.1 | GCA008726175_00463 | CDS | open | 5564-6919 | _na 451_aa | mshC | cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase |
| 3085 | VYVD01000018.1 | GCA008726175_00464 | CDS | open | 6922-7329 | _na 135_aa | hypothetical protein | |
| 3086 | VYVD01000018.1 | GCA008726175_00465 | CDS | open | 7379-11038 | _na 1219_aa | metH | methionine synthase |
| 3087 | VYVD01000018.1 | GCA008726175_00466 | CDS | open | 11046-11951 | _na 301_aa | Thioesterase-like superfamily protein | |
| 3088 | VYVD01000018.1 | GCA008726175_00467 | CDS | open | 12107-12790 | _na 227_aa | HAD family phosphatase | |
| 3089 | VYVD01000018.1 | GCA008726175_00468 | CDS | open | 12813-13076 | _na 87_aa | phosphoribosyl-ATP diphosphatase | |
| 3090 | VYVD01000018.1 | GCA008726175_00469 | CDS | open | 13091-13936 | _na 281_aa | hisG | ATP phosphoribosyltransferase |
| 3091 | VYVD01000018.1 | GCA008726175_00470 | CDS | open | 14195-15643 | _na 482_aa | aspA | aspartate ammonia-lyase |
| 3092 | VYVD01000018.1 | GCA008726175_00471 | CDS | open | 15683-16996 | _na 437_aa | dcuA | C4-dicarboxylate transporter DcuA |
| 3093 | VYVD01000018.1 | GCA008726175_00472 | CDS | open | 17174-18106 | _na 310_aa | recB | RecB family exonuclease |
| 3094 | VYVD01000018.1 | GCA008726175_00473 | CDS | open | 18187-19029 | _na 280_aa | trmI | tRNA (adenine(58)-N(1))-methyltransferase TrmI |
| 3095 | VYVD01000018.1 | GCA008726175_00474 | CDS | open | 19121-20716 | _na 531_aa | arc | proteasome ATPase |
| 3096 | VYVD01000018.1 | GCA008726175_00475 | CDS | open | 20709-22286 | _na 525_aa | dop | depupylase/deamidase Dop |
| 3097 | VYVD01000018.1 | GCA008726175_00476 | CDS | open | 22348-22542 | _na 64_aa | Prokaryotic ubiquitin-like protein Pup | |
| 3098 | VYVD01000018.1 | GCA008726175_00477 | CDS | open | 22546-24072 | _na 508_aa | pafA | Pup--protein ligase |
| 3099 | VYVD01000018.1 | GCA008726175_00478 | CDS | open | 24116-25144 | _na 342_aa | WYL domain protein | |
| 3100 | VYVD01000018.1 | GCA008726175_00479 | CDS | open | 25144-26175 | _na 343_aa | WYL domain protein | |
| 3101 | VYVD01000018.1 | GCA008726175_00480 | CDS | open | 26250-26561 | _na 103_aa | tatA | Sec-independent protein translocase subunit TatA |
| 3102 | VYVD01000018.1 | GCA008726175_00481 | CDS | open | 26646-27806 | _na 386_aa | tatC | twin-arginine translocase subunit TatC |
| 3103 | VYVD01000018.1 | GCA008726175_00482 | CDS | open | 27831-30617 | _na 928_aa | DEAD/DEAH box helicase | |
| 3104 | VYVD01000018.1 | GCA008726175_00483 | CDS | open | 30707-31822 | _na 371_aa | Aminopeptidase P family protein | |
| 3105 | VYVD01000018.1 | GCA008726175_00484 | CDS | open | 31855-32619 | _na 254_aa | Short chain dehydrogenase family protein | |
| 3106 | VYVD01000018.1 | GCA008726175_00485 | CDS | open | 32616-33842 | _na 408_aa | Precorrin-6Y C | |
| 3107 | VYVD01000018.1 | GCA008726175_00486 | CDS | open | 33889-34662 | _na 257_aa | cobM | precorrin-4 C(11)-methyltransferase |
| 3108 | VYVD01000018.1 | GCA008726175_00487 | CDS | open | 34650-35390 | _na 246_aa | cobalt-precorrin-6A reductase | |
| 3109 | VYVD01000018.1 | GCA008726175_00488 | CDS | open | 35415-35720 | _na 101_aa | Putative membrane protein | |
| 3110 | VYVD01000018.1 | GCA008726175_00489 | CDS | open | 35701-36171 | _na 156_aa | hypothetical protein | |
| 3111 | VYVD01000018.1 | GCA008726175_00490 | CDS | open | 36598-38211 | _na 537_aa | cobI | precorrin-2 C(20)-methyltransferase |
| 3112 | VYVD01000018.1 | GCA008726175_00491 | CDS | open | 38215-38865 | _na 216_aa | precorrin-8X methylmutase | |
| 3113 | VYVD01000018.1 | GCA008726175_00492 | CDS | open | 38877-40190 | _na 437_aa | cobG | precorrin-3B synthase |
| 3114 | VYVD01000018.1 | GCA008726175_00493 | CDS | open | 40304-41866 | _na 520_aa | Lipase | |
| 3115 | VYVD01000018.1 | GCA008726175_00494 | CDS | open | 41750-41974 | _na 74_aa | hypothetical protein | |
| 3116 | VYVD01000018.1 | GCA008726175_00495 | CDS | open | 42025-45690 | _na 1221_aa | cobN | cobaltochelatase subunit CobN |
| 3117 | VYVD01000018.1 | GCA008726175_00496 | CDS | open | 45789-46409 | _na 206_aa | fxsA | FxsA cytoplasmic membrane family protein |
| 3118 | VYVD01000018.1 | GCA008726175_00497 | CDS | open | 46448-48136 | _na 562_aa | lnt | apolipoprotein N-acyltransferase |
| 3119 | VYVD01000018.1 | GCA008726175_00498 | CDS | open | 48149-48961 | _na 270_aa | Glycosyl transferase 2 family protein | |
| 3120 | VYVD01000018.1 | GCA008726175_00458 | gene | open | 512-1084 | |||
| 3121 | VYVD01000018.1 | GCA008726175_00459 | gene | open | 1223-2323 | |||
| 3122 | VYVD01000018.1 | GCA008726175_00460 | gene | open | 2324-3373 | lppL | ||
| 3123 | VYVD01000018.1 | GCA008726175_00461 | gene | open | 3596-4531 | |||
| 3124 | VYVD01000018.1 | GCA008726175_00462 | gene | open | 4553-5545 | |||
| 3125 | VYVD01000018.1 | GCA008726175_00463 | gene | open | 5564-6919 | mshC | ||
| 3126 | VYVD01000018.1 | GCA008726175_00464 | gene | open | 6922-7329 | |||
| 3127 | VYVD01000018.1 | GCA008726175_00465 | gene | open | 7379-11038 | metH | ||
| 3128 | VYVD01000018.1 | GCA008726175_00466 | gene | open | 11046-11951 | |||
| 3129 | VYVD01000018.1 | GCA008726175_00467 | gene | open | 12107-12790 | |||
| 3130 | VYVD01000018.1 | GCA008726175_00468 | gene | open | 12813-13076 | |||
| 3131 | VYVD01000018.1 | GCA008726175_00469 | gene | open | 13091-13936 | hisG | ||
| 3132 | VYVD01000018.1 | GCA008726175_00470 | gene | open | 14195-15643 | aspA | ||
