HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Fusobacterium necrophorum (GCA_018206505.1)

Select a Genome:
BAKTA Annotations for GCA_018206505.1
Genome Selected: Fusobacterium necrophorum
ContigsBases CDSrRNA tmRNAtRNA
35 2082099 1932 2 1 45
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3982 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:3]    |    Number of Records Found: 3982 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1001 JADRGD010000001.1 GCA018206505_00424 gene open 485584-486279
1002 JADRGD010000001.1 GCA018206505_00425 gene open 486352-487215
1003 JADRGD010000001.1 GCA018206505_00426 gene open 487218-487319
1004 JADRGD010000001.1 GCA018206505_00427 gene open 487635-488150
1005 JADRGD010000001.1 GCA018206505_00428 gene open 488147-488527
1006 JADRGD010000001.1 GCA018206505_00429 gene open 488545-490299
1007 JADRGD010000001.1 GCA018206505_00430 gene open 490325-491170
1008 JADRGD010000001.1 GCA018206505_00431 gene open 491251-491796
1009 JADRGD010000001.1 GCA018206505_00432 gene open 491912-492478
1010 JADRGD010000001.1 GCA018206505_00433 gene open 492958-494595
1011 JADRGD010000001.1 GCA018206505_00434 gene open 494677-495654
1012 JADRGD010000001.1 GCA018206505_00435 gene open 495651-496472
1013 JADRGD010000001.1 GCA018206505_00436 gene open 496484-497296 nikD
1014 JADRGD010000001.1 GCA018206505_00437 gene open 497280-497915
1015 JADRGD010000001.1 GCA018206505_00438 gene open 498069-498857 mtnN
1016 JADRGD010000001.1 GCA018206505_00439 gene open 498883-499551
1017 JADRGD010000001.1 GCA018206505_00440 gene open 499563-500942
1018 JADRGD010000001.1 GCA018206505_00441 gene open 501133-502281
1019 JADRGD010000001.1 GCA018206505_00442 gene open 502314-503603
1020 JADRGD010000001.1 GCA018206505_00443 gene open 503622-504671
1021 JADRGD010000001.1 GCA018206505_00444 gene open 504699-505913 mtnK
1022 JADRGD010000001.1 GCA018206505_00445 gene open 506118-506930
1023 JADRGD010000001.1 GCA018206505_00446 gene open 507021-508046
1024 JADRGD010000001.1 GCA018206505_00447 gene open 508056-509153 dnaN
1025 JADRGD010000001.1 GCA018206505_00448 gene open 509156-509929
1026 JADRGD010000001.1 GCA018206505_00449 gene open 509969-510469
1027 JADRGD010000001.1 GCA018206505_00450 gene open 510469-510915
1028 JADRGD010000001.1 GCA018206505_00451 gene open 510935-511624
1029 JADRGD010000001.1 GCA018206505_00452 gene open 511868-513193
1030 JADRGD010000001.1 GCA018206505_00453 gene open 513298-514101
1031 JADRGD010000001.1 GCA018206505_00454 gene open 514114-514890
1032 JADRGD010000001.1 GCA018206505_00455 gene open 514958-516466
1033 JADRGD010000001.1 GCA018206505_00456 gene open 516482-517555
1034 JADRGD010000001.1 GCA018206505_00457 gene open 517674-517955
1035 JADRGD010000001.1 GCA018206505_00458 gene open 518457-522134
1036 JADRGD010000001.1 GCA018206505_00459 gene open 522146-522622
1037 JADRGD010000001.1 GCA018206505_00460 gene open 522650-523366 purC
1038 JADRGD010000001.1 GCA018206505_00461 gene open 523394-524743 purF
1039 JADRGD010000001.1 GCA018206505_00462 gene open 524757-525773
1040 JADRGD010000001.1 GCA018206505_00463 gene open 525761-526321 purN
1041 JADRGD010000001.1 GCA018206505_00464 gene open 526323-527825 purH
1042 JADRGD010000001.1 GCA018206505_00465 gene open 527843-529069
1043 JADRGD010000001.1 GCA018206505_00466 gene open 529239-529859
1044 JADRGD010000001.1 GCA018206505_00467 gene open 529872-530657 murI
1045 JADRGD010000001.1 GCA018206505_00468 gene open 530897-531514
1046 JADRGD010000001.1 GCA018206505_00469 gene open 532066-532569
1047 JADRGD010000001.1 GCA018206505_00470 gene open 532635-533039
1048 JADRGD010000001.1 GCA018206505_00471 gene open 533130-533306
1049 JADRGD010000001.1 GCA018206505_00472 gene open 534021-535724
1050 JADRGD010000001.1 GCA018206505_00473 gene open 535739-537967 ycaO
1051 JADRGD010000001.1 GCA018206505_00474 gene open 538004-538984
1052 JADRGD010000001.1 GCA018206505_00475 gene open 539044-540075
1053 JADRGD010000001.1 GCA018206505_00476 gene open 540072-540845
1054 JADRGD010000001.1 GCA018206505_00477 gene open 540864-542657
1055 JADRGD010000001.1 GCA018206505_00478 gene open 542662-544407
1056 JADRGD010000001.1 GCA018206505_00479 gene open 545034-546836 lepA
1057 JADRGD010000001.1 GCA018206505_00480 gene open 546951-548909
1058 JADRGD010000001.1 GCA018206505_00481 gene open 549307-550704
1059 JADRGD010000001.1 GCA018206505_00482 gene open 551154-551687 ywqK
1060 JADRGD010000001.1 GCA018206505_00483 gene open 551782-553212 tolC
1061 JADRGD010000001.1 GCA018206505_00484 gene open 553205-554308
1062 JADRGD010000001.1 GCA018206505_00485 gene open 554321-557380
1063 JADRGD010000001.1 GCA018206505_00486 gene open 557398-558585
1064 JADRGD010000001.1 GCA018206505_00487 gene open 558592-559449 truB
1065 JADRGD010000001.1 GCA018206505_00488 gene open 559468-561279 typA
1066 JADRGD010000001.1 GCA018206505_00489 gene open 561519-562652
1067 JADRGD010000001.1 GCA018206505_00490 gene open 562649-563317
1068 JADRGD010000001.1 GCA018206505_00491 gene open 563395-564309
1069 JADRGD010000001.1 GCA018206505_00492 gene open 564342-565073
1070 JADRGD010000001.1 GCA018206505_00493 gene open 565190-566236
1071 JADRGD010000001.1 GCA018206505_00494 gene open 566255-566995
1072 JADRGD010000001.1 GCA018206505_00495 gene open 567169-570132
1073 JADRGD010000001.1 GCA018206505_00496 gene open 570214-571200
1074 JADRGD010000001.1 GCA018206505_00497 gene open 571295-572242
1075 JADRGD010000001.1 GCA018206505_00498 gene open 572208-573059 rpiR
1076 JADRGD010000001.1 GCA018206505_00499 gene open 573069-573896 nagB
1077 JADRGD010000001.1 GCA018206505_00500 gene open 574547-575800
1078 JADRGD010000001.1 GCA018206505_00501 gene open 576157-576972
1079 JADRGD010000001.1 GCA018206505_00502 gene open 577403-580843
1080 JADRGD010000001.1 GCA018206505_00503 gene open 580938-581480
1081 JADRGD010000001.1 GCA018206505_00504 gene open 581628-582263
1082 JADRGD010000001.1 GCA018206505_00505 gene open 582470-583402
1083 JADRGD010000001.1 GCA018206505_00506 gene open 583399-584217
1084 JADRGD010000001.1 GCA018206505_00507 gene open 584582-585370
