HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Corynebacterium matruchotii (GCA_008868665.1)

Select a Genome:
BAKTA Annotations for GCA_008868665.1
Genome Selected: Corynebacterium matruchotii
ContigsBases CDSrRNA tmRNAtRNA
50 2850841 2543 4 1 51
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 5216 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:5]    |    Number of Records Found: 5216 [11 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2001 WBMK01000005.1 GCA008868665_02156 CDS open 140801-141451 _na     216_aa rplD 50S ribosomal protein L4
2002 WBMK01000005.1 GCA008868665_02157 CDS open 141448-142104 _na     218_aa rplC 50S ribosomal protein L3
2003 WBMK01000005.1 GCA008868665_02158 CDS open 142137-142442 _na     101_aa rpsJ 30S ribosomal protein S10
2004 WBMK01000005.1 GCA008868665_02159 CDS open 143047-144030 _na     327_aa ABC transporter%2C permease protein
2005 WBMK01000005.1 GCA008868665_02160 CDS open 144031-144981 _na     316_aa ABC transporter%2C permease protein
2006 WBMK01000005.1 GCA008868665_02161 CDS open 144978-146987 _na     669_aa oppF murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF
2007 WBMK01000005.1 GCA008868665_02162 CDS open 147004-148692 _na     562_aa ABC transporter%2C substrate-binding protein%2C family 5
2008 WBMK01000005.1 GCA008868665_02163 CDS open 148807-150492 _na     561_aa ABC transporter%2C substrate-binding protein%2C family 5
2009 WBMK01000005.1 GCA008868665_02164 CDS open 150568-152247 _na     559_aa Extracellular solute-binding protein
2010 WBMK01000005.1 GCA008868665_02165 CDS open 152257-153939 _na     560_aa ABC transporter%2C substrate-binding protein%2C family 5
2011 WBMK01000005.1 GCA008868665_02166 CDS open 153991-154203 _na     70_aa hypothetical protein
2012 WBMK01000005.1 GCA008868665_02167 CDS open 154291-155535 _na     414_aa Transporter%2C major facilitator family protein
2013 WBMK01000005.1 GCA008868665_02168 CDS open 155553-156113 _na     186_aa yetF YetF C-terminal domain-containing protein
2014 WBMK01000005.1 GCA008868665_02169 CDS open 156130-156780 _na     216_aa WYL domain-containing protein
2015 WBMK01000005.1 GCA008868665_02170 CDS open 156851-158539 _na     562_aa Tat pathway signal sequence domain protein
2016 WBMK01000005.1 GCA008868665_02171 CDS open 158658-159641 _na     327_aa Peptidase%2C M48 family
2017 WBMK01000005.1 GCA008868665_02172 CDS open 160357-161292 _na     311_aa Dyp-type peroxidase family protein
2018 WBMK01000005.1 GCA008868665_02173 CDS open 161767-162960 _na     397_aa tuf elongation factor Tu
2019 WBMK01000005.1 GCA008868665_02174 CDS open 163399-165525 _na     708_aa fusA elongation factor G
2020 WBMK01000005.1 GCA008868665_02175 CDS open 165584-166051 _na     155_aa rpsG 30S ribosomal protein S7
2021 WBMK01000005.1 GCA008868665_02176 CDS open 166058-166429 _na     123_aa rpsL 30S ribosomal protein S12
2022 WBMK01000005.1 GCA008868665_02177 CDS open 166699-167463 _na     254_aa ABC transporter permease
2023 WBMK01000005.1 GCA008868665_02178 CDS open 168006-168914 _na     302_aa ABC transporter%2C permease protein
2024 WBMK01000005.1 GCA008868665_02179 CDS open 168911-170245 _na     444_aa Maltose/maltodextrin transport system permease protein
2025 WBMK01000005.1 GCA008868665_02180 CDS open 170282-171484 _na     400_aa ABC transporter%2C solute-binding protein
2026 WBMK01000005.1 GCA008868665_02023 gene open 144-512
2027 WBMK01000005.1 GCA008868665_02024 gene open 558-950
2028 WBMK01000005.1 GCA008868665_02025 gene open 939-1649
2029 WBMK01000005.1 GCA008868665_02026 gene open 1631-2602
2030 WBMK01000005.1 GCA008868665_02027 gene open 2589-3287 luxR
2031 WBMK01000005.1 GCA008868665_02028 gene open 3299-4450
2032 WBMK01000005.1 GCA008868665_02029 gene open 4575-5705 pspC
2033 WBMK01000005.1 GCA008868665_02030 gene open 6154-6774
2034 WBMK01000005.1 GCA008868665_02031 gene open 6948-7472
2035 WBMK01000005.1 GCA008868665_02032 gene open 7475-9019 guaA
2036 WBMK01000005.1 GCA008868665_02033 gene open 9791-10231
2037 WBMK01000005.1 GCA008868665_02034 gene open 10344-11192
2038 WBMK01000005.1 GCA008868665_02035 gene open 11196-12353 guaB3
2039 WBMK01000005.1 GCA008868665_02036 gene open 13218-14738 guaB
2040 WBMK01000005.1 GCA008868665_02037 gene open 14912-15286
2041 WBMK01000005.1 GCA008868665_02038 gene open 16149-17183 rsdA
2042 WBMK01000005.1 GCA008868665_02039 gene open 17185-17748 sigD
2043 WBMK01000005.1 GCA008868665_02040 gene open 17941-18891
2044 WBMK01000005.1 GCA008868665_02041 gene open 19478-21097 groL
2045 WBMK01000005.1 GCA008868665_02042 gene open 21104-21400 groES
2046 WBMK01000005.1 GCA008868665_02043 gene open 22018-22224
2047 WBMK01000005.1 GCA008868665_02044 gene open 22281-23309 tsaD
2048 WBMK01000005.1 GCA008868665_02045 gene open 23306-23782 rimI
2049 WBMK01000005.1 GCA008868665_02046 gene open 23779-24465 tsaB
2050 WBMK01000005.1 GCA008868665_02047 gene open 24469-24945
2051 WBMK01000005.1 GCA008868665_02048 gene open 25007-25486 tsaE
2052 WBMK01000005.1 GCA008868665_02049 gene open 25488-26624 alr
2053 WBMK01000005.1 GCA008868665_02050 gene open 27259-28245
2054 WBMK01000005.1 GCA008868665_02051 gene open 28246-28944 pnuC
2055 WBMK01000005.1 GCA008868665_02052 gene open 29017-29694
