HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Staphylococcus schleiferi (GCA_011137195.1)

Select a Genome:
BAKTA Annotations for GCA_011137195.1
Genome Selected: Staphylococcus schleiferi
ContigsBases CDSrRNA tmRNAtRNA
88 2,469,638 2295 8 1 58
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4824 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:10]    |    Number of Records Found: 4824 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
4501 POVK01000048.1 GCA011137195_01847 gene open 6240-7634 menE
4502 POVK01000048.1 GCA011137195_01848 gene open 7631-8620 menC
4503 POVK01000048.1 GCA011137195_01849 gene open 8596-8847 yidD
4504 POVK01000048.1 GCA011137195_01850 gene open 8905-9375 ytkD
4505 POVK01000048.1 GCA011137195_01851 gene open 9356-10126
4506 POVK01000048.1 GCA011137195_01852 gene open 10257-11840 pckA
4507 POVK01000048.1 GCA011137195_01853 gene open 12388-13587 metK
4508 POVK01000048.1 GCA011137195_01854 gene open 13677-14588
4509 POVK01000049.1 GCA011137195_01855 CDS open 158-1159 _na     333_aa Phosphate transporter
4510 POVK01000049.1 GCA011137195_01856 CDS open 1174-1791 _na     205_aa DUF47 domain-containing protein
4511 POVK01000049.1 GCA011137195_01857 CDS open 2476-4374 _na     632_aa ABC3 transporter permease C-terminal domain-containing protein
4512 POVK01000049.1 GCA011137195_01858 CDS open 4364-5125 _na     253_aa ABC transporter domain-containing protein
4513 POVK01000049.1 GCA011137195_01859 CDS open 5230-6252 _na     340_aa histidine kinase
4514 POVK01000049.1 GCA011137195_01860 CDS open 6239-6919 _na     226_aa graR Response regulator protein GraR
4515 POVK01000049.1 GCA011137195_01861 CDS open 6925-7845 _na     306_aa NAD(P)-binding domain-containing protein
4516 POVK01000049.1 GCA011137195_01862 CDS open 7991-8518 _na     175_aa N-acetyltransferase domain-containing protein
4517 POVK01000049.1 GCA011137195_01863 CDS open 8679-9704 _na     341_aa BD-FAE-like domain-containing protein
4518 POVK01000049.1 GCA011137195_01864 CDS open 9747-10814 _na     355_aa Branched-chain amino acid transport system II carrier protein
4519 POVK01000049.1 GCA011137195_01855 gene open 158-1159
4520 POVK01000049.1 GCA011137195_01856 gene open 1174-1791
4521 POVK01000049.1 GCA011137195_01857 gene open 2476-4374
4522 POVK01000049.1 GCA011137195_01858 gene open 4364-5125
4523 POVK01000049.1 GCA011137195_01859 gene open 5230-6252
4524 POVK01000049.1 GCA011137195_01860 gene open 6239-6919 graR
4525 POVK01000049.1 GCA011137195_01861 gene open 6925-7845
4526 POVK01000049.1 GCA011137195_01862 gene open 7991-8518
4527 POVK01000049.1 GCA011137195_01863 gene open 8679-9704
4528 POVK01000049.1 GCA011137195_01864 gene open 9747-10814
4529 POVK01000050.1 GCA011137195_01944 CDS open 146-1294 _na     382_aa dltD D-alanyl-lipoteichoic acid biosynthesis protein DltD
4530 POVK01000050.1 GCA011137195_01945 CDS open 1291-1527 _na     78_aa dltC D-alanine--poly(phosphoribitol) ligase subunit DltC
4531 POVK01000050.1 GCA011137195_01946 CDS open 1561-2778 _na     405_aa dltB D-alanyl-lipoteichoic acid biosynthesis protein DltB
4532 POVK01000050.1 GCA011137195_01947 CDS open 2775-4229 _na     484_aa dltA D-alanine--poly(phosphoribitol) ligase subunit DltA
4533 POVK01000050.1 GCA011137195_01948 CDS open 4713-6236 _na     507_aa 2%2C3-cyclic-nucleotide 2-phosphodiesterase
4534 POVK01000050.1 GCA011137195_01949 CDS open 6370-9510 _na     1046_aa Antiadhesin Pls
