HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Moraxella catarrhalis (GCA_009378595.1)

Select a Genome:
BAKTA Annotations for GCA_009378595.1
Genome Selected: Moraxella catarrhalis
ContigsBases CDSrRNA tmRNAtRNA
27 1,993,570 1832 3 1 42
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3773 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:2]    |    Number of Records Found: 3773 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
501 RCJR01000001.1 GCA009378595_00348 gene open 114305-114793
502 RCJR01000001.1 GCA009378595_00349 gene open 114855-115970 serB
503 RCJR01000001.1 GCA009378595_00350 gene open 116243-117499
504 RCJR01000001.1 GCA009378595_00351 gene open 117594-117812
505 RCJR01000001.1 GCA009378595_00352 gene open 117915-118436 yecA
506 RCJR01000001.1 GCA009378595_00353 gene open 118546-118908 ybjQ
507 RCJR01000001.1 GCA009378595_00354 gene open 118961-119350 ybjQ
508 RCJR01000001.1 GCA009378595_00356 gene open 119644-120714 epmB
509 RCJR01000001.1 GCA009378595_00357 gene open 120844-121419 efp
510 RCJR01000001.1 GCA009378595_00358 gene open 121696-122601 lpxC
511 RCJR01000001.1 GCA009378595_00359 gene open 122979-123527
512 RCJR01000001.1 GCA009378595_00360 gene open 123801-124478
513 RCJR01000001.1 GCA009378595_00361 gene open 124569-125198
514 RCJR01000001.1 GCA009378595_00362 gene open 125234-125551 yhbY
515 RCJR01000001.1 GCA009378595_00363 gene open 125694-126326 rlmE
516 RCJR01000001.1 GCA009378595_00364 gene open 126447-128342 ftsH
517 RCJR01000001.1 GCA009378595_00365 gene open 128507-129283 plsC
518 RCJR01000001.1 GCA009378595_00366 gene open 129336-131696 mrcA
519 RCJR01000001.1 GCA009378595_00367 gene open 132060-133994 htpG
520 RCJR01000001.1 GCA009378595_00368 gene open 134238-135668
521 RCJR01000001.1 GCA009378595_00369 gene open 135979-137319 gdhA
522 RCJR01000001.1 GCA009378595_00370 gene open 137534-138652 frmA
523 RCJR01000001.1 GCA009378595_00371 gene open 138665-139495 fghA
524 RCJR01000001.1 GCA009378595_00372 gene open 139536-140396 dsbD
525 RCJR01000001.1 GCA009378595_00373 gene open 140393-140575 ccoS
526 RCJR01000001.1 GCA009378595_00374 gene open 140727-142223 selO
527 RCJR01000001.1 GCA009378595_00375 gene open 142317-143495 oLE1
528 RCJR01000001.1 GCA009378595_00376 gene open 143884-143997 tetR
529 RCJR01000001.1 GCA009378595_00377 gene open 143994-144596 tetR
530 RCJR01000001.1 GCA009378595_00378 gene open 144713-146101 potE
531 RCJR01000001.1 GCA009378595_00379 gene open 146401-147168 fabG
532 RCJR01000001.1 GCA009378595_00380 gene open 147185-148354 pcnB
533 RCJR01000001.1 GCA009378595_00381 gene open 148459-150789 sfcA
534 RCJR01000001.1 GCA009378595_00382 gene open 151057-152055 hemB
535 RCJR01000001.1 GCA009378595_00383 gene open 152168-152608
536 RCJR01000001.1 GCA009378595_00384 gene open 152988-153977 ruvB
537 RCJR01000001.1 GCA009378595_00385 gene open 154082-155365 paaJ
538 RCJR01000001.1 GCA009378595_00386 gene open 155687-157054 fabG
539 RCJR01000001.1 GCA009378595_00387 gene open 157122-158018 maoC
540 RCJR01000001.1 GCA009378595_00388 gene open 158129-159388 ampC
541 RCJR01000001.1 GCA009378595_00389 gene open 159482-160018 hpt
542 RCJR01000001.1 GCA009378595_00390 gene open 160094-160495
543 RCJR01000001.1 GCA009378595_00391 gene open 160624-162522 ilvD
544 RCJR01000001.1 GCA009378595_00392 gene open 163034-164734 betT
545 RCJR01000001.1 GCA009378595_00393 gene open 164871-166118 perM
546 RCJR01000001.1 GCA009378595_00394 gene open 166190-166840
547 RCJR01000001.1 GCA009378595_00395 gene open 166957-167391 hinT
548 RCJR01000001.1 GCA009378595_00396 gene open 167441-168214 fpr
549 RCJR01000001.1 GCA009378595_00397 gene open 168408-169124 tsaA
550 RCJR01000001.1 GCA009378595_00400 gene open 169810-171231 acrA
551 RCJR01000001.1 GCA009378595_00401 gene open 171245-174400 acrB
552 RCJR01000001.1 GCA009378595_00402 gene open 174410-175933 tolC
553 RCJR01000001.1 GCA009378595_00403 gene open 175993-176661 terZ
554 RCJR01000001.1 GCA009378595_00404 gene open 176849-178243 glcD
555 RCJR01000001.1 GCA009378595_00405 gene open 178515-179924 yegQ
556 RCJR01000001.1 GCA009378595_00406 gene open 179939-180922
557 RCJR01000001.1 GCA009378595_00407 gene open 180897-181637
558 RCJR01000001.1 GCA009378595_00408 gene open 181642-181902 nuoI
559 RCJR01000001.1 GCA009378595_00409 gene open 181980-182426 yqeY
560 RCJR01000001.1 GCA009378595_00410 gene open 182452-183288 rsmI
561 RCJR01000001.1 GCA009378595_00411 gene open 183291-183965 yihA
562 RCJR01000001.1 GCA009378595_00412 gene open 184193-185494 thrA
563 RCJR01000001.1 GCA009378595_00413 gene open 185869-186672 dsbG
564 RCJR01000001.1 GCA009378595_00414 gene open 187146-188618 guaB
565 RCJR01000001.1 GCA009378595_00415 gene open 189012-191288 cirA
566 RCJR01000001.1 GCA009378595_00416 gene open 191424-191993 tPR
567 RCJR01000001.1 GCA009378595_00417 gene open 192281-192895 metW
568 RCJR01000001.1 GCA009378595_00418 gene open 192950-194119 mET2
569 RCJR01000001.1 GCA009378595_00419 gene open 194237-194734 slpA
570 RCJR01000001.1 GCA009378595_00420 gene open 194964-195476 lspA
571 RCJR01000001.1 GCA009378595_00421 gene open 195469-198756 ileS
572 RCJR01000001.1 GCA009378595_00422 gene open 198847-200076
573 RCJR01000001.1 GCA009378595_00423 gene open 200066-200467 yurZ
574 RCJR01000001.1 GCA009378595_00424 gene open 200451-201371
575 RCJR01000001.1 GCA009378595_00425 gene open 201667-201765