2056 WBMK01000005.1 GCA008868665_02053 gene open 29795-30658
2057 WBMK01000005.1 GCA008868665_02054 gene open 30647-30856
2058 WBMK01000005.1 GCA008868665_02055 gene open 30847-32013
2059 WBMK01000005.1 GCA008868665_02056 gene open 31998-32312
2060 WBMK01000005.1 GCA008868665_02057 gene open 32793-34109 glmM
2061 WBMK01000005.1 GCA008868665_02058 gene open 35069-36664
2062 WBMK01000005.1 GCA008868665_02059 gene open 36736-37269 rpsI
2063 WBMK01000005.1 GCA008868665_02060 gene open 37266-37709 rplM
2064 WBMK01000005.1 GCA008868665_02061 gene open 38179-38466
2065 WBMK01000005.1 GCA008868665_02062 gene open 38592-38717
2066 WBMK01000005.1 GCA008868665_02063 gene open 38682-38996
2067 WBMK01000005.1 GCA008868665_02064 gene open 39058-40140
2068 WBMK01000005.1 GCA008868665_02065 gene open 40137-43829
2069 WBMK01000005.1 GCA008868665_02066 gene open 44425-45840 eccD
2070 WBMK01000005.1 GCA008868665_02067 gene open 45837-47030
2071 WBMK01000005.1 GCA008868665_02068 gene open 47033-47452
2072 WBMK01000005.1 GCA008868665_02069 gene open 47629-48960 eccB
2073 WBMK01000005.1 GCA008868665_02070 gene open 49744-52551
2074 WBMK01000005.1 GCA008868665_02071 gene open 52632-53504 truA
2075 WBMK01000005.1 GCA008868665_02072 gene open 53526-54077
2076 WBMK01000005.1 GCA008868665_02073 gene open 54382-54831
2077 WBMK01000005.1 GCA008868665_02074 gene open 54939-55388 rplQ
2078 WBMK01000005.1 GCA008868665_02075 gene open 55462-56487
2079 WBMK01000005.1 GCA008868665_02076 gene open 56645-57256 rpsD
2080 WBMK01000005.1 GCA008868665_02077 gene open 57279-57683 rpsK
2081 WBMK01000005.1 GCA008868665_02078 gene open 57687-58055 rpsM
2082 WBMK01000005.1 GCA008868665_02079 gene open 58227-58448 infA
2083 WBMK01000005.1 GCA008868665_02080 gene open 58766-59563
2084 WBMK01000005.1 GCA008868665_02081 gene open 59670-60485 map
2085 WBMK01000005.1 GCA008868665_02082 gene open 60508-61122
2086 WBMK01000005.1 GCA008868665_02083 gene open 61281-61826
2087 WBMK01000005.1 GCA008868665_02084 gene open 61828-63150 secY
2088 WBMK01000005.1 GCA008868665_02085 gene open 64197-64367
2089 WBMK01000005.1 GCA008868665_02086 gene open 64353-65738
2090 WBMK01000005.1 GCA008868665_02087 gene open 65833-67374
2091 WBMK01000005.1 GCA008868665_02088 gene open 67849-68763
2092 WBMK01000005.1 GCA008868665_02089 gene open 68768-70300
2093 WBMK01000005.1 GCA008868665_02090 gene open 70345-71895
2094 WBMK01000005.1 GCA008868665_02091 gene open 73122-73577 rplO
2095 WBMK01000005.1 GCA008868665_02092 gene open 73581-73766 rpmD
2096 WBMK01000005.1 GCA008868665_02093 gene open 73769-74392 rpsE
2097 WBMK01000005.1 GCA008868665_02094 gene open 74430-74831 rplR
2098 WBMK01000005.1 GCA008868665_02095 gene open 74834-75370 rplF
2099 WBMK01000005.1 GCA008868665_02096 gene open 75386-75784 rpsH
2100 WBMK01000005.1 GCA008868665_02097 gene open 75969-76286
2101 WBMK01000005.1 GCA008868665_02098 gene open 76489-77331
2102 WBMK01000005.1 GCA008868665_02099 gene open 77340-77903
2103 WBMK01000005.1 GCA008868665_02100 gene open 77975-80167
2104 WBMK01000005.1 GCA008868665_02101 gene open 80171-81007 thiM
2105 WBMK01000005.1 GCA008868665_02102 gene open 81199-81747
2106 WBMK01000005.1 GCA008868665_02103 gene open 81740-82795
2107 WBMK01000005.1 GCA008868665_02104 gene open 82799-83347
2108 WBMK01000005.1 GCA008868665_02105 gene open 84181-85473
2109 WBMK01000005.1 GCA008868665_02106 gene open 85474-86613
2110 WBMK01000005.1 GCA008868665_02107 gene open 86644-88524
2111 WBMK01000005.1 GCA008868665_02108 gene open 88747-90744
2112 WBMK01000005.1 GCA008868665_02109 gene open 90866-92263
2113 WBMK01000005.1 GCA008868665_02110 gene open 92360-93073
2114 WBMK01000005.1 GCA008868665_02111 gene open 93509-94444
2115 WBMK01000005.1 GCA008868665_02112 gene open 94504-95292
2116 WBMK01000005.1 GCA008868665_02113 gene open 95462-96022 rplE
2117 WBMK01000005.1 GCA008868665_02114 gene open 96025-96339 rplX
2118 WBMK01000005.1 GCA008868665_02115 gene open 96343-96711 rplN
2119 WBMK01000005.1 GCA008868665_02116 gene open 96990-97316
2120 WBMK01000005.1 GCA008868665_02117 gene open 97483-98124
2121 WBMK01000005.1 GCA008868665_02118 gene open 98245-98619
2122 WBMK01000005.1 GCA008868665_02119 gene open 98660-99316
2123 WBMK01000005.1 GCA008868665_02120 gene open 99470-100348
2124 WBMK01000005.1 GCA008868665_02121 gene open 100369-102714
2125 WBMK01000005.1 GCA008868665_02122 gene open 102745-103734
2126 WBMK01000005.1 GCA008868665_02123 gene open 103836-104642
2127 WBMK01000005.1 GCA008868665_02124 gene open 104639-105715
2128 WBMK01000005.1 GCA008868665_02125 gene open 105712-106713
2129 WBMK01000005.1 GCA008868665_02126 gene open 106710-106877
2130 WBMK01000005.1 GCA008868665_02127 gene open 106874-107614
2131 WBMK01000005.1 GCA008868665_02128 gene open 107649-107864
2132 WBMK01000005.1 GCA008868665_02129 gene open 108030-110213
2133 WBMK01000005.1 GCA008868665_02130 gene open 110242-111240
2134 WBMK01000005.1 GCA008868665_02131 gene open 111409-112326
2135 WBMK01000005.1 GCA008868665_02132 gene open 113511-114545
2136 WBMK01000005.1 GCA008868665_02133 gene open 115028-115546
2137 WBMK01000005.1 GCA008868665_02134 gene open 116049-118688
2138 WBMK01000005.1 GCA008868665_02135 gene open 119274-119540
2139 WBMK01000005.1 GCA008868665_02136 gene open 119571-122105