4535 POVK01000050.1 GCA011137195_01950 CDS open 9923-10525 _na     200_aa CAAX amino terminal protease
4536 POVK01000050.1 GCA011137195_01951 CDS open 10532-10717 _na     61_aa DUF2187 domain-containing protein
4537 POVK01000050.1 GCA011137195_01952 CDS open 10907-11899 _na     330_aa lipoate--protein ligase
4538 POVK01000050.1 GCA011137195_01953 CDS open 11970-12188 _na     72_aa IDEAL domain-containing protein
4539 POVK01000050.1 GCA011137195_01954 CDS open 12427-12789 _na     120_aa Competence transcription factor
4540 POVK01000050.1 GCA011137195_01944 gene open 146-1294 dltD
4541 POVK01000050.1 GCA011137195_01945 gene open 1291-1527 dltC
4542 POVK01000050.1 GCA011137195_01946 gene open 1561-2778 dltB
4543 POVK01000050.1 GCA011137195_01947 gene open 2775-4229 dltA
4544 POVK01000050.1 GCA011137195_01948 gene open 4713-6236
4545 POVK01000050.1 GCA011137195_01949 gene open 6370-9510
4546 POVK01000050.1 GCA011137195_01950 gene open 9923-10525
4547 POVK01000050.1 GCA011137195_01951 gene open 10532-10717
4548 POVK01000050.1 GCA011137195_01952 gene open 10907-11899
4549 POVK01000050.1 GCA011137195_01953 gene open 11970-12188
4550 POVK01000050.1 GCA011137195_01954 gene open 12427-12789
4551 POVK01000050.1 GCA011137195_01955 gene open 13369-13443 trnN
4552 POVK01000050.1 GCA011137195_01956 gene open 13445-13533 trnS
4553 POVK01000050.1 GCA011137195_01955 tRNA open 13369-13443 trnN tRNA-Asn(gtt)
4554 POVK01000050.1 GCA011137195_01956 tRNA open 13445-13533 trnS tRNA-Ser(gct)
4555 POVK01000051.1 GCA011137195_01957 CDS open 99-416 _na     105_aa mspA membrane stabilizing protein MspA
4556 POVK01000051.1 GCA011137195_01958 CDS open 462-629 _na     55_aa SE1832 family protein
4557 POVK01000051.1 GCA011137195_01959 CDS open 748-1656 _na     302_aa Auxin efflux carrier
4558 POVK01000051.1 GCA011137195_01960 CDS open 1807-2667 _na     286_aa N-acetyltransferase domain-containing protein
4559 POVK01000051.1 GCA011137195_01961 CDS open 2952-5084 _na     710_aa DNA topoisomerase 3
4560 POVK01000051.1 GCA011137195_01962 CDS open 5203-6537 _na     444_aa pbuG Guanine/hypoxanthine permease pbuG
4561 POVK01000051.1 GCA011137195_01963 CDS open 6690-7088 _na     132_aa Integral membrane protein
4562 POVK01000051.1 GCA011137195_01964 CDS open 7554-7862 _na     102_aa rpsJ_Y58D 30S ribosomal protein S10
4563 POVK01000051.1 GCA011137195_01965 CDS open 7890-8549 _na     219_aa rplC 50S ribosomal protein L3
4564 POVK01000051.1 GCA011137195_01966 CDS open 8576-9199 _na     207_aa rplD 50S ribosomal protein L4
4565 POVK01000051.1 GCA011137195_01967 CDS open 9199-9474 _na     91_aa rplW 50S ribosomal protein L23
4566 POVK01000051.1 GCA011137195_01968 CDS open 9503-10336 _na     277_aa rplB 50S ribosomal protein L2
4567 POVK01000051.1 GCA011137195_01969 CDS open 10401-10679 _na     92_aa rpsS 30S ribosomal protein S19
4568 POVK01000051.1 GCA011137195_01970 CDS open 10712-11065 _na     117_aa rplV 50S ribosomal protein L22
4569 POVK01000051.1 GCA011137195_01971 CDS open 11089-11742 _na     217_aa rpsC 30S ribosomal protein S3
4570 POVK01000051.1 GCA011137195_01972 CDS open 11745-12179 _na     144_aa rplP 50S ribosomal protein L16
4571 POVK01000051.1 GCA011137195_01973 CDS open 12169-12378 _na     69_aa rpmC 50S ribosomal protein L29
4572 POVK01000051.1 GCA011137195_01974 CDS open 12403-12666 _na     87_aa rpsQ 30S ribosomal protein S17
4573 POVK01000051.1 GCA011137195_01975 CDS open 12698-13066 _na     122_aa rplN 50S ribosomal protein L14
