HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Streptococcus mutans (GCA_012641625.1)

Select a Genome:
BAKTA Annotations for GCA_012641625.1
Genome Selected: Streptococcus mutans
ContigsBases CDSrRNA tmRNAtRNA
19 1,964,397 1848 6 1 44
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3834 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:3]    |    Number of Records Found: 3834 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1001 RXZD01000001.1 GCA012641625_00482 gene open 400985-402643 recN
1002 RXZD01000001.1 GCA012641625_00483 gene open 402660-403124 argR
1003 RXZD01000001.1 GCA012641625_00484 gene open 403111-403938 yqxC
1004 RXZD01000001.1 GCA012641625_00485 gene open 403931-404800 ispA
1005 RXZD01000001.1 GCA012641625_00486 gene open 404797-405018 xseB
1006 RXZD01000001.1 GCA012641625_00487 gene open 404993-406336 xseA
1007 RXZD01000001.1 GCA012641625_00488 gene open 406780-408522 lytS
1008 RXZD01000001.1 GCA012641625_00489 gene open 408503-409237 lytR
1009 RXZD01000001.1 GCA012641625_00490 gene open 409413-409880 lrgA
1010 RXZD01000001.1 GCA012641625_00491 gene open 409882-410613 lrgB
1011 RXZD01000001.1 GCA012641625_00492 gene open 410938-411771 nnr2
1012 RXZD01000001.1 GCA012641625_00493 gene open 411768-412622 folD
1013 RXZD01000001.1 GCA012641625_00494 gene open 412743-412889
1014 RXZD01000001.1 GCA012641625_00495 gene open 412908-415058 feoB
1015 RXZD01000001.1 GCA012641625_00496 gene open 415055-415531 feoA
1016 RXZD01000001.1 GCA012641625_00497 gene open 415724-416458 glnQ
1017 RXZD01000001.1 GCA012641625_00498 gene open 416458-417144 hisM
1018 RXZD01000001.1 GCA012641625_00499 gene open 417357-417587 ykuJ
1019 RXZD01000001.1 GCA012641625_00500 gene open 417664-418644 argF
1020 RXZD01000001.1 GCA012641625_00501 gene open 418901-421162 clpE
1021 RXZD01000001.1 GCA012641625_00502 gene open 421273-421728 mutT
1022 RXZD01000001.1 GCA012641625_00503 gene open 421803-422105
1023 RXZD01000001.1 GCA012641625_00504 gene open 422880-425672 ileS
1024 RXZD01000001.1 GCA012641625_00505 gene open 426164-426979 divIVA
1025 RXZD01000001.1 GCA012641625_00506 gene open 426990-427781 ylmH
1026 RXZD01000001.1 GCA012641625_00507 gene open 427785-428045 yggT
1027 RXZD01000001.1 GCA012641625_00508 gene open 428045-428620 sepF
1028 RXZD01000001.1 GCA012641625_00509 gene open 428634-429305 yggS
1029 RXZD01000001.1 GCA012641625_00510 gene open 429308-430612 ftsZ
1030 RXZD01000001.1 GCA012641625_00511 gene open 430636-431997 ftsA
1031 RXZD01000001.1 GCA012641625_00512 gene open 432149-433273 ftsQ
1032 RXZD01000001.1 GCA012641625_00513 gene open 433273-434358 murG
1033 RXZD01000001.1 GCA012641625_00514 gene open 434361-435716 murD
1034 RXZD01000001.1 GCA012641625_00515 gene open 435905-436159
1035 RXZD01000001.1 GCA012641625_00516 gene open 436188-438032 typA
1036 RXZD01000001.1 GCA012641625_00517 gene open 438265-438654 pspE
1037 RXZD01000001.1 GCA012641625_00518 gene open 438664-439635 nagC
1038 RXZD01000001.1 GCA012641625_00519 gene open 439628-439834 yqgQ
1039 RXZD01000001.1 GCA012641625_00520 gene open 440042-440569 dps
1040 RXZD01000001.1 GCA012641625_00521 gene open 440670-441326 gspO
1041 RXZD01000001.1 GCA012641625_00522 gene open 441563-442345 trpA
1042 RXZD01000001.1 GCA012641625_00523 gene open 442349-443560 trpB
1043 RXZD01000001.1 GCA012641625_00524 gene open 443557-444138 trpF
1044 RXZD01000001.1 GCA012641625_00525 gene open 444125-444892 trpC
1045 RXZD01000001.1 GCA012641625_00526 gene open 444885-445892 trpD
1046 RXZD01000001.1 GCA012641625_00527 gene open 445913-446476 pabA
1047 RXZD01000001.1 GCA012641625_00528 gene open 446473-447834 trpE
1048 RXZD01000001.1 GCA012641625_00529 gene open 447843-448139 pheA
1049 RXZD01000001.1 GCA012641625_00530 gene open 448826-449563
1050 RXZD01000001.1 GCA012641625_00531 gene open 449750-450031 ygiN
1051 RXZD01000001.1 GCA012641625_00532 gene open 450170-451204
1052 RXZD01000001.1 GCA012641625_00533 gene open 451501-452337 soxR
1053 RXZD01000001.1 GCA012641625_00534 gene open 452404-454146 mdlB
1054 RXZD01000001.1 GCA012641625_00535 gene open 454136-455881 mdlB
1055 RXZD01000001.1 GCA012641625_00536 gene open 456038-456574 vanZ
1056 RXZD01000001.1 GCA012641625_00537 gene open 456574-457659 rlmN
1057 RXZD01000001.1 GCA012641625_00538 gene open 457656-458204 yutD
1058 RXZD01000001.1 GCA012641625_00539 gene open 458201-459532 ushA
1059 RXZD01000001.1 GCA012641625_00540 gene open 459605-460645 sdrC
1060 RXZD01000001.1 GCA012641625_00541 gene open 460623-461123 coaD
1061 RXZD01000001.1 GCA012641625_00542 gene open 461113-461661 rsmD
1062 RXZD01000001.1 GCA012641625_00543 gene open 462236-464011
1063 RXZD01000001.1 GCA012641625_00544 gene open 464132-464698 acrR
1064 RXZD01000001.1 GCA012641625_00545 gene open 464894-465010
1065 RXZD01000001.1 GCA012641625_00546 gene open 465375-465701
1066 RXZD01000001.1 GCA012641625_00547 gene open 465742-465945
1067 RXZD01000001.1 GCA012641625_00548 gene open 466508-467143
1068 RXZD01000001.1 GCA012641625_00549 gene open 467218-468282 mmcQ
1069 RXZD01000001.1 GCA012641625_00550 gene open 468351-469175 sppA
1070 RXZD01000001.1 GCA012641625_00551 gene open 469187-469933 sppR
1071 RXZD01000001.1 GCA012641625_00552 gene open 470224-471003 dpnI
1072 RXZD01000001.1 GCA012641625_00553 gene open 471278-471835
1073 RXZD01000001.1 GCA012641625_00554 gene open 471915-473615 yvbJ
1074 RXZD01000001.1 GCA012641625_00555 gene open 473635-474729
1075 RXZD01000001.1 GCA012641625_00556 gene open 474853-475401 hpf
1076 RXZD01000001.1 GCA012641625_00557 gene open 475480-476145 comFC
1077 RXZD01000001.1 GCA012641625_00558 gene open 476142-477443 comFA
1078 RXZD01000001.1 GCA012641625_00559 gene open 477516-478145 yIH1