576 RCJR01000001.1 GCA009378595_00426 gene open 202026-203345 uraA
577 RCJR01000001.1 GCA009378595_00427 gene open 203512-205011 alsT
578 RCJR01000001.1 GCA009378595_00428 gene open 205171-205701 trxA
579 RCJR01000001.1 GCA009378595_00429 gene open 205850-206302
580 RCJR01000001.1 GCA009378595_00430 gene open 206478-206801 fdxA
581 RCJR01000001.1 GCA009378595_00431 gene open 207090-207605
582 RCJR01000001.1 GCA009378595_00432 gene open 207802-209352 murJ
583 RCJR01000001.1 GCA009378595_00433 gene open 209529-210116 ampD
584 RCJR01000001.1 GCA009378595_00434 gene open 210251-212098
585 RCJR01000001.1 GCA009378595_00435 gene open 212114-212962 wcaG
586 RCJR01000001.1 GCA009378595_00436 gene open 213047-214516 citT
587 RCJR01000001.1 GCA009378595_00437 gene open 214792-217719 valS
588 RCJR01000001.1 GCA009378595_00438 gene open 217791-218009 dam
589 RCJR01000001.1 GCA009378595_00439 gene open 218171-218950 dpnC
590 RCJR01000001.1 GCA009378595_00440 gene open 218937-219107
591 RCJR01000001.1 GCA009378595_00441 gene open 219212-219550
592 RCJR01000001.1 GCA009378595_00442 gene open 219558-220463 acuC
593 RCJR01000001.1 GCA009378595_00443 gene open 220499-221134
594 RCJR01000001.1 GCA009378595_00444 gene open 221416-222174 ccmA
595 RCJR01000001.1 GCA009378595_00445 gene open 222171-222845 ccmB
596 RCJR01000001.1 GCA009378595_00446 gene open 222886-223740 nit1
597 RCJR01000001.1 GCA009378595_00447 gene open 223979-224179 thiS
598 RCJR01000001.1 GCA009378595_00448 gene open 224216-224599 ygdD
599 RCJR01000001.1 GCA009378595_00449 gene open 224677-225792 rpoH
600 RCJR01000001.1 GCA009378595_00450 gene open 225964-226383 tusA
601 RCJR01000001.1 GCA009378595_00451 gene open 226383-227036
602 RCJR01000001.1 GCA009378595_00452 gene open 227266-228534 serS
603 RCJR01000001.1 GCA009378595_00453 gene open 228731-230719 tkt
604 RCJR01000001.1 GCA009378595_00454 gene open 230915-231640 pyrH
605 RCJR01000001.1 GCA009378595_00455 gene open 231746-232300 frr
606 RCJR01000001.1 GCA009378595_00456 gene open 232397-233143 uppS
607 RCJR01000001.1 GCA009378595_00457 gene open 233210-234058 cdsA
608 RCJR01000001.1 GCA009378595_00458 gene open 234142-235386 dxr
609 RCJR01000001.1 GCA009378595_00459 gene open 235383-236756 rseP
610 RCJR01000001.1 GCA009378595_00460 gene open 236929-239370 bamA
611 RCJR01000001.1 GCA009378595_00461 gene open 239370-240383 lpxD
612 RCJR01000001.1 GCA009378595_00462 gene open 240494-241021 fabZ
613 RCJR01000001.1 GCA009378595_00463 gene open 241065-241838 lpxA
614 RCJR01000001.1 GCA009378595_00464 gene open 242219-243706 yocR
615 RCJR01000001.1 GCA009378595_00465 gene open 243722-243850
616 RCJR01000001.1 GCA009378595_00466 gene open 244091-245695 appC
617 RCJR01000001.1 GCA009378595_00467 gene open 245698-246846 cydB
618 RCJR01000001.1 GCA009378595_00468 gene open 246927-247055 cydX
619 RCJR01000001.1 GCA009378595_00469 gene open 247214-249205 dsbD
620 RCJR01000001.1 GCA009378595_00470 gene open 249485-249592
621 RCJR01000001.1 GCA009378595_00471 gene open 249664-250992
622 RCJR01000001.1 GCA009378595_00472 gene open 251203-252708 alsT
623 RCJR01000001.1 GCA009378595_00473 gene open 253130-253753 lemA
624 RCJR01000001.1 GCA009378595_00474 gene open 253785-254873 ygcG
625 RCJR01000001.1 GCA009378595_00475 gene open 254873-255391
626 RCJR01000001.1 GCA009378595_00476 gene open 255421-255684
627 RCJR01000001.1 GCA009378595_00477 gene open 256922-257245
628 RCJR01000001.1 GCA009378595_00478 gene open 257275-257511
629 RCJR01000001.1 GCA009378595_00479 gene open 257757-259394
630 RCJR01000001.1 GCA009378595_00480 gene open 259396-260727
631 RCJR01000001.1 GCA009378595_00481 gene open 260720-261751
632 RCJR01000001.1 GCA009378595_00482 gene open 261880-262818
633 RCJR01000001.1 GCA009378595_00483 gene open 262912-266076
634 RCJR01000001.1 GCA009378595_00484 gene open 266131-266499
635 RCJR01000001.1 GCA009378595_00485 gene open 267036-267695 nfnB
636 RCJR01000001.1 GCA009378595_00486 gene open 267800-268861 fadH
637 RCJR01000001.1 GCA009378595_00487 gene open 269115-270032 lysR
638 RCJR01000001.1 GCA009378595_00488 gene open 270199-270510 rplU
639 RCJR01000001.1 GCA009378595_00489 gene open 270575-270832 rpmA
640 RCJR01000001.1 GCA009378595_00490 gene open 271076-271720
641 RCJR01000001.1 GCA009378595_00491 gene open 271819-272583 dnaA
642 RCJR01000001.1 GCA009378595_00492 gene open 272746-273855 perM
643 RCJR01000001.1 GCA009378595_00493 gene open 274148-275194 purM
644 RCJR01000001.1 GCA009378595_00494 gene open 275194-275862 purN
645 RCJR01000001.1 GCA009378595_00497 gene open 276562-277329
646 RCJR01000001.1 GCA009378595_00498 gene open 277398-277553 rpmG
647 RCJR01000001.1 GCA009378595_00499 gene open 277593-277829 rpmB
648 RCJR01000001.1 GCA009378595_00500 gene open 278090-278437 hopJ
649 RCJR01000001.1 GCA009378595_00501 gene open 278452-278703 csrA
650 RCJR01000001.1 GCA009378595_00502 gene open 278917-280200 metL1
651 RCJR01000001.1 GCA009378595_00503 gene open 280532-280816
652 RCJR01000001.1 GCA009378595_00504 gene open 281138-282703
653 RCJR01000001.1 GCA009378595_00505 gene open 283004-285685 alaS
654 RCJR01000001.1 GCA009378595_00506 gene open 285966-286193
655 RCJR01000001.1 GCA009378595_00507 gene open 286298-287686 purB
656 RCJR01000001.1 GCA009378595_00508 gene open 287794-289062 ykvI
657 RCJR01000001.1 GCA009378595_00509 gene open 289119-290297 mnmA
658 RCJR01000001.1 GCA009378595_00510 gene open 290399-290884 ispF