4574 POVK01000051.1 GCA011137195_01976 CDS open 13109-13426 _na     105_aa rplX 50S ribosomal protein L24
4575 POVK01000051.1 GCA011137195_01957 gene open 99-416 mspA
4576 POVK01000051.1 GCA011137195_01958 gene open 462-629
4577 POVK01000051.1 GCA011137195_01959 gene open 748-1656
4578 POVK01000051.1 GCA011137195_01960 gene open 1807-2667
4579 POVK01000051.1 GCA011137195_01961 gene open 2952-5084
4580 POVK01000051.1 GCA011137195_01962 gene open 5203-6537 pbuG
4581 POVK01000051.1 GCA011137195_01963 gene open 6690-7088
4582 POVK01000051.1 GCA011137195_01964 gene open 7554-7862 rpsJ_Y58D
4583 POVK01000051.1 GCA011137195_01965 gene open 7890-8549 rplC
4584 POVK01000051.1 GCA011137195_01966 gene open 8576-9199 rplD
4585 POVK01000051.1 GCA011137195_01967 gene open 9199-9474 rplW
4586 POVK01000051.1 GCA011137195_01968 gene open 9503-10336 rplB
4587 POVK01000051.1 GCA011137195_01969 gene open 10401-10679 rpsS
4588 POVK01000051.1 GCA011137195_01970 gene open 10712-11065 rplV
4589 POVK01000051.1 GCA011137195_01971 gene open 11089-11742 rpsC
4590 POVK01000051.1 GCA011137195_01972 gene open 11745-12179 rplP
4591 POVK01000051.1 GCA011137195_01973 gene open 12169-12378 rpmC
4592 POVK01000051.1 GCA011137195_01974 gene open 12403-12666 rpsQ
4593 POVK01000051.1 GCA011137195_01975 gene open 12698-13066 rplN
4594 POVK01000051.1 GCA011137195_01976 gene open 13109-13426 rplX
4595 POVK01000052.1 regulatory_region open 11968-12026 Ribosomal protein L13 leader
4596 POVK01000052.1 GCA011137195_01977 CDS open 111-650 _na     179_aa rplE 50S ribosomal protein L5
4597 POVK01000052.1 GCA011137195_01978 CDS open 672-857 _na     61_aa rpsZ type Z 30S ribosomal protein S14
4598 POVK01000052.1 GCA011137195_01979 CDS open 889-1287 _na     132_aa rpsH 30S ribosomal protein S8
4599 POVK01000052.1 GCA011137195_01980 CDS open 1316-1852 _na     178_aa rplF 50S ribosomal protein L6
4600 POVK01000052.1 GCA011137195_01981 CDS open 1883-2242 _na     119_aa rplR 50S ribosomal protein L18
4601 POVK01000052.1 GCA011137195_01982 CDS open 2266-2766 _na     166_aa rpsE 30S ribosomal protein S5
4602 POVK01000052.1 GCA011137195_01983 CDS open 2783-2962 _na     59_aa rpmD 50S ribosomal protein L30
4603 POVK01000052.1 GCA011137195_01984 CDS open 2979-3419 _na     146_aa rplO 50S ribosomal protein L15
4604 POVK01000052.1 GCA011137195_01985 CDS open 3419-4711 _na     430_aa secY preprotein translocase subunit SecY
4605 POVK01000052.1 GCA011137195_01986 CDS open 4729-5379 _na     216_aa adenylate kinase
4606 POVK01000052.1 GCA011137195_01987 CDS open 5538-5756 _na     72_aa infA translation initiation factor IF-1
4607 POVK01000052.1 GCA011137195_01988 CDS open 5788-5901 _na     37_aa rpmJ 50S ribosomal protein L36
4608 POVK01000052.1 GCA011137195_01989 CDS open 5925-6290 _na     121_aa rpsM 30S ribosomal protein S13
4609 POVK01000052.1 GCA011137195_01990 CDS open 6315-6704 _na     129_aa rpsK 30S ribosomal protein S11
4610 POVK01000052.1 GCA011137195_01991 CDS open 6780-7724 _na     314_aa rpoA DNA-directed RNA polymerase subunit alpha
4611 POVK01000052.1 GCA011137195_01992 CDS open 7741-8109 _na     122_aa rplQ 50S ribosomal protein L17
4612 POVK01000052.1 GCA011137195_01993 CDS open 8628-9437 _na     269_aa energy-coupling factor transporter ATPase
4613 POVK01000052.1 GCA011137195_01994 CDS open 9434-10300 _na     288_aa energy-coupling factor transporter ATPase