2140 WBMK01000005.1 GCA008868665_02137 gene open 122435-122689
2141 WBMK01000005.1 GCA008868665_02138 gene open 123117-124946
2142 WBMK01000005.1 GCA008868665_02139 gene open 125644-126372
2143 WBMK01000005.1 GCA008868665_02140 gene open 126397-127020
2144 WBMK01000005.1 GCA008868665_02141 gene open 127013-128071
2145 WBMK01000005.1 GCA008868665_02142 gene open 128128-129759
2146 WBMK01000005.1 GCA008868665_02143 gene open 129775-129990
2147 WBMK01000005.1 GCA008868665_02144 gene open 129992-131260
2148 WBMK01000005.1 GCA008868665_02145 gene open 131282-135142
2149 WBMK01000005.1 GCA008868665_02146 gene open 135117-136364
2150 WBMK01000005.1 GCA008868665_02147 gene open 136709-136969
2151 WBMK01000005.1 GCA008868665_02148 gene open 137267-137545 rpsQ
2152 WBMK01000005.1 GCA008868665_02149 gene open 137548-137778 rpmC
2153 WBMK01000005.1 GCA008868665_02150 gene open 137778-138194 rplP
2154 WBMK01000005.1 GCA008868665_02151 gene open 138200-138946 rpsC
2155 WBMK01000005.1 GCA008868665_02152 gene open 138949-139302 rplV
2156 WBMK01000005.1 GCA008868665_02153 gene open 139306-139584 rpsS
2157 WBMK01000005.1 GCA008868665_02154 gene open 139601-140443 rplB
2158 WBMK01000005.1 GCA008868665_02155 gene open 140472-140780 rplW
2159 WBMK01000005.1 GCA008868665_02156 gene open 140801-141451 rplD
2160 WBMK01000005.1 GCA008868665_02157 gene open 141448-142104 rplC
2161 WBMK01000005.1 GCA008868665_02158 gene open 142137-142442 rpsJ
2162 WBMK01000005.1 GCA008868665_02159 gene open 143047-144030
2163 WBMK01000005.1 GCA008868665_02160 gene open 144031-144981
2164 WBMK01000005.1 GCA008868665_02161 gene open 144978-146987 oppF
2165 WBMK01000005.1 GCA008868665_02162 gene open 147004-148692
2166 WBMK01000005.1 GCA008868665_02163 gene open 148807-150492
2167 WBMK01000005.1 GCA008868665_02164 gene open 150568-152247
2168 WBMK01000005.1 GCA008868665_02165 gene open 152257-153939
2169 WBMK01000005.1 GCA008868665_02166 gene open 153991-154203
2170 WBMK01000005.1 GCA008868665_02167 gene open 154291-155535
2171 WBMK01000005.1 GCA008868665_02168 gene open 155553-156113 yetF
2172 WBMK01000005.1 GCA008868665_02169 gene open 156130-156780
2173 WBMK01000005.1 GCA008868665_02170 gene open 156851-158539
2174 WBMK01000005.1 GCA008868665_02171 gene open 158658-159641
2175 WBMK01000005.1 GCA008868665_02172 gene open 160357-161292
2176 WBMK01000005.1 GCA008868665_02173 gene open 161767-162960 tuf
2177 WBMK01000005.1 GCA008868665_02174 gene open 163399-165525 fusA
2178 WBMK01000005.1 GCA008868665_02175 gene open 165584-166051 rpsG
2179 WBMK01000005.1 GCA008868665_02176 gene open 166058-166429 rpsL
2180 WBMK01000005.1 GCA008868665_02177 gene open 166699-167463
2181 WBMK01000005.1 GCA008868665_02178 gene open 168006-168914
2182 WBMK01000005.1 GCA008868665_02179 gene open 168911-170245
2183 WBMK01000005.1 GCA008868665_02180 gene open 170282-171484
2184 WBMK01000006.1 GCA008868665_02302 gene open 128631-128727 Bacteria_small_SRP
2185 WBMK01000006.1 GCA008868665_02302 ncRNA open 128631-128727 Bacterial small signal recognition particle RNA
2186 WBMK01000006.1 repeat_region open 89411-89569 CRISPR array with 3 repeats of length 30%2C consensus sequence CGGAACTACCTCCGCGTGCGCGGAGAATAC and spacer length 29
2187 WBMK01000006.1 repeat_region open 90045-91487 CRISPR array with 24 repeats of length 29%2C consensus sequence GGAACTACCTCCGCGTGCGCGGAGAATAC and spacer length 32
2188 WBMK01000006.1 GCA008868665_02181 CDS open 363-1121 _na     252_aa hypothetical protein
2189 WBMK01000006.1 GCA008868665_02182 CDS open 1366-1752 _na     128_aa hypothetical protein
2190 WBMK01000006.1 GCA008868665_02183 CDS open 1771-3765 _na     664_aa DUF5979 domain-containing protein
2191 WBMK01000006.1 GCA008868665_02184 CDS open 4071-4850 _na     259_aa Oxidoreductase%2C short chain dehydrogenase/reductase family protein
2192 WBMK01000006.1 GCA008868665_02185 CDS open 4860-5879 _na     339_aa araC Transcriptional regulator%2C AraC family
2193 WBMK01000006.1 GCA008868665_02186 CDS open 6067-6774 _na     235_aa rplA 50S ribosomal protein L1
2194 WBMK01000006.1 GCA008868665_02187 CDS open 6854-7285 _na     143_aa rplK 50S ribosomal protein L11
2195 WBMK01000006.1 GCA008868665_02188 CDS open 7466-8341 _na     291_aa nusG transcription termination/antitermination protein NusG
2196 WBMK01000006.1 GCA008868665_02189 CDS open 8492-8815 _na     107_aa secE preprotein translocase subunit SecE
2197 WBMK01000006.1 GCA008868665_02194 CDS open 9600-10631 _na     343_aa Polyprenyl synthetase
2198 WBMK01000006.1 GCA008868665_02195 CDS open 10777-12195 _na     472_aa Geranylgeranyl reductase family
2199 WBMK01000006.1 GCA008868665_02196 CDS open 12192-12911 _na     239_aa demethylmenaquinone methyltransferase
2200 WBMK01000006.1 GCA008868665_02197 CDS open 12904-14016 _na     370_aa Glycosyltransferase%2C group 1 family protein
2201 WBMK01000006.1 GCA008868665_02198 CDS open 14013-14576 _na     187_aa DUF3592 domain-containing protein
2202 WBMK01000006.1 GCA008868665_02199 CDS open 14589-16178 _na     529_aa menD 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase
2203 WBMK01000006.1 GCA008868665_02200 CDS open 16239-16613 _na     124_aa hypothetical protein
2204 WBMK01000006.1 GCA008868665_02201 CDS open 16613-17644 _na     343_aa o-succinylbenzoate synthase