| 3133 | VYVD01000018.1 | GCA008726175_00471 | gene | open | 15683-16996 | dcuA | ||
| 3134 | VYVD01000018.1 | GCA008726175_00472 | gene | open | 17174-18106 | recB | ||
| 3135 | VYVD01000018.1 | GCA008726175_00473 | gene | open | 18187-19029 | trmI | ||
| 3136 | VYVD01000018.1 | GCA008726175_00474 | gene | open | 19121-20716 | arc | ||
| 3137 | VYVD01000018.1 | GCA008726175_00475 | gene | open | 20709-22286 | dop | ||
| 3138 | VYVD01000018.1 | GCA008726175_00476 | gene | open | 22348-22542 | |||
| 3139 | VYVD01000018.1 | GCA008726175_00477 | gene | open | 22546-24072 | pafA | ||
| 3140 | VYVD01000018.1 | GCA008726175_00478 | gene | open | 24116-25144 | |||
| 3141 | VYVD01000018.1 | GCA008726175_00479 | gene | open | 25144-26175 | |||
| 3142 | VYVD01000018.1 | GCA008726175_00480 | gene | open | 26250-26561 | tatA | ||
| 3143 | VYVD01000018.1 | GCA008726175_00481 | gene | open | 26646-27806 | tatC | ||
| 3144 | VYVD01000018.1 | GCA008726175_00482 | gene | open | 27831-30617 | |||
| 3145 | VYVD01000018.1 | GCA008726175_00483 | gene | open | 30707-31822 | |||
| 3146 | VYVD01000018.1 | GCA008726175_00484 | gene | open | 31855-32619 | |||
| 3147 | VYVD01000018.1 | GCA008726175_00485 | gene | open | 32616-33842 | |||
| 3148 | VYVD01000018.1 | GCA008726175_00486 | gene | open | 33889-34662 | cobM | ||
| 3149 | VYVD01000018.1 | GCA008726175_00487 | gene | open | 34650-35390 | |||
| 3150 | VYVD01000018.1 | GCA008726175_00488 | gene | open | 35415-35720 | |||
| 3151 | VYVD01000018.1 | GCA008726175_00489 | gene | open | 35701-36171 | |||
| 3152 | VYVD01000018.1 | GCA008726175_00490 | gene | open | 36598-38211 | cobI | ||
| 3153 | VYVD01000018.1 | GCA008726175_00491 | gene | open | 38215-38865 | |||
| 3154 | VYVD01000018.1 | GCA008726175_00492 | gene | open | 38877-40190 | cobG | ||
| 3155 | VYVD01000018.1 | GCA008726175_00493 | gene | open | 40304-41866 | |||
| 3156 | VYVD01000018.1 | GCA008726175_00494 | gene | open | 41750-41974 | |||
| 3157 | VYVD01000018.1 | GCA008726175_00495 | gene | open | 42025-45690 | cobN | ||
| 3158 | VYVD01000018.1 | GCA008726175_00496 | gene | open | 45789-46409 | fxsA | ||
| 3159 | VYVD01000018.1 | GCA008726175_00497 | gene | open | 46448-48136 | lnt | ||
| 3160 | VYVD01000018.1 | GCA008726175_00498 | gene | open | 48149-48961 | |||
| 3161 | VYVD01000018.1 | GCA008726175_00457 | gene | open | 200-285 | trnL | ||
| 3162 | VYVD01000018.1 | GCA008726175_00457 | tRNA | open | 200-285 | trnL | tRNA-Leu(gag) | |
| 3163 | VYVD01000019.1 | GCA008726175_00499 | CDS | open | 306-1058 | _na 250_aa | HNH nuclease domain-containing protein | |
| 3164 | VYVD01000019.1 | GCA008726175_00500 | CDS | open | 1731-2075 | _na 114_aa | NIPSNAP domain-containing protein | |
| 3165 | VYVD01000019.1 | GCA008726175_00501 | CDS | open | 2145-2474 | _na 109_aa | Cation transporter | |
| 3166 | VYVD01000019.1 | GCA008726175_00502 | CDS | open | 2471-2830 | _na 119_aa | Cation transporter | |
| 3167 | VYVD01000019.1 | GCA008726175_00503 | CDS | open | 2827-3372 | _na 181_aa | tetR | Transcriptional regulator%2C TetR family |
| 3168 | VYVD01000019.1 | GCA008726175_00504 | CDS | open | 3579-4136 | _na 185_aa | Resolvase/invertase-type recombinase catalytic domain-containing protein | |
| 3169 | VYVD01000019.1 | GCA008726175_00505 | CDS | open | 4399-4674 | _na 91_aa | hypothetical protein | |
| 3170 | VYVD01000019.1 | GCA008726175_00506 | CDS | open | 4998-5279 | _na 93_aa | DUF3618 domain-containing protein | |
| 3171 | VYVD01000019.1 | GCA008726175_00507 | CDS | open | 5430-5957 | _na 175_aa | bcp | thioredoxin-dependent thiol peroxidase |
| 3172 | VYVD01000019.1 | GCA008726175_00508 | CDS | open | 6117-6692 | _na 191_aa | tetR | Bacterial regulatory s%2C tetR family protein |
| 3173 | VYVD01000019.1 | GCA008726175_00509 | CDS | open | 6853-8613 | _na 586_aa | Cell surface protein | |
| 3174 | VYVD01000019.1 | GCA008726175_00510 | CDS | open | 8626-9030 | _na 134_aa | holo-ACP synthase | |
| 3175 | VYVD01000019.1 | GCA008726175_00511 | CDS | open | 9027-18122 | _na 3031_aa | Ketosynthase family 3 (KS3) domain-containing protein | |
| 3176 | VYVD01000019.1 | GCA008726175_00512 | CDS | open | 18517-18714 | _na 65_aa | Coil containing protein | |
| 3177 | VYVD01000019.1 | GCA008726175_00513 | CDS | open | 18897-19316 | _na 139_aa | hypothetical protein | |
| 3178 | VYVD01000019.1 | GCA008726175_00515 | CDS | open | 19757-20152 | _na 131_aa | Glucitol operon activator family protein | |
| 3179 | VYVD01000019.1 | GCA008726175_00516 | CDS | open | 20186-20539 | _na 117_aa | Integral membrane domain protein | |
| 3180 | VYVD01000019.1 | GCA008726175_00517 | CDS | open | 20562-21263 | _na 233_aa | dITP/XTP pyrophosphatase | |
| 3181 | VYVD01000019.1 | GCA008726175_00518 | CDS | open | 21260-22021 | _na 253_aa | rph | ribonuclease PH |
| 3182 | VYVD01000019.1 | GCA008726175_00519 | CDS | open | 22090-22839 | _na 249_aa | Metallo-beta-lactamase superfamily protein | |
| 3183 | VYVD01000019.1 | GCA008726175_00520 | CDS | open | 22946-23812 | _na 288_aa | murI | glutamate racemase |
| 3184 | VYVD01000019.1 | GCA008726175_00521 | CDS | open | 23921-24595 | _na 224_aa | Rhomboid family intramembrane serine protease | |
| 3185 | VYVD01000019.1 | GCA008726175_00522 | CDS | open | 24612-25715 | _na 367_aa | Peptidase S58 family protein | |
| 3186 | VYVD01000019.1 | GCA008726175_00523 | CDS | open | 25801-26352 | _na 183_aa | DUF2017 domain-containing protein | |