659 RCJR01000001.1 GCA009378595_00511 gene open 290941-291507 pncA
660 RCJR01000001.1 GCA009378595_00512 gene open 291560-291895 grxD
661 RCJR01000001.1 GCA009378595_00513 gene open 292026-292301
662 RCJR01000001.1 GCA009378595_00514 gene open 292323-292634
663 RCJR01000001.1 GCA009378595_00515 gene open 292812-293138
664 RCJR01000001.1 GCA009378595_00516 gene open 293096-293617
665 RCJR01000001.1 GCA009378595_00517 gene open 293578-293805
666 RCJR01000001.1 GCA009378595_00518 gene open 293869-294219
667 RCJR01000001.1 GCA009378595_00519 gene open 294443-294781 fdx
668 RCJR01000001.1 GCA009378595_00520 gene open 294887-296746 hscA
669 RCJR01000001.1 GCA009378595_00521 gene open 296899-297417 hscB
670 RCJR01000001.1 GCA009378595_00522 gene open 297444-297764 iscA
671 RCJR01000001.1 GCA009378595_00523 gene open 297874-298257 iscU
672 RCJR01000001.1 GCA009378595_00524 gene open 298434-299657 iscS
673 RCJR01000001.1 GCA009378595_00525 gene open 299654-300160 iscR
674 RCJR01000001.1 GCA009378595_00526 gene open 300356-301033
675 RCJR01000001.1 GCA009378595_00527 gene open 301509-301781 hupA
676 RCJR01000001.1 GCA009378595_00528 gene open 301946-303799 surA
677 RCJR01000001.1 GCA009378595_00529 gene open 303931-305529 purH
678 RCJR01000001.1 GCA009378595_00530 gene open 306205-313191
679 RCJR01000001.1 GCA009378595_00531 gene open 313517-313762 fis
680 RCJR01000001.1 GCA009378595_00532 gene open 313773-314705 prmA
681 RCJR01000001.1 GCA009378595_00533 gene open 314942-317764 pgpB
682 RCJR01000001.1 GCA009378595_00534 gene open 317830-320169 mrcB
683 RCJR01000001.1 GCA009378595_00535 gene open 320696-323341
684 RCJR01000001.1 GCA009378595_00536 gene open 323428-324147
685 RCJR01000001.1 GCA009378595_00537 gene open 324474-325451 nadK
686 RCJR01000001.1 GCA009378595_00538 gene open 325482-325772 yeaC
687 RCJR01000001.1 GCA009378595_00539 gene open 325919-326425 apt
688 RCJR01000001.1 GCA009378595_00540 gene open 326455-328095 ubiB
689 RCJR01000001.1 GCA009378595_00541 gene open 328116-328760 ubiJ
690 RCJR01000001.1 GCA009378595_00542 gene open 328757-329614 ubiE
691 RCJR01000001.1 GCA009378595_00543 gene open 330034-330651 sodA
692 RCJR01000001.1 GCA009378595_00544 gene open 331073-332134 csm6
693 RCJR01000001.1 GCA009378595_00545 gene open 332178-333053 atu1564
694 RCJR01000001.1 GCA009378595_00546 gene open 333086-333979 ypfJ
695 RCJR01000001.1 GCA009378595_00547 gene open 334216-334875 ypfH
696 RCJR01000001.1 GCA009378595_00548 gene open 334960-335937
697 RCJR01000001.1 GCA009378595_00549 gene open 336232-337494 mntH
698 RCJR01000001.1 GCA009378595_00550 gene open 337629-338039 tnpA
699 RCJR01000001.1 GCA009378595_00551 gene open 338087-338506 orfB
700 RCJR01000001.1 GCA009378595_00552 gene open 339269-340768 osmY
701 RCJR01000001.1 GCA009378595_00553 gene open 340937-341446
702 RCJR01000001.1 GCA009378595_00554 gene open 341759-343003 lolE
703 RCJR01000001.1 GCA009378595_00555 gene open 343012-343689 lolD
704 RCJR01000001.1 GCA009378595_00556 gene open 343754-344098
705 RCJR01000001.1 GCA009378595_00557 gene open 344318-345478 metK
706 RCJR01000001.1 GCA009378595_00558 gene open 345805-346467
707 RCJR01000001.1 GCA009378595_00559 gene open 346652-347239 orn
708 RCJR01000001.1 GCA009378595_00560 gene open 347581-348159 yceI
709 RCJR01000001.1 GCA009378595_00561 gene open 348260-349057 lpxH
710 RCJR01000001.1 GCA009378595_00562 gene open 349059-349568 ppiB
711 RCJR01000001.1 GCA009378595_00563 gene open 349770-351521 glnS
712 RCJR01000001.1 GCA009378595_00564 gene open 351658-353514 ypbB
713 RCJR01000001.1 GCA009378595_00565 gene open 353501-354592 gapA
714 RCJR01000001.1 GCA009378595_00566 gene open 354781-355047 sdhE
715 RCJR01000001.1 GCA009378595_00567 gene open 355282-355563
716 RCJR01000001.1 GCA009378595_00568 gene open 355741-356451 yidB
717 RCJR01000001.1 GCA009378595_00569 gene open 356591-357265 serB
718 RCJR01000001.1 GCA009378595_00570 gene open 357462-358511 prfB
719 RCJR01000001.1 GCA009378595_00571 gene open 358764-360290 aCH1
720 RCJR01000001.1 GCA009378595_00572 gene open 360611-362290
721 RCJR01000001.1 GCA009378595_00573 gene open 362518-362796
722 RCJR01000001.1 GCA009378595_00574 gene open 363008-363343
723 RCJR01000001.1 GCA009378595_00575 gene open 363499-363630
724 RCJR01000001.1 GCA009378595_00576 gene open 363694-366003
725 RCJR01000001.1 GCA009378595_00577 gene open 366196-368076 rpoD
726 RCJR01000001.1 GCA009378595_00578 gene open 368513-368923 lrgA
727 RCJR01000001.1 GCA009378595_00579 gene open 368920-369615 lrgB
728 RCJR01000001.1 GCA009378595_00580 gene open 369857-370768 mltE
729 RCJR01000001.1 GCA009378595_00581 gene open 370950-371855 htpX
730 RCJR01000001.1 GCA009378595_00582 gene open 371916-373325 hflX
731 RCJR01000001.1 GCA009378595_00583 gene open 373429-374319 folP
732 RCJR01000001.1 GCA009378595_00584 gene open 374320-375060 rsmE
733 RCJR01000001.1 GCA009378595_00585 gene open 375389-377065 msrB
734 RCJR01000001.1 GCA009378595_00586 gene open 377346-378755 ahcY
735 RCJR01000001.1 GCA009378595_00587 gene open 379341-382565 cirA
736 RCJR01000001.1 GCA009378595_00588 gene open 382718-383035
737 RCJR01000001.1 GCA009378595_00589 gene open 383626-385137
738 RCJR01000001.1 GCA009378595_00590 gene open 385412-387553
739 RCJR01000001.1 GCA009378595_00591 gene open 387889-389523 mscS
740 RCJR01000001.1 GCA009378595_00592 gene open 389595-390398 tatD
741 RCJR01000001.1 GCA009378595_00593 gene open 390395-391363 dusA