1079 RXZD01000001.1 GCA012641625_00560 gene open 478236-479162 cysK
1080 RXZD01000001.1 GCA012641625_00561 gene open 479498-480589 gldA
1081 RXZD01000001.1 GCA012641625_00562 gene open 480627-481295 talA
1082 RXZD01000001.1 GCA012641625_00563 gene open 481314-483770 pflD
1083 RXZD01000001.1 GCA012641625_00564 gene open 484019-484765 glpR
1084 RXZD01000001.1 GCA012641625_00565 gene open 484896-485672 pflA
1085 RXZD01000001.1 GCA012641625_00566 gene open 485751-486140 yabR
1086 RXZD01000001.1 GCA012641625_00567 gene open 486121-487536 ppiB
1087 RXZD01000001.1 GCA012641625_00568 gene open 487580-488221 citB
1088 RXZD01000001.1 GCA012641625_00569 gene open 488214-489218
1089 RXZD01000001.1 GCA012641625_00570 gene open 489215-489910 liaF
1090 RXZD01000001.1 GCA012641625_00571 gene open 490351-492201 pknB
1091 RXZD01000001.1 GCA012641625_00572 gene open 492198-492959 pTC1
1092 RXZD01000001.1 GCA012641625_00573 gene open 492980-494302 rsmB
1093 RXZD01000001.1 GCA012641625_00574 gene open 494283-495218 fmt
1094 RXZD01000001.1 GCA012641625_00575 gene open 495278-497662 priA
1095 RXZD01000001.1 GCA012641625_00576 gene open 497704-498021 rpoZ
1096 RXZD01000001.1 GCA012641625_00577 gene open 498045-498677 gmk
1097 RXZD01000001.1 GCA012641625_00578 gene open 499125-500732 rny
1098 RXZD01000001.1 GCA012641625_00579 gene open 500877-501359 luxS
1099 RXZD01000001.1 GCA012641625_00580 gene open 501520-503160
1100 RXZD01000001.1 GCA012641625_00581 gene open 503176-504330 rlmL
1101 RXZD01000001.1 GCA012641625_00583 gene open 504780-505118 gpsB
1102 RXZD01000001.1 GCA012641625_00584 gene open 505224-505745 yoqJ
1103 RXZD01000001.1 GCA012641625_00585 gene open 505825-506418 recU
1104 RXZD01000001.1 GCA012641625_00586 gene open 506519-508642 pbp1a
1105 RXZD01000001.1 GCA012641625_00587 gene open 508750-510084 pepC
1106 RXZD01000001.1 GCA012641625_00588 gene open 510197-511021 nadE
1107 RXZD01000001.1 GCA012641625_00589 gene open 511018-512478 pncB
1108 RXZD01000001.1 GCA012641625_00590 gene open 512814-513728 trxB
1109 RXZD01000001.1 GCA012641625_00591 gene open 513791-514015
1110 RXZD01000001.1 GCA012641625_00592 gene open 514064-514807 glnQ
1111 RXZD01000001.1 GCA012641625_00593 gene open 514807-515610 hisM
1112 RXZD01000001.1 GCA012641625_00594 gene open 515633-516454 hisJ
1113 RXZD01000001.1 GCA012641625_00595 gene open 516695-518038 srmB
1114 RXZD01000001.1 GCA012641625_00596 gene open 518422-519441 mraY
1115 RXZD01000001.1 GCA012641625_00597 gene open 519443-521692 pbp2X
1116 RXZD01000001.1 GCA012641625_00598 gene open 521696-522019 ftsL
1117 RXZD01000001.1 GCA012641625_00599 gene open 522029-522979 rsmH
1118 RXZD01000001.1 GCA012641625_00600 gene open 523283-524533 proA
1119 RXZD01000001.1 GCA012641625_00601 gene open 524537-525346 proB
1120 RXZD01000001.1 GCA012641625_00602 gene open 525835-526215
1121 RXZD01000001.1 GCA012641625_00603 gene open 526339-526593 ynzC
1122 RXZD01000001.1 GCA012641625_00604 gene open 526699-528738 glyS
1123 RXZD01000001.1 GCA012641625_00605 gene open 528741-529658 glyQ
1124 RXZD01000001.1 GCA012641625_00607 gene open 530109-530519
1125 RXZD01000001.1 GCA012641625_00608 gene open 530512-530970 marR
1126 RXZD01000001.1 GCA012641625_00609 gene open 530967-531383
1127 RXZD01000001.1 GCA012641625_00610 gene open 531501-532112 acrR
1128 RXZD01000001.1 GCA012641625_00611 gene open 532393-536694
1129 RXZD01000001.1 GCA012641625_00612 gene open 536828-537979 nagA
1130 RXZD01000001.1 GCA012641625_00613 gene open 538328-538726
1131 RXZD01000001.1 GCA012641625_00614 gene open 538740-539198 lytTR
1132 RXZD01000001.1 GCA012641625_00615 gene open 539212-540069
1133 RXZD01000001.1 GCA012641625_00616 gene open 540070-540939 rbbA
1134 RXZD01000001.1 GCA012641625_00617 gene open 541291-541782 ygjV
1135 RXZD01000001.1 GCA012641625_00618 gene open 541888-542709
1136 RXZD01000001.1 GCA012641625_00619 gene open 542956-543159 copZ
1137 RXZD01000001.1 GCA012641625_00620 gene open 543172-545400 zntA
1138 RXZD01000001.1 GCA012641625_00621 gene open 545397-545840 copY
1139 RXZD01000001.1 GCA012641625_00622 gene open 546231-546461
1140 RXZD01000001.1 GCA012641625_00623 gene open 546729-546998
1141 RXZD01000001.1 GCA012641625_00624 gene open 546940-547290 rbfA
1142 RXZD01000001.1 GCA012641625_00625 gene open 547524-550274 infB
1143 RXZD01000001.1 GCA012641625_00626 gene open 550295-550597 rpl7Ae
1144 RXZD01000001.1 GCA012641625_00627 gene open 550590-550886 rnpM
1145 RXZD01000001.1 GCA012641625_00628 gene open 550904-552097 nusA
1146 RXZD01000001.1 GCA012641625_00629 gene open 552133-552624 rimP
1147 RXZD01000001.1 GCA012641625_00631 gene open 552896-553531 trmB
1148 RXZD01000001.1 GCA012641625_00632 gene open 553541-554323 ccrZ
1149 RXZD01000001.1 GCA012641625_00633 gene open 554382-555416 ecsB
1150 RXZD01000001.1 GCA012641625_00634 gene open 555419-556144 rbbA
1151 RXZD01000001.1 GCA012641625_00635 gene open 556209-556628 hinT
1152 RXZD01000001.1 GCA012641625_00636 gene open 556625-556918
1153 RXZD01000001.1 GCA012641625_00637 gene open 557088-558308 brpA
1154 RXZD01000001.1 GCA012641625_00638 gene open 558637-559080 tsaE
1155 RXZD01000001.1 GCA012641625_00639 gene open 559208-560638 nCS2
1156 RXZD01000001.1 GCA012641625_00640 gene open 560708-561307
1157 RXZD01000001.1 GCA012641625_00641 gene open 561628-562428 cof
1158 RXZD01000001.1 GCA012641625_00642 gene open 562544-562951 hipB
1159 RXZD01000001.1 GCA012641625_00643 gene open 562964-563287
1160 RXZD01000001.1 GCA012641625_00644 gene open 563293-564405 dinB
1161 RXZD01000001.1 GCA012641625_00645 gene open 564628-566955 pflB
1162 RXZD01000001.1 GCA012641625_00646 gene open 567119-567559