| 3187 | VYVD01000019.1 | GCA008726175_00524 | CDS | open | 26383-26652 | _na 89_aa | clpS | ATP-dependent Clp protease adapter ClpS |
| 3188 | VYVD01000019.1 | GCA008726175_00525 | CDS | open | 26758-28068 | _na 436_aa | nicotinate phosphoribosyltransferase | |
| 3189 | VYVD01000019.1 | GCA008726175_00526 | CDS | open | 28083-30185 | _na 700_aa | DNA 5'-3' helicase | |
| 3190 | VYVD01000019.1 | GCA008726175_00527 | CDS | open | 30338-31951 | _na 537_aa | AMP-binding enzyme family protein | |
| 3191 | VYVD01000019.1 | GCA008726175_00528 | CDS | open | 31942-32745 | _na 267_aa | peptidyl-tRNA hydrolase | |
| 3192 | VYVD01000019.1 | GCA008726175_00529 | CDS | open | 32745-34037 | _na 430_aa | serB | phosphoserine phosphatase SerB |
| 3193 | VYVD01000019.1 | GCA008726175_00530 | CDS | open | 34315-36015 | _na 566_aa | ctaD | cytochrome c oxidase subunit I |
| 3194 | VYVD01000019.1 | GCA008726175_00531 | CDS | open | 36346-37362 | _na 338_aa | nrdF | class 1b ribonucleoside-diphosphate reductase subunit beta |
| 3195 | VYVD01000019.1 | GCA008726175_00532 | CDS | open | 37700-39145 | _na 481_aa | Major Facilitator Superfamily protein | |
| 3196 | VYVD01000019.1 | GCA008726175_00533 | CDS | open | 39196-39921 | _na 241_aa | deoD | purine-nucleoside phosphorylase |
| 3197 | VYVD01000019.1 | GCA008726175_00534 | CDS | open | 40157-42310 | _na 717_aa | nrdE | class 1b ribonucleoside-diphosphate reductase subunit alpha |
| 3198 | VYVD01000019.1 | GCA008726175_00535 | CDS | open | 42476-42898 | _na 140_aa | nrdI | class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI |
| 3199 | VYVD01000019.1 | GCA008726175_00536 | CDS | open | 42984-43208 | _na 74_aa | nrdH | Glutaredoxin-like protein NrdH |
| 3200 | VYVD01000019.1 | GCA008726175_00537 | CDS | open | 43961-44083 | _na 40_aa | ykgO | type B 50S ribosomal protein L36 |
| 3201 | VYVD01000019.1 | GCA008726175_00538 | CDS | open | 44335-45816 | _na 493_aa | MFS transporter | |
| 3202 | VYVD01000019.1 | GCA008726175_00539 | CDS | open | 45855-46706 | _na 283_aa | nadE | ammonia-dependent NAD(+) synthetase |
| 3203 | VYVD01000019.1 | GCA008726175_00540 | CDS | open | 46758-47285 | _na 175_aa | TetR/AcrR family transcriptional regulator | |
| 3204 | VYVD01000019.1 | GCA008726175_00541 | CDS | open | 47534-47968 | _na 144_aa | Pyridoxamine 5'-phosphate oxidase family protein | |
| 3205 | VYVD01000019.1 | GCA008726175_00542 | CDS | open | 48016-48174 | _na 52_aa | hypothetical protein | |
| 3206 | VYVD01000019.1 | GCA008726175_00543 | CDS | open | 48219-48506 | _na 95_aa | hypothetical protein | |
| 3207 | VYVD01000019.1 | GCA008726175_00499 | gene | open | 306-1058 | |||
| 3208 | VYVD01000019.1 | GCA008726175_00500 | gene | open | 1731-2075 | |||
| 3209 | VYVD01000019.1 | GCA008726175_00501 | gene | open | 2145-2474 | |||
| 3210 | VYVD01000019.1 | GCA008726175_00502 | gene | open | 2471-2830 | |||
| 3211 | VYVD01000019.1 | GCA008726175_00503 | gene | open | 2827-3372 | tetR | ||
| 3212 | VYVD01000019.1 | GCA008726175_00504 | gene | open | 3579-4136 | |||
| 3213 | VYVD01000019.1 | GCA008726175_00505 | gene | open | 4399-4674 | |||
| 3214 | VYVD01000019.1 | GCA008726175_00506 | gene | open | 4998-5279 | |||
| 3215 | VYVD01000019.1 | GCA008726175_00507 | gene | open | 5430-5957 | bcp | ||
| 3216 | VYVD01000019.1 | GCA008726175_00508 | gene | open | 6117-6692 | tetR | ||
| 3217 | VYVD01000019.1 | GCA008726175_00509 | gene | open | 6853-8613 | |||
| 3218 | VYVD01000019.1 | GCA008726175_00510 | gene | open | 8626-9030 | |||
| 3219 | VYVD01000019.1 | GCA008726175_00511 | gene | open | 9027-18122 | |||
| 3220 | VYVD01000019.1 | GCA008726175_00512 | gene | open | 18517-18714 | |||
| 3221 | VYVD01000019.1 | GCA008726175_00513 | gene | open | 18897-19316 | |||
| 3222 | VYVD01000019.1 | GCA008726175_00515 | gene | open | 19757-20152 | |||
| 3223 | VYVD01000019.1 | GCA008726175_00516 | gene | open | 20186-20539 | |||
| 3224 | VYVD01000019.1 | GCA008726175_00517 | gene | open | 20562-21263 | |||
| 3225 | VYVD01000019.1 | GCA008726175_00518 | gene | open | 21260-22021 | rph | ||
| 3226 | VYVD01000019.1 | GCA008726175_00519 | gene | open | 22090-22839 | |||
| 3227 | VYVD01000019.1 | GCA008726175_00520 | gene | open | 22946-23812 | murI | ||
| 3228 | VYVD01000019.1 | GCA008726175_00521 | gene | open | 23921-24595 | |||
| 3229 | VYVD01000019.1 | GCA008726175_00522 | gene | open | 24612-25715 | |||
| 3230 | VYVD01000019.1 | GCA008726175_00523 | gene | open | 25801-26352 | |||
| 3231 | VYVD01000019.1 | GCA008726175_00524 | gene | open | 26383-26652 | clpS | ||
| 3232 | VYVD01000019.1 | GCA008726175_00525 | gene | open | 26758-28068 | |||
| 3233 | VYVD01000019.1 | GCA008726175_00526 | gene | open | 28083-30185 | |||
| 3234 | VYVD01000019.1 | GCA008726175_00527 | gene | open | 30338-31951 | |||
| 3235 | VYVD01000019.1 | GCA008726175_00528 | gene | open | 31942-32745 | |||
| 3236 | VYVD01000019.1 | GCA008726175_00529 | gene | open | 32745-34037 | serB | ||
| 3237 | VYVD01000019.1 | GCA008726175_00530 | gene | open | 34315-36015 | ctaD | ||
| 3238 | VYVD01000019.1 | GCA008726175_00531 | gene | open | 36346-37362 | nrdF | ||
| 3239 | VYVD01000019.1 | GCA008726175_00532 | gene | open | 37700-39145 | |||
| 3240 | VYVD01000019.1 | GCA008726175_00533 | gene | open | 39196-39921 | deoD | ||
| 3241 | VYVD01000019.1 | GCA008726175_00534 | gene | open | 40157-42310 | nrdE | ||