1085 JADRGD010000001.1 GCA018206505_00508 gene open 585367-586095
1086 JADRGD010000001.1 GCA018206505_00509 gene open 586233-586661
1087 JADRGD010000001.1 GCA018206505_00510 gene open 586667-587080
1088 JADRGD010000001.1 GCA018206505_00511 gene open 587154-587399
1089 JADRGD010000001.1 GCA018206505_00512 gene open 587584-588144
1090 JADRGD010000001.1 GCA018206505_00513 gene open 588193-588645
1091 JADRGD010000001.1 GCA018206505_00514 gene open 588709-589683 araC
1092 JADRGD010000001.1 GCA018206505_00515 gene open 589931-591703
1093 JADRGD010000001.1 GCA018206505_00516 gene open 591696-593420
1094 JADRGD010000001.1 GCA018206505_00517 gene open 593479-594063
1095 JADRGD010000001.1 GCA018206505_00518 gene open 594063-594749
1096 JADRGD010000001.1 GCA018206505_00519 gene open 594743-596119
1097 JADRGD010000001.1 GCA018206505_00520 gene open 596676-598667
1098 JADRGD010000001.1 GCA018206505_00521 gene open 598914-601967
1099 JADRGD010000001.1 GCA018206505_00522 gene open 601964-603073
1100 JADRGD010000001.1 GCA018206505_00523 gene open 603083-604354 tolC
1101 JADRGD010000001.1 GCA018206505_00524 gene open 604496-606214
1102 JADRGD010000001.1 GCA018206505_00525 gene open 606207-607946
1103 JADRGD010000001.1 GCA018206505_00526 gene open 608151-608723
1104 JADRGD010000001.1 GCA018206505_00527 gene open 608865-609656
1105 JADRGD010000001.1 GCA018206505_00528 gene open 609675-610682
1106 JADRGD010000001.1 GCA018206505_00529 gene open 610669-611457
1107 JADRGD010000001.1 GCA018206505_00530 gene open 611516-612436
1108 JADRGD010000001.1 GCA018206505_00531 gene open 612597-613121
1109 JADRGD010000001.1 GCA018206505_00532 gene open 613347-613979
1110 JADRGD010000001.1 GCA018206505_00533 gene open 614009-615355 mepA
1111 JADRGD010000001.1 GCA018206505_00534 gene open 615462-616211
1112 JADRGD010000001.1 GCA018206505_00535 gene open 616239-617447
1113 JADRGD010000001.1 GCA018206505_00536 gene open 617544-617936
1114 JADRGD010000001.1 GCA018206505_00537 gene open 618085-618414
1115 JADRGD010000001.1 GCA018206505_00538 gene open 618636-619325
1116 JADRGD010000001.1 GCA018206505_00539 gene open 619345-619863
1117 JADRGD010000001.1 GCA018206505_00540 gene open 620057-621529
1118 JADRGD010000001.1 GCA018206505_00541 gene open 621707-622645
1119 JADRGD010000001.1 GCA018206505_00542 gene open 622789-623592
1120 JADRGD010000001.1 GCA018206505_00543 gene open 623664-624176
1121 JADRGD010000001.1 GCA018206505_00544 gene open 624294-625178
1122 JADRGD010000001.1 GCA018206505_00545 gene open 625206-625505
1123 JADRGD010000001.1 GCA018206505_00546 gene open 625633-626904
1124 JADRGD010000001.1 GCA018206505_00547 gene open 626912-629539
1125 JADRGD010000001.1 GCA018206505_00548 gene open 629536-632559
1126 JADRGD010000001.1 GCA018206505_00549 gene open 632564-633382 thyA
1127 JADRGD010000001.1 GCA018206505_00550 gene open 633397-634446 rlmN
1128 JADRGD010000001.1 GCA018206505_00551 gene open 634456-636594
1129 JADRGD010000001.1 GCA018206505_00552 gene open 636597-639302
1130 JADRGD010000001.1 GCA018206505_00553 gene open 639299-640465 sbcD
1131 JADRGD010000001.1 GCA018206505_00554 gene open 640455-643220 sbcC
1132 JADRGD010000001.1 GCA018206505_00555 gene open 643234-643869 queH
1133 JADRGD010000001.1 GCA018206505_00556 gene open 643862-644482
1134 JADRGD010000001.1 GCA018206505_00557 gene open 644504-645988
1135 JADRGD010000001.1 GCA018206505_00558 gene open 645991-646503
1136 JADRGD010000001.1 GCA018206505_00559 gene open 646630-649104
1137 JADRGD010000001.1 GCA018206505_00560 gene open 649085-649459 grdX
1138 JADRGD010000001.1 GCA018206505_00561 gene open 649679-650341
1139 JADRGD010000001.1 GCA018206505_00562 gene open 650386-651693
1140 JADRGD010000001.1 GCA018206505_00563 gene open 651888-653324
1141 JADRGD010000001.1 GCA018206505_00564 gene open 653452-654204
1142 JADRGD010000001.1 GCA018206505_00565 gene open 654201-654614 exbD
1143 JADRGD010000001.1 GCA018206505_00566 gene open 654628-655263 motA
1144 JADRGD010000001.1 GCA018206505_00567 gene open 655401-656657
1145 JADRGD010000001.1 GCA018206505_00568 gene open 656764-659697
1146 JADRGD010000001.1 GCA018206505_00569 gene open 660396-661079
1147 JADRGD010000001.1 GCA018206505_00570 gene open 661088-662293
1148 JADRGD010000001.1 GCA018206505_00571 gene open 662298-662738
1149 JADRGD010000001.1 GCA018206505_00572 gene open 662815-663234
1150 JADRGD010000001.1 GCA018206505_00573 gene open 663253-663927
1151 JADRGD010000001.1 GCA018206505_00574 gene open 663931-665133
1152 JADRGD010000001.1 GCA018206505_00575 gene open 665143-666423
1153 JADRGD010000001.1 GCA018206505_00576 gene open 666425-667690
1154 JADRGD010000001.1 GCA018206505_00577 gene open 668047-669117
1155 JADRGD010000001.1 GCA018206505_00578 gene open 669107-672316 carB
1156 JADRGD010000001.1 GCA018206505_00579 gene open 672509-673729 gltT
1157 JADRGD010000001.1 GCA018206505_00580 gene open 674396-674932
1158 JADRGD010000001.1 GCA018206505_00581 gene open 675486-676001
1159 JADRGD010000001.1 GCA018206505_00582 gene open 675988-677262
1160 JADRGD010000001.1 GCA018206505_00583 gene open 677676-679070 mepA
1161 JADRGD010000001.1 GCA018206505_00584 gene open 679072-681552
1162 JADRGD010000001.1 GCA018206505_00585 gene open 681580-682176 tetR
1163 JADRGD010000001.1 GCA018206505_00586 gene open 682432-682719
1164 JADRGD010000001.1 GCA018206505_00587 gene open 682851-683039
1165 JADRGD010000001.1 GCA018206505_00588 gene open 683143-683394
1166 JADRGD010000001.1 GCA018206505_00137 gene open 155275-155350 trnG
1167 JADRGD010000001.1 GCA018206505_00138 gene open 155361-155436 trnK
1168 JADRGD010000001.1 GCA018206505_00139 gene open 155446-155520 trnE
1169 JADRGD010000001.1 GCA018206505_00140 gene open 155524-155599 trnV
1170 JADRGD010000001.1 GCA018206505_00141 gene open 155606-155683 trnD
1171 JADRGD010000001.1 GCA018206505_00401 gene open 461821-461897 trnP
1172 JADRGD010000001.1 GCA018206505_00402 gene open 461901-461975 trnQ
1173 JADRGD010000001.1 GCA018206505_00137 tRNA open 155275-155350 trnG tRNA-Gly(tcc)
1174 JADRGD010000001.1 GCA018206505_00138 tRNA open 155361-155436 trnK tRNA-Lys(ctt)
1175 JADRGD010000001.1 GCA018206505_00139 tRNA open 155446-155520 trnE tRNA-Glu(ttc)
1176 JADRGD010000001.1 GCA018206505_00140 tRNA open 155524-155599 trnV tRNA-Val(tac)
1177 JADRGD010000001.1 GCA018206505_00141 tRNA open 155606-155683 trnD tRNA-Asp(gtc)
1178 JADRGD010000001.1 GCA018206505_00401 tRNA open 461821-461897 trnP tRNA-Pro(tgg)
1179 JADRGD010000001.1 GCA018206505_00402 tRNA open 461901-461975 trnQ tRNA-Gln(ttg)
1180 JADRGD010000002.1 regulatory_region open 34286-34385 TPP riboswitch aptamer (THI element)
1181 JADRGD010000002.1 regulatory_region open 64195-64369 Cobalamin riboswitch aptamer
1182 JADRGD010000002.1 regulatory_region open 93565-93738 Cobalamin riboswitch aptamer
1183 JADRGD010000002.1 regulatory_region open 100880-100965 SAM riboswitch aptamer (S box leader)
1184 JADRGD010000002.1 regulatory_region open 243892-243997 TPP riboswitch aptamer (THI element)
1185 JADRGD010000002.1 regulatory_region open 393389-393476 SAM riboswitch aptamer (S box leader)
1186 JADRGD010000002.1 repeat_region open 3534-3714 CRISPR array with 3 repeats of length 39%2C consensus sequence AGTTTCAGATCTATCTTAAGTTACATTACTCTCAAACAA and spacer length 27
1187 JADRGD010000002.1 repeat_region open 3931-4636 CRISPR array with 11 repeats of length 36%2C consensus sequence GTTTCAGATCTATCTTAAGTTACATTACTCTCAAAC and spacer length 30
1188 JADRGD010000002.1 GCA018206505_00589 CDS open 560-1063 _na     167_aa Flavodoxin
1189 JADRGD010000002.1 GCA018206505_00590 CDS open 1219-1791 _na     190_aa Nitroreductase
1190 JADRGD010000002.1 GCA018206505_00591 CDS open 2153-2350 _na     65_aa Phage tail tape measure protein domain-containing protein
1191 JADRGD010000002.1 GCA018206505_00592 CDS open 2362-2721 _na     119_aa hypothetical protein
1192 JADRGD010000002.1 GCA018206505_00593 CDS open 4696-5376 _na     226_aa csn2 type II-A CRISPR-associated protein Csn2
1193 JADRGD010000002.1 GCA018206505_00594 CDS open 5373-5693 _na     106_aa cas2 CRISPR-associated endonuclease Cas2
1194 JADRGD010000002.1 GCA018206505_00595 CDS open 5683-6555 _na     290_aa cas1 type II CRISPR-associated endonuclease Cas1
1195 JADRGD010000002.1 GCA018206505_00596 CDS open 6557-10570 _na     1337_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
1196 JADRGD010000002.1 GCA018206505_00597 CDS open 10840-11790 _na     316_aa ctlX citrulline utilization hydrolase CtlX
1197 JADRGD010000002.1 GCA018206505_00598 CDS open 11826-12089 _na     87_aa rpsP 30S ribosomal protein S16
1198 JADRGD010000002.1 GCA018206505_00599 CDS open 12129-13478 _na     449_aa ffh signal recognition particle protein
1199 JADRGD010000002.1 GCA018206505_00600 CDS open 13489-13800 _na     103_aa ylxM YlxM family DNA-binding protein
1200 JADRGD010000002.1 GCA018206505_00601 CDS open 13868-14236 _na     122_aa Nuclear transport factor 2 family protein
1201 JADRGD010000002.1 GCA018206505_00602 CDS open 14233-15171 _na     312_aa UDP-glucose 4-epimerase
1202 JADRGD010000002.1 GCA018206505_00603 CDS open 15220-16077 _na     285_aa eamA EamA domain-containing protein
1203 JADRGD010000002.1 GCA018206505_00604 CDS open 16292-16855 _na     187_aa efp elongation factor P
1204 JADRGD010000002.1 GCA018206505_00605 CDS open 16869-17897 _na     342_aa Protein-arginine rhamnosyltransferase
1205 JADRGD010000002.1 GCA018206505_00606 CDS open 17905-18120 _na     71_aa Lipoprotein
1206 JADRGD010000002.1 GCA018206505_00607 CDS open 18131-18826 _na     231_aa Pseudouridine synthase
1207 JADRGD010000002.1 GCA018206505_00608 CDS open 18813-19769 _na     318_aa NADH oxidase
1208 JADRGD010000002.1 GCA018206505_00609 CDS open 19766-21754 _na     662_aa Peptidase%2C S9A/B/C family%2C catalytic domain protein
1209 JADRGD010000002.1 GCA018206505_00610 CDS open 21765-22796 _na     343_aa queA tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA
1210 JADRGD010000002.1 GCA018206505_00611 CDS open 22796-23668 _na     290_aa Geranyl transferase
1211 JADRGD010000002.1 GCA018206505_00612 CDS open 23655-23879 _na     74_aa xseB exodeoxyribonuclease VII small subunit
1212 JADRGD010000002.1 GCA018206505_00613 CDS open 23857-24375 _na     172_aa Peptidyl-prolyl cis-trans isomerase
1213 JADRGD010000002.1 GCA018206505_00614 CDS open 24406-24954 _na     182_aa rsmD 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD
1214 JADRGD010000002.1 GCA018206505_00615 CDS open 24951-26057 _na     368_aa prmC peptide chain release factor N(5)-glutamine methyltransferase
1215 JADRGD010000002.1 GCA018206505_00616 CDS open 26059-27138 _na     359_aa prfA peptide chain release factor 1
1216 JADRGD010000002.1 GCA018206505_00617 CDS open 27229-27906 _na     225_aa TIGR02206 family protein
1217 JADRGD010000002.1 GCA018206505_00618 CDS open 27919-28530 _na     203_aa Ribonuclease H
1218 JADRGD010000002.1 GCA018206505_00619 CDS open 28539-29099 _na     186_aa HEAT repeat domain-containing protein
1219 JADRGD010000002.1 GCA018206505_00620 CDS open 29096-30103 _na     335_aa lpxK tetraacyldisaccharide 4'-kinase
1220 JADRGD010000002.1 GCA018206505_00621 CDS open 30122-33640 _na     1172_aa smc chromosome segregation protein SMC
1221 JADRGD010000002.1 GCA018206505_00622 CDS open 33813-34277 _na     154_aa 2-thiouracil desulfurase
1222 JADRGD010000002.1 GCA018206505_00623 CDS open 34447-34659 _na     70_aa thiS sulfur carrier protein ThiS
1223 JADRGD010000002.1 GCA018206505_00624 CDS open 34685-35464 _na     259_aa Thiazole synthase
1224 JADRGD010000002.1 GCA018206505_00625 CDS open 35461-36567 _na     368_aa thiH 2-iminoacetate synthase ThiH
1225 JADRGD010000002.1 GCA018206505_00626 CDS open 36564-37112 _na     182_aa thiF sulfur carrier protein ThiS adenylyltransferase ThiF
1226 JADRGD010000002.1 GCA018206505_00627 CDS open 37096-37734 _na     212_aa Thiamine-phosphate synthase
1227 JADRGD010000002.1 GCA018206505_00628 CDS open 37731-38528 _na     265_aa hydroxymethylpyrimidine kinase
1228 JADRGD010000002.1 GCA018206505_00629 CDS open 38690-42628 _na     1312_aa Autotransporter outer membrane beta-barrel domain-containing protein
1229 JADRGD010000002.1 GCA018206505_00630 CDS open 42644-45001 _na     785_aa Hemin receptor
1230 JADRGD010000002.1 GCA018206505_00631 CDS open 45009-45116 _na     35_aa hypothetical protein
1231 JADRGD010000002.1 GCA018206505_00632 CDS open 45376-46395 _na     339_aa Histidine kinase
1232 JADRGD010000002.1 GCA018206505_00633 CDS open 46730-47128 _na     132_aa mscL large-conductance mechanosensitive channel protein MscL
1233 JADRGD010000002.1 GCA018206505_00634 CDS open 47146-48198 _na     350_aa mnmA tRNA 2-thiouridine(34) synthase MnmA
1234 JADRGD010000002.1 GCA018206505_00635 CDS open 48223-48846 _na     207_aa lysE Lysine transporter LysE
1235 JADRGD010000002.1 GCA018206505_00636 CDS open 48914-49501 _na     195_aa Redoxin
1236 JADRGD010000002.1 GCA018206505_00637 CDS open 49505-50932 _na     475_aa dGTP triphosphohydrolase
1237 JADRGD010000002.1 GCA018206505_00638 CDS open 50914-52569 _na     551_aa Dynamin family protein
1238 JADRGD010000002.1 GCA018206505_00639 CDS open 52685-53017 _na     110_aa arsR ArsR family transcriptional regulator
1239 JADRGD010000002.1 GCA018206505_00640 CDS open 53010-53771 _na     253_aa Threonine/serine exporter-like N-terminal domain-containing protein
1240 JADRGD010000002.1 GCA018206505_00641 CDS open 53783-54223 _na     146_aa Membrane protein
1241 JADRGD010000002.1 GCA018206505_00642 CDS open 54191-55084 _na     297_aa DUF535 domain-containing protein
1242 JADRGD010000002.1 GCA018206505_00643 CDS open 55106-56011 _na     301_aa Membrane protein
1243 JADRGD010000002.1 GCA018206505_00644 CDS open 56016-57239 _na     407_aa L-serine ammonia-lyase
1244 JADRGD010000002.1 GCA018206505_00645 CDS open 57349-58914 _na     521_aa rny ribonuclease Y
1245 JADRGD010000002.1 GCA018206505_00646 CDS open 58939-59289 _na     116_aa Anti-sigma factor antagonist
1246 JADRGD010000002.1 GCA018206505_00647 CDS open 59294-59689 _na     131_aa ATP-binding protein
1247 JADRGD010000002.1 GCA018206505_00648 CDS open 59694-60080 _na     128_aa Lipoprotein
1248 JADRGD010000002.1 GCA018206505_00649 CDS open 60116-61024 _na     302_aa miaA tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA
1249 JADRGD010000002.1 GCA018206505_00650 CDS open 61034-62320 _na     428_aa obgE GTPase ObgE
1250 JADRGD010000002.1 GCA018206505_00651 CDS open 62338-63960 _na     540_aa ABC transporter%2C ATP-binding protein
1251 JADRGD010000002.1 GCA018206505_00652 CDS open 64589-65524 _na     311_aa nikB nickel ABC transporter permease
1252 JADRGD010000002.1 GCA018206505_00653 CDS open 65525-66349 _na     274_aa nikC nickel transporter permease
1253 JADRGD010000002.1 GCA018206505_00654 CDS open 66398-67966 _na     522_aa ABC transporter substrate-binding protein
1254 JADRGD010000002.1 GCA018206505_00655 CDS open 67986-68771 _na     261_aa Peptide ABC transporter ATP-binding protein
1255 JADRGD010000002.1 GCA018206505_00656 CDS open 68752-69564 _na     270_aa ABC transporter ATP-binding protein
1256 JADRGD010000002.1 GCA018206505_00657 CDS open 69803-70795 _na     330_aa Phosphotransferase system EIIC domain-containing protein
1257 JADRGD010000002.1 GCA018206505_00658 CDS open 70893-72563 _na     556_aa hcp hydroxylamine reductase
1258 JADRGD010000002.1 GCA018206505_00659 CDS open 72777-74465 _na     562_aa Glycine/betaine ABC transporter permease
1259 JADRGD010000002.1 GCA018206505_00660 CDS open 74458-75681 _na     407_aa Glycine betaine ABC transporter%2C ATP-binding protein OpuAA
1260 JADRGD010000002.1 GCA018206505_00661 CDS open 75957-77012 _na     351_aa Endonuclease
1261 JADRGD010000002.1 GCA018206505_00662 CDS open 77015-78832 _na     605_aa Magnesium chelatase
1262 JADRGD010000002.1 GCA018206505_00663 CDS open 78843-79871 _na     342_aa Mg-protoporphyrin IX chelatase
1263 JADRGD010000002.1 GCA018206505_00664 CDS open 79868-80896 _na     342_aa Radical SAM/SPASM domain-containing protein
1264 JADRGD010000002.1 GCA018206505_00665 CDS open 80883-81995 _na     370_aa Iron dicitrate transporter
1265 JADRGD010000002.1 GCA018206505_00666 CDS open 82029-82799 _na     256_aa ABC transporter%2C ATP-binding protein
1266 JADRGD010000002.1 GCA018206505_00667 CDS open 82796-83824 _na     342_aa Iron ABC transporter
1267 JADRGD010000002.1 GCA018206505_00668 CDS open 83845-84729 _na     294_aa Hemin receptor
1268 JADRGD010000002.1 GCA018206505_00669 CDS open 84794-86803 _na     669_aa Hemin receptor
1269 JADRGD010000002.1 GCA018206505_00670 CDS open 86833-90570 _na     1245_aa cobN cobaltochelatase subunit CobN
1270 JADRGD010000002.1 GCA018206505_00671 CDS open 90581-91456 _na     291_aa ABC transporter substrate-binding protein
1271 JADRGD010000002.1 GCA018206505_00672 CDS open 91493-93457 _na     654_aa TonB-dependent receptor
1272 JADRGD010000002.1 GCA018206505_00673 CDS open 94003-95205 _na     400_aa Metallo-beta-lactamase domain protein
1273 JADRGD010000002.1 GCA018206505_00674 CDS open 95221-97134 _na     637_aa Rubredoxin
1274 JADRGD010000002.1 GCA018206505_00675 CDS open 97436-98728 _na     430_aa UPF0597 protein FSBG_01082
1275 JADRGD010000002.1 GCA018206505_00676 CDS open 98860-99573 _na     237_aa NAD-dependent protein deacylase
1276 JADRGD010000002.1 GCA018206505_00677 CDS open 99816-100739 _na     307_aa 5-methyltetrahydrofolate--homocysteine methyltransferase
1277 JADRGD010000002.1 GCA018206505_00679 CDS open 101595-101852 _na     85_aa hypothetical protein
1278 JADRGD010000002.1 GCA018206505_00680 CDS open 101862-102332 _na     156_aa hypothetical protein
1279 JADRGD010000002.1 GCA018206505_00681 CDS open 102329-102841 _na     170_aa N-acetylmuramoyl-L-alanine amidase
1280 JADRGD010000002.1 GCA018206505_00682 CDS open 102845-103486 _na     213_aa DUF4376 domain-containing protein
1281 JADRGD010000002.1 GCA018206505_00683 CDS open 103497-106682 _na     1061_aa hypothetical protein
1282 JADRGD010000002.1 GCA018206505_00684 CDS open 106684-110961 _na     1425_aa Phage tail tape measure protein
1283 JADRGD010000002.1 GCA018206505_00685 CDS open 111222-111644 _na     140_aa hypothetical protein
1284 JADRGD010000002.1 GCA018206505_00686 CDS open 111656-112582 _na     308_aa phage tail tube protein
1285 JADRGD010000002.1 GCA018206505_00687 CDS open 112584-113327 _na     247_aa DUF6838 domain-containing protein
1286 JADRGD010000002.1 GCA018206505_00688 CDS open 113318-113854 _na     178_aa HK97 gp10 family phage protein
1287 JADRGD010000002.1 GCA018206505_00689 CDS open 113854-114198 _na     114_aa Phage head-tail adaptor
1288 JADRGD010000002.1 GCA018206505_00690 CDS open 114200-114580 _na     126_aa hypothetical protein
1289 JADRGD010000002.1 GCA018206505_00691 CDS open 114589-115779 _na     396_aa Phage coat protein
1290 JADRGD010000002.1 GCA018206505_00692 CDS open 115798-116388 _na     196_aa Phage minor structural protein GP20
1291 JADRGD010000002.1 GCA018206505_00693 CDS open 116497-116631 _na     44_aa hypothetical protein
1292 JADRGD010000002.1 GCA018206505_00694 CDS open 116702-117607 _na     301_aa Rha family transcriptional regulator
1293 JADRGD010000002.1 GCA018206505_00695 CDS open 117732-118535 _na     267_aa Lipoprotein
1294 JADRGD010000002.1 GCA018206505_00696 CDS open 118651-118995 _na     114_aa yjcQ YjcQ protein
1295 JADRGD010000002.1 GCA018206505_00697 CDS open 118979-119137 _na     52_aa hypothetical protein
1296 JADRGD010000002.1 GCA018206505_00698 CDS open 119194-119370 _na     58_aa Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix domain protein
1297 JADRGD010000002.1 GCA018206505_00699 CDS open 119367-120941 _na     524_aa Phage protein F-like protein
1298 JADRGD010000002.1 GCA018206505_00700 CDS open 120928-122322 _na     464_aa Phage portal protein%2C SPP1 Gp6-like protein
1299 JADRGD010000002.1 GCA018206505_00701 CDS open 122335-123450 _na     371_aa Phage terminase large subunit
1300 JADRGD010000002.1 GCA018206505_00702 CDS open 123506-123715 _na     69_aa terminase
1301 JADRGD010000002.1 GCA018206505_00703 CDS open 123727-124119 _na     130_aa terminase small subunit
1302 JADRGD010000002.1 GCA018206505_00705 CDS open 124356-124862 _na     168_aa hypothetical protein
1303 JADRGD010000002.1 GCA018206505_00706 CDS open 124864-125526 _na     220_aa hypothetical protein
1304 JADRGD010000002.1 GCA018206505_00707 CDS open 125663-126205 _na     180_aa RNA polymerase sigma-70 region 4 domain-containing protein
1305 JADRGD010000002.1 GCA018206505_00708 CDS open 126216-126551 _na     111_aa dUTPase
1306 JADRGD010000002.1 GCA018206505_00709 CDS open 126548-127930 _na     460_aa DEAD/DEAH box helicase
1307 JADRGD010000002.1 GCA018206505_00710 CDS open 127944-128237 _na     97_aa VRR-NUC domain-containing protein
1308 JADRGD010000002.1 GCA018206505_00711 CDS open 128522-130966 _na     814_aa vapE VapE domain-containing protein
1309 JADRGD010000002.1 GCA018206505_00712 CDS open 130989-131642 _na     217_aa DUF3310 domain-containing protein
1310 JADRGD010000002.1 GCA018206505_00713 CDS open 131639-132226 _na     195_aa hypothetical protein
1311 JADRGD010000002.1 GCA018206505_00714 CDS open 132235-134205 _na     656_aa DNA-directed DNA polymerase
1312 JADRGD010000002.1 GCA018206505_00715 CDS open 134251-134829 _na     192_aa DUF2815 domain-containing protein
1313 JADRGD010000002.1 GCA018206505_00716 CDS open 134852-136021 _na     389_aa Nuclease
1314 JADRGD010000002.1 GCA018206505_00717 CDS open 136021-136485 _na     154_aa hypothetical protein
1315 JADRGD010000002.1 GCA018206505_00718 CDS open 136485-137258 _na     257_aa hypothetical protein
1316 JADRGD010000002.1 GCA018206505_00719 CDS open 137255-137431 _na     58_aa TMhelix containing protein
1317 JADRGD010000002.1 GCA018206505_00720 CDS open 137409-137675 _na     88_aa hypothetical protein
1318 JADRGD010000002.1 GCA018206505_00721 CDS open 137778-137975 _na     65_aa DNA binding domain%2C excisionase family
1319 JADRGD010000002.1 GCA018206505_00722 CDS open 137985-138122 _na     45_aa hypothetical protein
1320 JADRGD010000002.1 GCA018206505_00723 CDS open 138138-138251 _na     37_aa hypothetical protein
1321 JADRGD010000002.1 GCA018206505_00724 CDS open 138265-138600 _na     111_aa hypothetical protein
1322 JADRGD010000002.1 GCA018206505_00725 CDS open 138705-139262 _na     185_aa hypothetical protein
1323 JADRGD010000002.1 GCA018206505_00726 CDS open 139426-139851 _na     141_aa hypothetical protein
1324 JADRGD010000002.1 GCA018206505_00727 CDS open 139978-140166 _na     62_aa Helix-turn-helix domain-containing protein
1325 JADRGD010000002.1 GCA018206505_00728 CDS open 140320-140808 _na     162_aa Helix-turn-helix transcriptional regulator
1326 JADRGD010000002.1 GCA018206505_00729 CDS open 140789-141232 _na     147_aa ImmA/IrrE family metallo-endopeptidase
1327 JADRGD010000002.1 GCA018206505_00730 CDS open 141484-142464 _na     326_aa Abi family protein
1328 JADRGD010000002.1 GCA018206505_00731 CDS open 142602-143726 _na     374_aa Site-specific integrase
1329 JADRGD010000002.1 GCA018206505_00732 CDS open 144112-144549 _na     145_aa lktC Leukotoxin-activating lysine-acyltransferase lktC
1330 JADRGD010000002.1 GCA018206505_00733 CDS open 144546-154277 _na     3243_aa lktA LktA
1331 JADRGD010000002.1 GCA018206505_00734 CDS open 154293-155942 _na     549_aa lktB LktB
1332 JADRGD010000002.1 GCA018206505_00735 CDS open 156271-157053 _na     260_aa Peptide ABC transporter substrate-binding protein
1333 JADRGD010000002.1 GCA018206505_00736 CDS open 157066-157791 _na     241_aa Peptide ABC transporter ATP-binding protein
1334 JADRGD010000002.1 GCA018206505_00737 CDS open 157791-158585 _na     264_aa Peptide ABC transporter permease
1335 JADRGD010000002.1 GCA018206505_00738 CDS open 158582-159493 _na     303_aa Peptide ABC transporter permease
1336 JADRGD010000002.1 GCA018206505_00739 CDS open 159546-161084 _na     512_aa Peptide-binding protein
1337 JADRGD010000002.1 GCA018206505_00740 CDS open 161335-162777 _na     480_aa gatB Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB
1338 JADRGD010000002.1 GCA018206505_00741 CDS open 162793-164250 _na     485_aa gatA Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA
1339 JADRGD010000002.1 GCA018206505_00742 CDS open 164265-164558 _na     97_aa gatC Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC
1340 JADRGD010000002.1 GCA018206505_00743 CDS open 164572-165291 _na     239_aa Pseudouridine synthase
1341 JADRGD010000002.1 GCA018206505_00744 CDS open 165263-165802 _na     179_aa scpB SMC-Scp complex subunit ScpB
1342 JADRGD010000002.1 GCA018206505_00745 CDS open 165786-167414 _na     542_aa hypothetical protein
1343 JADRGD010000002.1 GCA018206505_00746 CDS open 167431-168477 _na     348_aa mreB Cell shape-determining protein MreB
1344 JADRGD010000002.1 GCA018206505_00747 CDS open 168482-169348 _na     288_aa MFS transporter
1345 JADRGD010000002.1 GCA018206505_00748 CDS open 169516-169962 _na     148_aa Histidine kinase
1346 JADRGD010000002.1 GCA018206505_00749 CDS open 170001-170642 _na     213_aa Formimidoyltetrahydrofolate cyclodeaminase
1347 JADRGD010000002.1 GCA018206505_00750 CDS open 170652-171878 _na     408_aa hutI imidazolonepropionase
1348 JADRGD010000002.1 GCA018206505_00751 CDS open 171889-172785 _na     298_aa ftcD glutamate formimidoyltransferase
1349 JADRGD010000002.1 GCA018206505_00752 CDS open 172831-174138 _na     435_aa Na+/H+ antiporter family protein
1350 JADRGD010000002.1 GCA018206505_00753 CDS open 174160-174822 _na     220_aa fliJ Flagellar FliJ protein
1351 JADRGD010000002.1 GCA018206505_00754 CDS open 174806-175963 _na     385_aa N-6 DNA methylase
1352 JADRGD010000002.1 GCA018206505_00755 CDS open 175947-177080 _na     377_aa Permease
1353 JADRGD010000002.1 GCA018206505_00756 CDS open 177084-177485 _na     133_aa nusG NusG domain-containing protein
1354 JADRGD010000002.1 GCA018206505_00757 CDS open 177460-178374 _na     304_aa phosphatidylserine decarboxylase
1355 JADRGD010000002.1 GCA018206505_00758 CDS open 178384-179892 _na     502_aa nicotinate phosphoribosyltransferase
1356 JADRGD010000002.1 GCA018206505_00759 CDS open 180082-180528 _na     148_aa dtd D-aminoacyl-tRNA deacylase
1357 JADRGD010000002.1 GCA018206505_00760 CDS open 180622-182163 _na     513_aa DNA-binding protein
1358 JADRGD010000002.1 GCA018206505_00761 CDS open 182180-183145 _na     321_aa ABC transporter permease
1359 JADRGD010000002.1 GCA018206505_00762 CDS open 183135-183947 _na     270_aa Glutathione ABC transporter permease
1360 JADRGD010000002.1 GCA018206505_00763 CDS open 183947-184723 _na     258_aa Peptide ABC transporter ATP-binding protein
1361 JADRGD010000002.1 GCA018206505_00764 CDS open 184726-185478 _na     250_aa Peptide ABC transporter ATP-binding protein
1362 JADRGD010000002.1 GCA018206505_00765 CDS open 185496-186884 _na     462_aa nhaC Na+/H+ antiporter NhaC
1363 JADRGD010000002.1 GCA018206505_00766 CDS open 187037-188026 _na     329_aa Electron transfer flavoprotein subunit alpha
1364 JADRGD010000002.1 GCA018206505_00767 CDS open 188038-188814 _na     258_aa Electron transfer flavoprotein subunit beta
1365 JADRGD010000002.1 GCA018206505_00768 CDS open 188827-189963 _na     378_aa Butyryl-CoA dehydrogenase
1366 JADRGD010000002.1 GCA018206505_00769 CDS open 190053-191480 _na     475_aa 2-hydroxy-acid oxidase
1367 JADRGD010000002.1 GCA018206505_00770 CDS open 191574-191699 _na     41_aa hypothetical protein
1368 JADRGD010000002.1 GCA018206505_00771 CDS open 191798-193378 _na     526_aa L-lactate permease
1369 JADRGD010000002.1 GCA018206505_00772 CDS open 193731-194441 _na     236_aa gntR GntR family transcriptional regulator
1370 JADRGD010000002.1 GCA018206505_00773 CDS open 194650-195333 _na     227_aa gntR GntR family transcriptional regulator
1371 JADRGD010000002.1 GCA018206505_00774 CDS open 195405-195755 _na     116_aa rplT 50S ribosomal protein L20
1372 JADRGD010000002.1 GCA018206505_00775 CDS open 195773-195979 _na     68_aa rpmI 50S ribosomal protein L35
1373 JADRGD010000002.1 GCA018206505_00776 CDS open 196030-196542 _na     170_aa infC translation initiation factor IF-3
1374 JADRGD010000002.1 GCA018206505_00777 CDS open 196832-197560 _na     242_aa DUF6941 domain-containing protein
1375 JADRGD010000002.1 GCA018206505_00778 CDS open 197709-198026 _na     105_aa hypothetical protein
1376 JADRGD010000002.1 GCA018206505_00779 CDS open 198023-198697 _na     224_aa PF06912 family protein
1377 JADRGD010000002.1 GCA018206505_00780 CDS open 198718-199011 _na     97_aa hypothetical protein
1378 JADRGD010000002.1 GCA018206505_00781 CDS open 199122-199367 _na     81_aa Helix-turn-helix domain-containing protein
1379 JADRGD010000002.1 GCA018206505_00782 CDS open 199520-199882 _na     120_aa DUF1353 domain-containing protein
1380 JADRGD010000002.1 GCA018206505_00783 CDS open 199887-200072 _na     61_aa DNA-binding protein
1381 JADRGD010000002.1 GCA018206505_00784 CDS open 200083-200451 _na     122_aa Peptidase M15
1382 JADRGD010000002.1 GCA018206505_00785 CDS open 200469-201569 _na     366_aa rfbB dTDP-glucose 4%2C6-dehydratase
1383 JADRGD010000002.1 GCA018206505_00786 CDS open 201566-202405 _na     279_aa rfbD dTDP-4-dehydrorhamnose reductase
1384 JADRGD010000002.1 GCA018206505_00787 CDS open 202402-202977 _na     191_aa rfbC dTDP-4-dehydrorhamnose 3%2C5-epimerase
1385 JADRGD010000002.1 GCA018206505_00788 CDS open 202956-203849 _na     297_aa rfbA glucose-1-phosphate thymidylyltransferase RfbA
1386 JADRGD010000002.1 GCA018206505_00789 CDS open 204000-204704 _na     234_aa Acylneuraminate cytidylyltransferase
1387 JADRGD010000002.1 GCA018206505_00790 CDS open 204728-205672 _na     314_aa Beta-1%2C4-N-acetylgalactosaminyltransferase
1388 JADRGD010000002.1 GCA018206505_00791 CDS open 205685-206935 _na     416_aa Polysaccharide biosynthesis protein
1389 JADRGD010000002.1 GCA018206505_00792 CDS open 206938-207915 _na     325_aa Glycosyl transferase family 52
1390 JADRGD010000002.1 GCA018206505_00793 CDS open 207912-208874 _na     320_aa Glycosyltransferase
1391 JADRGD010000002.1 GCA018206505_00794 CDS open 208850-209665 _na     271_aa Glycosyltransferase family 2
1392 JADRGD010000002.1 GCA018206505_00795 CDS open 209662-210798 _na     378_aa Glycosyltransferase family 1 protein
1393 JADRGD010000002.1 GCA018206505_00796 CDS open 210795-211688 _na     297_aa UDP-N-acetylenolpyruvoylglucosamine reductase
1394 JADRGD010000002.1 GCA018206505_00797 CDS open 211688-212368 _na     226_aa Sugar transferase
1395 JADRGD010000002.1 GCA018206505_00798 CDS open 212393-214198 _na     601_aa UDP-4-dehydro-6-deoxy-2-acetamido-D-glucose 4-reductase
1396 JADRGD010000002.1 GCA018206505_00799 CDS open 214430-215569 _na     379_aa Glycosyltransferase
1397 JADRGD010000002.1 GCA018206505_00800 CDS open 215566-217110 _na     514_aa O-antigen ligase-related domain-containing protein
1398 JADRGD010000002.1 GCA018206505_00801 CDS open 217091-218056 _na     321_aa Capsular biosynthesis protein
1399 JADRGD010000002.1 GCA018206505_00802 CDS open 218053-219012 _na     319_aa Glycosyltransferase%2C group 2 family protein
1400 JADRGD010000002.1 GCA018206505_00803 CDS open 219134-220318 _na     394_aa Glycosyltransferase%2C group 1 family protein
1401 JADRGD010000002.1 GCA018206505_00804 CDS open 220344-221108 _na     254_aa rfaY Lipopolysaccharide core biosynthesis protein RfaY
1402 JADRGD010000002.1 GCA018206505_00805 CDS open 221084-221842 _na     252_aa Polysaccharide deacetylase
1403 JADRGD010000002.1 GCA018206505_00806 CDS open 221853-222905 _na     350_aa LOS biosynthesis enzyme LBGB
1404 JADRGD010000002.1 GCA018206505_00807 CDS open 222912-224555 _na     547_aa Arylsulfatase
1405 JADRGD010000002.1 GCA018206505_00808 CDS open 224757-225638 _na     293_aa Lipid kinase
1406 JADRGD010000002.1 GCA018206505_00809 CDS open 225702-226487 _na     261_aa AP endonuclease%2C family 2
1407 JADRGD010000002.1 GCA018206505_00810 CDS open 226504-227790 _na     428_aa C4-dicarboxylate ABC transporter
1408 JADRGD010000002.1 GCA018206505_00811 CDS open 227787-228248 _na     153_aa TRAP transporter%2C DctQ-like membrane protein
1409 JADRGD010000002.1 GCA018206505_00812 CDS open 228266-229267 _na     333_aa ABC transporter%2C substrate-binding protein%2C family 7
1410 JADRGD010000002.1 GCA018206505_00813 CDS open 229300-230334 _na     344_aa Periplasmic-binding protein-like domain protein
1411 JADRGD010000002.1 GCA018206505_00814 CDS open 230646-232031 _na     461_aa M18 family aminopeptidase
1412 JADRGD010000002.1 GCA018206505_00815 CDS open 232207-232476 _na     89_aa Type II toxin-antitoxin system RelE/ParE family toxin
1413 JADRGD010000002.1 GCA018206505_00816 CDS open 232478-232702 _na     74_aa relB type II toxin-antitoxin system RelB family antitoxin
1414 JADRGD010000002.1 GCA018206505_00817 CDS open 232837-234654 _na     605_aa htpG molecular chaperone HtpG
1415 JADRGD010000002.1 GCA018206505_00818 CDS open 234953-236125 _na     390_aa porin
1416 JADRGD010000002.1 GCA018206505_00819 CDS open 236281-237102 _na     273_aa Outer membrane protein beta-barrel domain-containing protein
1417 JADRGD010000002.1 GCA018206505_00820 CDS open 237326-238417 _na     363_aa Major outer membrane protein
1418 JADRGD010000002.1 GCA018206505_00821 CDS open 238645-240279 _na     544_aa 9-O-acetyl-N-acetylneuraminate esterase
1419 JADRGD010000002.1 GCA018206505_00822 CDS open 240398-242062 _na     554_aa PF08011 family protein
1420 JADRGD010000002.1 GCA018206505_00823 CDS open 242535-243836 _na     433_aa thiC phosphomethylpyrimidine synthase ThiC
1421 JADRGD010000002.1 GCA018206505_00824 CDS open 244011-244676 _na     221_aa Butyrate--acetoacetate CoA-transferase subunit B
1422 JADRGD010000002.1 GCA018206505_00825 CDS open 244690-245340 _na     216_aa Butyrate--acetoacetate CoA-transferase subunit A
1423 JADRGD010000002.1 GCA018206505_00826 CDS open 245368-246744 _na     458_aa TIGR00366 family protein
1424 JADRGD010000002.1 GCA018206505_00827 CDS open 246898-249141 _na     747_aa ATPase P
1425 JADRGD010000002.1 GCA018206505_00828 CDS open 249138-249332 _na     64_aa Heavy metal-associated domain protein
1426 JADRGD010000002.1 GCA018206505_00829 CDS open 249478-250101 _na     207_aa upp uracil phosphoribosyltransferase
1427 JADRGD010000002.1 GCA018206505_00830 CDS open 250157-250399 _na     80_aa type B 50S ribosomal protein L31
1428 JADRGD010000002.1 GCA018206505_00831 CDS open 250497-250898 _na     133_aa Periplasmic heavy metal sensor
1429 JADRGD010000002.1 GCA018206505_00832 CDS open 250913-251236 _na     107_aa Gram-positive signal peptide protein%2C YSIRK family
1430 JADRGD010000002.1 GCA018206505_00833 CDS open 251233-251685 _na     150_aa Sigma-70 region 2
1431 JADRGD010000002.1 GCA018206505_00834 CDS open 251742-252803 _na     353_aa ispG flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase
1432 JADRGD010000002.1 GCA018206505_00835 CDS open 252844-253986 _na     380_aa Peptidase M23
1433 JADRGD010000002.1 GCA018206505_00836 CDS open 253990-255231 _na     413_aa rho transcription termination factor Rho
1434 JADRGD010000002.1 GCA018206505_00837 CDS open 255248-256555 _na     435_aa miaB tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB
1435 JADRGD010000002.1 GCA018206505_00838 CDS open 256705-257103 _na     132_aa FMN-binding protein
1436 JADRGD010000002.1 GCA018206505_00839 CDS open 257172-258221 _na     349_aa disA DNA integrity scanning diadenylate cyclase DisA
1437 JADRGD010000002.1 GCA018206505_00840 CDS open 258218-259600 _na     460_aa radA DNA repair protein RadA
1438 JADRGD010000002.1 GCA018206505_00841 CDS open 259604-260101 _na     165_aa coaD pantetheine-phosphate adenylyltransferase
1439 JADRGD010000002.1 GCA018206505_00842 CDS open 260108-261385 _na     425_aa Ribonuclease G
1440 JADRGD010000002.1 GCA018206505_00843 CDS open 261360-262406 _na     348_aa Coproporphyrinogen III oxidase
1441 JADRGD010000002.1 GCA018206505_00844 CDS open 262403-263101 _na     232_aa rnc ribonuclease III
1442 JADRGD010000002.1 GCA018206505_00845 CDS open 263111-264358 _na     415_aa fabF beta-ketoacyl-ACP synthase II
1443 JADRGD010000002.1 GCA018206505_00846 CDS open 264434-264658 _na     74_aa acyl carrier protein
1444 JADRGD010000002.1 GCA018206505_00847 CDS open 264695-265609 _na     304_aa fabD ACP S-malonyltransferase
1445 JADRGD010000002.1 GCA018206505_00848 CDS open 265632-266618 _na     328_aa Beta-ketoacyl-[acyl-carrier-protein] synthase III
1446 JADRGD010000002.1 GCA018206505_00849 CDS open 266615-267616 _na     333_aa plsX phosphate acyltransferase PlsX
1447 JADRGD010000002.1 GCA018206505_00850 CDS open 267760-267942 _na     60_aa rpmF 50S ribosomal protein L32
1448 JADRGD010000002.1 GCA018206505_00851 CDS open 268022-269116 _na     364_aa ychF redox-regulated ATPase YchF
1449 JADRGD010000002.1 GCA018206505_00852 CDS open 269181-270539 _na     452_aa UPF0210 protein FSBG_00970
1450 JADRGD010000002.1 GCA018206505_00853 CDS open 270566-270835 _na     89_aa ACT domain-containing protein
1451 JADRGD010000002.1 GCA018206505_00854 CDS open 271004-272488 _na     494_aa Na+/H+ antiporter family protein
1452 JADRGD010000002.1 GCA018206505_00855 CDS open 272713-274233 _na     506_aa gpmI 2%2C3-bisphosphoglycerate-independent phosphoglycerate mutase
1453 JADRGD010000002.1 GCA018206505_00856 CDS open 274248-275039 _na     263_aa tpiA triose-phosphate isomerase
1454 JADRGD010000002.1 GCA018206505_00857 CDS open 275147-275728 _na     193_aa comF Competence protein ComF
1455 JADRGD010000002.1 GCA018206505_00858 CDS open 275778-276002 _na     74_aa Zinc finger protein
1456 JADRGD010000002.1 GCA018206505_00859 CDS open 275962-276333 _na     123_aa yraN YraN family protein
1457 JADRGD010000002.1 GCA018206505_00860 CDS open 276351-276980 _na     209_aa ribonuclease HII
1458 JADRGD010000002.1 GCA018206505_00861 CDS open 276949-277905 _na     318_aa Pseudouridine synthase
1459 JADRGD010000002.1 GCA018206505_00862 CDS open 278247-279893 _na     548_aa Putative alkyl hydroperoxide reductase F subunit
1460 JADRGD010000002.1 GCA018206505_00863 CDS open 279973-280533 _na     186_aa ahpC alkyl hydroperoxide reductase subunit C
1461 JADRGD010000002.1 GCA018206505_00864 CDS open 280815-281420 _na     201_aa Peptidase C39-like domain-containing protein
1462 JADRGD010000002.1 GCA018206505_00865 CDS open 281589-282686 _na     365_aa Lipoprotein
1463 JADRGD010000002.1 GCA018206505_00866 CDS open 282762-282932 _na     56_aa Rubredoxin
1464 JADRGD010000002.1 GCA018206505_00867 CDS open 282992-284011 _na     339_aa mglC galactose/methyl galactoside ABC transporter permease MglC
1465 JADRGD010000002.1 GCA018206505_00868 CDS open 284031-285533 _na     500_aa mglA galactose/methyl galactoside ABC transporter ATP-binding protein MglA
1466 JADRGD010000002.1 GCA018206505_00869 CDS open 285628-286641 _na     337_aa mglB galactose/glucose ABC transporter substrate-binding protein MglB
1467 JADRGD010000002.1 GCA018206505_00870 CDS open 286788-287741 _na     317_aa Glucokinase
1468 JADRGD010000002.1 GCA018206505_00871 CDS open 287941-288921 _na     326_aa trpS tryptophan--tRNA ligase
1469 JADRGD010000002.1 GCA018206505_00872 CDS open 289061-290215 _na     384_aa YARHG domain-containing protein
1470 JADRGD010000002.1 GCA018206505_00873 CDS open 290526-293840 _na     1104_aa TonB-dependent receptor domain protein
1471 JADRGD010000002.1 GCA018206505_00874 CDS open 294224-294658 _na     144_aa DUF327 domain-containing protein
1472 JADRGD010000002.1 GCA018206505_00875 CDS open 294667-295275 _na     202_aa L-threonylcarbamoyladenylate synthase
1473 JADRGD010000002.1 GCA018206505_00876 CDS open 295278-296228 _na     316_aa ribose-phosphate diphosphokinase
1474 JADRGD010000002.1 GCA018206505_00877 CDS open 296218-297576 _na     452_aa glmU bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU
1475 JADRGD010000002.1 GCA018206505_00878 CDS open 297615-298160 _na     181_aa J domain-containing protein
1476 JADRGD010000002.1 GCA018206505_00879 CDS open 298183-298740 _na     185_aa Tetratricopeptide repeat protein
1477 JADRGD010000002.1 GCA018206505_00880 CDS open 299309-299776 _na     155_aa SMODS and SLOG-associating 2TM effector domain-containing protein
1478 JADRGD010000002.1 GCA018206505_00881 CDS open 299875-300831 _na     318_aa RloB-like protein
1479 JADRGD010000002.1 GCA018206505_00882 CDS open 300835-302220 _na     461_aa AAA domain protein
1480 JADRGD010000002.1 GCA018206505_00883 CDS open 302654-303727 _na     357_aa Peptidase%2C A26 omptin family protein
1481 JADRGD010000002.1 GCA018206505_00886 CDS open 304172-305470 _na     432_aa rsmB 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB
1482 JADRGD010000002.1 GCA018206505_00887 CDS open 305607-306947 _na     446_aa mgtE magnesium transporter
1483 JADRGD010000002.1 GCA018206505_00888 CDS open 307032-307925 _na     297_aa eamA EamA domain-containing protein
1484 JADRGD010000002.1 GCA018206505_00889 CDS open 307932-308555 _na     207_aa tRNA 5-hydroxyuridine methyltransferase
1485 JADRGD010000002.1 GCA018206505_00890 CDS open 308481-308639 _na     52_aa hypothetical protein
1486 JADRGD010000002.1 GCA018206505_00891 CDS open 308629-309804 _na     391_aa Multidrug transporter
1487 JADRGD010000002.1 GCA018206505_00892 CDS open 310354-311538 _na     394_aa Elongation factor Tu
1488 JADRGD010000002.1 GCA018206505_00893 CDS open 311573-313654 _na     693_aa fusA elongation factor G
1489 JADRGD010000002.1 GCA018206505_00894 CDS open 313681-314151 _na     156_aa rpsG 30S ribosomal protein S7
1490 JADRGD010000002.1 GCA018206505_00895 CDS open 314172-314540 _na     122_aa rpsL 30S ribosomal protein S12
1491 JADRGD010000002.1 GCA018206505_00896 CDS open 315014-316300 _na     428_aa O-acetylhomoserine aminocarboxypropyltransferase
1492 JADRGD010000002.1 GCA018206505_00897 CDS open 316328-318127 _na     599_aa metA homoserine O-succinyltransferase
1493 JADRGD010000002.1 GCA018206505_00898 CDS open 318575-319291 _na     238_aa gntR GntR family transcriptional regulator
1494 JADRGD010000002.1 GCA018206505_00899 CDS open 319727-320515 _na     262_aa Electron transfer flavoprotein subunit beta
1495 JADRGD010000002.1 GCA018206505_00900 CDS open 320533-321555 _na     340_aa Electron transfer flavoprotein subunit alpha
1496 JADRGD010000002.1 GCA018206505_00901 CDS open 321578-322789 _na     403_aa CoA transferase
1497 JADRGD010000002.1 GCA018206505_00902 CDS open 322877-324094 _na     405_aa 2-hydroxyglutaryl-CoA dehydratase%2C D-component
1498 JADRGD010000002.1 GCA018206505_00903 CDS open 324087-325214 _na     375_aa Phenyllactate dehydratase
1499 JADRGD010000002.1 GCA018206505_00904 CDS open 325225-326358 _na     377_aa Butyryl-CoA dehydrogenase
1500 JADRGD010000002.1 GCA018206505_00905 CDS open 326465-327586 _na     373_aa Beta-carotene 15%2C15'-monooxygenase