742 RCJR01000001.1 GCA009378595_00594 gene open 391385-392164
743 RCJR01000001.1 GCA009378595_00595 gene open 392155-393060 menH
744 RCJR01000001.1 GCA009378595_00596 gene open 393375-394730 glmM
745 RCJR01000001.1 GCA009378595_00597 gene open 394896-395531 pdxH
746 RCJR01000001.1 GCA009378595_00598 gene open 395783-396451 lolA
747 RCJR01000001.1 GCA009378595_00599 gene open 396476-396688 copZ
748 RCJR01000001.1 GCA009378595_00600 gene open 396865-397473 nuoA
749 RCJR01000001.1 GCA009378595_00601 gene open 397539-397694
750 RCJR01000001.1 GCA009378595_00602 gene open 397823-398494 nuoB
751 RCJR01000001.1 GCA009378595_00603 gene open 398593-400341 nuoC
752 RCJR01000001.1 GCA009378595_00604 gene open 400361-401602
753 RCJR01000001.1 GCA009378595_00605 gene open 402340-403107 tauE
754 RCJR01000001.1 GCA009378595_00606 gene open 403196-403705 nuoE
755 RCJR01000001.1 GCA009378595_00607 gene open 403702-405120 nuoF
756 RCJR01000001.1 GCA009378595_00608 gene open 405122-408223 nuoG
757 RCJR01000001.1 GCA009378595_00609 gene open 408224-409252 nuoH
758 RCJR01000001.1 GCA009378595_00610 gene open 409253-409801 nuoI
759 RCJR01000001.1 GCA009378595_00611 gene open 409798-410430 nuoJ
760 RCJR01000001.1 GCA009378595_00612 gene open 410417-410791 nuoK
761 RCJR01000001.1 GCA009378595_00613 gene open 410798-412651 nuoL
762 RCJR01000001.1 GCA009378595_00614 gene open 412653-414380 nuoM
763 RCJR01000001.1 GCA009378595_00615 gene open 414383-415861 nuoN
764 RCJR01000001.1 GCA009378595_00616 gene open 416001-416750 grxC
765 RCJR01000001.1 GCA009378595_00617 gene open 417007-417828 fpr
766 RCJR01000001.1 GCA009378595_00618 gene open 418040-419767 argS
767 RCJR01000001.1 GCA009378595_00621 gene open 420319-421077 elyC
768 RCJR01000001.1 GCA009378595_00622 gene open 421061-422137 murB
769 RCJR01000001.1 GCA009378595_00623 gene open 422162-422662 wzb
770 RCJR01000001.1 GCA009378595_00624 gene open 422668-423069 hslR
771 RCJR01000001.1 GCA009378595_00625 gene open 423093-423761
772 RCJR01000001.1 GCA009378595_00626 gene open 423719-424105 dcm
773 RCJR01000001.1 GCA009378595_00627 gene open 424190-424333
774 RCJR01000001.1 GCA009378595_00628 gene open 424338-425879 ilvA
775 RCJR01000001.1 GCA009378595_00629 gene open 426057-426806 tACO1
776 RCJR01000001.1 GCA009378595_00630 gene open 427077-428591 rimO
777 RCJR01000001.1 GCA009378595_00355 gene open 119537-119613 trnV
778 RCJR01000001.1 GCA009378595_00398 gene open 169228-169314 trnL
779 RCJR01000001.1 GCA009378595_00399 gene open 169360-169433 trnC
780 RCJR01000001.1 GCA009378595_00495 gene open 276087-276162 trnN
781 RCJR01000001.1 GCA009378595_00619 gene open 419967-420057 trnS
782 RCJR01000001.1 GCA009378595_00620 gene open 420081-420171 trnS
783 RCJR01000001.1 GCA009378595_00631 gene open 428809-428885 trnD
784 RCJR01000001.1 GCA009378595_00355 tRNA open 119537-119613 trnV tRNA-Val(gac)
785 RCJR01000001.1 GCA009378595_00398 tRNA open 169228-169314 trnL tRNA-Leu(taa)
786 RCJR01000001.1 GCA009378595_00399 tRNA open 169360-169433 trnC tRNA-Cys(gca)
787 RCJR01000001.1 GCA009378595_00495 tRNA open 276087-276162 trnN tRNA-Asn(gtt)
788 RCJR01000001.1 GCA009378595_00619 tRNA open 419967-420057 trnS tRNA-Ser(tga)
789 RCJR01000001.1 GCA009378595_00620 tRNA open 420081-420171 trnS tRNA-Ser(tga)
790 RCJR01000001.1 GCA009378595_00631 tRNA open 428809-428885 trnD tRNA-Asp(gtc)
791 RCJR01000002.1 rep_origin open 312512-313109
792 RCJR01000002.1 GCA009378595_00932 gene open 327523-327626 V_AS9
793 RCJR01000002.1 GCA009378595_00932 ncRNA open 327523-327626 Vibrio RNA AS9
794 RCJR01000002.1 repeat_region open 284485-284644 CRISPR array with 3 repeats of length 30%2C consensus sequence CTTCACGACCGCACAGGTCGCTTAGAAAAT and spacer length 30
795 RCJR01000002.1 repeat_region open 284787-285726 CRISPR array with 16 repeats of length 28%2C consensus sequence CTTCACGACCGCACAGGTCGCTTAGAAA and spacer length 32
796 RCJR01000002.1 GCA009378595_00641 CDS open 324-1133 _na     269_aa pssA CDP-diacylglycerol--serine O-phosphatidyltransferase
797 RCJR01000002.1 GCA009378595_00642 CDS open 1193-2080 _na     295_aa rlmJ Ribosomal RNA large subunit methyltransferase J
798 RCJR01000002.1 GCA009378595_00643 CDS open 2220-2840 _na     206_aa eGL9 2OG-Fe(II) oxygenase
799 RCJR01000002.1 GCA009378595_00644 CDS open 2895-3149 _na     84_aa Putative 30S ribosomal protein S15
800 RCJR01000002.1 GCA009378595_00645 CDS open 3816-5000 _na     394_aa dapE succinyl-diaminopimelate desuccinylase
801 RCJR01000002.1 GCA009378595_00646 CDS open 5095-6090 _na     331_aa afuA Fe(3+) ABC transporter substrate-binding protein
802 RCJR01000002.1 GCA009378595_00647 CDS open 6333-7934 _na     533_aa fbpB ABC transporter permease
803 RCJR01000002.1 GCA009378595_00648 CDS open 7966-8985 _na     339_aa potA Fe3+/spermidine/putrescine ABC transporter ATP-binding protein
804 RCJR01000002.1 GCA009378595_00649 CDS open 9044-9241 _na     65_aa iscX Fe-S cluster assembly protein IscX
805 RCJR01000002.1 GCA009378595_00650 CDS open 9628-11184 _na     518_aa ahpF alkyl hydroperoxide reductase subunit F
806 RCJR01000002.1 GCA009378595_00651 CDS open 11524-11757 _na     77_aa ydcH DUF465 domain-containing protein
807 RCJR01000002.1 GCA009378595_00652 CDS open 11958-12524 _na     188_aa ahpC alkyl hydroperoxide reductase subunit C
808 RCJR01000002.1 GCA009378595_00653 CDS open 12745-13647 _na     300_aa lysR Hydrogen peroxide-inducible activator