| 3242 | VYVD01000019.1 | GCA008726175_00535 | gene | open | 42476-42898 | nrdI | ||
| 3243 | VYVD01000019.1 | GCA008726175_00536 | gene | open | 42984-43208 | nrdH | ||
| 3244 | VYVD01000019.1 | GCA008726175_00537 | gene | open | 43961-44083 | ykgO | ||
| 3245 | VYVD01000019.1 | GCA008726175_00538 | gene | open | 44335-45816 | |||
| 3246 | VYVD01000019.1 | GCA008726175_00539 | gene | open | 45855-46706 | nadE | ||
| 3247 | VYVD01000019.1 | GCA008726175_00540 | gene | open | 46758-47285 | |||
| 3248 | VYVD01000019.1 | GCA008726175_00541 | gene | open | 47534-47968 | |||
| 3249 | VYVD01000019.1 | GCA008726175_00542 | gene | open | 48016-48174 | |||
| 3250 | VYVD01000019.1 | GCA008726175_00543 | gene | open | 48219-48506 | |||
| 3251 | VYVD01000019.1 | GCA008726175_00514 | gene | open | 19473-19554 | trnL | ||
| 3252 | VYVD01000019.1 | GCA008726175_00514 | tRNA | open | 19473-19554 | trnL | tRNA-Leu(tag) | |
| 3253 | VYVD01000020.1 | repeat_region | open | 23966-26039 | CRISPR array with 34 repeats of length 28%2C consensus sequence GTTTTCCCCGCGCGAGCGGGGATGTTCC and spacer length 33 | |||
| 3254 | VYVD01000020.1 | GCA008726175_00726 | CDS | open | 698-1513 | _na 271_aa | Integral membrane protein | |
| 3255 | VYVD01000020.1 | GCA008726175_00727 | CDS | open | 1552-1671 | _na 39_aa | hypothetical protein | |
| 3256 | VYVD01000020.1 | GCA008726175_00728 | CDS | open | 1799-3061 | _na 420_aa | alanine transaminase | |
| 3257 | VYVD01000020.1 | GCA008726175_00729 | CDS | open | 3081-4433 | _na 450_aa | PLP-dependent aminotransferase family protein | |
| 3258 | VYVD01000020.1 | GCA008726175_00730 | CDS | open | 4458-4874 | _na 138_aa | YdhG-like domain-containing protein | |
| 3259 | VYVD01000020.1 | GCA008726175_00731 | CDS | open | 4934-6316 | _na 460_aa | Drug resistance MFS transporter%2C drug:H+ antiporter-2 family protein | |
| 3260 | VYVD01000020.1 | GCA008726175_00732 | CDS | open | 6300-6992 | _na 230_aa | ABC transporter family protein | |
| 3261 | VYVD01000020.1 | GCA008726175_00733 | CDS | open | 6989-8002 | _na 337_aa | Phosphatidate phosphatase APP1 catalytic domain-containing protein | |
| 3262 | VYVD01000020.1 | GCA008726175_00734 | CDS | open | 8096-8422 | _na 108_aa | Transglycosylase-like domain protein | |
| 3263 | VYVD01000020.1 | GCA008726175_00735 | CDS | open | 8419-9648 | _na 409_aa | HNH endonuclease family protein | |
| 3264 | VYVD01000020.1 | GCA008726175_00736 | CDS | open | 9946-10089 | _na 47_aa | N-acetyltransferase family protein | |
| 3265 | VYVD01000020.1 | GCA008726175_00737 | CDS | open | 10068-10307 | _na 79_aa | GNAT family N-acetyltransferase | |
| 3266 | VYVD01000020.1 | GCA008726175_00738 | CDS | open | 10264-11181 | _na 305_aa | Pyridine nucleotide-disulfide oxidoreductase family protein | |
| 3267 | VYVD01000020.1 | GCA008726175_00739 | CDS | open | 11236-12234 | _na 332_aa | Luciferase-type oxidoreductase%2C family protein | |
| 3268 | VYVD01000020.1 | GCA008726175_00740 | CDS | open | 12218-13255 | _na 345_aa | L-glyceraldehyde 3-phosphate reductase | |
| 3269 | VYVD01000020.1 | GCA008726175_00741 | CDS | open | 13401-14729 | _na 442_aa | Peptidase | |
| 3270 | VYVD01000020.1 | GCA008726175_00742 | CDS | open | 14985-17795 | _na 936_aa | CRISPR-associated helicase Cas3 | |
| 3271 | VYVD01000020.1 | GCA008726175_00743 | CDS | open | 17792-19426 | _na 544_aa | casA | type I-E CRISPR-associated protein Cse1/CasA |
| 3272 | VYVD01000020.1 | GCA008726175_00744 | CDS | open | 19429-20052 | _na 207_aa | casB | type I-E CRISPR-associated protein Cse2/CasB |
| 3273 | VYVD01000020.1 | GCA008726175_00745 | CDS | open | 20073-21194 | _na 373_aa | cas7e | type I-E CRISPR-associated protein Cas7/Cse4/CasC |
| 3274 | VYVD01000020.1 | GCA008726175_00746 | CDS | open | 21194-21895 | _na 233_aa | cas5e | type I-E CRISPR-associated protein Cas5/CasD |
| 3275 | VYVD01000020.1 | GCA008726175_00747 | CDS | open | 21899-22600 | _na 233_aa | cas6e | type I-E CRISPR-associated protein Cas6/Cse3/CasE |
| 3276 | VYVD01000020.1 | GCA008726175_00748 | CDS | open | 22603-23562 | _na 319_aa | cas1e | type I-E CRISPR-associated endonuclease Cas1e |
| 3277 | VYVD01000020.1 | GCA008726175_00749 | CDS | open | 23556-23921 | _na 121_aa | cas2e | type I-E CRISPR-associated endoribonuclease Cas2e |
| 3278 | VYVD01000020.1 | GCA008726175_00750 | CDS | open | 26122-26526 | _na 134_aa | Helicase | |
| 3279 | VYVD01000020.1 | GCA008726175_00751 | CDS | open | 26635-26970 | _na 111_aa | YCII-related domain-containing protein | |
| 3280 | VYVD01000020.1 | GCA008726175_00752 | CDS | open | 26972-27823 | _na 283_aa | Short chain dehydrogenase family protein | |
| 3281 | VYVD01000020.1 | GCA008726175_00753 | CDS | open | 27820-29037 | _na 405_aa | Saccharopine dehydrogenase | |
| 3282 | VYVD01000020.1 | GCA008726175_00754 | CDS | open | 29144-30352 | _na 402_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 3283 | VYVD01000020.1 | GCA008726175_00755 | CDS | open | 30520-31767 | _na 415_aa | Fic family protein | |
| 3284 | VYVD01000020.1 | GCA008726175_00756 | CDS | open | 31782-32168 | _na 128_aa | Iron-sulfur protein | |
| 3285 | VYVD01000020.1 | GCA008726175_00757 | CDS | open | 32199-32915 | _na 238_aa | Pyridoxal phosphate homeostasis protein | |
| 3286 | VYVD01000020.1 | GCA008726175_00758 | CDS | open | 32973-34172 | _na 399_aa | DUF2029 domain-containing protein | |