2205 WBMK01000006.1 GCA008868665_02202 CDS open 17694-18650 _na     318_aa 1%2C4-dihydroxy-2-naphthoyl-CoA synthase
2206 WBMK01000006.1 GCA008868665_02203 CDS open 18661-19998 _na     445_aa menE o-succinylbenzoate--CoA ligase
2207 WBMK01000006.1 GCA008868665_02204 CDS open 20269-21039 _na     256_aa 1%2C4-dihydroxy-2-naphthoate polyprenyltransferase
2208 WBMK01000006.1 GCA008868665_02205 CDS open 21074-21439 _na     121_aa DUF4229 domain-containing protein
2209 WBMK01000006.1 GCA008868665_02206 CDS open 21578-21934 _na     118_aa Secreted protein
2210 WBMK01000006.1 GCA008868665_02207 CDS open 22035-22349 _na     104_aa arsR Transcriptional regulator%2C ArsR family
2211 WBMK01000006.1 GCA008868665_02208 CDS open 22410-23462 _na     350_aa ccsB c-type cytochrome biogenesis protein CcsB
2212 WBMK01000006.1 GCA008868665_02209 CDS open 23604-25220 _na     538_aa ResB-like protein
2213 WBMK01000006.1 GCA008868665_02210 CDS open 25299-26105 _na     268_aa Cytochrome C biogenesis protein transmembrane region
2214 WBMK01000006.1 GCA008868665_02211 CDS open 26160-26753 _na     197_aa Antioxidant%2C AhpC/TSA family
2215 WBMK01000006.1 GCA008868665_02212 CDS open 26754-27362 _na     202_aa Phosphoglycerate mutase family protein
2216 WBMK01000006.1 GCA008868665_02213 CDS open 27450-28721 _na     423_aa hemL glutamate-1-semialdehyde 2%2C1-aminomutase
2217 WBMK01000006.1 GCA008868665_02214 CDS open 28808-29428 _na     206_aa NADH-flavin reductase
2218 WBMK01000006.1 GCA008868665_02215 CDS open 29568-29936 _na     122_aa hxlR Transcriptional regulator%2C HxlR family
2219 WBMK01000006.1 GCA008868665_02216 CDS open 29947-31350 _na     467_aa protoporphyrinogen oxidase
2220 WBMK01000006.1 GCA008868665_02217 CDS open 31394-32536 _na     380_aa hemE uroporphyrinogen decarboxylase
2221 WBMK01000006.1 GCA008868665_02218 CDS open 32777-34408 _na     543_aa hypothetical protein
2222 WBMK01000006.1 GCA008868665_02219 CDS open 34469-35530 _na     353_aa DUF222 domain-containing protein
2223 WBMK01000006.1 GCA008868665_02220 CDS open 35618-38254 _na     878_aa E1-E2 ATPase
2224 WBMK01000006.1 GCA008868665_02221 CDS open 38454-39164 _na     236_aa hypothetical protein
2225 WBMK01000006.1 GCA008868665_02222 CDS open 39264-40286 _na     340_aa hemB porphobilinogen synthase
2226 WBMK01000006.1 GCA008868665_02223 CDS open 40332-41114 _na     260_aa Uroporphyrinogen-III synthase
2227 WBMK01000006.1 GCA008868665_02224 CDS open 41111-42007 _na     298_aa hemC hydroxymethylbilane synthase
2228 WBMK01000006.1 GCA008868665_02225 CDS open 42008-43375 _na     455_aa glutamyl-tRNA reductase
2229 WBMK01000006.1 GCA008868665_02226 CDS open 43549-43785 _na     78_aa Glutaredoxin-like protein
2230 WBMK01000006.1 GCA008868665_02227 CDS open 43952-45007 _na     351_aa HAD hydrolase%2C family IB
2231 WBMK01000006.1 GCA008868665_02228 CDS open 45066-45167 _na     33_aa 30S ribosomal protein bS22
2232 WBMK01000006.1 GCA008868665_02229 CDS open 45987-46796 _na     269_aa proC pyrroline-5-carboxylate reductase
2233 WBMK01000006.1 GCA008868665_02230 CDS open 47206-48639 _na     477_aa Transmembrane protein
2234 WBMK01000006.1 GCA008868665_02231 CDS open 49346-50290 _na     314_aa Ppx/GppA phosphatase family protein
2235 WBMK01000006.1 GCA008868665_02232 CDS open 50658-51269 _na     203_aa Secreted protein
2236 WBMK01000006.1 GCA008868665_02233 CDS open 51343-52092 _na     249_aa phosphoglyceromutase
2237 WBMK01000006.1 GCA008868665_02234 CDS open 52165-53004 _na     279_aa Oxidoreductase%2C short chain dehydrogenase/reductase family protein
2238 WBMK01000006.1 GCA008868665_02235 CDS open 53171-54649 _na     492_aa succinic semialdehyde dehydrogenase
2239 WBMK01000006.1 GCA008868665_02236 CDS open 54673-55425 _na     250_aa SDR family oxidoreductase
2240 WBMK01000006.1 GCA008868665_02237 CDS open 55403-56638 _na     411_aa mshA D-inositol-3-phosphate glycosyltransferase
2241 WBMK01000006.1 GCA008868665_02238 CDS open 56925-58769 _na     614_aa long-chain-fatty-acid--CoA ligase
2242 WBMK01000006.1 GCA008868665_02239 CDS open 58759-59907 _na     382_aa UDP-N-acetylmuramate dehydrogenase
2243 WBMK01000006.1 GCA008868665_02240 CDS open 59928-60428 _na     166_aa DUF2505 domain-containing protein
2244 WBMK01000006.1 GCA008868665_02241 CDS open 60444-61274 _na     276_aa Class I SAM-dependent methyltransferase
2245 WBMK01000006.1 GCA008868665_02242 CDS open 61329-62159 _na     276_aa DUF2993 domain-containing protein
2246 WBMK01000006.1 GCA008868665_02243 CDS open 62427-62984 _na     185_aa Deoxyribose-phosphate aldolase
2247 WBMK01000006.1 GCA008868665_02244 CDS open 63013-63300 _na     95_aa DUF2516 domain-containing protein
2248 WBMK01000006.1 GCA008868665_02245 CDS open 63363-64682 _na     439_aa DUF445 domain-containing protein
2249 WBMK01000006.1 GCA008868665_02246 CDS open 64828-65178 _na     116_aa Transmembrane protein
2250 WBMK01000006.1 GCA008868665_02247 CDS open 65349-66098 _na     249_aa succinate dehydrogenase
2251 WBMK01000006.1 GCA008868665_02248 CDS open 66098-68113 _na     671_aa Succinate dehydrogenase subunit A
2252 WBMK01000006.1 GCA008868665_02249 CDS open 68144-68902 _na     252_aa Succinate dehydrogenase cytochrome B subunit%2C b558 family