809 RCJR01000002.1 GCA009378595_00654 CDS open 13661-14374 _na     237_aa ygjP YgjP-like metallopeptidase domain-containing protein
810 RCJR01000002.1 GCA009378595_00655 CDS open 14337-15260 _na     307_aa ddlA D-alanine--D-alanine ligase
811 RCJR01000002.1 GCA009378595_00656 CDS open 15306-16766 _na     486_aa murC UDP-N-acetylmuramate--L-alanine ligase
812 RCJR01000002.1 GCA009378595_00657 CDS open 16931-17455 _na     174_aa rimL Acetyltransferase domain protein
813 RCJR01000002.1 GCA009378595_00658 CDS open 17756-18859 _na     367_aa murG undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase
814 RCJR01000002.1 GCA009378595_00659 CDS open 18965-19936 _na     323_aa gshB glutathione synthase
815 RCJR01000002.1 GCA009378595_00660 CDS open 20031-20678 _na     215_aa pyrE Orotate phosphoribosyltransferase
816 RCJR01000002.1 GCA009378595_00661 CDS open 20822-21700 _na     292_aa tsf translation elongation factor Ts
817 RCJR01000002.1 GCA009378595_00662 CDS open 21778-22593 _na     271_aa rpsB 30S ribosomal protein S2
818 RCJR01000002.1 GCA009378595_00663 CDS open 22827-26453 _na     1208_aa smc chromosome segregation protein SMC
819 RCJR01000002.1 GCA009378595_00664 CDS open 26578-27075 _na     165_aa mutT RNA pyrophosphohydrolase
820 RCJR01000002.1 GCA009378595_00665 CDS open 27607-28020 _na     137_aa yhfA OsmC family protein
821 RCJR01000002.1 GCA009378595_00666 CDS open 28017-28439 _na     140_aa MAPEG family protein
822 RCJR01000002.1 GCA009378595_00667 CDS open 28457-29164 _na     235_aa coaX pantothenate kinase
823 RCJR01000002.1 GCA009378595_00668 CDS open 29219-30112 _na     297_aa birA2 Ligase
824 RCJR01000002.1 GCA009378595_00669 CDS open 30190-30987 _na     265_aa tauE putative membrane transporter protein
825 RCJR01000002.1 GCA009378595_00671 CDS open 31450-31608 _na     52_aa UPF0391 membrane protein AO382_0985
826 RCJR01000002.1 GCA009378595_00672 CDS open 31735-33909 _na     724_aa ctpA C-terminal processing peptidase family protein
827 RCJR01000002.1 GCA009378595_00673 CDS open 34145-35218 _na     357_aa nagZ beta-N-acetylhexosaminidase
828 RCJR01000002.1 GCA009378595_00674 CDS open 35460-36830 _na     456_aa gorA glutathione-disulfide reductase
829 RCJR01000002.1 GCA009378595_00675 CDS open 36986-38212 _na     408_aa serA phosphoglycerate dehydrogenase
830 RCJR01000002.1 GCA009378595_00676 CDS open 38427-42665 _na     1412_aa rpoC DNA-directed RNA polymerase subunit beta'
831 RCJR01000002.1 GCA009378595_00677 CDS open 42745-46836 _na     1363_aa rpoB DNA-directed RNA polymerase subunit beta
832 RCJR01000002.1 GCA009378595_00678 CDS open 47256-47630 _na     124_aa rplL 50S ribosomal protein L7/L12
833 RCJR01000002.1 GCA009378595_00679 CDS open 47688-48191 _na     167_aa rplJ 50S ribosomal protein L10
834 RCJR01000002.1 GCA009378595_00680 CDS open 48503-49204 _na     233_aa rplA 50S ribosomal protein L1
835 RCJR01000002.1 GCA009378595_00681 CDS open 49204-49635 _na     143_aa rplK 50S ribosomal protein L11
836 RCJR01000002.1 GCA009378595_00682 CDS open 49736-50266 _na     176_aa nusG transcription termination/antitermination protein NusG
837 RCJR01000002.1 GCA009378595_00683 CDS open 50288-50761 _na     157_aa secE preprotein translocase subunit SecE
838 RCJR01000002.1 GCA009378595_00685 CDS open 51044-52234 _na     396_aa tuf elongation factor Tu
839 RCJR01000002.1 GCA009378595_00690 CDS open 53140-53397 _na     85_aa Transcriptional regulator
840 RCJR01000002.1 GCA009378595_00691 CDS open 53498-54388 _na     296_aa yobV HTH deoR-type domain-containing protein
841 RCJR01000002.1 GCA009378595_00692 CDS open 54391-55323 _na     310_aa rPT1 AAA+ ATPase domain-containing protein
842 RCJR01000002.1 GCA009378595_00693 CDS open 55320-55679 _na     119_aa hypothetical protein
843 RCJR01000002.1 GCA009378595_00694 CDS open 55681-56088 _na     135_aa hypothetical protein
844 RCJR01000002.1 GCA009378595_00695 CDS open 56088-56567 _na     159_aa hypothetical protein
845 RCJR01000002.1 GCA009378595_00696 CDS open 56620-58131 _na     503_aa Anthranilate synthase component 1
846 RCJR01000002.1 GCA009378595_00697 CDS open 58485-58805 _na     106_aa yqfO PII-like insert in the putative protein YqfO%2C YbgI/NIF3 family
847 RCJR01000002.1 GCA009378595_00698 CDS open 58845-59555 _na     236_aa purC phosphoribosylaminoimidazolesuccinocarboxamide synthase
848 RCJR01000002.1 GCA009378595_00699 CDS open 59609-59881 _na     90_aa Lipoprotein
849 RCJR01000002.1 GCA009378595_00700 CDS open 59954-60859 _na     301_aa dapA 4-hydroxy-tetrahydrodipicolinate synthase
850 RCJR01000002.1 GCA009378595_00701 CDS open 61040-61660 _na     206_aa tmk dTMP kinase
851 RCJR01000002.1 GCA009378595_00702 CDS open 61673-62800 _na     375_aa mltG Endolytic murein transglycosylase
852 RCJR01000002.1 GCA009378595_00703 CDS open 62906-63730 _na     274_aa ilvE Aminodeoxychorismate lyase
853 RCJR01000002.1 GCA009378595_00704 CDS open 63737-64339 _na     200_aa hypothetical protein
854 RCJR01000002.1 GCA009378595_00705 CDS open 64461-65252 _na     263_aa aroE shikimate dehydrogenase
855 RCJR01000002.1 GCA009378595_00706 CDS open 65291-65434 _na     47_aa FxLD family lantipeptide
856 RCJR01000002.1 GCA009378595_00707 CDS open 65666-67486 _na     606_aa caiA Acyl-CoA dehydrogenase
857 RCJR01000002.1 GCA009378595_00708 CDS open 67623-68573 _na     316_aa trxB thioredoxin-disulfide reductase
858 RCJR01000002.1 GCA009378595_00709 CDS open 68702-69892 _na     396_aa tuf elongation factor Tu