| 3287 | VYVD01000020.1 | GCA008726175_00759 | CDS | open | 34185-36602 | _na 805_aa | hrpB | ATP-dependent helicase HrpB |
| 3288 | VYVD01000020.1 | GCA008726175_00760 | CDS | open | 36646-37539 | _na 297_aa | Cation diffusion facilitator transporter family protein | |
| 3289 | VYVD01000020.1 | GCA008726175_00761 | CDS | open | 37649-38596 | _na 315_aa | Serine aminopeptidase S33 domain-containing protein | |
| 3290 | VYVD01000020.1 | GCA008726175_00762 | CDS | open | 38609-39109 | _na 166_aa | Methylated-DNA--protein-cysteine methyltransferase | |
| 3291 | VYVD01000020.1 | GCA008726175_00763 | CDS | open | 39113-39775 | _na 220_aa | Nitroreductase family protein | |
| 3292 | VYVD01000020.1 | GCA008726175_00764 | CDS | open | 39787-41847 | _na 686_aa | Flavin oxidoreductase / NADH oxidase family protein | |
| 3293 | VYVD01000020.1 | GCA008726175_00765 | CDS | open | 42031-42792 | _na 253_aa | SDR family oxidoreductase | |
| 3294 | VYVD01000020.1 | GCA008726175_00766 | CDS | open | 42817-43548 | _na 243_aa | SDR family oxidoreductase | |
| 3295 | VYVD01000020.1 | GCA008726175_00767 | CDS | open | 43631-45328 | _na 565_aa | AMP-binding enzyme family protein | |
| 3296 | VYVD01000020.1 | GCA008726175_00768 | CDS | open | 45868-46329 | _na 153_aa | HNH endonuclease family protein | |
| 3297 | VYVD01000020.1 | GCA008726175_00726 | gene | open | 698-1513 | |||
| 3298 | VYVD01000020.1 | GCA008726175_00727 | gene | open | 1552-1671 | |||
| 3299 | VYVD01000020.1 | GCA008726175_00728 | gene | open | 1799-3061 | |||
| 3300 | VYVD01000020.1 | GCA008726175_00729 | gene | open | 3081-4433 | |||
| 3301 | VYVD01000020.1 | GCA008726175_00730 | gene | open | 4458-4874 | |||
| 3302 | VYVD01000020.1 | GCA008726175_00731 | gene | open | 4934-6316 | |||
| 3303 | VYVD01000020.1 | GCA008726175_00732 | gene | open | 6300-6992 | |||
| 3304 | VYVD01000020.1 | GCA008726175_00733 | gene | open | 6989-8002 | |||
| 3305 | VYVD01000020.1 | GCA008726175_00734 | gene | open | 8096-8422 | |||
| 3306 | VYVD01000020.1 | GCA008726175_00735 | gene | open | 8419-9648 | |||
| 3307 | VYVD01000020.1 | GCA008726175_00736 | gene | open | 9946-10089 | |||
| 3308 | VYVD01000020.1 | GCA008726175_00737 | gene | open | 10068-10307 | |||
| 3309 | VYVD01000020.1 | GCA008726175_00738 | gene | open | 10264-11181 | |||
| 3310 | VYVD01000020.1 | GCA008726175_00739 | gene | open | 11236-12234 | |||
| 3311 | VYVD01000020.1 | GCA008726175_00740 | gene | open | 12218-13255 | |||
| 3312 | VYVD01000020.1 | GCA008726175_00741 | gene | open | 13401-14729 | |||
| 3313 | VYVD01000020.1 | GCA008726175_00742 | gene | open | 14985-17795 | |||
| 3314 | VYVD01000020.1 | GCA008726175_00743 | gene | open | 17792-19426 | casA | ||
| 3315 | VYVD01000020.1 | GCA008726175_00744 | gene | open | 19429-20052 | casB | ||
| 3316 | VYVD01000020.1 | GCA008726175_00745 | gene | open | 20073-21194 | cas7e | ||
| 3317 | VYVD01000020.1 | GCA008726175_00746 | gene | open | 21194-21895 | cas5e | ||
| 3318 | VYVD01000020.1 | GCA008726175_00747 | gene | open | 21899-22600 | cas6e | ||
| 3319 | VYVD01000020.1 | GCA008726175_00748 | gene | open | 22603-23562 | cas1e | ||
| 3320 | VYVD01000020.1 | GCA008726175_00749 | gene | open | 23556-23921 | cas2e | ||
| 3321 | VYVD01000020.1 | GCA008726175_00750 | gene | open | 26122-26526 | |||
| 3322 | VYVD01000020.1 | GCA008726175_00751 | gene | open | 26635-26970 | |||
| 3323 | VYVD01000020.1 | GCA008726175_00752 | gene | open | 26972-27823 | |||
| 3324 | VYVD01000020.1 | GCA008726175_00753 | gene | open | 27820-29037 | |||
| 3325 | VYVD01000020.1 | GCA008726175_00754 | gene | open | 29144-30352 | |||
| 3326 | VYVD01000020.1 | GCA008726175_00755 | gene | open | 30520-31767 | |||
| 3327 | VYVD01000020.1 | GCA008726175_00756 | gene | open | 31782-32168 | |||
| 3328 | VYVD01000020.1 | GCA008726175_00757 | gene | open | 32199-32915 | |||
| 3329 | VYVD01000020.1 | GCA008726175_00758 | gene | open | 32973-34172 | |||
| 3330 | VYVD01000020.1 | GCA008726175_00759 | gene | open | 34185-36602 | hrpB | ||
| 3331 | VYVD01000020.1 | GCA008726175_00760 | gene | open | 36646-37539 | |||
| 3332 | VYVD01000020.1 | GCA008726175_00761 | gene | open | 37649-38596 | |||
| 3333 | VYVD01000020.1 | GCA008726175_00762 | gene | open | 38609-39109 | |||
| 3334 | VYVD01000020.1 | GCA008726175_00763 | gene | open | 39113-39775 | |||
| 3335 | VYVD01000020.1 | GCA008726175_00764 | gene | open | 39787-41847 | |||
| 3336 | VYVD01000020.1 | GCA008726175_00765 | gene | open | 42031-42792 | |||
| 3337 | VYVD01000020.1 | GCA008726175_00766 | gene | open | 42817-43548 | |||
| 3338 | VYVD01000020.1 | GCA008726175_00767 | gene | open | 43631-45328 | |||
| 3339 | VYVD01000020.1 | GCA008726175_00768 | gene | open | 45868-46329 | |||
| 3340 | VYVD01000021.1 | regulatory_region | open | 42941-43063 | TPP riboswitch aptamer (THI element) | |||
| 3341 | VYVD01000021.1 | GCA008726175_00769 | CDS | open | 304-1368 | _na 354_aa | Phosphoribosylformylglycinamidine cyclo-ligase | |
| 3342 | VYVD01000021.1 | GCA008726175_00770 | CDS | open | 1527-3095 | _na 522_aa | purF | amidophosphoribosyltransferase |
| 3343 | VYVD01000021.1 | GCA008726175_00771 | CDS | open | 3149-3589 | _na 146_aa | Bacterial SCP orthologue domain-containing protein | |
| 3344 | VYVD01000021.1 | GCA008726175_00772 | CDS | open | 3619-4626 | _na 335_aa | Thioesterase superfamily protein | |
| 3345 | VYVD01000021.1 | GCA008726175_00773 | CDS | open | 4623-5315 | _na 230_aa | Alkaline phosphatase | |