2253 WBMK01000006.1 GCA008868665_02250 CDS open 69344-70783 _na     479_aa lpdA dihydrolipoyl dehydrogenase
2254 WBMK01000006.1 GCA008868665_02251 CDS open 70933-71052 _na     39_aa hypothetical protein
2255 WBMK01000006.1 GCA008868665_02252 CDS open 71676-72746 _na     356_aa Surface layer protein A
2256 WBMK01000006.1 GCA008868665_02253 CDS open 73156-74451 _na     431_aa Tat pathway signal sequence domain protein
2257 WBMK01000006.1 GCA008868665_02254 CDS open 74448-75446 _na     332_aa DUF222 domain-containing protein
2258 WBMK01000006.1 GCA008868665_02255 CDS open 75728-76732 _na     334_aa rfbB dTDP-glucose 4%2C6-dehydratase
2259 WBMK01000006.1 GCA008868665_02256 CDS open 76778-78295 _na     505_aa dTDP-4-dehydrorhamnose reductase
2260 WBMK01000006.1 GCA008868665_02257 CDS open 78295-79152 _na     285_aa rfbA glucose-1-phosphate thymidylyltransferase RfbA
2261 WBMK01000006.1 GCA008868665_02258 CDS open 79183-80058 _na     291_aa Glycosyltransferase%2C group 2 family protein
2262 WBMK01000006.1 GCA008868665_02259 CDS open 80094-80825 _na     243_aa Glycosyltransferase%2C group 2 family protein
2263 WBMK01000006.1 GCA008868665_02260 CDS open 80822-81175 _na     117_aa DUF2304 domain-containing protein
2264 WBMK01000006.1 GCA008868665_02261 CDS open 81227-82090 _na     287_aa DsbA-like protein
2265 WBMK01000006.1 GCA008868665_02262 CDS open 82464-84110 _na     548_aa Long-chain-fatty-acid--CoA ligase
2266 WBMK01000006.1 GCA008868665_02263 CDS open 84181-85128 _na     315_aa NAD dependent epimerase/dehydratase family protein
2267 WBMK01000006.1 GCA008868665_02264 CDS open 85209-86060 _na     283_aa DUF3037 domain-containing protein
2268 WBMK01000006.1 GCA008868665_02265 CDS open 86007-86120 _na     37_aa hypothetical protein
2269 WBMK01000006.1 GCA008868665_02266 CDS open 86191-87795 _na     534_aa HIRAN domain-containing protein
2270 WBMK01000006.1 GCA008868665_02267 CDS open 88053-88322 _na     89_aa Secreted protein
2271 WBMK01000006.1 GCA008868665_02268 CDS open 88491-88922 _na     143_aa TM2 domain-containing protein
2272 WBMK01000006.1 GCA008868665_02269 CDS open 89110-89262 _na     50_aa hypothetical protein
2273 WBMK01000006.1 GCA008868665_02270 CDS open 89632-89844 _na     70_aa vbhA Antitoxin VbhA domain-containing protein
2274 WBMK01000006.1 GCA008868665_02272 CDS open 92101-93195 _na     364_aa DNA polymerase III subunit delta'
2275 WBMK01000006.1 GCA008868665_02273 CDS open 93415-94980 _na     521_aa Adenylate cyclase
2276 WBMK01000006.1 GCA008868665_02274 CDS open 95192-97204 _na     670_aa OPT family oligopeptide transporter
2277 WBMK01000006.1 GCA008868665_02275 CDS open 97201-98622 _na     473_aa YhgE/Pip domain protein
2278 WBMK01000006.1 GCA008868665_02276 CDS open 98834-101881 _na     1015_aa DUF4040 domain-containing protein
2279 WBMK01000006.1 GCA008868665_02277 CDS open 101878-102327 _na     149_aa Monovalent cation/H+ antiporter subunit C
2280 WBMK01000006.1 GCA008868665_02278 CDS open 102331-103941 _na     536_aa Putative monovalent cation/H+ antiporter subunit D
2281 WBMK01000006.1 GCA008868665_02279 CDS open 103983-104396 _na     137_aa monovalent cation/H+ antiporter subunit E
2282 WBMK01000006.1 GCA008868665_02280 CDS open 104396-104662 _na     88_aa Putative monovalent cation/H+ antiporter subunit F
2283 WBMK01000006.1 GCA008868665_02281 CDS open 104665-105000 _na     111_aa Na+/H+ antiporter subunit G
2284 WBMK01000006.1 GCA008868665_02282 CDS open 105024-105590 _na     188_aa RNA polymerase sigma factor
2285 WBMK01000006.1 GCA008868665_02283 CDS open 105728-106324 _na     198_aa Antioxidant%2C AhpC/TSA family
2286 WBMK01000006.1 GCA008868665_02284 CDS open 106324-106848 _na     174_aa ahpD Alkyl hydroperoxide reductase AhpD
2287 WBMK01000006.1 GCA008868665_02285 CDS open 107059-107940 _na     293_aa SCP-like protein
2288 WBMK01000006.1 GCA008868665_02286 CDS open 108195-109721 _na     508_aa Catalase
2289 WBMK01000006.1 GCA008868665_02287 CDS open 109879-110418 _na     179_aa Acetyltransferase%2C GNAT family
2290 WBMK01000006.1 GCA008868665_02288 CDS open 110507-111538 _na     343_aa aspartate-semialdehyde dehydrogenase
2291 WBMK01000006.1 GCA008868665_02289 CDS open 111594-112859 _na     421_aa aspartate kinase
2292 WBMK01000006.1 GCA008868665_02290 CDS open 112979-113821 _na     280_aa Tat pathway signal sequence domain protein
2293 WBMK01000006.1 GCA008868665_02291 CDS open 113831-115177 _na     448_aa Tat pathway signal sequence domain protein
2294 WBMK01000006.1 GCA008868665_02292 CDS open 115680-116009 _na     109_aa hypothetical protein
2295 WBMK01000006.1 GCA008868665_02293 CDS open 116450-118276 _na     608_aa leuA 2-isopropylmalate synthase
2296 WBMK01000006.1 GCA008868665_02294 CDS open 118333-119556 _na     407_aa Putative DNA polymerase III%2C epsilon subunit
2297 WBMK01000006.1 GCA008868665_02295 CDS open 119579-120856 _na     425_aa murT Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit MurT
2298 WBMK01000006.1 GCA008868665_02296 CDS open 120857-121588 _na     243_aa gatD Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit GatD
2299 WBMK01000006.1 GCA008868665_02297 CDS open 121577-122233 _na     218_aa recR recombination mediator RecR