859 RCJR01000002.1 GCA009378595_00710 CDS open 70013-72139 _na     708_aa fusA elongation factor G
860 RCJR01000002.1 GCA009378595_00711 CDS open 72299-72772 _na     157_aa rpsG 30S ribosomal protein S7
861 RCJR01000002.1 GCA009378595_00712 CDS open 72893-73342 _na     149_aa rpsL 30S ribosomal protein S12
862 RCJR01000002.1 GCA009378595_00713 CDS open 73484-75613 _na     709_aa ecsC EcsC family protein
863 RCJR01000002.1 GCA009378595_00714 CDS open 75972-77204 _na     410_aa fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1
864 RCJR01000002.1 GCA009378595_00715 CDS open 77382-78761 _na     459_aa trpE Para-aminobenzoate synthase%2C aminase component
865 RCJR01000002.1 GCA009378595_00716 CDS open 78777-80573 _na     598_aa pepP Xaa-Pro aminopeptidase
866 RCJR01000002.1 GCA009378595_00717 CDS open 80747-80929 _na     60_aa hypothetical protein
867 RCJR01000002.1 GCA009378595_00718 CDS open 81156-82781 _na     541_aa Surface lipoprotein assembly modifier C-terminal beta-barrel domain-containing protein
868 RCJR01000002.1 GCA009378595_00719 CDS open 82783-85785 _na     1000_aa cirA Lactoferrin binding protein A
869 RCJR01000002.1 GCA009378595_00720 CDS open 85958-88630 _na     890_aa Lactoferrin binding protein B
870 RCJR01000002.1 GCA009378595_00721 CDS open 89055-90641 _na     528_aa lnt apolipoprotein N-acyltransferase
871 RCJR01000002.1 GCA009378595_00722 CDS open 90778-91074 _na     98_aa Lipoprotein
872 RCJR01000002.1 GCA009378595_00723 CDS open 91244-94042 _na     932_aa secA preprotein translocase subunit SecA
873 RCJR01000002.1 GCA009378595_00724 CDS open 94345-95649 _na     434_aa hemL glutamate-1-semialdehyde 2%2C1-aminomutase
874 RCJR01000002.1 GCA009378595_00725 CDS open 95689-96027 _na     112_aa phnA Alkylphosphonate utilization protein
875 RCJR01000002.1 GCA009378595_00726 CDS open 96212-96913 _na     233_aa ygfZ Aminomethyltransferase folate-binding domain protein
876 RCJR01000002.1 GCA009378595_00727 CDS open 96985-97857 _na     290_aa corC Magnesium/cobalt efflux protein
877 RCJR01000002.1 GCA009378595_00728 CDS open 98018-98482 _na     154_aa ycgN YcgN family cysteine cluster protein
878 RCJR01000002.1 GCA009378595_00729 CDS open 98669-99406 _na     245_aa dLH Dienelactone hydrolase
879 RCJR01000002.1 GCA009378595_00730 CDS open 99491-101002 _na     503_aa pepD2 Xaa-His dipeptidase%2C Metallo peptidase%2C MEROPS family M20C
880 RCJR01000002.1 GCA009378595_00731 CDS open 101121-102248 _na     375_aa pucG Class V aminotransferase
881 RCJR01000002.1 GCA009378595_00732 CDS open 102492-102779 _na     95_aa Lipoprotein
882 RCJR01000002.1 GCA009378595_00733 CDS open 102852-103088 _na     78_aa DUF2788 domain-containing protein
883 RCJR01000002.1 GCA009378595_00734 CDS open 103286-103954 _na     222_aa ftsN SPOR domain-containing protein
884 RCJR01000002.1 GCA009378595_00735 CDS open 104067-104984 _na     305_aa mutK ABC transporter
885 RCJR01000002.1 GCA009378595_00736 CDS open 105068-106126 _na     352_aa cmoB tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB
886 RCJR01000002.1 GCA009378595_00737 CDS open 106179-106949 _na     256_aa cmoA carboxy-S-adenosyl-L-methionine synthase CmoA
887 RCJR01000002.1 GCA009378595_00738 CDS open 107004-107537 _na     177_aa msrA Peptide methionine sulfoxide reductase MsrA
888 RCJR01000002.1 GCA009378595_00739 CDS open 107639-109060 _na     473_aa pGRP Membrane-bound lytic murein transglycosylase B
889 RCJR01000002.1 GCA009378595_00740 CDS open 109157-109342 _na     61_aa H-NS histone family
890 RCJR01000002.1 GCA009378595_00741 CDS open 109504-110361 _na     285_aa murI glutamate racemase
891 RCJR01000002.1 GCA009378595_00742 CDS open 110427-111053 _na     208_aa Proteophosphoglycan
892 RCJR01000002.1 GCA009378595_00743 CDS open 111421-113082 _na     553_aa fixX Electron transfer flavoprotein-ubiquinone oxidoreductase
893 RCJR01000002.1 GCA009378595_00744 CDS open 113198-114541 _na     447_aa hemA glutamyl-tRNA reductase
894 RCJR01000002.1 GCA009378595_00745 CDS open 114876-116891 _na     671_aa hemYx Tetratricopeptide repeat protein
895 RCJR01000002.1 GCA009378595_00746 CDS open 116920-117492 _na     190_aa lolB Outer-membrane lipoprotein LolB
896 RCJR01000002.1 GCA009378595_00747 CDS open 117497-118369 _na     290_aa ispE 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase
897 RCJR01000002.1 GCA009378595_00750 CDS open 118938-119891 _na     317_aa prsA Ribose-phosphate pyrophosphokinase
898 RCJR01000002.1 GCA009378595_00751 CDS open 119938-120453 _na     171_aa cybB Prokaryotic cytochrome b561 family protein
899 RCJR01000002.1 GCA009378595_00752 CDS open 120667-121671 _na     334_aa accB HlyD family secretion protein
900 RCJR01000002.1 GCA009378595_00753 CDS open 121866-122588 _na     240_aa ompR Transcriptional regulatory protein YycF
901 RCJR01000002.1 GCA009378595_00754 CDS open 122724-124289 _na     521_aa baeS histidine kinase
902 RCJR01000002.1 GCA009378595_00755 CDS open 124413-125483 _na     356_aa metN methionine ABC transporter ATP-binding protein MetN
903 RCJR01000002.1 GCA009378595_00756 CDS open 125473-126162 _na     229_aa metP Methionine ABC transporter permease protein
904 RCJR01000002.1 GCA009378595_00757 CDS open 126354-127184 _na     276_aa nlpA Lipoprotein
905 RCJR01000002.1 GCA009378595_00758 CDS open 127254-127775 _na     173_aa ccmE cytochrome c maturation protein CcmE