| 3346 | VYVD01000021.1 | GCA008726175_00774 | CDS | open | 5450-6388 | _na 312_aa | Peptidase C51 domain-containing protein | |
| 3347 | VYVD01000021.1 | GCA008726175_00775 | CDS | open | 6395-6895 | _na 166_aa | Glutathione peroxidase | |
| 3348 | VYVD01000021.1 | GCA008726175_00776 | CDS | open | 6933-7727 | _na 264_aa | DUF2334 domain-containing protein | |
| 3349 | VYVD01000021.1 | GCA008726175_00777 | CDS | open | 7876-8547 | _na 223_aa | bluB | 5%2C6-dimethylbenzimidazole synthase |
| 3350 | VYVD01000021.1 | GCA008726175_00778 | CDS | open | 8552-10792 | _na 746_aa | Prolyl oligopeptidase family protein | |
| 3351 | VYVD01000021.1 | GCA008726175_00779 | CDS | open | 10789-11682 | _na 297_aa | phosphoribosylaminoimidazolesuccinocarboxamide synthase | |
| 3352 | VYVD01000021.1 | GCA008726175_00780 | CDS | open | 11979-13301 | _na 440_aa | acetyl-CoA C-acetyltransferase | |
| 3353 | VYVD01000021.1 | GCA008726175_00781 | CDS | open | 13349-14707 | _na 452_aa | 3-oxoacyl-ACP reductase | |
| 3354 | VYVD01000021.1 | GCA008726175_00782 | CDS | open | 14761-15723 | _na 320_aa | MaoC-like domain-containing protein | |
| 3355 | VYVD01000021.1 | GCA008726175_00783 | CDS | open | 16075-16539 | _na 154_aa | nrdI | class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI |
| 3356 | VYVD01000021.1 | GCA008726175_00784 | CDS | open | 16536-17540 | _na 334_aa | nrdF | class 1b ribonucleoside-diphosphate reductase subunit beta |
| 3357 | VYVD01000021.1 | GCA008726175_00785 | CDS | open | 17583-18158 | _na 191_aa | NADPH-dependent FMN reductase family protein | |
| 3358 | VYVD01000021.1 | GCA008726175_00786 | CDS | open | 18279-18974 | _na 231_aa | PhnB-like domain-containing protein | |
| 3359 | VYVD01000021.1 | GCA008726175_00787 | CDS | open | 18977-20953 | _na 658_aa | VWFA domain-containing protein | |
| 3360 | VYVD01000021.1 | GCA008726175_00788 | CDS | open | 21290-22219 | _na 309_aa | Alpha/beta hydrolase | |
| 3361 | VYVD01000021.1 | GCA008726175_00789 | CDS | open | 22405-23892 | _na 495_aa | purB | adenylosuccinate lyase |
| 3362 | VYVD01000021.1 | GCA008726175_00790 | CDS | open | 23870-24319 | _na 149_aa | iclR | IclR helix-turn-helix domain protein |
| 3363 | VYVD01000021.1 | GCA008726175_00791 | CDS | open | 24579-25859 | _na 426_aa | Reduced folate carrier family protein | |
| 3364 | VYVD01000021.1 | GCA008726175_00792 | CDS | open | 25923-26708 | _na 261_aa | Glutamate ABC transport system%2C ATP-binding protein | |
| 3365 | VYVD01000021.1 | GCA008726175_00793 | CDS | open | 26724-27665 | _na 313_aa | Glutamate-binding protein | |
| 3366 | VYVD01000021.1 | GCA008726175_00794 | CDS | open | 27685-28371 | _na 228_aa | Glutamate ABC transport system%2C permease protein | |
| 3367 | VYVD01000021.1 | GCA008726175_00795 | CDS | open | 28371-29309 | _na 312_aa | Amino ABC transporter%2C permease%2C 3-TM region%2C His/Glu/Gln/Arg/opine family domain protein | |
| 3368 | VYVD01000021.1 | GCA008726175_00796 | CDS | open | 29961-35378 | _na 1805_aa | G5 domain-containing protein | |
| 3369 | VYVD01000021.1 | GCA008726175_00797 | CDS | open | 35814-37616 | _na 600_aa | Transporter%2C betaine/carnitine/choline transporter family protein | |
| 3370 | VYVD01000021.1 | GCA008726175_00798 | CDS | open | 37826-39412 | _na 528_aa | PhoD-like phosphatase family protein | |
| 3371 | VYVD01000021.1 | GCA008726175_00799 | CDS | open | 39449-40648 | _na 399_aa | thiF | ThiF family protein |
| 3372 | VYVD01000021.1 | GCA008726175_00800 | CDS | open | 40648-41520 | _na 290_aa | Thiazole synthase | |
| 3373 | VYVD01000021.1 | GCA008726175_00801 | CDS | open | 41523-41756 | _na 77_aa | thiS | sulfur carrier protein ThiS |
| 3374 | VYVD01000021.1 | GCA008726175_00802 | CDS | open | 41770-43098 | _na 442_aa | thiO | glycine oxidase ThiO |
| 3375 | VYVD01000021.1 | GCA008726175_00803 | CDS | open | 43134-43892 | _na 252_aa | Thiamine-phosphate synthase | |
| 3376 | VYVD01000021.1 | GCA008726175_00769 | gene | open | 304-1368 | |||
| 3377 | VYVD01000021.1 | GCA008726175_00770 | gene | open | 1527-3095 | purF | ||
| 3378 | VYVD01000021.1 | GCA008726175_00771 | gene | open | 3149-3589 | |||
| 3379 | VYVD01000021.1 | GCA008726175_00772 | gene | open | 3619-4626 | |||
| 3380 | VYVD01000021.1 | GCA008726175_00773 | gene | open | 4623-5315 | |||
| 3381 | VYVD01000021.1 | GCA008726175_00774 | gene | open | 5450-6388 | |||
| 3382 | VYVD01000021.1 | GCA008726175_00775 | gene | open | 6395-6895 | |||
| 3383 | VYVD01000021.1 | GCA008726175_00776 | gene | open | 6933-7727 | |||
| 3384 | VYVD01000021.1 | GCA008726175_00777 | gene | open | 7876-8547 | bluB | ||
| 3385 | VYVD01000021.1 | GCA008726175_00778 | gene | open | 8552-10792 | |||
| 3386 | VYVD01000021.1 | GCA008726175_00779 | gene | open | 10789-11682 | |||
| 3387 | VYVD01000021.1 | GCA008726175_00780 | gene | open | 11979-13301 | |||
| 3388 | VYVD01000021.1 | GCA008726175_00781 | gene | open | 13349-14707 | |||
| 3389 | VYVD01000021.1 | GCA008726175_00782 | gene | open | 14761-15723 | |||
| 3390 | VYVD01000021.1 | GCA008726175_00783 | gene | open | 16075-16539 | nrdI | ||
| 3391 | VYVD01000021.1 | GCA008726175_00784 | gene | open | 16536-17540 | nrdF | ||
| 3392 | VYVD01000021.1 | GCA008726175_00785 | gene | open | 17583-18158 | |||
| 3393 | VYVD01000021.1 | GCA008726175_00786 | gene | open | 18279-18974 | |||