4614 POVK01000052.1 GCA011137195_01995 CDS open 10290-11093 _na     267_aa ecfT Energy-coupling factor transporter transmembrane protein EcfT
4615 POVK01000052.1 GCA011137195_01996 CDS open 11114-11917 _na     267_aa truA tRNA pseudouridine(38-40) synthase TruA
4616 POVK01000052.1 GCA011137195_01997 CDS open 12133-12570 _na     145_aa rplM 50S ribosomal protein L13
4617 POVK01000052.1 GCA011137195_01998 CDS open 12590-12982 _na     130_aa rpsI 30S ribosomal protein S9
4618 POVK01000052.1 GCA011137195_01977 gene open 111-650 rplE
4619 POVK01000052.1 GCA011137195_01978 gene open 672-857 rpsZ
4620 POVK01000052.1 GCA011137195_01979 gene open 889-1287 rpsH
4621 POVK01000052.1 GCA011137195_01980 gene open 1316-1852 rplF
4622 POVK01000052.1 GCA011137195_01981 gene open 1883-2242 rplR
4623 POVK01000052.1 GCA011137195_01982 gene open 2266-2766 rpsE
4624 POVK01000052.1 GCA011137195_01983 gene open 2783-2962 rpmD
4625 POVK01000052.1 GCA011137195_01984 gene open 2979-3419 rplO
4626 POVK01000052.1 GCA011137195_01985 gene open 3419-4711 secY
4627 POVK01000052.1 GCA011137195_01986 gene open 4729-5379
4628 POVK01000052.1 GCA011137195_01987 gene open 5538-5756 infA
4629 POVK01000052.1 GCA011137195_01988 gene open 5788-5901 rpmJ
4630 POVK01000052.1 GCA011137195_01989 gene open 5925-6290 rpsM
4631 POVK01000052.1 GCA011137195_01990 gene open 6315-6704 rpsK
4632 POVK01000052.1 GCA011137195_01991 gene open 6780-7724 rpoA
4633 POVK01000052.1 GCA011137195_01992 gene open 7741-8109 rplQ
4634 POVK01000052.1 GCA011137195_01993 gene open 8628-9437
4635 POVK01000052.1 GCA011137195_01994 gene open 9434-10300
4636 POVK01000052.1 GCA011137195_01995 gene open 10290-11093 ecfT
4637 POVK01000052.1 GCA011137195_01996 gene open 11114-11917 truA
4638 POVK01000052.1 GCA011137195_01997 gene open 12133-12570 rplM
4639 POVK01000052.1 GCA011137195_01998 gene open 12590-12982 rpsI
4640 POVK01000053.1 GCA011137195_02013 gene open 11359-11416 sau-5949
4641 POVK01000053.1 GCA011137195_02013 ncRNA open 11359-11416 Staphylococcus sRNA sau-5949
4642 POVK01000053.1 GCA011137195_01999 CDS open 268-951 _na     227_aa rutF Flavin reductase like domain-containing protein
4643 POVK01000053.1 GCA011137195_02000 CDS open 1234-1842 _na     202_aa 6-phospho 3-hexuloisomerase
4644 POVK01000053.1 GCA011137195_02001 CDS open 1784-2422 _na     212_aa 3-hexulose-6-phosphate synthase
4645 POVK01000053.1 GCA011137195_02002 CDS open 2533-3255 _na     240_aa nagB glucosamine-6-phosphate deaminase
4646 POVK01000053.1 GCA011137195_02003 CDS open 3265-3936 _na     223_aa Putative N-acetylmannosamine-6-phosphate 2-epimerase
4647 POVK01000053.1 GCA011137195_02004 CDS open 4348-5193 _na     281_aa SIS domain-containing protein
4648 POVK01000053.1 GCA011137195_02005 CDS open 5264-5632 _na     122_aa DUF1806 domain-containing protein
4649 POVK01000053.1 GCA011137195_02006 CDS open 5651-6328 _na     225_aa bshB2 bacillithiol biosynthesis deacetylase BshB2
4650 POVK01000053.1 GCA011137195_02007 CDS open 6376-7257 _na     293_aa folE2 GTP cyclohydrolase FolE2
4651 POVK01000053.1 GCA011137195_02008 CDS open 7561-8427 _na     288_aa Cof-like hydrolase
4652 POVK01000053.1 GCA011137195_02009 CDS open 8652-9131 _na     159_aa tadA tRNA adenosine(34) deaminase TadA
4653 POVK01000053.1 GCA011137195_02010 CDS open 9202-9810 _na     202_aa Deoxynucleoside kinase
4654 POVK01000053.1 GCA011137195_02011 CDS open 9812-10477 _na     221_aa DeoxyadenosIne kinase
4655 POVK01000053.1 GCA011137195_02012 CDS open 10543-11253 _na     236_aa HAD hydrolase%2C family IA