2300 WBMK01000006.1 GCA008868665_02298 CDS open 123103-123402 _na     99_aa YbaB/EbfC family nucleoid-associated protein
2301 WBMK01000006.1 GCA008868665_02299 CDS open 123523-126456 _na     977_aa DNA polymerase III subunit gamma and tau
2302 WBMK01000006.1 GCA008868665_02300 CDS open 126511-127065 _na     184_aa Suppressor of fused-like domain-containing protein
2303 WBMK01000006.1 GCA008868665_02301 CDS open 127243-128517 _na     424_aa Aminotransferase%2C class I/II
2304 WBMK01000006.1 GCA008868665_02304 CDS open 129368-130840 _na     490_aa SAM-dependent methyltransferase
2305 WBMK01000006.1 GCA008868665_02305 CDS open 130832-131719 _na     295_aa Glutamyl-Q tRNA(Asp) synthetase
2306 WBMK01000006.1 GCA008868665_02181 gene open 363-1121
2307 WBMK01000006.1 GCA008868665_02182 gene open 1366-1752
2308 WBMK01000006.1 GCA008868665_02183 gene open 1771-3765
2309 WBMK01000006.1 GCA008868665_02184 gene open 4071-4850
2310 WBMK01000006.1 GCA008868665_02185 gene open 4860-5879 araC
2311 WBMK01000006.1 GCA008868665_02186 gene open 6067-6774 rplA
2312 WBMK01000006.1 GCA008868665_02187 gene open 6854-7285 rplK
2313 WBMK01000006.1 GCA008868665_02188 gene open 7466-8341 nusG
2314 WBMK01000006.1 GCA008868665_02189 gene open 8492-8815 secE
2315 WBMK01000006.1 GCA008868665_02194 gene open 9600-10631
2316 WBMK01000006.1 GCA008868665_02195 gene open 10777-12195
2317 WBMK01000006.1 GCA008868665_02196 gene open 12192-12911
2318 WBMK01000006.1 GCA008868665_02197 gene open 12904-14016
2319 WBMK01000006.1 GCA008868665_02198 gene open 14013-14576
2320 WBMK01000006.1 GCA008868665_02199 gene open 14589-16178 menD
2321 WBMK01000006.1 GCA008868665_02200 gene open 16239-16613
2322 WBMK01000006.1 GCA008868665_02201 gene open 16613-17644
2323 WBMK01000006.1 GCA008868665_02202 gene open 17694-18650
2324 WBMK01000006.1 GCA008868665_02203 gene open 18661-19998 menE
2325 WBMK01000006.1 GCA008868665_02204 gene open 20269-21039
2326 WBMK01000006.1 GCA008868665_02205 gene open 21074-21439
2327 WBMK01000006.1 GCA008868665_02206 gene open 21578-21934
2328 WBMK01000006.1 GCA008868665_02207 gene open 22035-22349 arsR
2329 WBMK01000006.1 GCA008868665_02208 gene open 22410-23462 ccsB
2330 WBMK01000006.1 GCA008868665_02209 gene open 23604-25220
2331 WBMK01000006.1 GCA008868665_02210 gene open 25299-26105
2332 WBMK01000006.1 GCA008868665_02211 gene open 26160-26753
2333 WBMK01000006.1 GCA008868665_02212 gene open 26754-27362
2334 WBMK01000006.1 GCA008868665_02213 gene open 27450-28721 hemL
2335 WBMK01000006.1 GCA008868665_02214 gene open 28808-29428
2336 WBMK01000006.1 GCA008868665_02215 gene open 29568-29936 hxlR
2337 WBMK01000006.1 GCA008868665_02216 gene open 29947-31350
2338 WBMK01000006.1 GCA008868665_02217 gene open 31394-32536 hemE
2339 WBMK01000006.1 GCA008868665_02218 gene open 32777-34408
2340 WBMK01000006.1 GCA008868665_02219 gene open 34469-35530
2341 WBMK01000006.1 GCA008868665_02220 gene open 35618-38254
2342 WBMK01000006.1 GCA008868665_02221 gene open 38454-39164
2343 WBMK01000006.1 GCA008868665_02222 gene open 39264-40286 hemB
2344 WBMK01000006.1 GCA008868665_02223 gene open 40332-41114
2345 WBMK01000006.1 GCA008868665_02224 gene open 41111-42007 hemC
2346 WBMK01000006.1 GCA008868665_02225 gene open 42008-43375
2347 WBMK01000006.1 GCA008868665_02226 gene open 43549-43785
2348 WBMK01000006.1 GCA008868665_02227 gene open 43952-45007
2349 WBMK01000006.1 GCA008868665_02228 gene open 45066-45167
2350 WBMK01000006.1 GCA008868665_02229 gene open 45987-46796 proC
2351 WBMK01000006.1 GCA008868665_02230 gene open 47206-48639
2352 WBMK01000006.1 GCA008868665_02231 gene open 49346-50290
2353 WBMK01000006.1 GCA008868665_02232 gene open 50658-51269
2354 WBMK01000006.1 GCA008868665_02233 gene open 51343-52092
2355 WBMK01000006.1 GCA008868665_02234 gene open 52165-53004
2356 WBMK01000006.1 GCA008868665_02235 gene open 53171-54649
2357 WBMK01000006.1 GCA008868665_02236 gene open 54673-55425
2358 WBMK01000006.1 GCA008868665_02237 gene open 55403-56638 mshA
2359 WBMK01000006.1 GCA008868665_02238 gene open 56925-58769
2360 WBMK01000006.1 GCA008868665_02239 gene open 58759-59907
2361 WBMK01000006.1 GCA008868665_02240 gene open 59928-60428
2362 WBMK01000006.1 GCA008868665_02241 gene open 60444-61274
2363 WBMK01000006.1 GCA008868665_02242 gene open 61329-62159
2364 WBMK01000006.1 GCA008868665_02243 gene open 62427-62984
2365 WBMK01000006.1 GCA008868665_02244 gene open 63013-63300
2366 WBMK01000006.1 GCA008868665_02245 gene open 63363-64682
2367 WBMK01000006.1 GCA008868665_02246 gene open 64828-65178
2368 WBMK01000006.1 GCA008868665_02247 gene open 65349-66098
2369 WBMK01000006.1 GCA008868665_02248 gene open 66098-68113
2370 WBMK01000006.1 GCA008868665_02249 gene open 68144-68902
2371 WBMK01000006.1 GCA008868665_02250 gene open 69344-70783 lpdA
2372 WBMK01000006.1 GCA008868665_02251 gene open 70933-71052
2373 WBMK01000006.1 GCA008868665_02252 gene open 71676-72746
2374 WBMK01000006.1 GCA008868665_02253 gene open 73156-74451
2375 WBMK01000006.1 GCA008868665_02254 gene open 74448-75446
2376 WBMK01000006.1 GCA008868665_02255 gene open 75728-76732 rfbB
2377 WBMK01000006.1 GCA008868665_02256 gene open 76778-78295
2378 WBMK01000006.1 GCA008868665_02257 gene open 78295-79152 rfbA
2379 WBMK01000006.1 GCA008868665_02258 gene open 79183-80058