906 RCJR01000002.1 GCA009378595_00759 CDS open 127845-128045 _na     66_aa ccmD heme exporter protein CcmD
907 RCJR01000002.1 GCA009378595_00760 CDS open 128045-128854 _na     269_aa ccmC Heme exporter protein C
908 RCJR01000002.1 GCA009378595_00761 CDS open 129053-129598 _na     181_aa Glycine zipper domain-containing protein
909 RCJR01000002.1 GCA009378595_00762 CDS open 129595-130746 _na     383_aa gsp Glutathionylspermidine synthase preATP-grasp family protein
910 RCJR01000002.1 GCA009378595_00763 CDS open 130838-131548 _na     236_aa ssb Single-stranded DNA-binding protein
911 RCJR01000002.1 GCA009378595_00764 CDS open 131691-134564 _na     957_aa uvrA excinuclease ABC subunit UvrA
912 RCJR01000002.1 GCA009378595_00765 CDS open 134637-135401 _na     254_aa nadD nicotinate (nicotinamide) nucleotide adenylyltransferase
913 RCJR01000002.1 GCA009378595_00766 CDS open 135434-135799 _na     121_aa rsfS ribosome silencing factor
914 RCJR01000002.1 GCA009378595_00767 CDS open 135814-136596 _na     260_aa mutT Coenzyme A pyrophosphatase
915 RCJR01000002.1 GCA009378595_00768 CDS open 136731-137306 _na     191_aa yjhB MutT/nudix family protein
916 RCJR01000002.1 GCA009378595_00769 CDS open 137356-137808 _na     150_aa dtd D-aminoacyl-tRNA deacylase
917 RCJR01000002.1 GCA009378595_00770 CDS open 137821-138525 _na     234_aa bioD dethiobiotin synthase
918 RCJR01000002.1 GCA009378595_00771 CDS open 138522-139379 _na     285_aa tam Malonyl-[acyl-carrier protein] O-methyltransferase
919 RCJR01000002.1 GCA009378595_00772 CDS open 139376-140575 _na     399_aa bioF Aminotransferase class I and II family protein
920 RCJR01000002.1 GCA009378595_00773 CDS open 140575-141897 _na     440_aa bioA adenosylmethionine--8-amino-7-oxononanoate transaminase
921 RCJR01000002.1 GCA009378595_00774 CDS open 142082-142522 _na     146_aa ybaN Inner membrane protein
922 RCJR01000002.1 GCA009378595_00775 CDS open 142762-143595 _na     277_aa asd archaetidylserine decarboxylase
923 RCJR01000002.1 GCA009378595_00776 CDS open 143913-144107 _na     64_aa Inner membrane protein YgaP-like transmembrane domain-containing protein
924 RCJR01000002.1 GCA009378595_00777 CDS open 144190-147156 _na     988_aa hPtr histidine kinase
925 RCJR01000002.1 GCA009378595_00778 CDS open 147295-148203 _na     302_aa cysM cysteine synthase CysM
926 RCJR01000002.1 GCA009378595_00779 CDS open 148212-148985 _na     257_aa polB Putative 3'-5' exonuclease related to the exonuclease domain of PolB family protein
927 RCJR01000002.1 GCA009378595_00780 CDS open 148997-149221 _na     74_aa hypothetical protein
928 RCJR01000002.1 GCA009378595_00781 CDS open 149279-149407 _na     42_aa hypothetical protein
929 RCJR01000002.1 GCA009378595_00782 CDS open 149508-151001 _na     497_aa rlmD 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD
930 RCJR01000002.1 GCA009378595_00783 CDS open 151058-152803 _na     581_aa srmB ATP-dependent RNA helicase
931 RCJR01000002.1 GCA009378595_00784 CDS open 153478-155844 _na     788_aa spoT GTP pyrophosphokinase
932 RCJR01000002.1 GCA009378595_00785 CDS open 155874-156782 _na     302_aa mutM bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase
933 RCJR01000002.1 GCA009378595_00786 CDS open 156830-157798 _na     322_aa zipA Cell division protein ZipA
934 RCJR01000002.1 GCA009378595_00787 CDS open 158123-158383 _na     86_aa rpmE type B 50S ribosomal protein L31
935 RCJR01000002.1 GCA009378595_00788 CDS open 158596-158892 _na     98_aa hupA integration host factor subunit alpha
936 RCJR01000002.1 GCA009378595_00789 CDS open 159041-161437 _na     798_aa pheT phenylalanine--tRNA ligase subunit beta
937 RCJR01000002.1 GCA009378595_00790 CDS open 161490-162521 _na     343_aa pheS phenylalanine--tRNA ligase subunit alpha
938 RCJR01000002.1 GCA009378595_00791 CDS open 162814-163509 _na     231_aa sco1 SCO1/SenC family protein
939 RCJR01000002.1 GCA009378595_00792 CDS open 163646-164482 _na     278_aa yfmG Sulfatase-modifying factor enzyme domain-containing protein
940 RCJR01000002.1 GCA009378595_00793 CDS open 164775-166283 _na     502_aa Copper-containing nitrite reductase
941 RCJR01000002.1 GCA009378595_00794 CDS open 166665-167198 _na     177_aa iscR Nitrite-sensitive transcriptional repressor NsrR
942 RCJR01000002.1 GCA009378595_00795 CDS open 167374-169650 _na     758_aa norB Nitric-oxide reductase%2C quinol-dependent
943 RCJR01000002.1 GCA009378595_00796 CDS open 170020-170376 _na     118_aa rplT 50S ribosomal protein L20
944 RCJR01000002.1 GCA009378595_00797 CDS open 170405-170596 _na     63_aa rpmI 50S ribosomal protein L35
945 RCJR01000002.1 GCA009378595_00798 CDS open 170857-171666 _na     269_aa hisIE bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE
946 RCJR01000002.1 GCA009378595_00799 CDS open 171729-171962 _na     77_aa tatA Sec-independent protein translocase subunit TatA
947 RCJR01000002.1 GCA009378595_00800 CDS open 171959-172495 _na     178_aa tatA Preprotein translocase subunit TatA
948 RCJR01000002.1 GCA009378595_00801 CDS open 172492-173235 _na     247_aa tatC Sec-independent protein translocase protein TatC
949 RCJR01000002.1 GCA009378595_00802 CDS open 173434-175122 _na     562_aa gltB2 Ferredoxin-dependent glutamate synthase
950 RCJR01000002.1 GCA009378595_00803 CDS open 175627-176370 _na     247_aa mngR GntR family transcriptional regulator
951 RCJR01000002.1 GCA009378595_00804 CDS open 176540-178024 _na     494_aa uvrD Putative DNA helicase