4656 POVK01000053.1 GCA011137195_01999 gene open 268-951 rutF
4657 POVK01000053.1 GCA011137195_02000 gene open 1234-1842
4658 POVK01000053.1 GCA011137195_02001 gene open 1784-2422
4659 POVK01000053.1 GCA011137195_02002 gene open 2533-3255 nagB
4660 POVK01000053.1 GCA011137195_02003 gene open 3265-3936
4661 POVK01000053.1 GCA011137195_02004 gene open 4348-5193
4662 POVK01000053.1 GCA011137195_02005 gene open 5264-5632
4663 POVK01000053.1 GCA011137195_02006 gene open 5651-6328 bshB2
4664 POVK01000053.1 GCA011137195_02007 gene open 6376-7257 folE2
4665 POVK01000053.1 GCA011137195_02008 gene open 7561-8427
4666 POVK01000053.1 GCA011137195_02009 gene open 8652-9131 tadA
4667 POVK01000053.1 GCA011137195_02010 gene open 9202-9810
4668 POVK01000053.1 GCA011137195_02011 gene open 9812-10477
4669 POVK01000053.1 GCA011137195_02012 gene open 10543-11253
4670 POVK01000054.1 GCA011137195_02014 CDS open 160-1341 _na     393_aa ltaA lipoteichoic acid biosynthesis MFS flippase LtaA
4671 POVK01000054.1 GCA011137195_02015 CDS open 1319-2494 _na     391_aa diglucosyl diacylglycerol synthase
4672 POVK01000054.1 GCA011137195_02016 CDS open 3044-4528 _na     494_aa UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L-lysine ligase
4673 POVK01000054.1 GCA011137195_02017 CDS open 4518-4757 _na     79_aa YueH-like protein
4674 POVK01000054.1 GCA011137195_02018 CDS open 4775-6337 _na     520_aa prfC peptide chain release factor 3
4675 POVK01000054.1 GCA011137195_02019 CDS open 6718-7521 _na     267_aa ykoY YkoY family integral membrane protein
4676 POVK01000054.1 GCA011137195_02020 CDS open 7774-9438 _na     554_aa Serine protease HtrA-like
4677 POVK01000054.1 GCA011137195_02021 CDS open 9450-10814 _na     454_aa trkH TrkH family potassium uptake protein
4678 POVK01000054.1 GCA011137195_02014 gene open 160-1341 ltaA
4679 POVK01000054.1 GCA011137195_02015 gene open 1319-2494
4680 POVK01000054.1 GCA011137195_02016 gene open 3044-4528
4681 POVK01000054.1 GCA011137195_02017 gene open 4518-4757
4682 POVK01000054.1 GCA011137195_02018 gene open 4775-6337 prfC
4683 POVK01000054.1 GCA011137195_02019 gene open 6718-7521 ykoY
4684 POVK01000054.1 GCA011137195_02020 gene open 7774-9438
4685 POVK01000054.1 GCA011137195_02021 gene open 9450-10814 trkH
4686 POVK01000055.1 GCA011137195_02026 gene open 4288-4557 Bacteria_large_SRP
4687 POVK01000055.1 GCA011137195_02027 gene open 4406-4505 Bacteria_small_SRP
4688 POVK01000055.1 GCA011137195_02026 ncRNA open 4288-4557 Bacterial large signal recognition particle RNA
4689 POVK01000055.1 GCA011137195_02027 ncRNA open 4406-4505 Bacterial small signal recognition particle RNA
4690 POVK01000055.1 GCA011137195_02022 CDS open 343-1785 _na     480_aa treB PTS trehalose transporter subunit IIBC
4691 POVK01000055.1 GCA011137195_02023 CDS open 1772-3451 _na     559_aa Alpha%2Calpha-phosphotrehalase
4692 POVK01000055.1 GCA011137195_02024 CDS open 3464-4195 _na     243_aa treR trehalose operon repressor
4693 POVK01000055.1 GCA011137195_02025 CDS open 4192-4296 _na     34_aa hypothetical protein
4694 POVK01000055.1 GCA011137195_02028 CDS open 4659-5192 _na     177_aa N-acetyltransferase domain-containing protein
4695 POVK01000055.1 GCA011137195_02029 CDS open 5259-6947 _na     562_aa dnaX DNA polymerase III subunit gamma/tau
4696 POVK01000055.1 GCA011137195_02030 CDS open 7161-7481 _na     106_aa YbaB/EbfC family nucleoid-associated protein