| 3394 | VYVD01000021.1 | GCA008726175_00787 | gene | open | 18977-20953 | |||
| 3395 | VYVD01000021.1 | GCA008726175_00788 | gene | open | 21290-22219 | |||
| 3396 | VYVD01000021.1 | GCA008726175_00789 | gene | open | 22405-23892 | purB | ||
| 3397 | VYVD01000021.1 | GCA008726175_00790 | gene | open | 23870-24319 | iclR | ||
| 3398 | VYVD01000021.1 | GCA008726175_00791 | gene | open | 24579-25859 | |||
| 3399 | VYVD01000021.1 | GCA008726175_00792 | gene | open | 25923-26708 | |||
| 3400 | VYVD01000021.1 | GCA008726175_00793 | gene | open | 26724-27665 | |||
| 3401 | VYVD01000021.1 | GCA008726175_00794 | gene | open | 27685-28371 | |||
| 3402 | VYVD01000021.1 | GCA008726175_00795 | gene | open | 28371-29309 | |||
| 3403 | VYVD01000021.1 | GCA008726175_00796 | gene | open | 29961-35378 | |||
| 3404 | VYVD01000021.1 | GCA008726175_00797 | gene | open | 35814-37616 | |||
| 3405 | VYVD01000021.1 | GCA008726175_00798 | gene | open | 37826-39412 | |||
| 3406 | VYVD01000021.1 | GCA008726175_00799 | gene | open | 39449-40648 | thiF | ||
| 3407 | VYVD01000021.1 | GCA008726175_00800 | gene | open | 40648-41520 | |||
| 3408 | VYVD01000021.1 | GCA008726175_00801 | gene | open | 41523-41756 | thiS | ||
| 3409 | VYVD01000021.1 | GCA008726175_00802 | gene | open | 41770-43098 | thiO | ||
| 3410 | VYVD01000021.1 | GCA008726175_00803 | gene | open | 43134-43892 | |||
| 3411 | VYVD01000022.1 | GCA008726175_00804 | CDS | open | 798-1172 | _na 124_aa | hypothetical protein | |
| 3412 | VYVD01000022.1 | GCA008726175_00805 | CDS | open | 1417-2685 | _na 422_aa | tyrS | tyrosine--tRNA ligase |
| 3413 | VYVD01000022.1 | GCA008726175_00806 | CDS | open | 2734-3384 | _na 216_aa | DNA-3-methyladenine glycosylase | |
| 3414 | VYVD01000022.1 | GCA008726175_00807 | CDS | open | 3385-3558 | _na 57_aa | UPF0434 protein CHU72_10820 | |
| 3415 | VYVD01000022.1 | GCA008726175_00808 | CDS | open | 3548-4195 | _na 215_aa | 5-bromo-4-chloroindolyl phosphate hydrolase | |
| 3416 | VYVD01000022.1 | GCA008726175_00809 | CDS | open | 4182-5813 | _na 543_aa | Magnesium chelatase | |
| 3417 | VYVD01000022.1 | GCA008726175_00810 | CDS | open | 5820-6971 | _na 383_aa | Secreted protein | |
| 3418 | VYVD01000022.1 | GCA008726175_00811 | CDS | open | 7502-8941 | _na 479_aa | argH | argininosuccinate lyase |
| 3419 | VYVD01000022.1 | GCA008726175_00812 | CDS | open | 8987-10186 | _na 399_aa | argininosuccinate synthase | |
| 3420 | VYVD01000022.1 | GCA008726175_00813 | CDS | open | 10236-10718 | _na 160_aa | arginine repressor | |
| 3421 | VYVD01000022.1 | GCA008726175_00814 | CDS | open | 10723-11664 | _na 313_aa | argF | ornithine carbamoyltransferase |
| 3422 | VYVD01000022.1 | GCA008726175_00815 | CDS | open | 11671-12876 | _na 401_aa | acetylornithine transaminase | |
| 3423 | VYVD01000022.1 | GCA008726175_00816 | CDS | open | 12933-13826 | _na 297_aa | Acetylglutamate kinase | |
| 3424 | VYVD01000022.1 | GCA008726175_00817 | CDS | open | 13848-15056 | _na 402_aa | argJ | bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ |
| 3425 | VYVD01000022.1 | GCA008726175_00818 | CDS | open | 15053-16102 | _na 349_aa | argC | N-acetyl-gamma-glutamyl-phosphate reductase |
| 3426 | VYVD01000022.1 | GCA008726175_00819 | CDS | open | 16274-17110 | _na 278_aa | Trypsin-like serine protease | |
| 3427 | VYVD01000022.1 | GCA008726175_00820 | CDS | open | 17138-19630 | _na 830_aa | pheT | phenylalanine--tRNA ligase subunit beta |
| 3428 | VYVD01000022.1 | GCA008726175_00821 | CDS | open | 19663-20712 | _na 349_aa | pheS | phenylalanine--tRNA ligase subunit alpha |
| 3429 | VYVD01000022.1 | GCA008726175_00822 | CDS | open | 20811-21641 | _na 276_aa | RNA 2'-O ribose methyltransferase substrate binding family protein | |
| 3430 | VYVD01000022.1 | GCA008726175_00823 | CDS | open | 21825-22208 | _na 127_aa | rplT | 50S ribosomal protein L20 |
| 3431 | VYVD01000022.1 | GCA008726175_00824 | CDS | open | 22286-22480 | _na 64_aa | rpmI | 50S ribosomal protein L35 |
| 3432 | VYVD01000022.1 | GCA008726175_00825 | CDS | open | 22557-23108 | _na 183_aa | infC | translation initiation factor IF-3 |
| 3433 | VYVD01000022.1 | GCA008726175_00826 | CDS | open | 23520-23888 | _na 122_aa | hypothetical protein | |
| 3434 | VYVD01000022.1 | GCA008726175_00827 | CDS | open | 23932-25944 | _na 670_aa | DUF2339 domain-containing protein | |
| 3435 | VYVD01000022.1 | GCA008726175_00828 | CDS | open | 25946-28798 | _na 950_aa | uvrA | excinuclease ABC subunit UvrA |
| 3436 | VYVD01000022.1 | GCA008726175_00829 | CDS | open | 28938-29645 | _na 235_aa | MBL fold metallo-hydrolase | |
| 3437 | VYVD01000022.1 | GCA008726175_00830 | CDS | open | 29835-30704 | _na 289_aa | doxX | DoxX family protein |
| 3438 | VYVD01000022.1 | GCA008726175_00831 | CDS | open | 30838-33339 | _na 833_aa | PhoH-like family protein | |
| 3439 | VYVD01000022.1 | GCA008726175_00832 | CDS | open | 33374-34468 | _na 364_aa | Winged helix DNA-binding domain-containing protein | |
| 3440 | VYVD01000022.1 | GCA008726175_00833 | CDS | open | 34537-34977 | _na 146_aa | Universal stress family protein | |
| 3441 | VYVD01000022.1 | GCA008726175_00834 | CDS | open | 35110-37242 | _na 710_aa | uvrB | excinuclease ABC subunit UvrB |
| 3442 | VYVD01000022.1 | GCA008726175_00835 | CDS | open | 37332-37457 | _na 41_aa | hypothetical protein | |
| 3443 | VYVD01000022.1 | GCA008726175_00836 | CDS | open | 37641-38525 | _na 294_aa | DUF559 domain-containing protein | |