2380 WBMK01000006.1 GCA008868665_02259 gene open 80094-80825
2381 WBMK01000006.1 GCA008868665_02260 gene open 80822-81175
2382 WBMK01000006.1 GCA008868665_02261 gene open 81227-82090
2383 WBMK01000006.1 GCA008868665_02262 gene open 82464-84110
2384 WBMK01000006.1 GCA008868665_02263 gene open 84181-85128
2385 WBMK01000006.1 GCA008868665_02264 gene open 85209-86060
2386 WBMK01000006.1 GCA008868665_02265 gene open 86007-86120
2387 WBMK01000006.1 GCA008868665_02266 gene open 86191-87795
2388 WBMK01000006.1 GCA008868665_02267 gene open 88053-88322
2389 WBMK01000006.1 GCA008868665_02268 gene open 88491-88922
2390 WBMK01000006.1 GCA008868665_02269 gene open 89110-89262
2391 WBMK01000006.1 GCA008868665_02270 gene open 89632-89844 vbhA
2392 WBMK01000006.1 GCA008868665_02272 gene open 92101-93195
2393 WBMK01000006.1 GCA008868665_02273 gene open 93415-94980
2394 WBMK01000006.1 GCA008868665_02274 gene open 95192-97204
2395 WBMK01000006.1 GCA008868665_02275 gene open 97201-98622
2396 WBMK01000006.1 GCA008868665_02276 gene open 98834-101881
2397 WBMK01000006.1 GCA008868665_02277 gene open 101878-102327
2398 WBMK01000006.1 GCA008868665_02278 gene open 102331-103941
2399 WBMK01000006.1 GCA008868665_02279 gene open 103983-104396
2400 WBMK01000006.1 GCA008868665_02280 gene open 104396-104662
2401 WBMK01000006.1 GCA008868665_02281 gene open 104665-105000
2402 WBMK01000006.1 GCA008868665_02282 gene open 105024-105590
2403 WBMK01000006.1 GCA008868665_02283 gene open 105728-106324
2404 WBMK01000006.1 GCA008868665_02284 gene open 106324-106848 ahpD
2405 WBMK01000006.1 GCA008868665_02285 gene open 107059-107940
2406 WBMK01000006.1 GCA008868665_02286 gene open 108195-109721
2407 WBMK01000006.1 GCA008868665_02287 gene open 109879-110418
2408 WBMK01000006.1 GCA008868665_02288 gene open 110507-111538
2409 WBMK01000006.1 GCA008868665_02289 gene open 111594-112859
2410 WBMK01000006.1 GCA008868665_02290 gene open 112979-113821
2411 WBMK01000006.1 GCA008868665_02291 gene open 113831-115177
2412 WBMK01000006.1 GCA008868665_02292 gene open 115680-116009
2413 WBMK01000006.1 GCA008868665_02293 gene open 116450-118276 leuA
2414 WBMK01000006.1 GCA008868665_02294 gene open 118333-119556
2415 WBMK01000006.1 GCA008868665_02295 gene open 119579-120856 murT
2416 WBMK01000006.1 GCA008868665_02296 gene open 120857-121588 gatD
2417 WBMK01000006.1 GCA008868665_02297 gene open 121577-122233 recR
2418 WBMK01000006.1 GCA008868665_02298 gene open 123103-123402
2419 WBMK01000006.1 GCA008868665_02299 gene open 123523-126456
2420 WBMK01000006.1 GCA008868665_02300 gene open 126511-127065
2421 WBMK01000006.1 GCA008868665_02301 gene open 127243-128517
2422 WBMK01000006.1 GCA008868665_02304 gene open 129368-130840
2423 WBMK01000006.1 GCA008868665_02305 gene open 130832-131719
2424 WBMK01000006.1 GCA008868665_02190 gene open 8955-9027 trnW
2425 WBMK01000006.1 GCA008868665_02191 gene open 9051-9122 trnM
2426 WBMK01000006.1 GCA008868665_02192 gene open 9171-9243 trnT
2427 WBMK01000006.1 GCA008868665_02193 gene open 9438-9523 trnY
2428 WBMK01000006.1 GCA008868665_02271 gene open 91937-92012 trnT
2429 WBMK01000006.1 GCA008868665_02303 gene open 128861-128946 trnS
2430 WBMK01000006.1 GCA008868665_02190 tRNA open 8955-9027 trnW tRNA-Trp(cca)
2431 WBMK01000006.1 GCA008868665_02191 tRNA open 9051-9122 trnM tRNA-Met(cat)
2432 WBMK01000006.1 GCA008868665_02192 tRNA open 9171-9243 trnT tRNA-Thr(ggt)
2433 WBMK01000006.1 GCA008868665_02193 tRNA open 9438-9523 trnY tRNA-Tyr(gta)
2434 WBMK01000006.1 GCA008868665_02271 tRNA open 91937-92012 trnT tRNA-Thr(cgt)
2435 WBMK01000006.1 GCA008868665_02303 tRNA open 128861-128946 trnS tRNA-Ser(gga)
2436 WBMK01000007.1 GCA008868665_02306 CDS open 189-392 _na     67_aa hypothetical protein
2437 WBMK01000007.1 GCA008868665_02307 CDS open 755-1975 _na     406_aa NYN domain-containing protein
2438 WBMK01000007.1 GCA008868665_02308 CDS open 1972-3138 _na     388_aa Transporter%2C major facilitator family protein
2439 WBMK01000007.1 GCA008868665_02309 CDS open 3437-4795 _na     452_aa PspA/IM30 family protein
2440 WBMK01000007.1 GCA008868665_02310 CDS open 5049-5420 _na     123_aa Thioredoxin
2441 WBMK01000007.1 GCA008868665_02311 CDS open 5563-5763 _na     66_aa Heavy metal-associated domain protein
2442 WBMK01000007.1 GCA008868665_02312 CDS open 6393-6611 _na     72_aa hypothetical protein
2443 WBMK01000007.1 GCA008868665_02313 CDS open 6878-9067 _na     729_aa Copper-exporting ATPase
2444 WBMK01000007.1 GCA008868665_02314 CDS open 9096-10001 _na     301_aa DUF3825 domain-containing protein
2445 WBMK01000007.1 GCA008868665_02315 CDS open 10072-10704 _na     210_aa DUF306 domain-containing protein
2446 WBMK01000007.1 GCA008868665_02316 CDS open 10734-11405 _na     223_aa DUF306 domain-containing protein
2447 WBMK01000007.1 GCA008868665_02317 CDS open 11411-12055 _na     214_aa DUF306 domain-containing protein
2448 WBMK01000007.1 GCA008868665_02318 CDS open 12086-12760 _na     224_aa DUF306 domain-containing protein
2449 WBMK01000007.1 GCA008868665_02319 CDS open 12757-13401 _na     214_aa DUF306 domain-containing protein
2450 WBMK01000007.1 GCA008868665_02320 CDS open 13587-14393 _na     268_aa Secreted protein
2451 WBMK01000007.1 GCA008868665_02321 CDS open 14581-15144 _na     187_aa DUF306 domain-containing protein