4697 POVK01000055.1 GCA011137195_02031 CDS open 7483-8079 _na     198_aa recR recombination mediator RecR
4698 POVK01000055.1 GCA011137195_02022 gene open 343-1785 treB
4699 POVK01000055.1 GCA011137195_02023 gene open 1772-3451
4700 POVK01000055.1 GCA011137195_02024 gene open 3464-4195 treR
4701 POVK01000055.1 GCA011137195_02025 gene open 4192-4296
4702 POVK01000055.1 GCA011137195_02028 gene open 4659-5192
4703 POVK01000055.1 GCA011137195_02029 gene open 5259-6947 dnaX
4704 POVK01000055.1 GCA011137195_02030 gene open 7161-7481
4705 POVK01000055.1 GCA011137195_02031 gene open 7483-8079 recR
4706 POVK01000056.1 GCA011137195_02032 gene open 13-238 tsr24
4707 POVK01000056.1 GCA011137195_02032 ncRNA open 13-238 S. aureus tsr24 small RNA
4708 POVK01000056.1 regulatory_region open 8593-8807 glmS glucosamine-6-phosphate activated ribozyme aptamer
4709 POVK01000056.1 GCA011137195_02033 CDS open 332-730 _na     132_aa DUF393 domain-containing protein
4710 POVK01000056.1 GCA011137195_02034 CDS open 934-2295 _na     453_aa EVE domain-containing protein
4711 POVK01000056.1 GCA011137195_02035 CDS open 2376-2615 _na     79_aa Holin
4712 POVK01000056.1 GCA011137195_02036 CDS open 2631-3569 _na     312_aa manA mannose-6-phosphate isomerase%2C class I
4713 POVK01000056.1 GCA011137195_02037 CDS open 3778-4482 _na     234_aa HTH gntR-type domain-containing protein
4714 POVK01000056.1 GCA011137195_02038 CDS open 4666-5568 _na     300_aa Glycerophosphoryl diester phosphodiesterase membrane domain-containing protein
4715 POVK01000056.1 GCA011137195_02039 CDS open 5619-6491 _na     290_aa Cof-like hydrolase
4716 POVK01000056.1 GCA011137195_02040 CDS open 6664-8466 _na     600_aa glmS glutamine--fructose-6-phosphate transaminase (isomerizing)
4717 POVK01000056.1 GCA011137195_02033 gene open 332-730
4718 POVK01000056.1 GCA011137195_02034 gene open 934-2295
4719 POVK01000056.1 GCA011137195_02035 gene open 2376-2615
4720 POVK01000056.1 GCA011137195_02036 gene open 2631-3569 manA
4721 POVK01000056.1 GCA011137195_02037 gene open 3778-4482
4722 POVK01000056.1 GCA011137195_02038 gene open 4666-5568
4723 POVK01000056.1 GCA011137195_02039 gene open 5619-6491
4724 POVK01000056.1 GCA011137195_02040 gene open 6664-8466 glmS
4725 POVK01000057.1 GCA011137195_02041 CDS open 580-1521 _na     313_aa Beta-channel forming cytolysin
4726 POVK01000057.1 GCA011137195_02042 CDS open 1524-2501 _na     325_aa Beta-channel forming cytolysin
4727 POVK01000057.1 GCA011137195_02043 CDS open 3447-4382 _na     311_aa LukS-PV
4728 POVK01000057.1 GCA011137195_02044 CDS open 4391-5368 _na     325_aa Beta-channel forming cytolysin
4729 POVK01000057.1 GCA011137195_02045 CDS open 5725-5862 _na     45_aa Beta-class phenol-soluble modulin
4730 POVK01000057.1 GCA011137195_02046 CDS open 6170-7234 _na     354_aa ulaG L-ascorbate 6-phosphate lactonase
4731 POVK01000057.1 GCA011137195_02047 CDS open 7812-9317 _na     501_aa Staphylocoagulase N-terminal subdomain 1 domain-containing protein
4732 POVK01000057.1 GCA011137195_02041 gene open 580-1521
4733 POVK01000057.1 GCA011137195_02042 gene open 1524-2501
4734 POVK01000057.1 GCA011137195_02043 gene open 3447-4382
4735 POVK01000057.1 GCA011137195_02044 gene open 4391-5368
4736 POVK01000057.1 GCA011137195_02045 gene open 5725-5862
4737 POVK01000057.1 GCA011137195_02046 gene open 6170-7234 ulaG
4738 POVK01000057.1 GCA011137195_02047 gene open 7812-9317
4739 POVK01000058.1 GCA011137195_02048 CDS open 53-517 _na     154_aa hypothetical protein