| 3444 | VYVD01000022.1 | GCA008726175_00837 | CDS | open | 38620-39309 | _na 229_aa | Secreted protein | |
| 3445 | VYVD01000022.1 | GCA008726175_00838 | CDS | open | 39415-40629 | _na 404_aa | Cys/Met metabolism PLP-dependent enzyme family protein | |
| 3446 | VYVD01000022.1 | GCA008726175_00839 | CDS | open | 40562-41176 | _na 204_aa | coaE | dephospho-CoA kinase |
| 3447 | VYVD01000022.1 | GCA008726175_00840 | CDS | open | 41237-42433 | _na 398_aa | GST C-terminal domain-containing protein | |
| 3448 | VYVD01000022.1 | GCA008726175_00841 | CDS | open | 42603-42743 | _na 46_aa | hypothetical protein | |
| 3449 | VYVD01000022.1 | GCA008726175_00804 | gene | open | 798-1172 | |||
| 3450 | VYVD01000022.1 | GCA008726175_00805 | gene | open | 1417-2685 | tyrS | ||
| 3451 | VYVD01000022.1 | GCA008726175_00806 | gene | open | 2734-3384 | |||
| 3452 | VYVD01000022.1 | GCA008726175_00807 | gene | open | 3385-3558 | |||
| 3453 | VYVD01000022.1 | GCA008726175_00808 | gene | open | 3548-4195 | |||
| 3454 | VYVD01000022.1 | GCA008726175_00809 | gene | open | 4182-5813 | |||
| 3455 | VYVD01000022.1 | GCA008726175_00810 | gene | open | 5820-6971 | |||
| 3456 | VYVD01000022.1 | GCA008726175_00811 | gene | open | 7502-8941 | argH | ||
| 3457 | VYVD01000022.1 | GCA008726175_00812 | gene | open | 8987-10186 | |||
| 3458 | VYVD01000022.1 | GCA008726175_00813 | gene | open | 10236-10718 | |||
| 3459 | VYVD01000022.1 | GCA008726175_00814 | gene | open | 10723-11664 | argF | ||
| 3460 | VYVD01000022.1 | GCA008726175_00815 | gene | open | 11671-12876 | |||
| 3461 | VYVD01000022.1 | GCA008726175_00816 | gene | open | 12933-13826 | |||
| 3462 | VYVD01000022.1 | GCA008726175_00817 | gene | open | 13848-15056 | argJ | ||
| 3463 | VYVD01000022.1 | GCA008726175_00818 | gene | open | 15053-16102 | argC | ||
| 3464 | VYVD01000022.1 | GCA008726175_00819 | gene | open | 16274-17110 | |||
| 3465 | VYVD01000022.1 | GCA008726175_00820 | gene | open | 17138-19630 | pheT | ||
| 3466 | VYVD01000022.1 | GCA008726175_00821 | gene | open | 19663-20712 | pheS | ||
| 3467 | VYVD01000022.1 | GCA008726175_00822 | gene | open | 20811-21641 | |||
| 3468 | VYVD01000022.1 | GCA008726175_00823 | gene | open | 21825-22208 | rplT | ||
| 3469 | VYVD01000022.1 | GCA008726175_00824 | gene | open | 22286-22480 | rpmI | ||
| 3470 | VYVD01000022.1 | GCA008726175_00825 | gene | open | 22557-23108 | infC | ||
| 3471 | VYVD01000022.1 | GCA008726175_00826 | gene | open | 23520-23888 | |||
| 3472 | VYVD01000022.1 | GCA008726175_00827 | gene | open | 23932-25944 | |||
| 3473 | VYVD01000022.1 | GCA008726175_00828 | gene | open | 25946-28798 | uvrA | ||
| 3474 | VYVD01000022.1 | GCA008726175_00829 | gene | open | 28938-29645 | |||
| 3475 | VYVD01000022.1 | GCA008726175_00830 | gene | open | 29835-30704 | doxX | ||
| 3476 | VYVD01000022.1 | GCA008726175_00831 | gene | open | 30838-33339 | |||
| 3477 | VYVD01000022.1 | GCA008726175_00832 | gene | open | 33374-34468 | |||
| 3478 | VYVD01000022.1 | GCA008726175_00833 | gene | open | 34537-34977 | |||
| 3479 | VYVD01000022.1 | GCA008726175_00834 | gene | open | 35110-37242 | uvrB | ||
| 3480 | VYVD01000022.1 | GCA008726175_00835 | gene | open | 37332-37457 | |||
| 3481 | VYVD01000022.1 | GCA008726175_00836 | gene | open | 37641-38525 | |||
| 3482 | VYVD01000022.1 | GCA008726175_00837 | gene | open | 38620-39309 | |||
| 3483 | VYVD01000022.1 | GCA008726175_00838 | gene | open | 39415-40629 | |||
| 3484 | VYVD01000022.1 | GCA008726175_00839 | gene | open | 40562-41176 | coaE | ||
| 3485 | VYVD01000022.1 | GCA008726175_00840 | gene | open | 41237-42433 | |||
| 3486 | VYVD01000022.1 | GCA008726175_00841 | gene | open | 42603-42743 | |||
| 3487 | VYVD01000023.1 | GCA008726175_00842 | CDS | open | 780-2072 | _na 430_aa | aceA | isocitrate lyase |
| 3488 | VYVD01000023.1 | GCA008726175_00843 | CDS | open | 2275-3711 | _na 478_aa | ramB | acetate metabolism transcriptional regulator RamB |
| 3489 | VYVD01000023.1 | GCA008726175_00844 | CDS | open | 3928-5361 | _na 477_aa | lpdA | dihydrolipoyl dehydrogenase |
| 3490 | VYVD01000023.1 | GCA008726175_00845 | CDS | open | 5426-7600 | _na 724_aa | Prolyl oligopeptidase family protein | |
| 3491 | VYVD01000023.1 | GCA008726175_00846 | CDS | open | 7611-9071 | _na 486_aa | Aminopeptidase N | |
| 3492 | VYVD01000023.1 | GCA008726175_00847 | CDS | open | 9090-10475 | _na 461_aa | Polysaccharide biosynthesis protein | |
| 3493 | VYVD01000023.1 | GCA008726175_00848 | CDS | open | 10550-11371 | _na 273_aa | Glycosyltransferase | |
| 3494 | VYVD01000023.1 | GCA008726175_00849 | CDS | open | 11383-12087 | _na 234_aa | Glycosyl transferase 2 family protein | |
| 3495 | VYVD01000023.1 | GCA008726175_00850 | CDS | open | 12084-12506 | _na 140_aa | DUF2304 domain-containing protein | |
| 3496 | VYVD01000023.1 | GCA008726175_00851 | CDS | open | 12556-13551 | _na 331_aa | DSBA-like thioredoxin domain protein | |
| 3497 | VYVD01000023.1 | GCA008726175_00852 | CDS | open | 13613-14614 | _na 333_aa | UDP-glucose 4-epimerase | |
| 3498 | VYVD01000023.1 | GCA008726175_00853 | CDS | open | 14708-15997 | _na 429_aa | Sugar (And other) transporter family protein | |
| 3499 | VYVD01000023.1 | GCA008726175_00854 | CDS | open | 16749-18092 | _na 447_aa | Sugar (And other) transporter family protein | |
| 3500 | VYVD01000023.1 | GCA008726175_00855 | CDS | open | 18308-20359 | _na 683_aa | Acyl-CoA oxidase |