1163 RXZD01000001.1 GCA012641625_00647 gene open 567693-568643 ampC
1164 RXZD01000001.1 GCA012641625_00648 gene open 568640-569398
1165 RXZD01000001.1 GCA012641625_00649 gene open 569571-570440 gla
1166 RXZD01000001.1 GCA012641625_00650 gene open 570555-572831 pepX
1167 RXZD01000001.1 GCA012641625_00651 gene open 573090-573389 ybaB
1168 RXZD01000001.1 GCA012641625_00652 gene open 573509-574024
1169 RXZD01000001.1 GCA012641625_00653 gene open 574159-575331 yhiN
1170 RXZD01000001.1 GCA012641625_00654 gene open 575495-575920
1171 RXZD01000001.1 GCA012641625_00655 gene open 576016-576339 azlD2
1172 RXZD01000001.1 GCA012641625_00656 gene open 576329-577027 azlC
1173 RXZD01000001.1 GCA012641625_00657 gene open 577106-578116 tsaD
1174 RXZD01000001.1 GCA012641625_00658 gene open 578131-578565 rimI
1175 RXZD01000001.1 GCA012641625_00659 gene open 578565-579251 tsaB
1176 RXZD01000001.1 GCA012641625_00660 gene open 579262-579720 marR
1177 RXZD01000001.1 GCA012641625_00661 gene open 579894-580940 wcaG
1178 RXZD01000001.1 GCA012641625_00662 gene open 581075-581929 pdxI
1179 RXZD01000001.1 GCA012641625_00663 gene open 582037-582390
1180 RXZD01000001.1 GCA012641625_00664 gene open 582447-583160
1181 RXZD01000001.1 GCA012641625_00665 gene open 583153-583998 rbbA
1182 RXZD01000001.1 GCA012641625_00666 gene open 584460-584690 rpoY
1183 RXZD01000001.1 GCA012641625_00667 gene open 584692-586374 rnjA
1184 RXZD01000001.1 GCA012641625_00668 gene open 586560-587195
1185 RXZD01000001.1 GCA012641625_00669 gene open 587343-588779 gltD
1186 RXZD01000001.1 GCA012641625_00670 gene open 588781-593298 gltB
1187 RXZD01000001.1 GCA012641625_00671 gene open 593458-594804 glnA
1188 RXZD01000001.1 GCA012641625_00672 gene open 594844-595215 soxR
1189 RXZD01000001.1 GCA012641625_00673 gene open 595297-595815 ygaE
1190 RXZD01000001.1 GCA012641625_00674 gene open 596202-597398 pgk
1191 RXZD01000001.1 GCA012641625_00675 gene open 597803-598816 gap
1192 RXZD01000001.1 GCA012641625_00676 gene open 599114-601195 fusA
1193 RXZD01000001.1 GCA012641625_00677 gene open 601364-601834 rpsG
1194 RXZD01000001.1 GCA012641625_00678 gene open 601852-602265 rpsL
1195 RXZD01000001.1 GCA012641625_00679 gene open 602525-603340 purR
1196 RXZD01000001.1 GCA012641625_00680 gene open 603408-604376 yhaM
1197 RXZD01000001.1 GCA012641625_00681 gene open 604366-605640 rmuC
1198 RXZD01000001.1 GCA012641625_00682 gene open 605644-606276 thiN
1199 RXZD01000001.1 GCA012641625_00683 gene open 606269-606928 rpe
1200 RXZD01000001.1 GCA012641625_00684 gene open 606936-607808 rsgA
1201 RXZD01000001.1 GCA012641625_00687 gene open 608353-608757
1202 RXZD01000001.1 GCA012641625_00688 gene open 608767-609642 rsmA
1203 RXZD01000001.1 GCA012641625_00689 gene open 609645-611624
1204 RXZD01000001.1 GCA012641625_00690 gene open 611958-612404 hinT
1205 RXZD01000001.1 GCA012641625_00691 gene open 612504-613118 nfnB
1206 RXZD01000001.1 GCA012641625_00692 gene open 613219-613533 hxlR
1207 RXZD01000001.1 GCA012641625_00693 gene open 613888-614349 sTE14
1208 RXZD01000001.1 GCA012641625_00694 gene open 614684-615256 rnmV
1209 RXZD01000001.1 GCA012641625_00695 gene open 615490-616389 tatD
1210 RXZD01000001.1 GCA012641625_00696 gene open 616567-616701 rpmH
1211 RXZD01000001.1 GCA012641625_00697 gene open 616923-617525
1212 RXZD01000001.1 GCA012641625_00698 gene open 617635-618603 jag
1213 RXZD01000001.1 GCA012641625_00699 gene open 618616-619431 yidC1
1214 RXZD01000001.1 GCA012641625_00700 gene open 619415-619774 rnpA
1215 RXZD01000001.1 GCA012641625_00701 gene open 619869-621251 argH
1216 RXZD01000001.1 GCA012641625_00702 gene open 621594-622784 argG
1217 RXZD01000001.1 GCA012641625_00703 gene open 622981-624210
1218 RXZD01000001.1 GCA012641625_00704 gene open 624358-624906 niaX
1219 RXZD01000001.1 GCA012641625_00705 gene open 624973-625497 niaR
1220 RXZD01000001.1 GCA012641625_00706 gene open 625613-627070 gltX
1221 RXZD01000001.1 GCA012641625_00707 gene open 627357-628070 aIM24
1222 RXZD01000001.1 GCA012641625_00708 gene open 628259-628753 cynT
1223 RXZD01000001.1 GCA012641625_00709 gene open 628843-630243 radA
1224 RXZD01000001.1 GCA012641625_00710 gene open 630201-630671 pncA
1225 RXZD01000001.1 GCA012641625_00711 gene open 630681-631124 dut
1226 RXZD01000001.1 GCA012641625_00712 gene open 631448-632467 gpsA
1227 RXZD01000001.1 GCA012641625_00713 gene open 632469-633389 galU
1228 RXZD01000001.1 GCA012641625_00714 gene open 633411-634082 glpG
1229 RXZD01000001.1 GCA012641625_00715 gene open 634069-634605 fAU1
1230 RXZD01000001.1 GCA012641625_00716 gene open 634939-636069 abgB
1231 RXZD01000001.1 GCA012641625_00717 gene open 636562-637260 dapD
1232 RXZD01000001.1 GCA012641625_00718 gene open 637379-638320
1233 RXZD01000001.1 GCA012641625_00719 gene open 638477-639019
1234 RXZD01000001.1 GCA012641625_00720 gene open 639055-639738
1235 RXZD01000001.1 GCA012641625_00721 gene open 639824-640378
1236 RXZD01000001.1 GCA012641625_00722 gene open 641255-641620 srlB
1237 RXZD01000001.1 GCA012641625_00723 gene open 641662-642672 srlE
1238 RXZD01000001.1 GCA012641625_00724 gene open 642763-643305 srlA
1239 RXZD01000001.1 GCA012641625_00725 gene open 643385-643873 gutM
1240 RXZD01000001.1 GCA012641625_00726 gene open 643873-645738 bglG
1241 RXZD01000001.1 GCA012641625_00727 gene open 645760-646560 fabG
1242 RXZD01000001.1 GCA012641625_00728 gene open 646726-648075 pgi
1243 RXZD01000001.1 GCA012641625_00729 gene open 648447-648971
1244 RXZD01000001.1 GCA012641625_00730 gene open 649195-649905
1245 RXZD01000001.1 GCA012641625_00731 gene open 650095-650223
1246 RXZD01000001.1 GCA012641625_00630 gene open 552731-552817 trnS
1247 RXZD01000001.1 GCA012641625_00685 gene open 607915-607997 trnL
1248 RXZD01000001.1 GCA012641625_00686 gene open 608160-608248 trnS
1249 RXZD01000001.1 GCA012641625_00630 tRNA open 552731-552817 trnS tRNA-Ser(gga)
1250 RXZD01000001.1 GCA012641625_00685 tRNA open 607915-607997 trnL tRNA-Leu(cag)
1251 RXZD01000001.1 GCA012641625_00686 tRNA open 608160-608248 trnS tRNA-Ser(cga)
1252 RXZD01000002.1 GCA012641625_00767 gene open 41403-41748 ssrA
1253 RXZD01000002.1 GCA012641625_00767 tmRNA open 41403-41748 ssrA transfer-messenger RNA%2C SsrA
1254 RXZD01000002.1 GCA012641625_00916 gene open 188721-188811 tracrRNA
1255 RXZD01000002.1 GCA012641625_00916 ncRNA open 188721-188811 Trans-activating crRNA
1256 RXZD01000002.1 regulatory_region open 18024-18109 Glycine riboswitch aptamer
1257 RXZD01000002.1 regulatory_region open 65227-65343 PyrR binding site
1258 RXZD01000002.1 regulatory_region open 325532-325628 PreQ1-II (pre queuosine) riboswitch aptamer
1259 RXZD01000002.1 repeat_region open 181035-181938 CRISPR array with 14 repeats of length 36%2C consensus sequence GTTTTGGAACCATTCGAAACAACACAGCTCTAAAAC and spacer length 30
1260 RXZD01000002.1 GCA012641625_00732 CDS open 119-913 _na     264_aa Abortive infection protein-like C-terminal domain-containing protein
1261 RXZD01000002.1 GCA012641625_00733 CDS open 1190-2935 _na     581_aa mdlB ABC transporter%2C ATP-binding protein
1262 RXZD01000002.1 GCA012641625_00734 CDS open 2928-4700 _na     590_aa ABC transporter%2C ATP-binding protein
1263 RXZD01000002.1 GCA012641625_00735 CDS open 4711-5322 _na     203_aa acrR Transcription regulator
1264 RXZD01000002.1 GCA012641625_00736 CDS open 5515-8148 _na     877_aa lolE ABC transporter%2C permease protein
1265 RXZD01000002.1 GCA012641625_00737 CDS open 8162-8863 _na     233_aa lolD ABC transporter%2C ATP-binding protein
1266 RXZD01000002.1 GCA012641625_00738 CDS open 8976-9533 _na     185_aa acrR Transcriptional regulator
1267 RXZD01000002.1 GCA012641625_00739 CDS open 9723-10013 _na     96_aa tnp IS3 family IS199 transposase ORF A
1268 RXZD01000002.1 GCA012641625_00740 CDS open 10049-10828 _na     259_aa tnp IS3 family IS199 transposase ORF B
1269 RXZD01000002.1 GCA012641625_00741 CDS open 10871-11434 _na     187_aa trxA Thioredoxin family protein
1270 RXZD01000002.1 GCA012641625_00742 CDS open 11448-12224 _na     258_aa ccdA Cytochrome C biogenesis protein
1271 RXZD01000002.1 GCA012641625_00743 CDS open 12358-13128 _na     256_aa cof Hydrolase
1272 RXZD01000002.1 GCA012641625_00744 CDS open 13225-13965 _na     246_aa Cyclase
1273 RXZD01000002.1 GCA012641625_00745 CDS open 13979-15259 _na     426_aa mET17 O-acetylhomoserine sulfhydrylase
1274 RXZD01000002.1 GCA012641625_00746 CDS open 15573-17849 _na     758_aa pcrA DNA helicase PcrA
1275 RXZD01000002.1 GCA012641625_00747 CDS open 18220-19584 _na     454_aa alsT Sodium/amino acid (Alanine) symporter
1276 RXZD01000002.1 GCA012641625_00748 CDS open 19683-20873 _na     396_aa fieF Cation efflux transporter
1277 RXZD01000002.1 GCA012641625_00749 CDS open 20996-21829 _na     277_aa hisJ ABC transporter%2C glutamine binding protein
1278 RXZD01000002.1 GCA012641625_00750 CDS open 21851-22480 _na     209_aa glnQ Amino acid ABC transporter%2C ATP-binding protein
1279 RXZD01000002.1 GCA012641625_00751 CDS open 22489-23130 _na     213_aa hisM Amino acid ABC transporter%2C permease protein
1280 RXZD01000002.1 GCA012641625_00752 CDS open 23321-23653 _na     110_aa yjdM Protein YjdM
1281 RXZD01000002.1 GCA012641625_00753 CDS open 23833-24981 _na     382_aa mtlD mannitol-1-phosphate 5-dehydrogenase
1282 RXZD01000002.1 GCA012641625_00754 CDS open 24997-25434 _na     145_aa mtlF Mannitol-specific phosphotransferase enzyme IIA component
1283 RXZD01000002.1 GCA012641625_00755 CDS open 25436-27388 _na     650_aa mtlR Putative transcriptional regulator MtlR
1284 RXZD01000002.1 GCA012641625_00756 CDS open 27418-29187 _na     589_aa mtlA PTS system mannitol-specific EIICB component
1285 RXZD01000002.1 GCA012641625_00757 CDS open 29674-31488 _na     604_aa glmS glutamine--fructose-6-phosphate transaminase (isomerizing)
1286 RXZD01000002.1 GCA012641625_00758 CDS open 31662-32216 _na     184_aa lepB signal peptidase I
1287 RXZD01000002.1 GCA012641625_00759 CDS open 32295-32537 _na     80_aa yeaQ Transglycosylase associated protein
1288 RXZD01000002.1 GCA012641625_00760 CDS open 32825-34327 _na     500_aa pyk pyruvate kinase
1289 RXZD01000002.1 GCA012641625_00761 CDS open 34401-35414 _na     337_aa pfkA 6-phosphofructokinase
1290 RXZD01000002.1 GCA012641625_00762 CDS open 35497-38601 _na     1034_aa dnaE DNA polymerase III subunit alpha
1291 RXZD01000002.1 GCA012641625_00763 CDS open 38779-39150 _na     123_aa yhcF Transcriptional regulator
1292 RXZD01000002.1 GCA012641625_00764 CDS open 39147-39854 _na     235_aa rbbA ABC transporter%2C ATP-binding protein
1293 RXZD01000002.1 GCA012641625_00765 CDS open 39864-40682 _na     272_aa Permease
1294 RXZD01000002.1 GCA012641625_00766 CDS open 40735-41349 _na     204_aa Lipoprotein
1295 RXZD01000002.1 GCA012641625_00768 CDS open 41828-42442 _na     204_aa tVP38 TVP38/TMEM64 family membrane protein
1296 RXZD01000002.1 GCA012641625_00770 CDS open 42949-44148 _na     399_aa rpsA 30S ribosomal protein S1
1297 RXZD01000002.1 GCA012641625_00773 CDS open 44634-44864 _na     76_aa Branched-chain amino acid aminotransferase
1298 RXZD01000002.1 GCA012641625_00774 CDS open 44929-45954 _na     341_aa ilvE branched-chain amino acid aminotransferase
1299 RXZD01000002.1 GCA012641625_00775 CDS open 46197-48617 _na     806_aa parC DNA topoisomerase IV subunit A
1300 RXZD01000002.1 GCA012641625_00776 CDS open 48915-49493 _na     192_aa RelA/SpoT domain-containing protein
1301 RXZD01000002.1 GCA012641625_00777 CDS open 50211-52160 _na     649_aa parE DNA topoisomerase IV subunit B
1302 RXZD01000002.1 GCA012641625_00778 CDS open 52273-52911 _na     212_aa plsY glycerol-3-phosphate 1-O-acyltransferase PlsY
1303 RXZD01000002.1 GCA012641625_00779 CDS open 52984-55209 _na     741_aa nt5e cell surface ecto-5'-nucleotidase Nt5e
1304 RXZD01000002.1 GCA012641625_00780 CDS open 55398-56666 _na     422_aa allB dihydroorotase
1305 RXZD01000002.1 GCA012641625_00781 CDS open 56676-57329 _na     217_aa ung uracil-DNA glycosylase
1306 RXZD01000002.1 GCA012641625_00782 CDS open 57352-58005 _na     217_aa hisM Amino acid ABC transporter%2C permease protein
1307 RXZD01000002.1 GCA012641625_00783 CDS open 58155-59006 _na     283_aa hisJ ABC transporter%2C amino acid binding protein
1308 RXZD01000002.1 GCA012641625_00784 CDS open 59121-60563 _na     480_aa gatA amidase
1309 RXZD01000002.1 GCA012641625_00785 CDS open 60623-60964 _na     113_aa mmcQ MmcQ-like protein
1310 RXZD01000002.1 GCA012641625_00786 CDS open 61138-61638 _na     166_aa ybhB Phospholipid-binding protein
1311 RXZD01000002.1 GCA012641625_00787 CDS open 61707-62060 _na     117_aa hypothetical protein
1312 RXZD01000002.1 GCA012641625_00788 CDS open 62084-62713 _na     209_aa pyrE Orotate phosphoribosyltransferase
1313 RXZD01000002.1 GCA012641625_00789 CDS open 62814-63506 _na     230_aa pyrF orotidine-5'-phosphate decarboxylase
1314 RXZD01000002.1 GCA012641625_00790 CDS open 63499-64428 _na     309_aa pyrD dihydroorotate dehydrogenase
1315 RXZD01000002.1 GCA012641625_00791 CDS open 64438-65214 _na     258_aa pyrK dihydroorotate dehydrogenase electron transfer subunit
1316 RXZD01000002.1 GCA012641625_00792 CDS open 65466-66374 _na     302_aa lysR Transcriptional regulator
1317 RXZD01000002.1 GCA012641625_00793 CDS open 66440-67207 _na     255_aa Csm6 HEPN domain-containing protein
1318 RXZD01000002.1 GCA012641625_00794 CDS open 67209-67889 _na     226_aa deoD purine-nucleoside phosphorylase
1319 RXZD01000002.1 GCA012641625_00795 CDS open 68127-68837 _na     236_aa guaA1 Glutamine amidotransferase domain-containing protein
1320 RXZD01000002.1 GCA012641625_00796 CDS open 68847-69656 _na     269_aa xapA purine-nucleoside phosphorylase
1321 RXZD01000002.1 GCA012641625_00797 CDS open 69819-70034 _na     71_aa Phosphopentomutase
1322 RXZD01000002.1 GCA012641625_00798 CDS open 70036-71247 _na     403_aa deoB phosphopentomutase
1323 RXZD01000002.1 GCA012641625_00799 CDS open 71302-71979 _na     225_aa rpiA ribose-5-phosphate isomerase RpiA
1324 RXZD01000002.1 GCA012641625_00800 CDS open 72108-73475 _na     455_aa mnmE tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE
1325 RXZD01000002.1 GCA012641625_00801 CDS open 73621-74424 _na     267_aa ligW Amidohydrolase-related domain-containing protein
1326 RXZD01000002.1 GCA012641625_00802 CDS open 74442-74792 _na     116_aa SnoaL-like domain-containing protein
1327 RXZD01000002.1 GCA012641625_00803 CDS open 74883-75185 _na     100_aa arsR Transcriptional regulator
1328 RXZD01000002.1 GCA012641625_00804 CDS open 75313-75900 _na     195_aa udg4 Uracil-DNA glycosylase-like domain-containing protein
1329 RXZD01000002.1 GCA012641625_00805 CDS open 75973-77385 _na     470_aa pepV dipeptidase PepV
1330 RXZD01000002.1 GCA012641625_00806 CDS open 77400-78002 _na     200_aa nfnB Nitroreductase
1331 RXZD01000002.1 GCA012641625_00807 CDS open 78149-79936 _na     595_aa uvrC excinuclease ABC subunit UvrC
1332 RXZD01000002.1 GCA012641625_00808 CDS open 80054-81208 _na     384_aa ltrA Putative low temperature requirement A protein
1333 RXZD01000002.1 GCA012641625_00809 CDS open 81252-81947 _na     231_aa yigB YjjG family noncanonical pyrimidine nucleotidase
1334 RXZD01000002.1 GCA012641625_00810 CDS open 82026-82190 _na     54_aa acrR Transcriptional regulator
1335 RXZD01000002.1 GCA012641625_00811 CDS open 82387-83685 _na     432_aa eno phosphopyruvate hydratase
1336 RXZD01000002.1 GCA012641625_00812 CDS open 84081-84722 _na     213_aa DUF4352 domain-containing protein
1337 RXZD01000002.1 GCA012641625_00813 CDS open 84760-85029 _na     89_aa Phage protein
1338 RXZD01000002.1 GCA012641625_00814 CDS open 85178-85630 _na     150_aa yueI Glycogen synthase
1339 RXZD01000002.1 GCA012641625_00815 CDS open 85707-86819 _na     370_aa glxK Glycerate kinase
1340 RXZD01000002.1 GCA012641625_00816 CDS open 86830-87255 _na     141_aa rimI N-acetyltransferase domain-containing protein
1341 RXZD01000002.1 GCA012641625_00817 CDS open 87344-87988 _na     214_aa Phosphoglycolate phosphatase
1342 RXZD01000002.1 GCA012641625_00818 CDS open 88682-88999 _na     105_aa vapI Plasmid maintenance system antidote protein
1343 RXZD01000002.1 GCA012641625_00819 CDS open 89013-89336 _na     107_aa higB Plasmid maintenance system killer protein
1344 RXZD01000002.1 GCA012641625_00820 CDS open 89431-89610 _na     59_aa hypothetical protein
1345 RXZD01000002.1 GCA012641625_00821 CDS open 89644-93093 _na     1149_aa DNA helicase
1346 RXZD01000002.1 GCA012641625_00822 CDS open 93080-93607 _na     175_aa spoIVCA master DNA invertase Mpi family serine-type recombinase
1347 RXZD01000002.1 GCA012641625_00823 CDS open 93613-94596 _na     327_aa TaqI-like C-terminal specificity domain-containing protein
1348 RXZD01000002.1 GCA012641625_00824 CDS open 94542-97748 _na     1068_aa Eco57I restriction-modification methylase domain-containing protein
1349 RXZD01000002.1 GCA012641625_00825 CDS open 98231-98578 _na     115_aa mazF Type II toxin-antitoxin system PemK/MazF family toxin
1350 RXZD01000002.1 GCA012641625_00826 CDS open 98633-98812 _na     59_aa divIVA DivIVA domain-containing protein
1351 RXZD01000002.1 GCA012641625_00827 CDS open 98825-99139 _na     104_aa hisE Phosphoribosyl-ATP pyrophosphatase
1352 RXZD01000002.1 GCA012641625_00828 CDS open 99283-99624 _na     113_aa hisI phosphoribosyl-AMP cyclohydrolase
1353 RXZD01000002.1 GCA012641625_00829 CDS open 99624-100379 _na     251_aa hisF Imidazole glycerol phosphate synthase subunit HisF
1354 RXZD01000002.1 GCA012641625_00830 CDS open 100382-101101 _na     239_aa hisA 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase
1355 RXZD01000002.1 GCA012641625_00831 CDS open 101541-102146 _na     201_aa hisH imidazole glycerol phosphate synthase subunit HisH
1356 RXZD01000002.1 GCA012641625_00832 CDS open 102143-102496 _na     117_aa Integral membrane protein
1357 RXZD01000002.1 GCA012641625_00833 CDS open 102512-103096 _na     194_aa hisB imidazoleglycerol-phosphate dehydratase HisB
1358 RXZD01000002.1 GCA012641625_00834 CDS open 103093-103740 _na     215_aa serB phosphoserine phosphatase SerB
1359 RXZD01000002.1 GCA012641625_00835 CDS open 103727-105010 _na     427_aa hisD Histidinol dehydrogenase
1360 RXZD01000002.1 GCA012641625_00836 CDS open 105007-105654 _na     215_aa hisG ATP phosphoribosyltransferase
1361 RXZD01000002.1 GCA012641625_00837 CDS open 105664-106626 _na     320_aa hisZ ATP phosphoribosyltransferase regulatory subunit
1362 RXZD01000002.1 GCA012641625_00838 CDS open 106623-107672 _na     349_aa hisC histidinol-phosphate transaminase
1363 RXZD01000002.1 GCA012641625_00839 CDS open 108844-110568 _na     574_aa ezrA septation ring formation regulator EzrA
1364 RXZD01000002.1 GCA012641625_00840 CDS open 110664-112616 _na     650_aa gyrB DNA topoisomerase (ATP-hydrolyzing) subunit B
1365 RXZD01000002.1 GCA012641625_00841 CDS open 112616-113200 _na     194_aa Hydrolase
1366 RXZD01000002.1 GCA012641625_00842 CDS open 113622-114848 _na     408_aa ftsW Cell division protein (Cell shape determining protein)
1367 RXZD01000002.1 GCA012641625_00843 CDS open 115055-116173 _na     372_aa menH AB hydrolase-1 domain-containing protein
1368 RXZD01000002.1 GCA012641625_00844 CDS open 116312-116878 _na     188_aa acrR Transcriptional regulator
1369 RXZD01000002.1 GCA012641625_00846 CDS open 117138-117797 _na     219_aa ywnB NAD(P)-binding domain-containing protein
1370 RXZD01000002.1 GCA012641625_00847 CDS open 117799-118977 _na     392_aa araJ Permease multidrug efflux protein
1371 RXZD01000002.1 GCA012641625_00848 CDS open 119128-119478 _na     116_aa soxR Transcriptional regulator
1372 RXZD01000002.1 GCA012641625_00849 CDS open 119657-120004 _na     115_aa rplS 50S ribosomal protein L19
1373 RXZD01000002.1 GCA012641625_00850 CDS open 120194-121414 _na     406_aa clcA Chloride channel permease
1374 RXZD01000002.1 GCA012641625_00851 CDS open 121500-122720 _na     406_aa Permease%2C chloride channel
1375 RXZD01000002.1 GCA012641625_00852 CDS open 122710-122982 _na     90_aa pheA Chorismate mutase
1376 RXZD01000002.1 GCA012641625_00853 CDS open 123028-123705 _na     225_aa tVP38 TVP38/TMEM64 family membrane protein
1377 RXZD01000002.1 GCA012641625_00854 CDS open 124126-125508 _na     460_aa sufB Fe-S cluster assembly protein SufB
1378 RXZD01000002.1 GCA012641625_00855 CDS open 125668-126111 _na     147_aa flavodoxin
1379 RXZD01000002.1 GCA012641625_00856 CDS open 126170-127186 _na     338_aa add adenosine deaminase
1380 RXZD01000002.1 GCA012641625_00857 CDS open 127294-128085 _na     263_aa yghU glutathione-dependent disulfide-bond oxidoreductase
1381 RXZD01000002.1 GCA012641625_00858 CDS open 128157-129089 _na     310_aa nrnA putative bifunctional oligoribonuclease and PAP phosphatase NrnA
1382 RXZD01000002.1 GCA012641625_00859 CDS open 129186-129428 _na     80_aa rpmE2 type B 50S ribosomal protein L31
1383 RXZD01000002.1 GCA012641625_00860 CDS open 129479-129784 _na     101_aa Acetate kinase
1384 RXZD01000002.1 GCA012641625_00861 CDS open 129777-130124 _na     115_aa qdoI Cupin type-2 domain-containing protein
1385 RXZD01000002.1 GCA012641625_00862 CDS open 130252-130932 _na     226_aa Methyltransferase
1386 RXZD01000002.1 GCA012641625_00863 CDS open 131092-132612 _na     506_aa zinT ZinT domain-containing protein
1387 RXZD01000002.1 GCA012641625_00864 CDS open 132839-134236 _na     465_aa pepD C69 family dipeptidase
1388 RXZD01000002.1 GCA012641625_00865 CDS open 134840-135751 _na     303_aa whiA DNA-binding protein WhiA
1389 RXZD01000002.1 GCA012641625_00866 CDS open 135748-136725 _na     325_aa cofD Putative gluconeogenesis factor
1390 RXZD01000002.1 GCA012641625_00867 CDS open 136722-137612 _na     296_aa rapZ RNase adapter RapZ
1391 RXZD01000002.1 GCA012641625_00868 CDS open 137605-138363 _na     252_aa Cyclic nucleotide-binding protein
1392 RXZD01000002.1 GCA012641625_00869 CDS open 138494-138871 _na     125_aa ridA Translation initiation inhibitor aldR regulator-like protein
1393 RXZD01000002.1 GCA012641625_00870 CDS open 138901-139992 _na     363_aa gldA Glycerol dehydrogenase
1394 RXZD01000002.1 GCA012641625_00871 CDS open 140508-141854 _na     448_aa asnS asparagine--tRNA ligase
1395 RXZD01000002.1 GCA012641625_00872 CDS open 141901-143082 _na     393_aa aspB Asparagine--oxo-acid transaminase
1396 RXZD01000002.1 GCA012641625_00873 CDS open 143148-145676 _na     842_aa dnaQ bifunctional DnaQ family exonuclease/ATP-dependent helicase
1397 RXZD01000002.1 GCA012641625_00874 CDS open 145870-146703 _na     277_aa ybbA Esterase
1398 RXZD01000002.1 GCA012641625_00875 CDS open 146922-147575 _na     217_aa rbbA ATP-binding protein
1399 RXZD01000002.1 GCA012641625_00876 CDS open 147577-148308 _na     243_aa ABC transporter permease
1400 RXZD01000002.1 GCA012641625_00877 CDS open 149081-149560 _na     159_aa hypothetical protein
1401 RXZD01000002.1 GCA012641625_00878 CDS open 149406-150158 _na     250_aa Esterase
1402 RXZD01000002.1 GCA012641625_00879 CDS open 150300-151478 _na     392_aa accC ATP-grasp domain-containing protein
1403 RXZD01000002.1 GCA012641625_00880 CDS open 151538-151678 _na     46_aa hypothetical protein
1404 RXZD01000002.1 GCA012641625_00881 CDS open 151622-152386 _na     254_aa fabG (S)-acetoin forming diacetyl reductase
1405 RXZD01000002.1 GCA012641625_00882 CDS open 152511-153149 _na     212_aa gloB Metallo-beta-lactamase domain-containing protein
1406 RXZD01000002.1 GCA012641625_00883 CDS open 153272-154216 _na     314_aa ftsX permease-like cell division protein FtsX
1407 RXZD01000002.1 GCA012641625_00884 CDS open 154200-154892 _na     230_aa ftsE cell division ATP-binding protein FtsE
1408 RXZD01000002.1 GCA012641625_00885 CDS open 154914-155891 _na     325_aa prfB peptide chain release factor 2
1409 RXZD01000002.1 GCA012641625_00886 CDS open 156059-157180 _na     373_aa queG tRNA epoxyqueuosine(34) reductase QueG
1410 RXZD01000002.1 GCA012641625_00887 CDS open 157393-158013 _na     206_aa Peptidase E
1411 RXZD01000002.1 GCA012641625_00888 CDS open 158010-158645 _na     211_aa Methyltransferase type 11 domain-containing protein
1412 RXZD01000002.1 GCA012641625_00889 CDS open 158818-159018 _na     66_aa DUF2568 domain-containing protein
1413 RXZD01000002.1 GCA012641625_00890 CDS open 159002-159583 _na     193_aa grpB GrpB family protein
1414 RXZD01000002.1 GCA012641625_00891 CDS open 159700-160485 _na     261_aa tsaC YrdC-like domain-containing protein
1415 RXZD01000002.1 GCA012641625_00892 CDS open 160550-160924 _na     124_aa GP-PDE domain-containing protein
1416 RXZD01000002.1 GCA012641625_00893 CDS open 161098-161688 _na     196_aa leuD 3-isopropylmalate dehydratase small subunit
1417 RXZD01000002.1 GCA012641625_00894 CDS open 161690-163075 _na     461_aa leuC 3-isopropylmalate dehydratase large subunit
1418 RXZD01000002.1 GCA012641625_00895 CDS open 163201-164235 _na     344_aa leuB 3-isopropylmalate dehydrogenase
1419 RXZD01000002.1 GCA012641625_00896 CDS open 164245-165810 _na     521_aa leuA 2-isopropylmalate synthase
1420 RXZD01000002.1 GCA012641625_00897 CDS open 166137-166766 _na     209_aa udk uridine kinase
1421 RXZD01000002.1 GCA012641625_00898 CDS open 166985-167965 _na     326_aa mviM Oxidoreductase
1422 RXZD01000002.1 GCA012641625_00899 CDS open 167962-169044 _na     360_aa RNA helicase
1423 RXZD01000002.1 GCA012641625_00900 CDS open 169237-170877 _na     546_aa pckA phosphoenolpyruvate carboxykinase (ATP)
1424 RXZD01000002.1 GCA012641625_00901 CDS open 171196-171852 _na     218_aa Pr6Pr family membrane protein
1425 RXZD01000002.1 GCA012641625_00902 CDS open 171917-172525 _na     202_aa DUF6287 domain-containing protein
1426 RXZD01000002.1 GCA012641625_00903 CDS open 172605-173081 _na     158_aa rimI Acetyltransferase
1427 RXZD01000002.1 GCA012641625_00904 CDS open 173160-173987 _na     275_aa menH AB hydrolase-1 domain-containing protein
1428 RXZD01000002.1 GCA012641625_00905 CDS open 174016-175851 _na     611_aa lepA translation elongation factor 4
1429 RXZD01000002.1 GCA012641625_00906 CDS open 176100-176228 _na     42_aa hypothetical protein
1430 RXZD01000002.1 GCA012641625_00907 CDS open 176623-178374 _na     583_aa gbpC Glucan-binding protein C%2C GbpC
1431 RXZD01000002.1 GCA012641625_00908 CDS open 178537-178821 _na     94_aa xRE HTH cro/C1-type domain-containing protein
1432 RXZD01000002.1 GCA012641625_00909 CDS open 179137-180030 _na     297_aa Transcriptional regulator
1433 RXZD01000002.1 GCA012641625_00910 CDS open 182082-182459 _na     125_aa hicB HicB-like antitoxin of toxin-antitoxin system domain-containing protein
1434 RXZD01000002.1 GCA012641625_00911 CDS open 182477-182668 _na     63_aa hicA Toxin HicA
1435 RXZD01000002.1 GCA012641625_00912 CDS open 182765-183427 _na     220_aa csn2 CRISPR-associated protein Csn2
1436 RXZD01000002.1 GCA012641625_00913 CDS open 183417-183761 _na     114_aa cas2 CRISPR-associated endonuclease Cas2
1437 RXZD01000002.1 GCA012641625_00914 CDS open 183758-184624 _na     288_aa cas1 type II CRISPR-associated endonuclease Cas1
1438 RXZD01000002.1 GCA012641625_00915 CDS open 184624-188661 _na     1345_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
1439 RXZD01000002.1 GCA012641625_00917 CDS open 189128-189994 _na     288_aa ssuE NADPH-dependent FMN reductase-like domain-containing protein
1440 RXZD01000002.1 GCA012641625_00918 CDS open 190101-190979 _na     292_aa araC Transcriptional regulator
1441 RXZD01000002.1 GCA012641625_00919 CDS open 191110-192600 _na     496_aa Reductase
1442 RXZD01000002.1 GCA012641625_00920 CDS open 192610-193785 _na     391_aa araJ Major facilitator superfamily (MFS) profile domain-containing protein
1443 RXZD01000002.1 GCA012641625_00921 CDS open 193961-196489 _na     842_aa lolD ABC transporter%2C membrane protein subunit and ATP-binding protein
1444 RXZD01000002.1 GCA012641625_00922 CDS open 196584-197243 _na     219_aa Integral membrane protein
1445 RXZD01000002.1 GCA012641625_00923 CDS open 197233-198006 _na     257_aa nagD Acid sugar phosphatase
1446 RXZD01000002.1 GCA012641625_00924 CDS open 198021-198638 _na     205_aa yjhB Mutator protein MutT
1447 RXZD01000002.1 GCA012641625_00925 CDS open 198659-199387 _na     242_aa fatA Oleoyl-acyl carrier protein thioesterase
1448 RXZD01000002.1 GCA012641625_00926 CDS open 199390-200532 _na     380_aa hemW radical SAM family heme chaperone HemW
1449 RXZD01000002.1 GCA012641625_00927 CDS open 201066-201662 _na     198_aa acrR Transcriptional regulator
1450 RXZD01000002.1 GCA012641625_00928 CDS open 201659-202225 _na     188_aa mdaB Oxidoreductase
1451 RXZD01000002.1 GCA012641625_00929 CDS open 202285-203538 _na     417_aa aceF Dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex
1452 RXZD01000002.1 GCA012641625_00930 CDS open 203552-204583 _na     343_aa acoB Pyruvate dehydrogenase E1 component beta subunit
1453 RXZD01000002.1 GCA012641625_00931 CDS open 204596-205669 _na     357_aa acoA Pyruvate dehydrogenase%2C TPP-dependent E1 component alpha-subunit
1454 RXZD01000002.1 GCA012641625_00932 CDS open 205695-207032 _na     445_aa lpdA dihydrolipoyl dehydrogenase
1455 RXZD01000002.1 GCA012641625_00933 CDS open 207261-209843 _na     860_aa clpB Chaperone protein ClpB
1456 RXZD01000002.1 GCA012641625_00934 CDS open 210037-211386 _na     449_aa glmM phosphoglucosamine mutase
1457 RXZD01000002.1 GCA012641625_00935 CDS open 211437-212393 _na     318_aa ybbR YbbR-like domain-containing protein
1458 RXZD01000002.1 GCA012641625_00936 CDS open 212386-213240 _na     284_aa cdaA diadenylate cyclase CdaA
1459 RXZD01000002.1 GCA012641625_00937 CDS open 213349-214692 _na     447_aa murT lipid II isoglutaminyl synthase subunit MurT
1460 RXZD01000002.1 GCA012641625_00938 CDS open 214692-215480 _na     262_aa gatD lipid II isoglutaminyl synthase subunit GatD
1461 RXZD01000002.1 GCA012641625_00939 CDS open 215722-217635 _na     637_aa abc-f ribosomal protection-like ABC-F family protein
1462 RXZD01000002.1 GCA012641625_00940 CDS open 217717-218826 _na     369_aa bcsZ Glucanase
1463 RXZD01000002.1 GCA012641625_00941 CDS open 218838-220145 _na     435_aa bcsA Glycosyltransferase%2C group 2 family protein
1464 RXZD01000002.1 GCA012641625_00942 CDS open 220120-220281 _na     53_aa DUF3149 domain-containing protein
1465 RXZD01000002.1 GCA012641625_00943 CDS open 220295-221113 _na     272_aa GGDEF domain-containing protein
1466 RXZD01000002.1 GCA012641625_00944 CDS open 221091-222239 _na     382_aa wecB non-hydrolyzing UDP-N-acetylglucosamine 2-epimerase
1467 RXZD01000002.1 GCA012641625_00945 CDS open 222566-223264 _na     232_aa Zn-dependent protease
1468 RXZD01000002.1 GCA012641625_00946 CDS open 223861-224391 _na     176_aa yehR DUF1307 domain-containing protein
1469 RXZD01000002.1 GCA012641625_00947 CDS open 224483-225274 _na     263_aa frmB Tributyrin esterase
1470 RXZD01000002.1 GCA012641625_00948 CDS open 225354-225668 _na     104_aa hot13 CHY-type domain-containing protein
1471 RXZD01000002.1 GCA012641625_00949 CDS open 225762-227426 _na     554_aa rnjA Ribonuclease J
1472 RXZD01000002.1 GCA012641625_00950 CDS open 227673-228431 _na     252_aa phnK ABC transporter%2C ATP-binding protein
1473 RXZD01000002.1 GCA012641625_00951 CDS open 228428-229297 _na     289_aa ABC transporter%2C permease protein
1474 RXZD01000002.1 GCA012641625_00952 CDS open 229408-230409 _na     333_aa trpX tryptophan ABC transporter substrate-binding protein
1475 RXZD01000002.1 GCA012641625_00953 CDS open 230671-232320 _na     549_aa rqcH Rqc2-like protein RqcH
1476 RXZD01000002.1 GCA012641625_00954 CDS open 232625-234022 _na     465_aa Amino acid permease
1477 RXZD01000002.1 GCA012641625_00955 CDS open 234093-234809 _na     238_aa budA acetolactate decarboxylase
1478 RXZD01000002.1 GCA012641625_00956 CDS open 234823-236502 _na     559_aa alsS acetolactate synthase AlsS
1479 RXZD01000002.1 GCA012641625_00957 CDS open 236635-237867 _na     410_aa lapB TPR repeat-containing protein
1480 RXZD01000002.1 GCA012641625_00958 CDS open 237857-239026 _na     389_aa AI-2E family transporter
1481 RXZD01000002.1 GCA012641625_00959 CDS open 239095-239574 _na     159_aa mutX 8-oxo-dGTP diphosphatase
1482 RXZD01000002.1 GCA012641625_00960 CDS open 239869-240915 _na     348_aa rfbB dTDP-glucose 4%2C6-dehydratase
1483 RXZD01000002.1 GCA012641625_00961 CDS open 241308-241484 _na     58_aa hypothetical protein
1484 RXZD01000002.1 GCA012641625_00962 CDS open 241547-242143 _na     198_aa rfbC dTDP-4-keto-L-rhamnose reductase
1485 RXZD01000002.1 GCA012641625_00963 CDS open 242145-243014 _na     289_aa rfbA glucose-1-phosphate thymidylyltransferase RfbA
1486 RXZD01000002.1 GCA012641625_00964 CDS open 243310-244098 _na     262_aa nIF3 Nif3-like dinuclear metal center hexameric protein
1487 RXZD01000002.1 GCA012641625_00965 CDS open 244088-244786 _na     232_aa trmK SAM-dependent methyltransferase
1488 RXZD01000002.1 GCA012641625_00966 CDS open 244776-245471 _na     231_aa dnaD DnaD domain-containing protein
1489 RXZD01000002.1 GCA012641625_00967 CDS open 245481-246425 _na     314_aa metA homoserine O-succinyltransferase
1490 RXZD01000002.1 GCA012641625_00968 CDS open 246529-247083 _na     184_aa apt adenine phosphoribosyltransferase
1491 RXZD01000002.1 GCA012641625_00969 CDS open 247720-248352 _na     210_aa mA1133 GyrI-like small molecule binding domain-containing protein
1492 RXZD01000002.1 GCA012641625_00970 CDS open 248604-249503 _na     299_aa yobV HTH deoR-type domain-containing protein
1493 RXZD01000002.1 GCA012641625_00971 CDS open 249623-251827 _na     734_aa recJ single-stranded-DNA-specific exonuclease RecJ
1494 RXZD01000002.1 GCA012641625_00972 CDS open 251824-252588 _na     254_aa yqjQ Oxidoreductase
1495 RXZD01000002.1 GCA012641625_00973 CDS open 252585-253514 _na     309_aa rnz ribonuclease Z
1496 RXZD01000002.1 GCA012641625_00974 CDS open 253542-254177 _na     211_aa Cystathionine beta-lyase
1497 RXZD01000002.1 GCA012641625_00975 CDS open 254164-255411 _na     415_aa hflX GTPase HflX
1498 RXZD01000002.1 GCA012641625_00976 CDS open 255600-256484 _na     294_aa miaA tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA
1499 RXZD01000002.1 GCA012641625_00977 CDS open 256559-256735 _na     58_aa DUF3042 domain-containing protein
1500 RXZD01000002.1 GCA012641625_00978 CDS open 257062-257673 _na     203_aa Lipoprotein