4740 POVK01000058.1 GCA011137195_02049 CDS open 648-2576 _na     642_aa Integral membrane bound transporter domain-containing protein
4741 POVK01000058.1 GCA011137195_02050 CDS open 2732-4132 _na     466_aa HTH gntR-type domain-containing protein
4742 POVK01000058.1 GCA011137195_02051 CDS open 4241-5128 _na     295_aa pdxS pyridoxal 5'-phosphate synthase subunit PdxS
4743 POVK01000058.1 GCA011137195_02052 CDS open 5130-5714 _na     194_aa pdxT pyridoxal 5'-phosphate synthase glutaminase subunit PdxT
4744 POVK01000058.1 GCA011137195_02048 gene open 53-517
4745 POVK01000058.1 GCA011137195_02049 gene open 648-2576
4746 POVK01000058.1 GCA011137195_02050 gene open 2732-4132
4747 POVK01000058.1 GCA011137195_02051 gene open 4241-5128 pdxS
4748 POVK01000058.1 GCA011137195_02052 gene open 5130-5714 pdxT
4749 POVK01000059.1 GCA011137195_02053 gene open 1-764 rrs
4750 POVK01000059.1 GCA011137195_02053 rRNA open 1-764 rrs 16S ribosomal RNA
4751 POVK01000060.1 GCA011137195_02127 gene open 40-97 sau-5949
4752 POVK01000060.1 GCA011137195_02127 ncRNA open 40-97 Staphylococcus sRNA sau-5949
4753 POVK01000060.1 GCA011137195_02128 CDS open 348-1034 _na     228_aa 2%2C3-diphosphoglycerate-dependent phosphoglycerate mutase
4754 POVK01000060.1 GCA011137195_02129 CDS open 1854-2807 _na     317_aa HTH lacI-type domain-containing protein
4755 POVK01000060.1 GCA011137195_02130 CDS open 2889-4130 _na     413_aa Aminotransferase class-V family protein
4756 POVK01000060.1 GCA011137195_02131 CDS open 4127-4939 _na     270_aa HAD hydrolase%2C family IIB
4757 POVK01000060.1 GCA011137195_02132 CDS open 4932-5978 _na     348_aa Gfo/Idh/MocA-like oxidoreductase N-terminal domain-containing protein
4758 POVK01000060.1 GCA011137195_02133 CDS open 5975-7102 _na     375_aa Major facilitator superfamily (MFS) profile domain-containing protein
4759 POVK01000060.1 GCA011137195_02128 gene open 348-1034
4760 POVK01000060.1 GCA011137195_02129 gene open 1854-2807
4761 POVK01000060.1 GCA011137195_02130 gene open 2889-4130
4762 POVK01000060.1 GCA011137195_02131 gene open 4127-4939
4763 POVK01000060.1 GCA011137195_02132 gene open 4932-5978
4764 POVK01000060.1 GCA011137195_02133 gene open 5975-7102
4765 POVK01000061.1 regulatory_region open 1358-1466 SAM riboswitch aptamer (S box leader)
4766 POVK01000061.1 GCA011137195_02134 CDS open 75-1259 _na     394_aa Peptidase M20 domain-containing protein 2
4767 POVK01000061.1 GCA011137195_02135 CDS open 1645-2121 _na     158_aa S-ribosylhomocysteine lyase
4768 POVK01000061.1 GCA011137195_02136 CDS open 2246-2599 _na     117_aa doxX DoxX family protein
4769 POVK01000061.1 GCA011137195_02137 CDS open 2611-3912 _na     433_aa pyrimidine-nucleoside phosphorylase
4770 POVK01000061.1 GCA011137195_02138 CDS open 4174-4887 _na     237_aa deoD purine-nucleoside phosphorylase
4771 POVK01000061.1 GCA011137195_02134 gene open 75-1259
4772 POVK01000061.1 GCA011137195_02135 gene open 1645-2121
4773 POVK01000061.1 GCA011137195_02136 gene open 2246-2599 doxX
4774 POVK01000061.1 GCA011137195_02137 gene open 2611-3912
4775 POVK01000061.1 GCA011137195_02138 gene open 4174-4887 deoD
4776 POVK01000062.1 GCA011137195_02140 gene open 787-972 rli28
4777 POVK01000062.1 GCA011137195_02143 gene open 3197-3254 sau-5949
4778 POVK01000062.1 GCA011137195_02140 ncRNA open 787-972 Listeria sRNA rli28
4779 POVK01000062.1 GCA011137195_02143 ncRNA open 3197-3254 Staphylococcus sRNA sau-5949
4780 POVK01000062.1 GCA011137195_02139 CDS open 756-860 _na     34_aa Holin-like toxin
4781 POVK01000062.1 GCA011137195_02141 CDS open 1504-1665 _na     53_aa hypothetical protein
4782 POVK01000062.1 GCA011137195_02142 CDS open 2019-2417 _na     132_aa Phage protein
4783 POVK01000062.1 GCA011137195_02139 gene open 756-860
4784 POVK01000062.1 GCA011137195_02141 gene open 1504-1665
4785 POVK01000062.1 GCA011137195_02142 gene open 2019-2417
4786 POVK01000064.1 repeat_region open 361-604 CRISPR array with 4 repeats of length 36%2C consensus sequence GTATCATTTATACCTAAAATTACAGAGTACTAAAAC and spacer length 30
4787 POVK01000064.1 GCA011137195_02144 CDS open 770-1780 _na     336_aa hypothetical protein
4788 POVK01000064.1 GCA011137195_02145 CDS open 1793-2092 _na     99_aa cas2 CRISPR-associated endonuclease Cas2
4789 POVK01000064.1 GCA011137195_02146 CDS open 2106-2612 _na     168_aa cas1 type II CRISPR-associated endonuclease Cas1
4790 POVK01000064.1 GCA011137195_02144 gene open 770-1780
4791 POVK01000064.1 GCA011137195_02145 gene open 1793-2092 cas2
4792 POVK01000064.1 GCA011137195_02146 gene open 2106-2612 cas1
4793 POVK01000065.1 GCA011137195_02147 CDS open 117-764 _na     215_aa ISL3 family transposase
4794 POVK01000065.1 GCA011137195_02147 gene open 117-764
4795 POVK01000067.1 GCA011137195_02148 CDS open 194-1285 _na     363_aa bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase
4796 POVK01000067.1 GCA011137195_02148 gene open 194-1285
4797 POVK01000069.1 GCA011137195_02149 gene open 206-320 rrf
4798 POVK01000069.1 GCA011137195_02149 rRNA open 206-320 rrf 5S ribosomal RNA
4799 POVK01000070.1 GCA011137195_02227 CDS open 61-294 _na     77_aa IS1181 transposase
4800 POVK01000070.1 GCA011137195_02227 gene open 61-294
4801 POVK01000071.1 GCA011137195_02228 CDS open 186-317 _na     43_aa Phage protein
4802 POVK01000071.1 GCA011137195_02229 CDS open 401-877 _na     158_aa DUF4930 domain-containing protein
4803 POVK01000071.1 GCA011137195_02230 CDS open 1050-1211 _na     53_aa hypothetical protein
4804 POVK01000071.1 GCA011137195_02228 gene open 186-317
4805 POVK01000071.1 GCA011137195_02229 gene open 401-877
4806 POVK01000071.1 GCA011137195_02230 gene open 1050-1211
4807 POVK01000073.1 GCA011137195_02231 CDS open 272-814 _na     180_aa hypothetical protein
4808 POVK01000073.1 GCA011137195_02231 gene open 272-814
4809 POVK01000074.1 GCA011137195_02232 gene open 86-160 trnN
4810 POVK01000074.1 GCA011137195_02233 gene open 162-236 trnE
4811 POVK01000074.1 GCA011137195_02234 gene open 245-318 trnD
4812 POVK01000074.1 GCA011137195_02232 tRNA open 86-160 trnN tRNA-Asn(gtt)
4813 POVK01000074.1 GCA011137195_02233 tRNA open 162-236 trnE tRNA-Glu(ttc)
4814 POVK01000074.1 GCA011137195_02234 tRNA open 245-318 trnD tRNA-Asp(gtc)
4815 POVK01000077.1 GCA011137195_02235 gene open 257-371 rrf
4816 POVK01000077.1 GCA011137195_02235 rRNA open 257-371 rrf 5S ribosomal RNA
4817 POVK01000078.1 GCA011137195_02304 gene open 167-243 trnI
4818 POVK01000078.1 GCA011137195_02305 gene open 280-355 trnA
4819 POVK01000078.1 GCA011137195_02304 tRNA open 167-243 trnI tRNA-Ile(gat)
4820 POVK01000078.1 GCA011137195_02305 tRNA open 280-355 trnA tRNA-Ala(tgc)
4821 POVK01000081.1 GCA011137195_02306 gene open 254-330 trnI
4822 POVK01000081.1 GCA011137195_02306 tRNA open 254-330 trnI tRNA-Ile(gat)
4823 POVK01000083.1 GCA011137195_02307 gene open 174-231 sau-5949
4824 POVK01000083.1 GCA011137195_02307 ncRNA open 174-231 Staphylococcus sRNA sau-5949