HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Aquamicrobium lusatiense (GCA_014201615.1)

Select a Genome:
BAKTA Annotations for GCA_014201615.1
Genome Selected: Aquamicrobium lusatiense
ContigsBases CDSrRNA tmRNAtRNA
13 4389592 4063 3 1 48
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 8292 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 8292 [17 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer
Range
(bp)
Show Sequences
(length) NA / AA
BAKTA
Gene
BAKTA
GeneProduct
1 JACHEU010000001.1 GCA014201615_02724 gene open 2825430-2825767 ssrA
2 JACHEU010000001.1 GCA014201615_02724 tmRNA open 2825430-2825767 ssrA transfer-messenger RNA%2C SsrA
3 JACHEU010000001.1 GCA014201615_00425 gene open 419111-419253 BjrC1505
4 JACHEU010000001.1 GCA014201615_00447 gene open 437429-437585 6S
5 JACHEU010000001.1 GCA014201615_00514 gene open 504876-504999 ar14
6 JACHEU010000001.1 GCA014201615_00730 gene open 736422-736557 ar35
7 JACHEU010000001.1 GCA014201615_00824 gene open 841872-841923 ffh
8 JACHEU010000001.1 GCA014201615_01053 gene open 1096074-1096170 Bacteria_small_SRP
9 JACHEU010000001.1 GCA014201615_01090 gene open 1130750-1130845 ar15
10 JACHEU010000001.1 GCA014201615_02275 gene open 2354375-2354492 ar14
11 JACHEU010000001.1 GCA014201615_02276 gene open 2354518-2354637 ar14
12 JACHEU010000001.1 GCA014201615_02455 gene open 2542467-2542577 Atu_C6
13 JACHEU010000001.1 GCA014201615_02634 gene open 2734088-2734235 ar9
14 JACHEU010000001.1 GCA014201615_02705 gene open 2809065-2809183 Atu_C8
15 JACHEU010000001.1 GCA014201615_02778 gene open 2886932-2887329 RNaseP_bact_a
16 JACHEU010000001.1 GCA014201615_00425 ncRNA open 419111-419253 Alphaproteobacterial sRNA BjrC1505
17 JACHEU010000001.1 GCA014201615_00447 ncRNA open 437429-437585 6S / SsrS RNA
18 JACHEU010000001.1 GCA014201615_00514 ncRNA open 504876-504999 Alphaproteobacterial ar14
19 JACHEU010000001.1 GCA014201615_00730 ncRNA open 736422-736557 Alphaproteobacterial sRNA ar35
20 JACHEU010000001.1 GCA014201615_00824 ncRNA open 841872-841923 ffh sRNA
21 JACHEU010000001.1 GCA014201615_01053 ncRNA open 1096074-1096170 Bacterial small signal recognition particle RNA
22 JACHEU010000001.1 GCA014201615_01090 ncRNA open 1130750-1130845 Alphaproteobacterial ar15
23 JACHEU010000001.1 GCA014201615_02275 ncRNA open 2354375-2354492 Alphaproteobacterial ar14
24 JACHEU010000001.1 GCA014201615_02276 ncRNA open 2354518-2354637 Alphaproteobacterial ar14
25 JACHEU010000001.1 GCA014201615_02455 ncRNA open 2542467-2542577 EcpR1
26 JACHEU010000001.1 GCA014201615_02634 ncRNA open 2734088-2734235 Alphaproteobacterial sRNA ar9
27 JACHEU010000001.1 GCA014201615_02705 ncRNA open 2809065-2809183 Rhizobiales sRNA Atu_C8
28 JACHEU010000001.1 GCA014201615_02778 ncRNA open 2886932-2887329 Bacterial RNase P class A
29 JACHEU010000001.1 regulatory_region open 97410-97495 Repression of heat shock gene expression (ROSE) element
30 JACHEU010000001.1 regulatory_region open 200274-200328 terC RNA
31 JACHEU010000001.1 regulatory_region open 233570-233767 Cobalamin riboswitch aptamer
32 JACHEU010000001.1 regulatory_region open 256902-256964 ybhL leader
33 JACHEU010000001.1 regulatory_region open 390082-390197 TPP riboswitch aptamer (THI element)
34 JACHEU010000001.1 regulatory_region open 401682-401734 serC leader
35 JACHEU010000001.1 regulatory_region open 448766-448844 Alpha-proteobacteria SAM riboswitch aptamer
36 JACHEU010000001.1 regulatory_region open 874581-874680 Pyrrolysine insertion sequence mttB
37 JACHEU010000001.1 regulatory_region open 1043461-1043538 Alpha-proteobacteria SAM riboswitch aptamer
38 JACHEU010000001.1 regulatory_region open 1404112-1404214 TPP riboswitch aptamer (THI element)
39 JACHEU010000001.1 regulatory_region open 1408669-1408879 Cobalamin riboswitch aptamer
40 JACHEU010000001.1 regulatory_region open 1418378-1418596 Cobalamin riboswitch aptamer
41 JACHEU010000001.1 regulatory_region open 1788613-1788744 AdoCbl (Cobalamin/B12) riboswitch aptamer
42 JACHEU010000001.1 regulatory_region open 1819778-1819859 chrB-a RNA
43 JACHEU010000001.1 regulatory_region open 2054980-2055018 THF-II riboswitch (folE RNA)
44 JACHEU010000001.1 regulatory_region open 2061426-2061593 FMN riboswitch aptamer (RFN element)
45 JACHEU010000001.1 regulatory_region open 2074760-2074847 Glycine riboswitch aptamer
46 JACHEU010000001.1 regulatory_region open 2659492-2659553 Fluoride riboswitch aptamer (crcB RNA motif)
47 JACHEU010000001.1 regulatory_region open 2769254-2769455 Cobalamin riboswitch aptamer
48 JACHEU010000001.1 repeat_region open 1873282-1873854 CRISPR array with 9 repeats of length 32%2C consensus sequence GTTTCGATCCACGCTCCCGCGAAGGGAGCGAC and spacer length 34
49 JACHEU010000001.1 GCA014201615_00001 CDS open 564-1337 _na     257_aa Membrane associated rhomboid family serine protease
50 JACHEU010000001.1 GCA014201615_00002 CDS open 1359-1940 _na     193_aa Corrinoid adenosyltransferase
51 JACHEU010000001.1 GCA014201615_00003 CDS open 1981-2172 _na     63_aa Hypoxia induced protein
52 JACHEU010000001.1 GCA014201615_00004 CDS open 2208-3047 _na     279_aa SDR family oxidoreductase
53 JACHEU010000001.1 GCA014201615_00005 CDS open 3122-3976 _na     284_aa Membrane protein
54 JACHEU010000001.1 GCA014201615_00006 CDS open 3946-4830 _na     294_aa Drug/metabolite transporter (DMT)-like permease
55 JACHEU010000001.1 GCA014201615_00007 CDS open 4924-5799 _na     291_aa gluQRS tRNA glutamyl-Q(34) synthetase GluQRS
56 JACHEU010000001.1 GCA014201615_00008 CDS open 5893-6534 _na     213_aa DNA-3-methyladenine glycosylase II
57 JACHEU010000001.1 GCA014201615_00009 CDS open 6642-7229 _na     195_aa mcrA 5-methylcytosine-specific restriction endonuclease McrA
58 JACHEU010000001.1 GCA014201615_00010 CDS open 7252-7548 _na     98_aa Phosphocarrier protein
59 JACHEU010000001.1 GCA014201615_00011 CDS open 7557-7958 _na     133_aa PTS fructose transporter subunit IIA
60 JACHEU010000001.1 GCA014201615_00012 CDS open 8104-8568 _na     154_aa Serine kinase of HPr protein (Carbohydrate metabolism regulator)
61 JACHEU010000001.1 GCA014201615_00013 CDS open 8577-10355 _na     592_aa histidine kinase
62 JACHEU010000001.1 GCA014201615_00014 CDS open 10486-11187 _na     233_aa bvrR response regulator transcription factor
63 JACHEU010000001.1 GCA014201615_00015 CDS open 11511-13121 _na     536_aa phosphoenolpyruvate carboxykinase
64 JACHEU010000001.1 GCA014201615_00016 CDS open 13202-13639 _na     145_aa arfB alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB
65 JACHEU010000001.1 GCA014201615_00017 CDS open 13711-14169 _na     152_aa lysM peptidoglycan-binding protein LysM
66 JACHEU010000001.1 GCA014201615_00018 CDS open 14272-14883 _na     203_aa Alkylated DNA repair protein (DNA oxidative demethylase)
67 JACHEU010000001.1 GCA014201615_00019 CDS open 14996-15955 _na     319_aa coaA type I pantothenate kinase
68 JACHEU010000001.1 GCA014201615_00020 CDS open 15982-16308 _na     108_aa phosphoribosyl-ATP diphosphatase
69 JACHEU010000001.1 GCA014201615_00021 CDS open 16317-17111 _na     264_aa hisF Imidazole glycerol phosphate synthase subunit HisF
70 JACHEU010000001.1 GCA014201615_00022 CDS open 17108-17872 _na     254_aa hisA 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase
71 JACHEU010000001.1 GCA014201615_00023 CDS open 17869-18519 _na     216_aa hisH imidazole glycerol phosphate synthase subunit HisH
72 JACHEU010000001.1 GCA014201615_00024 CDS open 18521-19012 _na     163_aa Putative lipid-binding transport protein (Tim44 family)
73 JACHEU010000001.1 GCA014201615_00025 CDS open 19015-19614 _na     199_aa hisB imidazoleglycerol-phosphate dehydratase HisB
74 JACHEU010000001.1 GCA014201615_00026 CDS open 19795-20346 _na     183_aa hslV ATP-dependent protease subunit HslV
75 JACHEU010000001.1 GCA014201615_00027 CDS open 20336-20851 _na     171_aa Aminoglycoside 6'-N-acetyltransferase
76 JACHEU010000001.1 GCA014201615_00028 CDS open 20861-21373 _na     170_aa RimJ/RimL family protein N-acetyltransferase
77 JACHEU010000001.1 GCA014201615_00029 CDS open 21515-22114 _na     199_aa UPF0314 protein HNR59_000030
78 JACHEU010000001.1 GCA014201615_00030 CDS open 22114-23178 _na     354_aa MFS family permease
79 JACHEU010000001.1 GCA014201615_00031 CDS open 23210-24520 _na     436_aa hslU ATP-dependent protease ATPase subunit HslU
80 JACHEU010000001.1 GCA014201615_00032 CDS open 24539-25585 _na     348_aa Chitooligosaccharide deacetylase
81 JACHEU010000001.1 GCA014201615_00033 CDS open 25582-26808 _na     408_aa Putative ATP-grasp superfamily ATP-dependent carboligase
82 JACHEU010000001.1 GCA014201615_00034 CDS open 26861-27148 _na     95_aa DUF1330 domain-containing protein
83 JACHEU010000001.1 GCA014201615_00035 CDS open 27184-27885 _na     233_aa pyrF orotidine-5'-phosphate decarboxylase
84 JACHEU010000001.1 GCA014201615_00036 CDS open 27882-28475 _na     197_aa NAD(P)H-dependent FMN reductase
85 JACHEU010000001.1 GCA014201615_00037 CDS open 28538-29059 _na     173_aa dsbB Disulfide bond formation protein DsbB
86 JACHEU010000001.1 GCA014201615_00038 CDS open 29078-29665 _na     195_aa dedA DedA family protein
87 JACHEU010000001.1 GCA014201615_00040 CDS open 30048-30653 _na     201_aa vasI Type VI secretion system protein VasI
88 JACHEU010000001.1 GCA014201615_00041 CDS open 30710-31519 _na     269_aa Putative N-formylglutamate amidohydrolase
89 JACHEU010000001.1 GCA014201615_00042 CDS open 31533-32870 _na     445_aa Glutamine synthetase
90 JACHEU010000001.1 GCA014201615_00043 CDS open 32895-33554 _na     219_aa Nicotinamidase-related amidase
91 JACHEU010000001.1 GCA014201615_00044 CDS open 33591-34460 _na     289_aa DNA-binding MurR/RpiR family transcriptional regulator
92 JACHEU010000001.1 GCA014201615_00045 CDS open 34572-36296 _na     574_aa nikD nickel import ATP-binding protein NikD
93 JACHEU010000001.1 GCA014201615_00046 CDS open 36293-37219 _na     308_aa Peptide/nickel transport system permease protein
94 JACHEU010000001.1 GCA014201615_00047 CDS open 37216-38193 _na     325_aa Peptide/nickel transport system permease protein
95 JACHEU010000001.1 GCA014201615_00048 CDS open 38190-39812 _na     540_aa Peptide/nickel transport system substrate-binding protein
96 JACHEU010000001.1 GCA014201615_00049 CDS open 39883-41208 _na     441_aa Acetylornithine deacetylase
97 JACHEU010000001.1 GCA014201615_00050 CDS open 41411-42073 _na     220_aa gntR DNA-binding GntR family transcriptional regulator
98 JACHEU010000001.1 GCA014201615_00051 CDS open 42242-43612 _na     456_aa Malonyl-CoA decarboxylase
99 JACHEU010000001.1 GCA014201615_00052 CDS open 43605-45116 _na     503_aa Malonyl-CoA/methylmalonyl-CoA synthetase
100 JACHEU010000001.1 GCA014201615_00053 CDS open 45200-46489 _na     429_aa BioF2-like acetyltransferase domain-containing protein
101 JACHEU010000001.1 GCA014201615_00054 CDS open 46489-47889 _na     466_aa O-antigen/teichoic acid export membrane protein
102 JACHEU010000001.1 GCA014201615_00055 CDS open 47997-48287 _na     96_aa N-acetyltransferase domain-containing protein
103 JACHEU010000001.1 GCA014201615_00056 CDS open 48296-48601 _na     101_aa N-acetyltransferase domain-containing protein
104 JACHEU010000001.1 GCA014201615_00057 CDS open 48598-49245 _na     215_aa Phospholipase/carboxylesterase
105 JACHEU010000001.1 GCA014201615_00058 CDS open 49256-50188 _na     310_aa Glyoxalase family protein
106 JACHEU010000001.1 GCA014201615_00059 CDS open 50394-51656 _na     420_aa ylmC Sporulation protein YlmC with PRC-barrel domain
107 JACHEU010000001.1 GCA014201615_00060 CDS open 51900-52802 _na     300_aa Diacylglycerol kinase family enzyme
108 JACHEU010000001.1 GCA014201615_00061 CDS open 52808-52993 _na     61_aa fliL Flagellar basal body-associated protein FliL
109 JACHEU010000001.1 GCA014201615_00062 CDS open 53082-53549 _na     155_aa High-affinity Fe2+/Pb2+ permease
110 JACHEU010000001.1 GCA014201615_00063 CDS open 53563-53889 _na     108_aa DUF883 domain-containing protein
111 JACHEU010000001.1 GCA014201615_00064 CDS open 54012-54797 _na     261_aa CRP-like cAMP-binding protein
112 JACHEU010000001.1 GCA014201615_00065 CDS open 54923-55324 _na     133_aa response regulator
113 JACHEU010000001.1 GCA014201615_00066 CDS open 55297-55845 _na     182_aa RNA polymerase sigma factor
114 JACHEU010000001.1 GCA014201615_00067 CDS open 55849-56049 _na     66_aa nepR Anti-sigma factor NepR domain-containing protein
115 JACHEU010000001.1 GCA014201615_00068 CDS open 56229-57074 _na     281_aa DNA-directed RNA polymerase specialized sigma24 family protein
116 JACHEU010000001.1 GCA014201615_00069 CDS open 57160-57324 _na     54_aa UPF0391 membrane protein BG36_06210
117 JACHEU010000001.1 GCA014201615_00070 CDS open 57482-58540 _na     352_aa histidine kinase
118 JACHEU010000001.1 GCA014201615_00071 CDS open 58587-58889 _na     100_aa Lipoprotein
119 JACHEU010000001.1 GCA014201615_00072 CDS open 59001-59249 _na     82_aa virB7 Type IV secretion system putative lipoprotein virB7
120 JACHEU010000001.1 GCA014201615_00073 CDS open 59381-60979 _na     532_aa histidine kinase
121 JACHEU010000001.1 GCA014201615_00074 CDS open 61075-61875 _na     266_aa mglA ABC-type sugar transport system%2C ATPase component
122 JACHEU010000001.1 GCA014201615_00075 CDS open 61887-63203 _na     438_aa xylH Xylose transport system permease protein XylH
123 JACHEU010000001.1 GCA014201615_00076 CDS open 63427-64467 _na     346_aa xylF D-xylose ABC transporter substrate-binding protein
124 JACHEU010000001.1 GCA014201615_00077 CDS open 64719-65984 _na     421_aa Putative NBD/HSP70 family sugar kinase
125 JACHEU010000001.1 GCA014201615_00078 CDS open 65971-66660 _na     229_aa phoB phosphate regulon transcriptional regulator PhoB
126 JACHEU010000001.1 GCA014201615_00079 CDS open 66683-67390 _na     235_aa phoU phosphate signaling complex protein PhoU
127 JACHEU010000001.1 GCA014201615_00080 CDS open 67429-68250 _na     273_aa pstB phosphate ABC transporter ATP-binding protein PstB
128 JACHEU010000001.1 GCA014201615_00081 CDS open 68267-69592 _na     441_aa pstA phosphate ABC transporter permease PstA
129 JACHEU010000001.1 GCA014201615_00082 CDS open 69589-71058 _na     489_aa pstC phosphate ABC transporter permease subunit PstC
130 JACHEU010000001.1 GCA014201615_00083 CDS open 71158-72195 _na     345_aa Phosphate ABC transporter substrate-binding protein (PhoT family)
131 JACHEU010000001.1 GCA014201615_00084 CDS open 72503-75829 _na     1108_aa histidine kinase
132 JACHEU010000001.1 GCA014201615_00085 CDS open 76450-76851 _na     133_aa Transmembrane protein
133 JACHEU010000001.1 GCA014201615_00086 CDS open 76918-77487 _na     189_aa Integral membrane protein
134 JACHEU010000001.1 GCA014201615_00088 CDS open 77689-78309 _na     206_aa nicotinate-nucleotide adenylyltransferase
135 JACHEU010000001.1 GCA014201615_00089 CDS open 78354-79640 _na     428_aa glutamate-5-semialdehyde dehydrogenase
136 JACHEU010000001.1 GCA014201615_00090 CDS open 79763-80947 _na     394_aa glutamate 5-kinase
137 JACHEU010000001.1 GCA014201615_00091 CDS open 80901-81941 _na     346_aa obgE GTPase ObgE
138 JACHEU010000001.1 GCA014201615_00092 CDS open 82085-82945 _na     286_aa Endonuclease
139 JACHEU010000001.1 GCA014201615_00093 CDS open 82978-83571 _na     197_aa RimJ/RimL family protein N-acetyltransferase
140 JACHEU010000001.1 GCA014201615_00094 CDS open 83693-83962 _na     89_aa rpmA 50S ribosomal protein L27
141 JACHEU010000001.1 GCA014201615_00095 CDS open 84065-84490 _na     141_aa rplU 50S ribosomal protein L21
142 JACHEU010000001.1 GCA014201615_00097 CDS open 86619-86951 _na     110_aa Transcriptional regulator
143 JACHEU010000001.1 GCA014201615_00098 CDS open 87026-87340 _na     104_aa hypothetical protein
144 JACHEU010000001.1 GCA014201615_00099 CDS open 87722-88462 _na     246_aa diguanylate cyclase
145 JACHEU010000001.1 GCA014201615_00100 CDS open 88720-89673 _na     317_aa ABC transporter permease
146 JACHEU010000001.1 GCA014201615_00101 CDS open 89663-90601 _na     312_aa ABC transporter domain-containing protein
147 JACHEU010000001.1 GCA014201615_00102 CDS open 90598-91797 _na     399_aa Alpha-galactosidase NEW3 domain-containing protein
148 JACHEU010000001.1 GCA014201615_00103 CDS open 91848-93218 _na     456_aa putative periplasmic serine endoprotease DegP-like
149 JACHEU010000001.1 GCA014201615_00104 CDS open 93352-93576 _na     74_aa DUF982 domain-containing protein
150 JACHEU010000001.1 GCA014201615_00105 CDS open 93648-95273 _na     541_aa groL chaperonin GroEL
151 JACHEU010000001.1 GCA014201615_00106 CDS open 95343-95657 _na     104_aa groES Co-chaperonin GroES
152 JACHEU010000001.1 GCA014201615_00107 CDS open 95998-96342 _na     114_aa hypothetical protein
153 JACHEU010000001.1 GCA014201615_00108 CDS open 96362-96640 _na     92_aa Protein usg
154 JACHEU010000001.1 GCA014201615_00109 CDS open 97054-97269 _na     71_aa DUF3572 domain-containing protein
155 JACHEU010000001.1 GCA014201615_00110 CDS open 97489-97965 _na     158_aa ibpA Molecular chaperone IbpA
156 JACHEU010000001.1 GCA014201615_00111 CDS open 98062-98574 _na     170_aa Hsp20/alpha crystallin family protein
157 JACHEU010000001.1 GCA014201615_00112 CDS open 98673-99377 _na     234_aa ETC complex I subunit
158 JACHEU010000001.1 GCA014201615_00113 CDS open 99387-99701 _na     104_aa DNA-directed RNA polymerase subunit omega
159 JACHEU010000001.1 GCA014201615_00114 CDS open 99732-100091 _na     119_aa SPW repeat protein
160 JACHEU010000001.1 GCA014201615_00115 CDS open 100213-102042 _na     609_aa ftsH ATP-dependent zinc metalloprotease FtsH
161 JACHEU010000001.1 GCA014201615_00116 CDS open 102281-102511 _na     76_aa DUF2274 domain-containing protein
162 JACHEU010000001.1 GCA014201615_00117 CDS open 102514-103641 _na     375_aa virB10 Type IV secretion system protein virB10
163 JACHEU010000001.1 GCA014201615_00118 CDS open 103638-104633 _na     331_aa trbG P-type conjugative transfer protein TrbG
164 JACHEU010000001.1 GCA014201615_00119 CDS open 104630-105319 _na     229_aa trbF conjugal transfer protein TrbF
165 JACHEU010000001.1 GCA014201615_00120 CDS open 105316-106656 _na     446_aa trbL P-type conjugative transfer protein TrbL
166 JACHEU010000001.1 GCA014201615_00121 CDS open 106659-106925 _na     88_aa trbK Conjugal transfer protein TrbK
167 JACHEU010000001.1 GCA014201615_00122 CDS open 106939-107712 _na     257_aa trbJ P-type conjugative transfer protein TrbJ
168 JACHEU010000001.1 GCA014201615_00123 CDS open 107709-110198 _na     829_aa trbE conjugal transfer protein TrbE
169 JACHEU010000001.1 GCA014201615_00124 CDS open 110212-110493 _na     93_aa trbD Conjugal transfer protein
170 JACHEU010000001.1 GCA014201615_00125 CDS open 110493-110825 _na     110_aa virB2 Type IV secretory pathway%2C VirB2 component
171 JACHEU010000001.1 GCA014201615_00126 CDS open 110822-111769 _na     315_aa trbB P-type conjugative transfer ATPase TrbB
172 JACHEU010000001.1 GCA014201615_00127 CDS open 112026-112595 _na     189_aa Adenylate kinase family enzyme
173 JACHEU010000001.1 GCA014201615_00128 CDS open 112613-113065 _na     150_aa Putative acetyltransferase
174 JACHEU010000001.1 GCA014201615_00129 CDS open 113193-113672 _na     159_aa copG CopG family transcriptional regulator
175 JACHEU010000001.1 GCA014201615_00130 CDS open 113683-115671 _na     662_aa virD4 Conjugal transfer protein TraG
176 JACHEU010000001.1 GCA014201615_00131 CDS open 115803-116699 _na     298_aa lysR LysR family transcriptional regulator
177 JACHEU010000001.1 GCA014201615_00132 CDS open 117126-119180 _na     684_aa virD2 MobA/VirD2-like nuclease domain-containing protein
178 JACHEU010000001.1 GCA014201615_00133 CDS open 119494-120261 _na     255_aa Soluble lytic murein transglycosylase-like protein
179 JACHEU010000001.1 GCA014201615_00134 CDS open 120284-120829 _na     181_aa traF S26 family signal peptidase
180 JACHEU010000001.1 GCA014201615_00135 CDS open 120826-121341 _na     171_aa SAM-dependent methyltransferase
181 JACHEU010000001.1 GCA014201615_00136 CDS open 121338-122567 _na     409_aa DNA (cytosine-5-)-methyltransferase
182 JACHEU010000001.1 GCA014201615_00137 CDS open 122564-123592 _na     342_aa Replication protein A
183 JACHEU010000001.1 GCA014201615_00138 CDS open 123593-123865 _na     90_aa DNA-binding protein
184 JACHEU010000001.1 GCA014201615_00139 CDS open 124332-124619 _na     95_aa DUF2285 domain-containing protein
185 JACHEU010000001.1 GCA014201615_00140 CDS open 124636-124977 _na     113_aa DUF2285 domain-containing protein
186 JACHEU010000001.1 GCA014201615_00141 CDS open 125204-125419 _na     71_aa Transcriptional regulator-like domain-containing protein
187 JACHEU010000001.1 GCA014201615_00142 CDS open 125770-125973 _na     67_aa hypothetical protein
188 JACHEU010000001.1 GCA014201615_00143 CDS open 126047-126718 _na     223_aa Methyltransferase
189 JACHEU010000001.1 GCA014201615_00144 CDS open 127026-127742 _na     238_aa YgjP-like metallopeptidase domain-containing protein
190 JACHEU010000001.1 GCA014201615_00145 CDS open 127739-130969 _na     1076_aa Type I restriction enzyme endonuclease subunit
191 JACHEU010000001.1 GCA014201615_00146 CDS open 131065-131382 _na     105_aa hypothetical protein
192 JACHEU010000001.1 GCA014201615_00147 CDS open 131434-131769 _na     111_aa hypothetical protein
193 JACHEU010000001.1 GCA014201615_00148 CDS open 131838-132359 _na     173_aa Putative integral membrane protein
194 JACHEU010000001.1 GCA014201615_00149 CDS open 132353-133597 _na     414_aa Type I restriction enzyme S subunit
195 JACHEU010000001.1 GCA014201615_00150 CDS open 133590-134615 _na     341_aa rhuM Bro-N domain-containing protein
196 JACHEU010000001.1 GCA014201615_00151 CDS open 134608-136125 _na     505_aa hsdM type I restriction-modification system subunit M
197 JACHEU010000001.1 GCA014201615_00152 CDS open 136122-136727 _na     201_aa Type I restriction modification DNA specificity domain-containing protein
198 JACHEU010000001.1 GCA014201615_00153 CDS open 137065-138402 _na     445_aa Integrase
199 JACHEU010000001.1 GCA014201615_00154 CDS open 138847-139545 _na     232_aa hypothetical protein
200 JACHEU010000001.1 GCA014201615_00155 CDS open 140049-140618 _na     189_aa Integrase
201 JACHEU010000001.1 GCA014201615_00156 CDS open 140618-141046 _na     142_aa hypothetical protein
202 JACHEU010000001.1 GCA014201615_00157 CDS open 141074-141484 _na     136_aa Transmembrane protein
203 JACHEU010000001.1 GCA014201615_00158 CDS open 141984-142919 _na     311_aa Methyltransferase
204 JACHEU010000001.1 GCA014201615_00159 CDS open 142923-144023 _na     366_aa DGQHR domain-containing protein
205 JACHEU010000001.1 GCA014201615_00160 CDS open 144227-144898 _na     223_aa hypothetical protein
206 JACHEU010000001.1 GCA014201615_00161 CDS open 145506-146312 _na     268_aa DUF4412 domain-containing protein
207 JACHEU010000001.1 GCA014201615_00162 CDS open 146371-147324 _na     317_aa Putative Co/Zn/Cd cation transporter (Cation efflux family)
208 JACHEU010000001.1 GCA014201615_00163 CDS open 147710-148834 _na     374_aa DNA repair exonuclease SbcCD nuclease subunit
209 JACHEU010000001.1 GCA014201615_00164 CDS open 148831-151452 _na     873_aa DNA repair exonuclease SbcCD ATPase subunit
210 JACHEU010000001.1 GCA014201615_00165 CDS open 151457-152803 _na     448_aa hemN oxygen-independent coproporphyrinogen III oxidase
211 JACHEU010000001.1 GCA014201615_00166 CDS open 152948-153670 _na     240_aa CRP/FNR family transcriptional regulator
212 JACHEU010000001.1 GCA014201615_00167 CDS open 153684-154112 _na     142_aa Hemerythrin-like domain-containing protein
213 JACHEU010000001.1 GCA014201615_00168 CDS open 154292-155953 _na     553_aa ccoN cytochrome-c oxidase%2C cbb3-type subunit I
214 JACHEU010000001.1 GCA014201615_00169 CDS open 155966-156697 _na     243_aa ccoO cytochrome-c oxidase%2C cbb3-type subunit II
215 JACHEU010000001.1 GCA014201615_00170 CDS open 156707-156859 _na     50_aa Cytochrome c oxidase cbb3-type subunit 4
216 JACHEU010000001.1 GCA014201615_00171 CDS open 156861-157715 _na     284_aa ccoP cytochrome-c oxidase%2C cbb3-type subunit III
217 JACHEU010000001.1 GCA014201615_00172 CDS open 157909-159465 _na     518_aa ccoG cytochrome c oxidase accessory protein CcoG
218 JACHEU010000001.1 GCA014201615_00173 CDS open 159468-159950 _na     160_aa fixH Nitrogen fixation protein FixH
219 JACHEU010000001.1 GCA014201615_00174 CDS open 159947-162184 _na     745_aa Cu2+-exporting ATPase
220 JACHEU010000001.1 GCA014201615_00175 CDS open 162181-162339 _na     52_aa ccoS cbb3-type cytochrome oxidase assembly protein CcoS
221 JACHEU010000001.1 GCA014201615_00177 CDS open 162769-162945 _na     58_aa Transcriptional regulator
222 JACHEU010000001.1 GCA014201615_00178 CDS open 163138-164427 _na     429_aa murA UDP-N-acetylglucosamine 1-carboxyvinyltransferase
223 JACHEU010000001.1 GCA014201615_00179 CDS open 164519-164953 _na     144_aa DUF2948 domain-containing protein
224 JACHEU010000001.1 GCA014201615_00180 CDS open 164959-166251 _na     430_aa Histidinol dehydrogenase
225 JACHEU010000001.1 GCA014201615_00181 CDS open 166257-166742 _na     161_aa UPF0262 protein BG36_18985
226 JACHEU010000001.1 GCA014201615_00182 CDS open 166792-167190 _na     132_aa low molecular weight phosphatase family protein
227 JACHEU010000001.1 GCA014201615_00183 CDS open 167290-167727 _na     145_aa Transmembrane protein
228 JACHEU010000001.1 GCA014201615_00184 CDS open 167896-169326 _na     476_aa AGZA family xanthine/uracil permease-like MFS transporter
229 JACHEU010000001.1 GCA014201615_00185 CDS open 169746-169964 _na     72_aa infA translation initiation factor IF-1
230 JACHEU010000001.1 GCA014201615_00186 CDS open 169986-170621 _na     211_aa Maf-like protein
231 JACHEU010000001.1 GCA014201615_00187 CDS open 170618-170833 _na     71_aa yacG DNA gyrase inhibitor YacG
232 JACHEU010000001.1 GCA014201615_00188 CDS open 170988-172409 _na     473_aa glutamine synthetase family protein
233 JACHEU010000001.1 GCA014201615_00189 CDS open 172461-173747 _na     428_aa Gamma-glutamylputrescine oxidase
234 JACHEU010000001.1 GCA014201615_00190 CDS open 174007-174414 _na     135_aa F0F1 ATP synthase subunit epsilon
235 JACHEU010000001.1 GCA014201615_00191 CDS open 174420-174614 _na     64_aa YHS domain-containing protein
236 JACHEU010000001.1 GCA014201615_00192 CDS open 174618-176264 _na     548_aa atpD F0F1 ATP synthase subunit beta
237 JACHEU010000001.1 GCA014201615_00193 CDS open 176335-177213 _na     292_aa F0F1 ATP synthase subunit gamma
238 JACHEU010000001.1 GCA014201615_00194 CDS open 177248-178777 _na     509_aa atpA F0F1 ATP synthase subunit alpha
239 JACHEU010000001.1 GCA014201615_00195 CDS open 178777-179337 _na     186_aa F0F1 ATP synthase subunit delta
240 JACHEU010000001.1 GCA014201615_00196 CDS open 179573-179968 _na     131_aa Membrane protein
241 JACHEU010000001.1 GCA014201615_00197 CDS open 180046-180747 _na     233_aa Aspartate racemase
242 JACHEU010000001.1 GCA014201615_00198 CDS open 180773-182956 _na     727_aa primosomal protein N'
243 JACHEU010000001.1 GCA014201615_00199 CDS open 183047-183700 _na     217_aa fsa fructose-6-phosphate aldolase
244 JACHEU010000001.1 GCA014201615_00200 CDS open 183751-184332 _na     193_aa LPS-assembly lipoprotein
245 JACHEU010000001.1 GCA014201615_00201 CDS open 184319-186970 _na     883_aa leuS leucine--tRNA ligase
246 JACHEU010000001.1 GCA014201615_00202 CDS open 187100-187762 _na     220_aa Pyridoxal phosphate homeostasis protein
247 JACHEU010000001.1 GCA014201615_00203 CDS open 187994-189100 _na     368_aa Amino acid ABC transporter substrate-binding protein
248 JACHEU010000001.1 GCA014201615_00204 CDS open 189439-191391 _na     650_aa acs acetate--CoA ligase
249 JACHEU010000001.1 GCA014201615_00205 CDS open 191517-191735 _na     72_aa DUF1674 domain-containing protein
250 JACHEU010000001.1 GCA014201615_00206 CDS open 191840-192919 _na     359_aa htpX zinc metalloprotease HtpX
251 JACHEU010000001.1 GCA014201615_00207 CDS open 192877-194325 _na     482_aa 16S rRNA (Cytosine967-C5)-methyltransferase
252 JACHEU010000001.1 GCA014201615_00208 CDS open 194486-196195 _na     569_aa Putative heparinase superfamily protein
253 JACHEU010000001.1 GCA014201615_00209 CDS open 196301-197917 _na     538_aa purH bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase
254 JACHEU010000001.1 GCA014201615_00210 CDS open 197952-199334 _na     460_aa MFS transporter
255 JACHEU010000001.1 GCA014201615_00211 CDS open 199492-200148 _na     218_aa yjbE YjbE family integral membrane protein
256 JACHEU010000001.1 GCA014201615_00212 CDS open 200430-205241 _na     1603_aa Glutamate dehydrogenase
257 JACHEU010000001.1 GCA014201615_00213 CDS open 205360-205974 _na     204_aa lysE Lysine transporter LysE
258 JACHEU010000001.1 GCA014201615_00214 CDS open 206114-207940 _na     608_aa typA translational GTPase TypA
259 JACHEU010000001.1 GCA014201615_00215 CDS open 208154-208438 _na     94_aa hypothetical protein
260 JACHEU010000001.1 GCA014201615_00216 CDS open 208448-209731 _na     427_aa MFS transporter
261 JACHEU010000001.1 GCA014201615_00217 CDS open 209804-210418 _na     204_aa acrR AcrR family transcriptional regulator
262 JACHEU010000001.1 GCA014201615_00218 CDS open 210415-212469 _na     684_aa Peptidyl-dipeptidase Dcp
263 JACHEU010000001.1 GCA014201615_00219 CDS open 212598-213011 _na     137_aa DUF4440 domain-containing protein
264 JACHEU010000001.1 GCA014201615_00220 CDS open 213059-213700 _na     213_aa Carbonic anhydrase
265 JACHEU010000001.1 GCA014201615_00221 CDS open 213829-214695 _na     288_aa pdxY pyridoxal kinase PdxY
266 JACHEU010000001.1 GCA014201615_00222 CDS open 214699-214995 _na     98_aa hypothetical protein
267 JACHEU010000001.1 GCA014201615_00223 CDS open 215106-215759 _na     217_aa lemA LemA family protein
268 JACHEU010000001.1 GCA014201615_00224 CDS open 215794-216648 _na     284_aa ygcG YgcG family protein
269 JACHEU010000001.1 GCA014201615_00225 CDS open 216649-217287 _na     212_aa Putative membrane protein
270 JACHEU010000001.1 GCA014201615_00226 CDS open 217376-217882 _na     168_aa Ribosomal protein S18 acetylase RimI-like enzyme
271 JACHEU010000001.1 GCA014201615_00227 CDS open 218130-218663 _na     177_aa ppa inorganic diphosphatase
272 JACHEU010000001.1 GCA014201615_00228 CDS open 218683-218997 _na     104_aa UPF0235 protein HNR59_000225
273 JACHEU010000001.1 GCA014201615_00229 CDS open 219006-219296 _na     96_aa Membrane protein
274 JACHEU010000001.1 GCA014201615_00231 CDS open 219615-219800 _na     61_aa Transposase
275 JACHEU010000001.1 GCA014201615_00232 CDS open 220002-221924 _na     640_aa Diguanylate cyclase (GGDEF)-like protein
276 JACHEU010000001.1 GCA014201615_00233 CDS open 221952-223415 _na     487_aa Selenocysteine lyase/cysteine desulfurase
277 JACHEU010000001.1 GCA014201615_00234 CDS open 223532-224017 _na     161_aa Lrp/AsnC family transcriptional regulator
278 JACHEU010000001.1 GCA014201615_00235 CDS open 224077-224217 _na     46_aa cydX cytochrome bd-I oxidase subunit CydX
279 JACHEU010000001.1 GCA014201615_00236 CDS open 224235-225392 _na     385_aa cydB cytochrome d ubiquinol oxidase subunit II
280 JACHEU010000001.1 GCA014201615_00237 CDS open 225398-226975 _na     525_aa Cytochrome d ubiquinol oxidase subunit I
281 JACHEU010000001.1 GCA014201615_00238 CDS open 227043-228737 _na     564_aa cydC ATP-binding cassette subfamily C protein CydC
282 JACHEU010000001.1 GCA014201615_00239 CDS open 228734-230530 _na     598_aa cydD thiol reductant ABC exporter subunit CydD
283 JACHEU010000001.1 GCA014201615_00240 CDS open 230527-231099 _na     190_aa HTH-type transcriptional regulator
284 JACHEU010000001.1 GCA014201615_00241 CDS open 231237-231863 _na     208_aa Protein tyrosine/serine phosphatase
285 JACHEU010000001.1 GCA014201615_00242 CDS open 231874-232947 _na     357_aa 5-(carboxyamino)imidazole ribonucleotide synthase
286 JACHEU010000001.1 GCA014201615_00243 CDS open 232947-233444 _na     165_aa N5-carboxyaminoimidazole ribonucleotide mutase
287 JACHEU010000001.1 GCA014201615_00244 CDS open 233935-235791 _na     618_aa Vitamin B12 transporter
288 JACHEU010000001.1 GCA014201615_00245 CDS open 235894-236781 _na     295_aa Iron complex transport system substrate-binding protein
289 JACHEU010000001.1 GCA014201615_00246 CDS open 236778-237779 _na     333_aa Iron complex transport system permease protein
290 JACHEU010000001.1 GCA014201615_00247 CDS open 237776-238558 _na     260_aa Iron complex transport system ATP-binding protein
291 JACHEU010000001.1 GCA014201615_00248 CDS open 238559-239698 _na     379_aa NTE family protein
292 JACHEU010000001.1 GCA014201615_00249 CDS open 239744-240526 _na     260_aa 3-hydroxybutyrate dehydrogenase
293 JACHEU010000001.1 GCA014201615_00250 CDS open 240668-241726 _na     352_aa Iron(III) transport system substrate-binding protein
294 JACHEU010000001.1 GCA014201615_00251 CDS open 241733-243313 _na     526_aa Iron(III) transport system permease protein
295 JACHEU010000001.1 GCA014201615_00252 CDS open 243310-244350 _na     346_aa Iron(III) transport system ATP-binding protein
296 JACHEU010000001.1 GCA014201615_00253 CDS open 244466-245692 _na     408_aa argininosuccinate synthase
297 JACHEU010000001.1 GCA014201615_00254 CDS open 245994-247259 _na     421_aa Glutamate dehydrogenase
298 JACHEU010000001.1 GCA014201615_00255 CDS open 247353-247994 _na     213_aa rhtB Threonine transporter RhtB
299 JACHEU010000001.1 GCA014201615_00256 CDS open 247966-248457 _na     163_aa DUF2179 domain-containing protein
300 JACHEU010000001.1 GCA014201615_00257 CDS open 248454-249686 _na     410_aa rlmN 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN
301 JACHEU010000001.1 GCA014201615_00258 CDS open 249912-250415 _na     167_aa Signal peptide protein
302 JACHEU010000001.1 GCA014201615_00259 CDS open 250777-251139 _na     120_aa DUF1232 domain-containing protein
303 JACHEU010000001.1 GCA014201615_00260 CDS open 251241-251537 _na     98_aa 4a-hydroxytetrahydrobiopterin dehydratase
304 JACHEU010000001.1 GCA014201615_00261 CDS open 251590-252102 _na     170_aa protein-tyrosine-phosphatase
305 JACHEU010000001.1 GCA014201615_00262 CDS open 252012-252602 _na     196_aa thpR RNA 2'%2C3'-cyclic phosphodiesterase
306 JACHEU010000001.1 GCA014201615_00263 CDS open 252721-253377 _na     218_aa Acyl-CoA thioesterase-1
307 JACHEU010000001.1 GCA014201615_00264 CDS open 253453-254172 _na     239_aa ABC transporter
308 JACHEU010000001.1 GCA014201615_00265 CDS open 254169-256721 _na     850_aa Glycosyl transferase family 1
309 JACHEU010000001.1 GCA014201615_00266 CDS open 256982-257761 _na     259_aa Bax inhibitor-1/YccA family protein
310 JACHEU010000001.1 GCA014201615_00267 CDS open 257866-258423 _na     185_aa Phosphinothricin acetyltransferase
311 JACHEU010000001.1 GCA014201615_00268 CDS open 258427-258813 _na     128_aa DUF2794 domain-containing protein
312 JACHEU010000001.1 GCA014201615_00269 CDS open 259257-260036 _na     259_aa DUF1223 domain-containing protein
313 JACHEU010000001.1 GCA014201615_00270 CDS open 260201-262903 _na     900_aa acnA aconitate hydratase AcnA
314 JACHEU010000001.1 GCA014201615_00271 CDS open 263177-263791 _na     204_aa ccmA heme ABC exporter ATP-binding protein CcmA
315 JACHEU010000001.1 GCA014201615_00272 CDS open 263861-264526 _na     221_aa ccmB heme exporter protein CcmB
316 JACHEU010000001.1 GCA014201615_00273 CDS open 264679-264852 _na     57_aa ccmD heme exporter protein CcmD
317 JACHEU010000001.1 GCA014201615_00274 CDS open 264849-265424 _na     191_aa dsbE Cytochrome c biogenesis protein CcmG/thiol:disulfide interchange protein DsbE
318 JACHEU010000001.1 GCA014201615_00275 CDS open 265415-265582 _na     55_aa DUF1127 domain-containing protein
319 JACHEU010000001.1 GCA014201615_00276 CDS open 265743-266402 _na     219_aa septation protein A
320 JACHEU010000001.1 GCA014201615_00277 CDS open 266460-267434 _na     324_aa ftsY signal recognition particle-docking protein FtsY
321 JACHEU010000001.1 GCA014201615_00278 CDS open 268037-269350 _na     437_aa mtaB tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB
322 JACHEU010000001.1 GCA014201615_00279 CDS open 269350-270237 _na     295_aa dapF diaminopimelate epimerase
323 JACHEU010000001.1 GCA014201615_00280 CDS open 270477-271022 _na     181_aa Alkaline proteinase inhibitor/ Outer membrane lipoprotein Omp19 domain-containing protein
324 JACHEU010000001.1 GCA014201615_00281 CDS open 271045-272259 _na     404_aa zapE cell division protein ZapE
325 JACHEU010000001.1 GCA014201615_00282 CDS open 272509-273477 _na     322_aa mdh malate dehydrogenase
326 JACHEU010000001.1 GCA014201615_00283 CDS open 273496-274692 _na     398_aa sucC ADP-forming succinate--CoA ligase subunit beta
327 JACHEU010000001.1 GCA014201615_00284 CDS open 274699-275601 _na     300_aa sucD succinate--CoA ligase subunit alpha
328 JACHEU010000001.1 GCA014201615_00285 CDS open 275739-278726 _na     995_aa 2-oxoglutarate dehydrogenase E1 component
329 JACHEU010000001.1 GCA014201615_00286 CDS open 278757-280016 _na     419_aa odhB 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase
330 JACHEU010000001.1 GCA014201615_00287 CDS open 280034-280549 _na     171_aa Spore coat protein U domain-containing protein
331 JACHEU010000001.1 GCA014201615_00288 CDS open 280631-282037 _na     468_aa lpdA dihydrolipoyl dehydrogenase
332 JACHEU010000001.1 GCA014201615_00289 CDS open 282172-282597 _na     141_aa Type IV secretory pathway VirB10-like protein
333 JACHEU010000001.1 GCA014201615_00290 CDS open 282688-283755 _na     355_aa gumN Polysaccharide biosynthesis protein GumN
334 JACHEU010000001.1 GCA014201615_00291 CDS open 283806-284696 _na     296_aa xerC Tyrosine recombinase XerC
335 JACHEU010000001.1 GCA014201615_00292 CDS open 284854-285450 _na     198_aa rimM ribosome maturation factor RimM
336 JACHEU010000001.1 GCA014201615_00293 CDS open 285447-286133 _na     228_aa trmD tRNA (guanosine(37)-N1)-methyltransferase TrmD
337 JACHEU010000001.1 GCA014201615_00294 CDS open 286187-287044 _na     285_aa RNA polymerase factor sigma-32
338 JACHEU010000001.1 GCA014201615_00295 CDS open 287170-288219 _na     349_aa Membrane dipeptidase
339 JACHEU010000001.1 GCA014201615_00296 CDS open 288261-288764 _na     167_aa DNA-binding Lrp family transcriptional regulator
340 JACHEU010000001.1 GCA014201615_00297 CDS open 288869-290062 _na     397_aa diaminopropionate ammonia-lyase
341 JACHEU010000001.1 GCA014201615_00298 CDS open 290100-290702 _na     200_aa phaR polyhydroxyalkanoate synthesis repressor PhaR
342 JACHEU010000001.1 GCA014201615_00299 CDS open 290986-292173 _na     395_aa Acetyl-CoA acetyltransferase
343 JACHEU010000001.1 GCA014201615_00300 CDS open 292289-293011 _na     240_aa Acetoacetyl-CoA reductase
344 JACHEU010000001.1 GCA014201615_00301 CDS open 293646-296816 _na     1056_aa ATP-dependent RNA helicase SUPV3L1/SUV3
345 JACHEU010000001.1 GCA014201615_00302 CDS open 296838-297218 _na     126_aa Ribosome-associated heat shock protein Hsp15
346 JACHEU010000001.1 GCA014201615_00303 CDS open 297370-297708 _na     112_aa fdxA ferredoxin FdxA
347 JACHEU010000001.1 GCA014201615_00304 CDS open 298052-298633 _na     193_aa cdnL RNA polymerase-binding transcription factor CarD
348 JACHEU010000001.1 GCA014201615_00305 CDS open 298706-299416 _na     236_aa glutamine amidotransferase
349 JACHEU010000001.1 GCA014201615_00306 CDS open 299551-300030 _na     159_aa Putative tellurite resistance protein B-like protein
350 JACHEU010000001.1 GCA014201615_00307 CDS open 300030-301769 _na     579_aa hemY HemY protein
351 JACHEU010000001.1 GCA014201615_00308 CDS open 301773-303170 _na     465_aa Phage tail protein
352 JACHEU010000001.1 GCA014201615_00309 CDS open 303277-303912 _na     211_aa uroporphyrinogen-III synthase
353 JACHEU010000001.1 GCA014201615_00310 CDS open 303993-304940 _na     315_aa hemC hydroxymethylbilane synthase
354 JACHEU010000001.1 GCA014201615_00311 CDS open 305004-306125 _na     373_aa tsaD tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD
355 JACHEU010000001.1 GCA014201615_00312 CDS open 306122-307120 _na     332_aa Glycerol-3-phosphate dehydrogenase [NAD(P)+]
356 JACHEU010000001.1 GCA014201615_00313 CDS open 307132-307425 _na     97_aa YciI-like protein
357 JACHEU010000001.1 GCA014201615_00314 CDS open 307442-307882 _na     146_aa Putative RNA-binding protein with PUA-like domain
358 JACHEU010000001.1 GCA014201615_00315 CDS open 307879-308544 _na     221_aa Putative nicotinamide N-methyase
359 JACHEU010000001.1 GCA014201615_00316 CDS open 308537-309100 _na     187_aa ykuD L%2CD-peptidoglycan transpeptidase YkuD (ErfK/YbiS/YcfS/YnhG family)
360 JACHEU010000001.1 GCA014201615_00317 CDS open 309226-309909 _na     227_aa ompR Transcriptional regulatory protein WalR
361 JACHEU010000001.1 GCA014201615_00318 CDS open 309993-310448 _na     151_aa CRP-like cAMP-binding protein
362 JACHEU010000001.1 GCA014201615_00319 CDS open 310462-311277 _na     271_aa exodeoxyribonuclease III
363 JACHEU010000001.1 GCA014201615_00320 CDS open 311359-312051 _na     230_aa Outer membrane lipoprotein-sorting protein
364 JACHEU010000001.1 GCA014201615_00321 CDS open 312248-314923 _na     891_aa ftsK DNA translocase FtsK
365 JACHEU010000001.1 GCA014201615_00322 CDS open 315167-316309 _na     380_aa Porin
366 JACHEU010000001.1 GCA014201615_00323 CDS open 316685-317827 _na     380_aa Porin
367 JACHEU010000001.1 GCA014201615_00324 CDS open 318257-319612 _na     451_aa Ammonium transporter
368 JACHEU010000001.1 GCA014201615_00325 CDS open 319645-319983 _na     112_aa Nitrogen regulatory protein P-II
369 JACHEU010000001.1 GCA014201615_00326 CDS open 320203-321072 _na     289_aa Acyl-CoA thioesterase-2
370 JACHEU010000001.1 GCA014201615_00327 CDS open 321174-322439 _na     421_aa ubiquinone biosynthesis hydroxylase
371 JACHEU010000001.1 GCA014201615_00328 CDS open 322479-322940 _na     153_aa Prolyl-tRNA editing enzyme YbaK/EbsC (Cys-tRNA(Pro) deacylase)
372 JACHEU010000001.1 GCA014201615_00329 CDS open 323125-323562 _na     145_aa osmC Osmotically inducible protein OsmC
373 JACHEU010000001.1 GCA014201615_00330 CDS open 323635-324270 _na     211_aa DUF480 domain-containing protein
374 JACHEU010000001.1 GCA014201615_00331 CDS open 324390-325169 _na     259_aa sdhB Succinate dehydrogenase iron-sulfur subunit
375 JACHEU010000001.1 GCA014201615_00332 CDS open 325181-326989 _na     602_aa sdhA succinate dehydrogenase flavoprotein subunit
376 JACHEU010000001.1 GCA014201615_00333 CDS open 326993-327388 _na     131_aa sdhD succinate dehydrogenase%2C hydrophobic membrane anchor protein
377 JACHEU010000001.1 GCA014201615_00334 CDS open 327385-327807 _na     140_aa sdhC succinate dehydrogenase%2C cytochrome b556 subunit
378 JACHEU010000001.1 GCA014201615_00335 CDS open 328038-328424 _na     128_aa C-type lysozyme inhibitor domain-containing protein
379 JACHEU010000001.1 GCA014201615_00336 CDS open 328782-329141 _na     119_aa Secreted protein
380 JACHEU010000001.1 GCA014201615_00337 CDS open 329323-330732 _na     469_aa leuC 3-isopropylmalate dehydratase large subunit
381 JACHEU010000001.1 GCA014201615_00338 CDS open 331047-331865 _na     272_aa Polar amino acid transport system permease protein
382 JACHEU010000001.1 GCA014201615_00339 CDS open 331926-332723 _na     265_aa Polar amino acid transport system substrate-binding protein
383 JACHEU010000001.1 GCA014201615_00340 CDS open 332917-333450 _na     177_aa rplS 50S ribosomal protein L19
384 JACHEU010000001.1 GCA014201615_00341 CDS open 333677-333838 _na     53_aa Transmembrane protein
385 JACHEU010000001.1 GCA014201615_00342 CDS open 333992-335899 _na     635_aa Propionyl-CoA synthetase
386 JACHEU010000001.1 GCA014201615_00343 CDS open 336000-337766 _na     588_aa Permease
387 JACHEU010000001.1 GCA014201615_00344 CDS open 337849-338148 _na     99_aa DUF1127 domain-containing protein
388 JACHEU010000001.1 GCA014201615_00345 CDS open 338310-339026 _na     238_aa deoR DeoR faimly transcriptional regulator
389 JACHEU010000001.1 GCA014201615_00346 CDS open 339239-340039 _na     266_aa Polyamine ABC transporter permease
390 JACHEU010000001.1 GCA014201615_00347 CDS open 340039-341220 _na     393_aa ABC transporter permease
391 JACHEU010000001.1 GCA014201615_00348 CDS open 341217-342284 _na     355_aa potA Spermidine/putrescine import ATP-binding protein PotA
392 JACHEU010000001.1 GCA014201615_00349 CDS open 342378-343427 _na     349_aa Putative spermidine/putrescine transport system substrate-binding protein
393 JACHEU010000001.1 GCA014201615_00350 CDS open 343870-344454 _na     194_aa XRE family transcriptional regulator
394 JACHEU010000001.1 GCA014201615_00351 CDS open 344617-345066 _na     149_aa ridA Enamine deaminase RidA (YjgF/YER057c/UK114 family)
395 JACHEU010000001.1 GCA014201615_00352 CDS open 345063-346292 _na     409_aa Acyl-CoA dehydrogenase
396 JACHEU010000001.1 GCA014201615_00353 CDS open 346296-347138 _na     280_aa enoyl-CoA hydratase family protein
397 JACHEU010000001.1 GCA014201615_00354 CDS open 347169-347627 _na     152_aa Quercetin dioxygenase-like cupin family protein
398 JACHEU010000001.1 GCA014201615_00355 CDS open 347643-348416 _na     257_aa 3-hydroxyacyl-CoA dehydrogenase
399 JACHEU010000001.1 GCA014201615_00356 CDS open 348413-350737 _na     774_aa bifunctional salicylyl-CoA 5-hydroxylase/oxidoreductase
400 JACHEU010000001.1 GCA014201615_00357 CDS open 350911-351432 _na     173_aa Transcriptional regulator
401 JACHEU010000001.1 GCA014201615_00358 CDS open 351519-352487 _na     322_aa Threonine dehydratase
402 JACHEU010000001.1 GCA014201615_00359 CDS open 352484-353296 _na     270_aa gntR GntR family transcriptional regulator
403 JACHEU010000001.1 GCA014201615_00360 CDS open 353480-354466 _na     328_aa ABC transporter
404 JACHEU010000001.1 GCA014201615_00361 CDS open 354552-355331 _na     259_aa ABC transporter ATP-binding protein
405 JACHEU010000001.1 GCA014201615_00362 CDS open 355336-356259 _na     307_aa Putative ABC transport system permease protein
406 JACHEU010000001.1 GCA014201615_00363 CDS open 356478-357725 _na     415_aa kynU kynureninase
407 JACHEU010000001.1 GCA014201615_00364 CDS open 357805-358491 _na     228_aa ABC transporter ATP-binding protein
408 JACHEU010000001.1 GCA014201615_00365 CDS open 358488-359237 _na     249_aa Amino acid/amide ABC transporter ATP-binding protein 1 (HAAT family)
409 JACHEU010000001.1 GCA014201615_00366 CDS open 359230-360210 _na     326_aa Branched-chain amino acid transport system permease protein
410 JACHEU010000001.1 GCA014201615_00367 CDS open 360207-361127 _na     306_aa livH LIV-I protein H
411 JACHEU010000001.1 GCA014201615_00368 CDS open 361293-362429 _na     378_aa ABC transporter substrate-binding protein
412 JACHEU010000001.1 GCA014201615_00369 CDS open 362469-363308 _na     279_aa kynA tryptophan 2%2C3-dioxygenase
413 JACHEU010000001.1 GCA014201615_00370 CDS open 363305-364927 _na     540_aa 2-aminobenzoate-CoA ligase
414 JACHEU010000001.1 GCA014201615_00371 CDS open 365190-366020 _na     276_aa Alpha/beta hydrolase family protein
415 JACHEU010000001.1 GCA014201615_00372 CDS open 366160-367041 _na     293_aa Beta-lactamase
416 JACHEU010000001.1 GCA014201615_00373 CDS open 367049-367366 _na     105_aa arsR DNA-binding transcriptional ArsR family regulator
417 JACHEU010000001.1 GCA014201615_00374 CDS open 367397-367621 _na     74_aa Inner membrane protein YgaP-like transmembrane domain-containing protein
418 JACHEU010000001.1 GCA014201615_00375 CDS open 367618-368046 _na     142_aa YeeE/YedE family protein
419 JACHEU010000001.1 GCA014201615_00376 CDS open 368046-368456 _na     136_aa Permease
420 JACHEU010000001.1 GCA014201615_00377 CDS open 368518-369210 _na     230_aa Cytoplasmic protein
421 JACHEU010000001.1 GCA014201615_00378 CDS open 369445-371646 _na     733_aa Alkaline phosphatase
422 JACHEU010000001.1 GCA014201615_00379 CDS open 371666-372097 _na     143_aa 2Fe-2S ferredoxin
423 JACHEU010000001.1 GCA014201615_00380 CDS open 372094-372687 _na     197_aa Biotin transporter
424 JACHEU010000001.1 GCA014201615_00381 CDS open 372956-373624 _na     222_aa gntR GntR family transcriptional regulator
425 JACHEU010000001.1 GCA014201615_00382 CDS open 373828-373968 _na     46_aa DUF1127 domain-containing protein
426 JACHEU010000001.1 GCA014201615_00383 CDS open 374105-375115 _na     336_aa Putative PIG3 family NAD(P)H quinone oxidoreductase
427 JACHEU010000001.1 GCA014201615_00384 CDS open 375251-375445 _na     64_aa DUF1192 domain-containing protein
428 JACHEU010000001.1 GCA014201615_00385 CDS open 375569-376816 _na     415_aa MFS transporter
429 JACHEU010000001.1 GCA014201615_00386 CDS open 376849-377112 _na     87_aa arsR DNA-binding transcriptional ArsR family regulator
430 JACHEU010000001.1 GCA014201615_00387 CDS open 377232-377414 _na     60_aa rpmF 50S ribosomal protein L32
431 JACHEU010000001.1 GCA014201615_00388 CDS open 377549-378322 _na     257_aa mtgA monofunctional biosynthetic peptidoglycan transglycosylase
432 JACHEU010000001.1 GCA014201615_00389 CDS open 378370-379344 _na     324_aa Farnesyl diphosphate synthase
433 JACHEU010000001.1 GCA014201615_00390 CDS open 379522-381855 _na     777_aa histidine kinase
434 JACHEU010000001.1 GCA014201615_00391 CDS open 381866-382717 _na     283_aa Lytic transglycosylase
435 JACHEU010000001.1 GCA014201615_00392 CDS open 382722-383978 _na     418_aa ispG flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase
436 JACHEU010000001.1 GCA014201615_00393 CDS open 384334-384513 _na     59_aa DUF465 domain-containing protein
437 JACHEU010000001.1 GCA014201615_00394 CDS open 384762-384965 _na     67_aa DUF465 domain-containing protein
438 JACHEU010000001.1 GCA014201615_00395 CDS open 385016-386617 _na     533_aa Metalloprotease
439 JACHEU010000001.1 GCA014201615_00396 CDS open 386681-387409 _na     242_aa thiQ thiamine ABC transporter ATP-binding protein
440 JACHEU010000001.1 GCA014201615_00397 CDS open 387406-389034 _na     542_aa thiP thiamine/thiamine pyrophosphate ABC transporter permease
441 JACHEU010000001.1 GCA014201615_00398 CDS open 389041-390039 _na     332_aa thiB thiamine ABC transporter substrate binding subunit
442 JACHEU010000001.1 GCA014201615_00399 CDS open 390285-390932 _na     215_aa thiamine diphosphokinase
443 JACHEU010000001.1 GCA014201615_00400 CDS open 390934-392751 _na     605_aa ccmA heme ABC exporter ATP-binding protein CcmA
444 JACHEU010000001.1 GCA014201615_00401 CDS open 392757-393710 _na     317_aa Drug/metabolite transporter (DMT)-like permease
445 JACHEU010000001.1 GCA014201615_00402 CDS open 393847-394497 _na     216_aa Threonine/homoserine/homoserine lactone efflux protein
446 JACHEU010000001.1 GCA014201615_00403 CDS open 394553-396295 _na     580_aa cheA CheA signal transduction histidine kinase
447 JACHEU010000001.1 GCA014201615_00404 CDS open 396364-397659 _na     431_aa purA adenylosuccinate synthase
448 JACHEU010000001.1 GCA014201615_00405 CDS open 397869-398771 _na     300_aa Drug/metabolite transporter (DMT)-like permease
449 JACHEU010000001.1 GCA014201615_00406 CDS open 398825-400426 _na     533_aa serA phosphoglycerate dehydrogenase
450 JACHEU010000001.1 GCA014201615_00407 CDS open 400505-401680 _na     391_aa phosphoserine transaminase
451 JACHEU010000001.1 GCA014201615_00408 CDS open 401876-402616 _na     246_aa Opacity protein-like surface antigen
452 JACHEU010000001.1 GCA014201615_00409 CDS open 402828-403709 _na     293_aa Opacity protein-like surface antigen
453 JACHEU010000001.1 GCA014201615_00410 CDS open 403924-405273 _na     449_aa glmM phosphoglucosamine mutase
454 JACHEU010000001.1 GCA014201615_00411 CDS open 405533-407470 _na     645_aa ftsH ATP-dependent zinc metalloprotease FtsH
455 JACHEU010000001.1 GCA014201615_00412 CDS open 407604-408950 _na     448_aa tRNA(Ile)-lysidine synthase
456 JACHEU010000001.1 GCA014201615_00413 CDS open 408944-410008 _na     354_aa ybgF tol-pal system protein YbgF
457 JACHEU010000001.1 GCA014201615_00414 CDS open 410189-410692 _na     167_aa pal peptidoglycan-associated lipoprotein Pal
458 JACHEU010000001.1 GCA014201615_00415 CDS open 410958-412271 _na     437_aa tolB Tol-Pal system beta propeller repeat protein TolB
459 JACHEU010000001.1 GCA014201615_00416 CDS open 412303-413421 _na     372_aa tolA Cell division and transport-associated protein TolA
460 JACHEU010000001.1 GCA014201615_00417 CDS open 413424-413876 _na     150_aa tolR protein TolR
461 JACHEU010000001.1 GCA014201615_00418 CDS open 413922-414629 _na     235_aa tolQ protein TolQ
462 JACHEU010000001.1 GCA014201615_00419 CDS open 415123-415593 _na     156_aa ybgC tol-pal system-associated acyl-CoA thioesterase
463 JACHEU010000001.1 GCA014201615_00420 CDS open 415614-416111 _na     165_aa mutT 8-oxo-dGTP pyrophosphatase MutT (NUDIX family)
464 JACHEU010000001.1 GCA014201615_00421 CDS open 416108-417145 _na     345_aa ruvB Holliday junction branch migration DNA helicase RuvB
465 JACHEU010000001.1 GCA014201615_00422 CDS open 417189-417809 _na     206_aa ruvA Holliday junction branch migration protein RuvA
466 JACHEU010000001.1 GCA014201615_00423 CDS open 417828-418337 _na     169_aa ruvC crossover junction endodeoxyribonuclease RuvC
467 JACHEU010000001.1 GCA014201615_00424 CDS open 418408-418929 _na     173_aa araC AraC family transcriptional regulator
468 JACHEU010000001.1 GCA014201615_00426 CDS open 419422-420069 _na     215_aa thiamine phosphate synthase
469 JACHEU010000001.1 GCA014201615_00427 CDS open 420073-421095 _na     340_aa Sel1 repeat family protein
470 JACHEU010000001.1 GCA014201615_00428 CDS open 421240-422040 _na     266_aa Inositol-1-monophosphatase
471 JACHEU010000001.1 GCA014201615_00429 CDS open 422032-423018 _na     328_aa Fucose 4-O-acetylase-like acetyltransferase
472 JACHEU010000001.1 GCA014201615_00430 CDS open 423217-424245 _na     342_aa MotA/TolQ/ExbB proton channel domain-containing protein
473 JACHEU010000001.1 GCA014201615_00431 CDS open 424247-425278 _na     343_aa peptidoglycan -binding protein
474 JACHEU010000001.1 GCA014201615_00432 CDS open 425474-425839 _na     121_aa DUF4168 domain-containing protein
475 JACHEU010000001.1 GCA014201615_00433 CDS open 426006-426629 _na     207_aa ATP-dependent Clp protease proteolytic subunit
476 JACHEU010000001.1 GCA014201615_00434 CDS open 426674-427030 _na     118_aa yndB putative protein YndB with AHSA1/START domain
477 JACHEU010000001.1 GCA014201615_00435 CDS open 427027-427425 _na     132_aa arsR DNA-binding transcriptional ArsR family regulator
478 JACHEU010000001.1 GCA014201615_00436 CDS open 427466-428962 _na     498_aa Metal-dependent carboxypeptidase
479 JACHEU010000001.1 GCA014201615_00437 CDS open 428962-430110 _na     382_aa Amidohydrolase
480 JACHEU010000001.1 GCA014201615_00438 CDS open 430120-431919 _na     599_aa ATP-binding cassette subfamily B protein
481 JACHEU010000001.1 GCA014201615_00439 CDS open 432112-432333 _na     73_aa rpmE 50S ribosomal protein L31
482 JACHEU010000001.1 GCA014201615_00440 CDS open 432415-432711 _na     98_aa Selenoprotein W-related protein
483 JACHEU010000001.1 GCA014201615_00441 CDS open 432711-433457 _na     248_aa YebC/PmpR family DNA-binding transcriptional regulator
484 JACHEU010000001.1 GCA014201615_00442 CDS open 433756-434568 _na     270_aa ulaG L-ascorbate metabolism protein UlaG (Beta-lactamase superfamily)
485 JACHEU010000001.1 GCA014201615_00443 CDS open 434620-434901 _na     93_aa yndB putative protein YndB with AHSA1/START domain
486 JACHEU010000001.1 GCA014201615_00444 CDS open 434922-435686 _na     254_aa terC Putative tellurium resistance membrane protein TerC
487 JACHEU010000001.1 GCA014201615_00445 CDS open 435773-436597 _na     274_aa ymdB Metallophosphoesterase%2C MG_246/BB_0505 family
488 JACHEU010000001.1 GCA014201615_00446 CDS open 436710-437318 _na     202_aa 5-formyltetrahydrofolate cyclo-ligase
489 JACHEU010000001.1 GCA014201615_00448 CDS open 437780-438619 _na     279_aa ATPase AAA
490 JACHEU010000001.1 GCA014201615_00449 CDS open 438830-439507 _na     225_aa queuosine precursor transporter
491 JACHEU010000001.1 GCA014201615_00450 CDS open 439577-439873 _na     98_aa rpmB 50S ribosomal protein L28
492 JACHEU010000001.1 GCA014201615_00451 CDS open 440133-440942 _na     269_aa DUF3108 domain-containing protein
493 JACHEU010000001.1 GCA014201615_00452 CDS open 441013-441897 _na     294_aa Drug/metabolite transporter (DMT)-like permease
494 JACHEU010000001.1 GCA014201615_00453 CDS open 441931-442698 _na     255_aa gloB hydroxyacylglutathione hydrolase
495 JACHEU010000001.1 GCA014201615_00454 CDS open 442831-443643 _na     270_aa SAM-dependent methyltransferase
496 JACHEU010000001.1 GCA014201615_00455 CDS open 443669-444619 _na     316_aa Alcohol dehydrogenase
497 JACHEU010000001.1 GCA014201615_00456 CDS open 444711-445283 _na     190_aa glutathione-specific gamma-glutamylcyclotransferase
498 JACHEU010000001.1 GCA014201615_00457 CDS open 445331-446326 _na     331_aa DUF2125 domain-containing protein
499 JACHEU010000001.1 GCA014201615_00458 CDS open 446519-447442 _na     307_aa prephenate/arogenate dehydrogenase family protein
500 JACHEU010000001.1 GCA014201615_00459 CDS open 447459-448568 _na     369_aa Histidinol-phosphate aminotransferase