2452 WBMK01000007.1 GCA008868665_02322 CDS open 15248-16750 _na     500_aa dnaB replicative DNA helicase
2453 WBMK01000007.1 GCA008868665_02323 CDS open 16825-18546 _na     573_aa Glycosyl hydrolase%2C family 15
2454 WBMK01000007.1 GCA008868665_02324 CDS open 19113-19565 _na     150_aa rplI 50S ribosomal protein L9
2455 WBMK01000007.1 GCA008868665_02325 CDS open 19608-20252 _na     214_aa Single-stranded DNA-binding protein
2456 WBMK01000007.1 GCA008868665_02326 CDS open 20338-20634 _na     98_aa rpsF 30S ribosomal protein S6
2457 WBMK01000007.1 GCA008868665_02327 CDS open 22049-24208 _na     719_aa ATPase/histidine kinase/DNA gyrase B/HSP90 domain protein
2458 WBMK01000007.1 GCA008868665_02328 CDS open 24451-26613 _na     720_aa ATPase/histidine kinase/DNA gyrase B/HSP90 domain protein
2459 WBMK01000007.1 GCA008868665_02329 CDS open 26620-27369 _na     249_aa hypothetical protein
2460 WBMK01000007.1 GCA008868665_02330 CDS open 27616-29859 _na     747_aa ATPase/histidine kinase/DNA gyrase B/HSP90 domain protein
2461 WBMK01000007.1 GCA008868665_02331 CDS open 29856-30527 _na     223_aa luxR Transcriptional regulator%2C LuxR family
2462 WBMK01000007.1 GCA008868665_02332 CDS open 30623-31297 _na     224_aa luxR Transcriptional regulator%2C LuxR family
2463 WBMK01000007.1 GCA008868665_02333 CDS open 31838-32056 _na     72_aa DNA-binding helix-turn-helix protein
2464 WBMK01000007.1 GCA008868665_02334 CDS open 33319-33678 _na     119_aa Hemerythrin HHE cation binding domain protein
2465 WBMK01000007.1 GCA008868665_02335 CDS open 33806-35305 _na     499_aa DUF2029 domain-containing protein
2466 WBMK01000007.1 GCA008868665_02336 CDS open 35428-37656 _na     742_aa peptidoglycan glycosyltransferase
2467 WBMK01000007.1 GCA008868665_02337 CDS open 38386-38904 _na     172_aa marR Transcriptional regulator%2C MarR family
2468 WBMK01000007.1 GCA008868665_02338 CDS open 39007-39672 _na     221_aa SDR family oxidoreductase
2469 WBMK01000007.1 GCA008868665_02339 CDS open 39682-40161 _na     159_aa Integral membrane protein
2470 WBMK01000007.1 GCA008868665_02340 CDS open 40229-41278 _na     349_aa IMP dehydrogenase
2471 WBMK01000007.1 GCA008868665_02341 CDS open 41275-42009 _na     244_aa glucose-6-phosphate 1-epimerase
2472 WBMK01000007.1 GCA008868665_02342 CDS open 42074-43051 _na     325_aa rhodanese-related sulfurtransferase
2473 WBMK01000007.1 GCA008868665_02343 CDS open 43122-44381 _na     419_aa Hypothetical glycosyl hydrolase family 15
2474 WBMK01000007.1 GCA008868665_02344 CDS open 44560-48180 _na     1206_aa pelF GT4 family glycosyltransferase PelF
2475 WBMK01000007.1 GCA008868665_02345 CDS open 48177-49544 _na     455_aa Tat pathway signal sequence domain protein
2476 WBMK01000007.1 GCA008868665_02346 CDS open 50445-50684 _na     79_aa Transposase
2477 WBMK01000007.1 GCA008868665_02347 CDS open 51305-52132 _na     275_aa DNA-(apurinic or apyrimidinic site) lyase
2478 WBMK01000007.1 GCA008868665_02348 CDS open 52129-52635 _na     168_aa DNA-binding helix-turn-helix protein
2479 WBMK01000007.1 GCA008868665_02349 CDS open 52680-53063 _na     127_aa DNA-binding helix-turn-helix protein
2480 WBMK01000007.1 GCA008868665_02350 CDS open 53358-54188 _na     276_aa hypothetical protein
2481 WBMK01000007.1 GCA008868665_02351 CDS open 54208-55689 _na     493_aa Bifunctional NAD(P)H-hydrate repair enzyme
2482 WBMK01000007.1 GCA008868665_02352 CDS open 55697-56485 _na     262_aa protein adenylyltransferase
2483 WBMK01000007.1 GCA008868665_02353 CDS open 56465-57538 _na     357_aa Transport protein
2484 WBMK01000007.1 GCA008868665_02354 CDS open 57632-58627 _na     331_aa Abi-like protein
2485 WBMK01000007.1 GCA008868665_02355 CDS open 58817-59365 _na     182_aa VanZ-like protein
2486 WBMK01000007.1 GCA008868665_02356 CDS open 60296-60883 _na     195_aa hypothetical protein
2487 WBMK01000007.1 GCA008868665_02357 CDS open 60910-61179 _na     89_aa hypothetical protein
2488 WBMK01000007.1 GCA008868665_02358 CDS open 62299-62607 _na     102_aa Serine protease
2489 WBMK01000007.1 GCA008868665_02359 CDS open 62792-63064 _na     90_aa PRA1 family protein
2490 WBMK01000007.1 GCA008868665_02360 CDS open 63070-63615 _na     181_aa Phosphopentomutase
2491 WBMK01000007.1 GCA008868665_02361 CDS open 63776-64006 _na     76_aa Tat pathway signal sequence domain protein
2492 WBMK01000007.1 GCA008868665_02362 CDS open 64088-65296 _na     402_aa Tat pathway signal sequence domain protein
2493 WBMK01000007.1 GCA008868665_02363 CDS open 65786-67162 _na     458_aa Glycosyl hydrolase%2C family 1
2494 WBMK01000007.1 GCA008868665_02364 CDS open 67159-67701 _na     180_aa PRD domain-containing protein
2495 WBMK01000007.1 GCA008868665_02365 CDS open 67687-70539 _na     950_aa leuS leucine--tRNA ligase
2496 WBMK01000007.1 GCA008868665_02366 CDS open 70800-71363 _na     187_aa hypothetical protein
2497 WBMK01000007.1 GCA008868665_02367 CDS open 71742-72326 _na     194_aa Secreted protein
2498 WBMK01000007.1 GCA008868665_02368 CDS open 72389-73162 _na     257_aa hypothetical protein
2499 WBMK01000007.1 GCA008868665_02369 CDS open 73351-73683 _na     110_aa Cupin domain protein
2500 WBMK01000007.1 GCA008868665_02370 CDS open 73748-74740 _na     330_aa htaA HtaA protein