952 RCJR01000002.1 GCA009378595_00805 CDS open 178029-179000 _na     323_aa dusA tRNA-dihydrouridine(16) synthase
953 RCJR01000002.1 GCA009378595_00806 CDS open 179148-179756 _na     202_aa Dyp-type peroxidase family protein
954 RCJR01000002.1 GCA009378595_00807 CDS open 179735-180469 _na     244_aa Dyp-type peroxidase domain-containing protein
955 RCJR01000002.1 GCA009378595_00808 CDS open 180539-181504 _na     321_aa efeO iron uptake system protein EfeO
956 RCJR01000002.1 GCA009378595_00809 CDS open 181822-182400 _na     192_aa DUF11 domain-containing protein
957 RCJR01000002.1 GCA009378595_00810 CDS open 182710-184041 _na     443_aa argA amino-acid N-acetyltransferase
958 RCJR01000002.1 GCA009378595_00811 CDS open 184110-185381 _na     423_aa gltS sodium/glutamate symporter
959 RCJR01000002.1 GCA009378595_00812 CDS open 185663-189607 _na     1314_aa purL phosphoribosylformylglycinamidine synthase
960 RCJR01000002.1 GCA009378595_00813 CDS open 189777-191000 _na     407_aa araJ Bcr/CflA family efflux transporter
961 RCJR01000002.1 GCA009378595_00814 CDS open 191155-192819 _na     554_aa pilB type IV-A pilus assembly ATPase PilB
962 RCJR01000002.1 GCA009378595_00815 CDS open 192858-194117 _na     419_aa pilC Type II secretion system (T2SS)%2C F family protein
963 RCJR01000002.1 GCA009378595_00816 CDS open 194117-194893 _na     258_aa pilD Peptidase
964 RCJR01000002.1 GCA009378595_00817 CDS open 195045-195680 _na     211_aa coaE dephospho-CoA kinase
965 RCJR01000002.1 GCA009378595_00818 CDS open 195672-196217 _na     181_aa DUF924 domain-containing protein
966 RCJR01000002.1 GCA009378595_00819 CDS open 196479-197126 _na     215_aa RND transporter
967 RCJR01000002.1 GCA009378595_00820 CDS open 197214-197654 _na     146_aa AcrB/AcrD/AcrF family protein
968 RCJR01000002.1 GCA009378595_00821 CDS open 197676-198437 _na     253_aa AcrB/AcrD/AcrF family protein
969 RCJR01000002.1 GCA009378595_00822 CDS open 198413-198796 _na     127_aa AcrB/AcrD/AcrF family protein
970 RCJR01000002.1 GCA009378595_00823 CDS open 198845-199117 _na     90_aa AcrB/AcrD/AcrF family protein
971 RCJR01000002.1 GCA009378595_00824 CDS open 199114-199464 _na     116_aa AcrB/AcrD/AcrF family
972 RCJR01000002.1 GCA009378595_00825 CDS open 199442-199552 _na     36_aa hypothetical protein
973 RCJR01000002.1 GCA009378595_00826 CDS open 199820-200107 _na     95_aa hlyD HlyD family secretion protein
974 RCJR01000002.1 GCA009378595_00827 CDS open 200212-200787 _na     191_aa hlyD HlyD secretion family protein
975 RCJR01000002.1 GCA009378595_00828 CDS open 200854-201507 _na     217_aa crp Cyclic nucleotide-binding domain-containing protein
976 RCJR01000002.1 GCA009378595_00829 CDS open 201494-203590 _na     698_aa recG ATP-dependent DNA helicase RecG
977 RCJR01000002.1 GCA009378595_00830 CDS open 203701-205005 _na     434_aa cysN sulfate adenylyltransferase
978 RCJR01000002.1 GCA009378595_00831 CDS open 205156-206079 _na     307_aa cysD sulfate adenylyltransferase subunit CysD
979 RCJR01000002.1 GCA009378595_00832 CDS open 206163-206894 _na     243_aa cysH phosphoadenylyl-sulfate reductase
980 RCJR01000002.1 GCA009378595_00833 CDS open 207240-207506 _na     88_aa Patatin
981 RCJR01000002.1 GCA009378595_00834 CDS open 207481-208395 _na     304_aa Alpha-beta hydrolase family esterase
982 RCJR01000002.1 GCA009378595_00835 CDS open 208532-209704 _na     390_aa fadA acetyl-CoA C-acyltransferase FadA
983 RCJR01000002.1 GCA009378595_00836 CDS open 209734-211887 _na     717_aa fadB fatty acid oxidation complex subunit alpha FadB
984 RCJR01000002.1 GCA009378595_00837 CDS open 212237-213361 _na     374_aa dnaJ J domain-containing protein
985 RCJR01000002.1 GCA009378595_00838 CDS open 213524-214840 _na     438_aa clpX ATP-dependent protease ATP-binding subunit ClpX
986 RCJR01000002.1 GCA009378595_00839 CDS open 214850-215503 _na     217_aa clpP ATP-dependent Clp endopeptidase proteolytic subunit ClpP
987 RCJR01000002.1 GCA009378595_00840 CDS open 215668-217002 _na     444_aa tig trigger factor
988 RCJR01000002.1 GCA009378595_00841 CDS open 217187-217798 _na     203_aa rdgB RdgB/HAM1 family non-canonical purine NTP pyrophosphatase
989 RCJR01000002.1 GCA009378595_00842 CDS open 217932-218681 _na     249_aa elsH Endonuclease/exonuclease/phosphatase domain-containing protein
990 RCJR01000002.1 GCA009378595_00843 CDS open 218898-221021 _na     707_aa dcp oligopeptidase A
991 RCJR01000002.1 GCA009378595_00844 CDS open 221026-221259 _na     77_aa Metal-binding protein
992 RCJR01000002.1 GCA009378595_00845 CDS open 221449-224136 _na     895_aa preP prolyl oligopeptidase
993 RCJR01000002.1 GCA009378595_00846 CDS open 224373-225605 _na     410_aa Porin
994 RCJR01000002.1 GCA009378595_00847 CDS open 225704-226921 _na     405_aa Porin
995 RCJR01000002.1 GCA009378595_00848 CDS open 227190-227285 _na     31_aa hypothetical protein
996 RCJR01000002.1 GCA009378595_00849 CDS open 227337-230078 _na     913_aa cirA TonB-dependent Receptor Plug domain protein
997 RCJR01000002.1 GCA009378595_00850 CDS open 230669-231256 _na     195_aa hypothetical protein
998 RCJR01000002.1 GCA009378595_00851 CDS open 231250-231450 _na     66_aa hypothetical protein
999 RCJR01000002.1 GCA009378595_00852 CDS open 231651-233099 _na     482_aa lpdA dihydrolipoyl dehydrogenase
1000 RCJR01000002.1 GCA009378595_00853 CDS open 233189-234427 _na     412_aa odhB 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase