HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Fusobacterium necrophorum (GCA_018206505.1)

Select a Genome:
BAKTA Annotations for GCA_018206505.1
Genome Selected: Fusobacterium necrophorum
ContigsBases CDSrRNA tmRNAtRNA
35 2082099 1932 2 1 45
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3982 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:5]    |    Number of Records Found: 3982 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2001 JADRGD010000002.1 GCA018206505_00985 gene open 405867-406583
2002 JADRGD010000002.1 GCA018206505_00986 gene open 406580-408595 pabB
2003 JADRGD010000002.1 GCA018206505_00987 gene open 408749-409396 ostA
2004 JADRGD010000002.1 GCA018206505_00988 gene open 409747-410472
2005 JADRGD010000002.1 GCA018206505_00989 gene open 410486-411697
2006 JADRGD010000002.1 GCA018206505_00990 gene open 411707-413074 argH
2007 JADRGD010000002.1 GCA018206505_00991 gene open 413125-413550
2008 JADRGD010000002.1 GCA018206505_00992 gene open 413620-414510 eamA
2009 JADRGD010000002.1 GCA018206505_00993 gene open 414599-415900
2010 JADRGD010000002.1 GCA018206505_00994 gene open 415915-416787
2011 JADRGD010000002.1 GCA018206505_00995 gene open 416789-417895 rodA
2012 JADRGD010000002.1 GCA018206505_00996 gene open 417905-418345 dut
2013 JADRGD010000002.1 GCA018206505_00997 gene open 418342-419592
2014 JADRGD010000002.1 GCA018206505_00998 gene open 419605-420690
2015 JADRGD010000002.1 GCA018206505_00999 gene open 420693-421769
2016 JADRGD010000002.1 GCA018206505_01000 gene open 421756-422307 cvpA
2017 JADRGD010000002.1 GCA018206505_01001 gene open 422319-423500
2018 JADRGD010000002.1 GCA018206505_01002 gene open 423515-424579 alr
2019 JADRGD010000002.1 GCA018206505_01003 gene open 424645-425586 secF
2020 JADRGD010000002.1 GCA018206505_01004 gene open 425588-426823 secD
2021 JADRGD010000002.1 GCA018206505_01005 gene open 426837-427256 ruvX
2022 JADRGD010000002.1 GCA018206505_01006 gene open 427268-429868 alaS
2023 JADRGD010000002.1 GCA018206505_01007 gene open 429887-430612 lptB
2024 JADRGD010000002.1 GCA018206505_01008 gene open 430631-433024 lptC
2025 JADRGD010000002.1 GCA018206505_01009 gene open 433017-435599 mutS
2026 JADRGD010000002.1 GCA018206505_01010 gene open 435578-436546 dusB
2027 JADRGD010000002.1 GCA018206505_01011 gene open 436660-436830
2028 JADRGD010000002.1 GCA018206505_01012 gene open 437387-437971
2029 JADRGD010000002.1 GCA018206505_01013 gene open 437980-438696
2030 JADRGD010000002.1 GCA018206505_00678 gene open 101155-101230 trnT
2031 JADRGD010000002.1 GCA018206505_00704 gene open 124151-124235 trnS
2032 JADRGD010000002.1 GCA018206505_00884 gene open 303933-304022 trnS
2033 JADRGD010000002.1 GCA018206505_00885 gene open 304028-304111 trnS
2034 JADRGD010000002.1 GCA018206505_00678 tRNA open 101155-101230 trnT tRNA-Thr(ggt)
2035 JADRGD010000002.1 GCA018206505_00704 tRNA open 124151-124235 trnS tRNA-Ser(gct)
2036 JADRGD010000002.1 GCA018206505_00884 tRNA open 303933-304022 trnS tRNA-Ser(gct)
2037 JADRGD010000002.1 GCA018206505_00885 tRNA open 304028-304111 trnS tRNA-Ser(tga)
2038 JADRGD010000003.1 regulatory_region open 132137-132312 Cobalamin riboswitch aptamer
2039 JADRGD010000003.1 regulatory_region open 145698-145785 SAM riboswitch aptamer (S box leader)
2040 JADRGD010000003.1 GCA018206505_01140 CDS open 235-1650 _na     471_aa Aspartate ammonia-lyase
2041 JADRGD010000003.1 GCA018206505_01141 CDS open 1643-2260 _na     205_aa cutC PF03932 family protein CutC
2042 JADRGD010000003.1 GCA018206505_01142 CDS open 2282-2842 _na     186_aa DNA polymerase III subunit epsilon
2043 JADRGD010000003.1 GCA018206505_01143 CDS open 2968-3693 _na     241_aa pflA pyruvate formate-lyase-activating protein
2044 JADRGD010000003.1 GCA018206505_01144 CDS open 3720-5951 _na     743_aa pflB formate C-acetyltransferase
2045 JADRGD010000003.1 GCA018206505_01145 CDS open 6160-7284 _na     374_aa tRNA ligase
2046 JADRGD010000003.1 GCA018206505_01146 CDS open 7291-7863 _na     190_aa 4Fe-4S ferredoxin-type domain-containing protein
2047 JADRGD010000003.1 GCA018206505_01147 CDS open 8303-9844 _na     513_aa abgT AbgT transporter family
2048 JADRGD010000003.1 GCA018206505_01148 CDS open 10029-10307 _na     92_aa N-acetyltransferase
2049 JADRGD010000003.1 GCA018206505_01149 CDS open 10399-10587 _na     62_aa DUF1653 domain-containing protein
2050 JADRGD010000003.1 GCA018206505_01150 CDS open 10754-11518 _na     254_aa PHP domain protein
2051 JADRGD010000003.1 GCA018206505_01151 CDS open 11533-12399 _na     288_aa Transporter
2052 JADRGD010000003.1 GCA018206505_01152 CDS open 12409-13092 _na     227_aa FCD domain protein
2053 JADRGD010000003.1 GCA018206505_01153 CDS open 13284-14609 _na     441_aa Transporter
2054 JADRGD010000003.1 GCA018206505_01154 CDS open 14851-16251 _na     466_aa tyrosine phenol-lyase
2055 JADRGD010000003.1 GCA018206505_01155 CDS open 16589-18307 _na     572_aa ABC transporter ATP-binding protein
2056 JADRGD010000003.1 GCA018206505_01156 CDS open 18300-20045 _na     581_aa ABC transporter ATP-binding protein
2057 JADRGD010000003.1 GCA018206505_01157 CDS open 20159-21148 _na     329_aa Transcriptional regulator
2058 JADRGD010000003.1 GCA018206505_01158 CDS open 21290-21892 _na     200_aa coaE dephospho-CoA kinase
2059 JADRGD010000003.1 GCA018206505_01159 CDS open 21864-24032 _na     722_aa Peptidase%2C U32 family
2060 JADRGD010000003.1 GCA018206505_01160 CDS open 24034-24537 _na     167_aa Phosphatidylglycerophosphatase A
2061 JADRGD010000003.1 GCA018206505_01161 CDS open 24550-25758 _na     402_aa CinA-like protein
2062 JADRGD010000003.1 GCA018206505_01162 CDS open 25762-26310 _na     182_aa Cupin domain protein
2063 JADRGD010000003.1 GCA018206505_01163 CDS open 26335-28860 _na     841_aa dhaL DhaL domain-containing protein
2064 JADRGD010000003.1 GCA018206505_01164 CDS open 28924-29853 _na     309_aa CBS domain protein
2065 JADRGD010000003.1 GCA018206505_01165 CDS open 29868-31142 _na     424_aa Citrate transporter-like domain-containing protein
2066 JADRGD010000003.1 GCA018206505_01166 CDS open 31152-32189 _na     345_aa mnmA tRNA 2-thiouridine(34) synthase MnmA
2067 JADRGD010000003.1 GCA018206505_01167 CDS open 32186-34207 _na     673_aa ligA NAD-dependent DNA ligase LigA
2068 JADRGD010000003.1 GCA018206505_01168 CDS open 34265-36934 _na     889_aa secA preprotein translocase subunit SecA
2069 JADRGD010000003.1 GCA018206505_01169 CDS open 36955-37695 _na     246_aa Lipoprotein
2070 JADRGD010000003.1 GCA018206505_01170 CDS open 37767-38585 _na     272_aa PHP domain protein
2071 JADRGD010000003.1 GCA018206505_01171 CDS open 38588-39586 _na     332_aa rfaD ADP-glyceromanno-heptose 6-epimerase
2072 JADRGD010000003.1 GCA018206505_01172 CDS open 39596-40417 _na     273_aa undecaprenyl-diphosphate phosphatase
2073 JADRGD010000003.1 GCA018206505_01173 CDS open 40427-41770 _na     447_aa MATE efflux family protein
2074 JADRGD010000003.1 GCA018206505_01174 CDS open 41833-43050 _na     405_aa Aminotransferase
2075 JADRGD010000003.1 GCA018206505_01175 CDS open 43296-45371 _na     691_aa Cadmium-exporting ATPase
2076 JADRGD010000003.1 GCA018206505_01176 CDS open 45499-46122 _na     207_aa Hemolysin D
2077 JADRGD010000003.1 GCA018206505_01177 CDS open 46239-46826 _na     195_aa Cytidylate kinase
2078 JADRGD010000003.1 GCA018206505_01178 CDS open 46851-47330 _na     159_aa hypothetical protein
2079 JADRGD010000003.1 GCA018206505_01179 CDS open 47343-49103 _na     586_aa Metallopeptidase family M24
2080 JADRGD010000003.1 GCA018206505_01180 CDS open 49121-50929 _na     602_aa glmS glutamine--fructose-6-phosphate transaminase (isomerizing)
2081 JADRGD010000003.1 GCA018206505_01181 CDS open 51034-51924 _na     296_aa thrB homoserine kinase
2082 JADRGD010000003.1 GCA018206505_01182 CDS open 51912-53369 _na     485_aa thrC threonine synthase
2083 JADRGD010000003.1 GCA018206505_01183 CDS open 53471-54589 _na     372_aa Homoserine dehydrogenase
2084 JADRGD010000003.1 GCA018206505_01184 CDS open 54586-55923 _na     445_aa aspartate kinase
2085 JADRGD010000003.1 GCA018206505_01185 CDS open 55920-56888 _na     322_aa aspartate-semialdehyde dehydrogenase
2086 JADRGD010000003.1 GCA018206505_01186 CDS open 57015-57932 _na     305_aa PF03537 domain protein
2087 JADRGD010000003.1 GCA018206505_01187 CDS open 58048-59058 _na     336_aa electron transfer flavoprotein subunit alpha/FixB family protein
2088 JADRGD010000003.1 GCA018206505_01188 CDS open 59090-59887 _na     265_aa Electron transfer flavoprotein subunit beta
2089 JADRGD010000003.1 GCA018206505_01189 CDS open 59925-61070 _na     381_aa Butyryl-CoA dehydrogenase
2090 JADRGD010000003.1 GCA018206505_01190 CDS open 61290-62213 _na     307_aa AEC family transporter
2091 JADRGD010000003.1 GCA018206505_01191 CDS open 62385-63137 _na     250_aa Ribosomal protein L11 methyltransferase-like protein
2092 JADRGD010000003.1 GCA018206505_01192 CDS open 63124-63879 _na     251_aa Threonine/serine exporter-like N-terminal domain-containing protein
2093 JADRGD010000003.1 GCA018206505_01193 CDS open 63880-64374 _na     164_aa PF12821 family protein
2094 JADRGD010000003.1 GCA018206505_01194 CDS open 64414-65070 _na     218_aa L%2CD-transpeptidase catalytic domain protein
2095 JADRGD010000003.1 GCA018206505_01195 CDS open 65078-66298 _na     406_aa Peptidase%2C U32 family
2096 JADRGD010000003.1 GCA018206505_01196 CDS open 66322-67662 _na     446_aa dnaB replicative DNA helicase
2097 JADRGD010000003.1 GCA018206505_01197 CDS open 67678-68127 _na     149_aa rplI 50S ribosomal protein L9
2098 JADRGD010000003.1 GCA018206505_01198 CDS open 68169-68972 _na     267_aa hypothetical protein
2099 JADRGD010000003.1 GCA018206505_01199 CDS open 68969-70375 _na     468_aa dnaX DNA polymerase III subunit gamma/tau
2100 JADRGD010000003.1 GCA018206505_01200 CDS open 70379-71767 _na     462_aa ntrC DNA-binding transcriptional regulator NtrC
2101 JADRGD010000003.1 GCA018206505_01201 CDS open 71784-72545 _na     253_aa tonB Biopolymer transporter TonB
2102 JADRGD010000003.1 GCA018206505_01202 CDS open 72560-72994 _na     144_aa Transport energizing protein%2C ExbD/TolR family
2103 JADRGD010000003.1 GCA018206505_01203 CDS open 73010-73621 _na     203_aa Transporter%2C MotA/TolQ/ExbB proton channel family protein
2104 JADRGD010000003.1 GCA018206505_01204 CDS open 73635-74003 _na     122_aa Lipoprotein
2105 JADRGD010000003.1 GCA018206505_01205 CDS open 74021-76768 _na     915_aa ybgF tol-pal system protein YbgF
2106 JADRGD010000003.1 GCA018206505_01206 CDS open 76978-77637 _na     219_aa Suppressor of fused domain protein
2107 JADRGD010000003.1 GCA018206505_01207 CDS open 77849-78856 _na     335_aa Cysteine synthase
2108 JADRGD010000003.1 GCA018206505_01208 CDS open 79067-79531 _na     154_aa YbaK/proline--tRNA ligase associated domain protein
2109 JADRGD010000003.1 GCA018206505_01209 CDS open 79578-80228 _na     216_aa lemA LemA family
2110 JADRGD010000003.1 GCA018206505_01210 CDS open 80603-81331 _na     242_aa Cell filamentation protein Fic
2111 JADRGD010000003.1 GCA018206505_01211 CDS open 81835-82113 _na     92_aa Transposase
2112 JADRGD010000003.1 GCA018206505_01212 CDS open 82190-83518 _na     442_aa Schlafen AlbA-2 domain-containing protein
2113 JADRGD010000003.1 GCA018206505_01213 CDS open 84034-87057 _na     1007_aa TonB-dependent receptor
2114 JADRGD010000003.1 GCA018206505_01214 CDS open 87197-87310 _na     37_aa hypothetical protein
2115 JADRGD010000003.1 GCA018206505_01215 CDS open 88077-89048 _na     323_aa oppF Oligopeptide ABC transporter%2C ATP-binding protein OppF
2116 JADRGD010000003.1 GCA018206505_01216 CDS open 89038-90045 _na     335_aa nikD Nickel import system ATP-binding protein NikD
2117 JADRGD010000003.1 GCA018206505_01217 CDS open 90066-90932 _na     288_aa nikC nickel transporter permease
2118 JADRGD010000003.1 GCA018206505_01218 CDS open 90947-91873 _na     308_aa nikB nickel ABC transporter permease
2119 JADRGD010000003.1 GCA018206505_01219 CDS open 91959-93491 _na     510_aa Diguanylate phosphodiesterase
2120 JADRGD010000003.1 GCA018206505_01220 CDS open 93591-94673 _na     360_aa YibE/F-like protein
2121 JADRGD010000003.1 GCA018206505_01221 CDS open 94733-94996 _na     87_aa rpsO 30S ribosomal protein S15
2122 JADRGD010000003.1 GCA018206505_01222 CDS open 95086-97275 _na     729_aa ftsH ATP-dependent zinc metalloprotease FtsH
2123 JADRGD010000003.1 GCA018206505_01223 CDS open 97272-98609 _na     445_aa tRNA(Ile)-lysidine synthase
2124 JADRGD010000003.1 GCA018206505_01224 CDS open 98626-99570 _na     314_aa Endolytic murein transglycosylase
2125 JADRGD010000003.1 GCA018206505_01225 CDS open 99588-101174 _na     528_aa RNA helicase
2126 JADRGD010000003.1 GCA018206505_01226 CDS open 101240-101701 _na     153_aa ywqK Toxin-antitoxin system YwqK family antitoxin
2127 JADRGD010000003.1 GCA018206505_01227 CDS open 101869-103302 _na     477_aa leucyl aminopeptidase
2128 JADRGD010000003.1 GCA018206505_01228 CDS open 103402-104547 _na     381_aa Acetyltransferase
2129 JADRGD010000003.1 GCA018206505_01229 CDS open 104522-105097 _na     191_aa NAD(P)H nitroreductase
2130 JADRGD010000003.1 GCA018206505_01230 CDS open 105305-105565 _na     86_aa rpsT 30S ribosomal protein S20
2131 JADRGD010000003.1 GCA018206505_01231 CDS open 105700-106659 _na     319_aa Electron transporter
2132 JADRGD010000003.1 GCA018206505_01232 CDS open 106673-107398 _na     241_aa Electron transfer flavoprotein
2133 JADRGD010000003.1 GCA018206505_01233 CDS open 107567-109048 _na     493_aa lysS lysine--tRNA ligase
2134 JADRGD010000003.1 GCA018206505_01234 CDS open 109075-110298 _na     407_aa tetratricopeptide repeat protein
2135 JADRGD010000003.1 GCA018206505_01235 CDS open 110301-110681 _na     126_aa DUF1934 domain-containing protein
2136 JADRGD010000003.1 GCA018206505_01236 CDS open 110681-111010 _na     109_aa DUF1292 domain-containing protein
2137 JADRGD010000003.1 GCA018206505_01237 CDS open 111049-111516 _na     155_aa Ribosomal RNA large subunit methyltransferase H
2138 JADRGD010000003.1 GCA018206505_01238 CDS open 111547-113340 _na     597_aa mutL DNA mismatch repair endonuclease MutL
2139 JADRGD010000003.1 GCA018206505_01239 CDS open 113489-115303 _na     604_aa Tetratricopeptide repeat protein
2140 JADRGD010000003.1 GCA018206505_01240 CDS open 115370-117898 _na     842_aa recJ single-stranded-DNA-specific exonuclease RecJ
2141 JADRGD010000003.1 GCA018206505_01241 CDS open 118154-119443 _na     429_aa Sodium:proton antiporter
2142 JADRGD010000003.1 GCA018206505_01242 CDS open 119437-120321 _na     294_aa lgt prolipoprotein diacylglyceryl transferase
2143 JADRGD010000003.1 GCA018206505_01243 CDS open 120369-122072 _na     567_aa NADH:ubiquinone oxidoreductase
2144 JADRGD010000003.1 GCA018206505_01244 CDS open 122090-123874 _na     594_aa hymB Protein HymB
2145 JADRGD010000003.1 GCA018206505_01245 CDS open 123887-124369 _na     160_aa nuoE NADH-quinone oxidoreductase subunit NuoE
2146 JADRGD010000003.1 GCA018206505_01246 CDS open 124540-126195 _na     551_aa Histidine kinase
2147 JADRGD010000003.1 GCA018206505_01247 CDS open 126182-126958 _na     258_aa DNA-binding response regulator
2148 JADRGD010000003.1 GCA018206505_01248 CDS open 126972-127862 _na     296_aa msrB bifunctional peptide-methionine (S)-S-oxide reductase MsrA/peptide-methionine (R)-S-oxide reductase MsrB
2149 JADRGD010000003.1 GCA018206505_01249 CDS open 127925-128599 _na     224_aa Redoxin domain-containing protein
2150 JADRGD010000003.1 GCA018206505_01250 CDS open 128639-129292 _na     217_aa ccdA Putative cytochrome C-type biogenesis protein CcdA
2151 JADRGD010000003.1 GCA018206505_01251 CDS open 129467-132010 _na     847_aa Autotransporter outer membrane beta-barrel domain-containing protein
2152 JADRGD010000003.1 GCA018206505_01252 CDS open 132430-133158 _na     242_aa phosphoserine phosphatase
2153 JADRGD010000003.1 GCA018206505_01253 CDS open 133298-134122 _na     274_aa Endonuclease/exonuclease/phosphatase family protein
2154 JADRGD010000003.1 GCA018206505_01254 CDS open 134122-134775 _na     217_aa thiamine diphosphokinase
2155 JADRGD010000003.1 GCA018206505_01255 CDS open 134963-135724 _na     253_aa Nickel transporter
2156 JADRGD010000003.1 GCA018206505_01256 CDS open 135721-136161 _na     146_aa DUF1007 domain-containing protein
2157 JADRGD010000003.1 GCA018206505_01257 CDS open 136424-136807 _na     127_aa Dihydrolipoamide acyltransferase
2158 JADRGD010000003.1 GCA018206505_01258 CDS open 136854-138143 _na     429_aa Uracil permease
2159 JADRGD010000003.1 GCA018206505_01259 CDS open 138158-139933 _na     591_aa pepF oligoendopeptidase F
2160 JADRGD010000003.1 GCA018206505_01260 CDS open 139942-141636 _na     564_aa Signal peptide peptidase SppA%2C 36K type
2161 JADRGD010000003.1 GCA018206505_01261 CDS open 141704-142063 _na     119_aa YbaB/EbfC family nucleoid-associated protein
2162 JADRGD010000003.1 GCA018206505_01262 CDS open 142158-142826 _na     222_aa DUF374 domain-containing protein
2163 JADRGD010000003.1 GCA018206505_01263 CDS open 142819-144759 _na     646_aa metG methionine--tRNA ligase
2164 JADRGD010000003.1 GCA018206505_01264 CDS open 144788-145672 _na     294_aa galU UTP--glucose-1-phosphate uridylyltransferase GalU
2165 JADRGD010000003.1 GCA018206505_01265 CDS open 145870-147018 _na     382_aa metK methionine adenosyltransferase
2166 JADRGD010000003.1 GCA018206505_01266 CDS open 147134-147814 _na     226_aa Cupin domain-containing protein
2167 JADRGD010000003.1 GCA018206505_01267 CDS open 147864-148616 _na     250_aa 3-oxoacyl-ACP reductase
2168 JADRGD010000003.1 GCA018206505_01268 CDS open 148638-150161 _na     507_aa Glycine/betaine ABC transporter permease
2169 JADRGD010000003.1 GCA018206505_01269 CDS open 150171-150884 _na     237_aa ABC transporter%2C ATP-binding protein
2170 JADRGD010000003.1 GCA018206505_01270 CDS open 150871-151218 _na     115_aa DNA-binding protein
2171 JADRGD010000003.1 GCA018206505_01271 CDS open 151415-151933 _na     172_aa DNA-binding transcriptional regulator
2172 JADRGD010000003.1 GCA018206505_01272 CDS open 152393-153016 _na     207_aa Orotate phosphoribosyltransferase
2173 JADRGD010000003.1 GCA018206505_01273 CDS open 153009-154226 _na     405_aa Dihydroorotase
2174 JADRGD010000003.1 GCA018206505_01274 CDS open 154220-154936 _na     238_aa pyrF orotidine-5'-phosphate decarboxylase
2175 JADRGD010000003.1 GCA018206505_01275 CDS open 154941-155861 _na     306_aa dihydroorotate dehydrogenase
2176 JADRGD010000003.1 GCA018206505_01276 CDS open 155871-156671 _na     266_aa Dihydroorotate dehydrogenase B (NAD(+))%2C electron transfer subunit
2177 JADRGD010000003.1 GCA018206505_01277 CDS open 156681-157586 _na     301_aa pyrB aspartate carbamoyltransferase
2178 JADRGD010000003.1 GCA018206505_01278 CDS open 157874-158842 _na     322_aa Thiamine ABC transporter substrate-binding protein
2179 JADRGD010000003.1 GCA018206505_01279 CDS open 159029-160741 _na     570_aa argS arginine--tRNA ligase
2180 JADRGD010000003.1 GCA018206505_01140 gene open 235-1650
2181 JADRGD010000003.1 GCA018206505_01141 gene open 1643-2260 cutC
2182 JADRGD010000003.1 GCA018206505_01142 gene open 2282-2842
2183 JADRGD010000003.1 GCA018206505_01143 gene open 2968-3693 pflA
2184 JADRGD010000003.1 GCA018206505_01144 gene open 3720-5951 pflB
2185 JADRGD010000003.1 GCA018206505_01145 gene open 6160-7284
2186 JADRGD010000003.1 GCA018206505_01146 gene open 7291-7863
2187 JADRGD010000003.1 GCA018206505_01147 gene open 8303-9844 abgT
2188 JADRGD010000003.1 GCA018206505_01148 gene open 10029-10307
2189 JADRGD010000003.1 GCA018206505_01149 gene open 10399-10587
2190 JADRGD010000003.1 GCA018206505_01150 gene open 10754-11518
2191 JADRGD010000003.1 GCA018206505_01151 gene open 11533-12399
2192 JADRGD010000003.1 GCA018206505_01152 gene open 12409-13092
2193 JADRGD010000003.1 GCA018206505_01153 gene open 13284-14609
2194 JADRGD010000003.1 GCA018206505_01154 gene open 14851-16251
2195 JADRGD010000003.1 GCA018206505_01155 gene open 16589-18307
2196 JADRGD010000003.1 GCA018206505_01156 gene open 18300-20045
2197 JADRGD010000003.1 GCA018206505_01157 gene open 20159-21148
2198 JADRGD010000003.1 GCA018206505_01158 gene open 21290-21892 coaE
2199 JADRGD010000003.1 GCA018206505_01159 gene open 21864-24032
2200 JADRGD010000003.1 GCA018206505_01160 gene open 24034-24537
2201 JADRGD010000003.1 GCA018206505_01161 gene open 24550-25758
2202 JADRGD010000003.1 GCA018206505_01162 gene open 25762-26310
2203 JADRGD010000003.1 GCA018206505_01163 gene open 26335-28860 dhaL
2204 JADRGD010000003.1 GCA018206505_01164 gene open 28924-29853
2205 JADRGD010000003.1 GCA018206505_01165 gene open 29868-31142
2206 JADRGD010000003.1 GCA018206505_01166 gene open 31152-32189 mnmA
2207 JADRGD010000003.1 GCA018206505_01167 gene open 32186-34207 ligA
2208 JADRGD010000003.1 GCA018206505_01168 gene open 34265-36934 secA
2209 JADRGD010000003.1 GCA018206505_01169 gene open 36955-37695
2210 JADRGD010000003.1 GCA018206505_01170 gene open 37767-38585
2211 JADRGD010000003.1 GCA018206505_01171 gene open 38588-39586 rfaD
2212 JADRGD010000003.1 GCA018206505_01172 gene open 39596-40417
2213 JADRGD010000003.1 GCA018206505_01173 gene open 40427-41770
2214 JADRGD010000003.1 GCA018206505_01174 gene open 41833-43050
2215 JADRGD010000003.1 GCA018206505_01175 gene open 43296-45371
2216 JADRGD010000003.1 GCA018206505_01176 gene open 45499-46122
2217 JADRGD010000003.1 GCA018206505_01177 gene open 46239-46826
2218 JADRGD010000003.1 GCA018206505_01178 gene open 46851-47330
2219 JADRGD010000003.1 GCA018206505_01179 gene open 47343-49103
2220 JADRGD010000003.1 GCA018206505_01180 gene open 49121-50929 glmS
2221 JADRGD010000003.1 GCA018206505_01181 gene open 51034-51924 thrB
2222 JADRGD010000003.1 GCA018206505_01182 gene open 51912-53369 thrC
2223 JADRGD010000003.1 GCA018206505_01183 gene open 53471-54589
2224 JADRGD010000003.1 GCA018206505_01184 gene open 54586-55923
2225 JADRGD010000003.1 GCA018206505_01185 gene open 55920-56888
2226 JADRGD010000003.1 GCA018206505_01186 gene open 57015-57932
2227 JADRGD010000003.1 GCA018206505_01187 gene open 58048-59058
2228 JADRGD010000003.1 GCA018206505_01188 gene open 59090-59887
2229 JADRGD010000003.1 GCA018206505_01189 gene open 59925-61070
2230 JADRGD010000003.1 GCA018206505_01190 gene open 61290-62213
2231 JADRGD010000003.1 GCA018206505_01191 gene open 62385-63137
2232 JADRGD010000003.1 GCA018206505_01192 gene open 63124-63879
2233 JADRGD010000003.1 GCA018206505_01193 gene open 63880-64374
2234 JADRGD010000003.1 GCA018206505_01194 gene open 64414-65070
2235 JADRGD010000003.1 GCA018206505_01195 gene open 65078-66298
2236 JADRGD010000003.1 GCA018206505_01196 gene open 66322-67662 dnaB
2237 JADRGD010000003.1 GCA018206505_01197 gene open 67678-68127 rplI
2238 JADRGD010000003.1 GCA018206505_01198 gene open 68169-68972
2239 JADRGD010000003.1 GCA018206505_01199 gene open 68969-70375 dnaX
2240 JADRGD010000003.1 GCA018206505_01200 gene open 70379-71767 ntrC
2241 JADRGD010000003.1 GCA018206505_01201 gene open 71784-72545 tonB
2242 JADRGD010000003.1 GCA018206505_01202 gene open 72560-72994
2243 JADRGD010000003.1 GCA018206505_01203 gene open 73010-73621
2244 JADRGD010000003.1 GCA018206505_01204 gene open 73635-74003
2245 JADRGD010000003.1 GCA018206505_01205 gene open 74021-76768 ybgF
2246 JADRGD010000003.1 GCA018206505_01206 gene open 76978-77637
2247 JADRGD010000003.1 GCA018206505_01207 gene open 77849-78856
2248 JADRGD010000003.1 GCA018206505_01208 gene open 79067-79531
2249 JADRGD010000003.1 GCA018206505_01209 gene open 79578-80228 lemA
2250 JADRGD010000003.1 GCA018206505_01210 gene open 80603-81331
2251 JADRGD010000003.1 GCA018206505_01211 gene open 81835-82113
2252 JADRGD010000003.1 GCA018206505_01212 gene open 82190-83518
2253 JADRGD010000003.1 GCA018206505_01213 gene open 84034-87057
2254 JADRGD010000003.1 GCA018206505_01214 gene open 87197-87310
2255 JADRGD010000003.1 GCA018206505_01215 gene open 88077-89048 oppF
2256 JADRGD010000003.1 GCA018206505_01216 gene open 89038-90045 nikD
2257 JADRGD010000003.1 GCA018206505_01217 gene open 90066-90932 nikC
2258 JADRGD010000003.1 GCA018206505_01218 gene open 90947-91873 nikB
2259 JADRGD010000003.1 GCA018206505_01219 gene open 91959-93491
2260 JADRGD010000003.1 GCA018206505_01220 gene open 93591-94673
2261 JADRGD010000003.1 GCA018206505_01221 gene open 94733-94996 rpsO
2262 JADRGD010000003.1 GCA018206505_01222 gene open 95086-97275 ftsH
2263 JADRGD010000003.1 GCA018206505_01223 gene open 97272-98609
2264 JADRGD010000003.1 GCA018206505_01224 gene open 98626-99570
2265 JADRGD010000003.1 GCA018206505_01225 gene open 99588-101174
2266 JADRGD010000003.1 GCA018206505_01226 gene open 101240-101701 ywqK
2267 JADRGD010000003.1 GCA018206505_01227 gene open 101869-103302
2268 JADRGD010000003.1 GCA018206505_01228 gene open 103402-104547
2269 JADRGD010000003.1 GCA018206505_01229 gene open 104522-105097
2270 JADRGD010000003.1 GCA018206505_01230 gene open 105305-105565 rpsT
2271 JADRGD010000003.1 GCA018206505_01231 gene open 105700-106659
2272 JADRGD010000003.1 GCA018206505_01232 gene open 106673-107398
2273 JADRGD010000003.1 GCA018206505_01233 gene open 107567-109048 lysS
2274 JADRGD010000003.1 GCA018206505_01234 gene open 109075-110298
2275 JADRGD010000003.1 GCA018206505_01235 gene open 110301-110681
2276 JADRGD010000003.1 GCA018206505_01236 gene open 110681-111010
2277 JADRGD010000003.1 GCA018206505_01237 gene open 111049-111516
2278 JADRGD010000003.1 GCA018206505_01238 gene open 111547-113340 mutL
2279 JADRGD010000003.1 GCA018206505_01239 gene open 113489-115303
2280 JADRGD010000003.1 GCA018206505_01240 gene open 115370-117898 recJ
2281 JADRGD010000003.1 GCA018206505_01241 gene open 118154-119443
2282 JADRGD010000003.1 GCA018206505_01242 gene open 119437-120321 lgt
2283 JADRGD010000003.1 GCA018206505_01243 gene open 120369-122072
2284 JADRGD010000003.1 GCA018206505_01244 gene open 122090-123874 hymB
2285 JADRGD010000003.1 GCA018206505_01245 gene open 123887-124369 nuoE
2286 JADRGD010000003.1 GCA018206505_01246 gene open 124540-126195
2287 JADRGD010000003.1 GCA018206505_01247 gene open 126182-126958
2288 JADRGD010000003.1 GCA018206505_01248 gene open 126972-127862 msrB
2289 JADRGD010000003.1 GCA018206505_01249 gene open 127925-128599
2290 JADRGD010000003.1 GCA018206505_01250 gene open 128639-129292 ccdA
2291 JADRGD010000003.1 GCA018206505_01251 gene open 129467-132010
2292 JADRGD010000003.1 GCA018206505_01252 gene open 132430-133158
2293 JADRGD010000003.1 GCA018206505_01253 gene open 133298-134122
2294 JADRGD010000003.1 GCA018206505_01254 gene open 134122-134775
2295 JADRGD010000003.1 GCA018206505_01255 gene open 134963-135724
2296 JADRGD010000003.1 GCA018206505_01256 gene open 135721-136161
2297 JADRGD010000003.1 GCA018206505_01257 gene open 136424-136807
2298 JADRGD010000003.1 GCA018206505_01258 gene open 136854-138143
2299 JADRGD010000003.1 GCA018206505_01259 gene open 138158-139933 pepF
2300 JADRGD010000003.1 GCA018206505_01260 gene open 139942-141636
2301 JADRGD010000003.1 GCA018206505_01261 gene open 141704-142063
2302 JADRGD010000003.1 GCA018206505_01262 gene open 142158-142826
2303 JADRGD010000003.1 GCA018206505_01263 gene open 142819-144759 metG
2304 JADRGD010000003.1 GCA018206505_01264 gene open 144788-145672 galU
2305 JADRGD010000003.1 GCA018206505_01265 gene open 145870-147018 metK
2306 JADRGD010000003.1 GCA018206505_01266 gene open 147134-147814
2307 JADRGD010000003.1 GCA018206505_01267 gene open 147864-148616
2308 JADRGD010000003.1 GCA018206505_01268 gene open 148638-150161
2309 JADRGD010000003.1 GCA018206505_01269 gene open 150171-150884
2310 JADRGD010000003.1 GCA018206505_01270 gene open 150871-151218
2311 JADRGD010000003.1 GCA018206505_01271 gene open 151415-151933
2312 JADRGD010000003.1 GCA018206505_01272 gene open 152393-153016
2313 JADRGD010000003.1 GCA018206505_01273 gene open 153009-154226
2314 JADRGD010000003.1 GCA018206505_01274 gene open 154220-154936 pyrF
2315 JADRGD010000003.1 GCA018206505_01275 gene open 154941-155861
2316 JADRGD010000003.1 GCA018206505_01276 gene open 155871-156671
2317 JADRGD010000003.1 GCA018206505_01277 gene open 156681-157586 pyrB
2318 JADRGD010000003.1 GCA018206505_01278 gene open 157874-158842
2319 JADRGD010000003.1 GCA018206505_01279 gene open 159029-160741 argS
2320 JADRGD010000003.1 GCA018206505_01280 gene open 161089-161165 trnR
2321 JADRGD010000003.1 GCA018206505_01280 tRNA open 161089-161165 trnR tRNA-Arg(tcg)
2322 JADRGD010000004.1 repeat_region open 25826-26532 CRISPR array with 11 repeats of length 30%2C consensus sequence GTTAAAATTCCAATCTACTTGGATTTAGTC and spacer length 36
2323 JADRGD010000004.1 GCA018206505_01284 CDS open 69-2381 _na     770_aa putative modification methyltransferase
2324 JADRGD010000004.1 GCA018206505_01285 CDS open 2381-2608 _na     75_aa Helix-turn-helix domain-containing protein
2325 JADRGD010000004.1 GCA018206505_01286 CDS open 2725-2883 _na     52_aa Conjugal transfer protein
2326 JADRGD010000004.1 GCA018206505_01287 CDS open 2887-3198 _na     103_aa Single-strand binding family protein
2327 JADRGD010000004.1 GCA018206505_01288 CDS open 3388-4227 _na     279_aa CD-NTase-associated protein 12/Pycsar effector protein TIR domain-containing protein
2328 JADRGD010000004.1 GCA018206505_01289 CDS open 4301-4912 _na     203_aa DUF6037 domain-containing protein
2329 JADRGD010000004.1 GCA018206505_01290 CDS open 5003-6784 _na     593_aa virD4 VirD4-like conjugal transfer protein%2C CD1115 family
2330 JADRGD010000004.1 GCA018206505_01291 CDS open 6781-7266 _na     161_aa Conjugal transfer protein
2331 JADRGD010000004.1 GCA018206505_01292 CDS open 7266-7853 _na     195_aa DUF6017 domain-containing protein
2332 JADRGD010000004.1 GCA018206505_01293 CDS open 7837-8280 _na     147_aa hypothetical protein
2333 JADRGD010000004.1 GCA018206505_01294 CDS open 8359-8640 _na     93_aa Succinate dehydrogenase
2334 JADRGD010000004.1 GCA018206505_01295 CDS open 8659-10290 _na     543_aa rlmD 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD
2335 JADRGD010000004.1 GCA018206505_01296 CDS open 10301-10561 _na     86_aa Septum formation initiator
2336 JADRGD010000004.1 GCA018206505_01297 CDS open 10558-11499 _na     313_aa rsmH 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH
2337 JADRGD010000004.1 GCA018206505_01298 CDS open 11515-11787 _na     90_aa YGGT family protein
2338 JADRGD010000004.1 GCA018206505_01299 CDS open 11797-12351 _na     184_aa pgsA CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase
2339 JADRGD010000004.1 GCA018206505_01300 CDS open 12364-13698 _na     444_aa rimO 30S ribosomal protein S12 methylthiotransferase RimO
2340 JADRGD010000004.1 GCA018206505_01301 CDS open 13715-15946 _na     743_aa pnp polyribonucleotide nucleotidyltransferase
2341 JADRGD010000004.1 GCA018206505_01302 CDS open 15894-17294 _na     466_aa Aldose 1-epimerase
2342 JADRGD010000004.1 GCA018206505_01303 CDS open 17382-18173 _na     263_aa putative membrane transporter protein
2343 JADRGD010000004.1 GCA018206505_01304 CDS open 18176-20416 _na     746_aa Serine protease
2344 JADRGD010000004.1 GCA018206505_01305 CDS open 20706-20954 _na     82_aa hypothetical protein
2345 JADRGD010000004.1 GCA018206505_01306 CDS open 20973-21521 _na     182_aa DJ-1 family glyoxalase III
2346 JADRGD010000004.1 GCA018206505_01307 CDS open 21652-21831 _na     59_aa hypothetical protein
2347 JADRGD010000004.1 GCA018206505_01308 CDS open 21873-22430 _na     185_aa DUF1788 domain-containing protein
2348 JADRGD010000004.1 GCA018206505_01309 CDS open 22451-23041 _na     196_aa DUF1819 domain-containing protein
2349 JADRGD010000004.1 GCA018206505_01310 CDS open 23066-25576 _na     836_aa pglZ BREX-1 system phosphatase PglZ type A
2350 JADRGD010000004.1 GCA018206505_01311 CDS open 26709-30044 _na     1111_aa cas13c type VI-C CRISPR-associated RNA-guided ribonuclease Cas13c
2351 JADRGD010000004.1 GCA018206505_01312 CDS open 30068-33718 _na     1216_aa pglX BREX-1 system adenine-specific DNA-methyltransferase PglX
2352 JADRGD010000004.1 GCA018206505_01313 CDS open 33814-37536 _na     1240_aa brxC BREX system P-loop protein BrxC
2353 JADRGD010000004.1 GCA018206505_01314 CDS open 37667-38227 _na     186_aa Chromate transporter
2354 JADRGD010000004.1 GCA018206505_01315 CDS open 38224-38802 _na     192_aa Chromate transporter
2355 JADRGD010000004.1 GCA018206505_01316 CDS open 38887-40164 _na     425_aa adenylosuccinate synthase
2356 JADRGD010000004.1 GCA018206505_01317 CDS open 40176-40880 _na     234_aa trmB tRNA (guanosine(46)-N7)-methyltransferase TrmB
2357 JADRGD010000004.1 GCA018206505_01318 CDS open 40856-42085 _na     409_aa 3-deoxy-D-manno-octulosonic acid transferase
2358 JADRGD010000004.1 GCA018206505_01319 CDS open 42095-42751 _na     218_aa cmk (d)CMP kinase
2359 JADRGD010000004.1 GCA018206505_01320 CDS open 42760-43689 _na     309_aa prmA 50S ribosomal protein L11 methyltransferase
2360 JADRGD010000004.1 GCA018206505_01321 CDS open 43686-44489 _na     267_aa Putative metallophosphoesterase
2361 JADRGD010000004.1 GCA018206505_01322 CDS open 44602-44919 _na     105_aa DNA-binding protein HU-beta
2362 JADRGD010000004.1 GCA018206505_01323 CDS open 45083-47002 _na     639_aa Glycogen debranching enzyme
2363 JADRGD010000004.1 GCA018206505_01324 CDS open 47061-47660 _na     199_aa Lipoprotein
2364 JADRGD010000004.1 GCA018206505_01325 CDS open 47676-51509 _na     1277_aa YadA-like family protein
2365 JADRGD010000004.1 GCA018206505_01326 CDS open 52039-53904 _na     621_aa PTS system fructose-specific EIIABC component
2366 JADRGD010000004.1 GCA018206505_01327 CDS open 53913-54833 _na     306_aa pfkB 1-phosphofructokinase
2367 JADRGD010000004.1 GCA018206505_01328 CDS open 54830-55531 _na     233_aa Transcription-repair coupling factor
2368 JADRGD010000004.1 GCA018206505_01329 CDS open 55720-57141 _na     473_aa Glycogen synthase
2369 JADRGD010000004.1 GCA018206505_01330 CDS open 57152-58315 _na     387_aa glgD glucose-1-phosphate adenylyltransferase subunit GlgD
2370 JADRGD010000004.1 GCA018206505_01331 CDS open 58334-59479 _na     381_aa glucose-1-phosphate adenylyltransferase
2371 JADRGD010000004.1 GCA018206505_01332 CDS open 59506-61341 _na     611_aa glgB 1%2C4-alpha-glucan branching protein GlgB
2372 JADRGD010000004.1 GCA018206505_01333 CDS open 61347-63710 _na     787_aa Alpha-1%2C4 glucan phosphorylase
2373 JADRGD010000004.1 GCA018206505_01334 CDS open 63900-64439 _na     179_aa rbr rubrerythrin
2374 JADRGD010000004.1 GCA018206505_01335 CDS open 64648-64758 _na     36_aa hypothetical protein
2375 JADRGD010000004.1 GCA018206505_01336 CDS open 64724-66538 _na     604_aa Acetyltransferase
2376 JADRGD010000004.1 GCA018206505_01337 CDS open 66540-67346 _na     268_aa Acyltransferase
2377 JADRGD010000004.1 GCA018206505_01338 CDS open 67369-68205 _na     278_aa DUF2490 domain-containing protein
2378 JADRGD010000004.1 GCA018206505_01339 CDS open 68227-68907 _na     226_aa Inhibitor of apoptosis-promoting Bax1
2379 JADRGD010000004.1 GCA018206505_01340 CDS open 68929-70110 _na     393_aa NADH-dependent butanol dehydrogenase A
2380 JADRGD010000004.1 GCA018206505_01341 CDS open 70148-71722 _na     524_aa FAD-dependent protein C-terminal domain-containing protein
2381 JADRGD010000004.1 GCA018206505_01342 CDS open 71719-72096 _na     125_aa hypothetical protein
2382 JADRGD010000004.1 GCA018206505_01343 CDS open 72181-73389 _na     402_aa Acetyl-CoA C-acetyltransferase
2383 JADRGD010000004.1 GCA018206505_01344 CDS open 73473-74198 _na     241_aa fabG 3-oxoacyl-[acyl-carrier-protein] reductase
2384 JADRGD010000004.1 GCA018206505_01345 CDS open 74383-75609 _na     408_aa aroA 3-phosphoshikimate 1-carboxyvinyltransferase
2385 JADRGD010000004.1 GCA018206505_01346 CDS open 75596-76591 _na     331_aa aroC chorismate synthase
2386 JADRGD010000004.1 GCA018206505_01347 CDS open 76569-76826 _na     85_aa Chorismate mutase
2387 JADRGD010000004.1 GCA018206505_01348 CDS open 76823-77626 _na     267_aa Shikimate dehydrogenase (NADP(+))
2388 JADRGD010000004.1 GCA018206505_01349 CDS open 77598-78032 _na     144_aa 3-dehydroquinate dehydratase
2389 JADRGD010000004.1 GCA018206505_01350 CDS open 78037-79674 _na     545_aa formate--tetrahydrofolate ligase
2390 JADRGD010000004.1 GCA018206505_01351 CDS open 79752-81107 _na     451_aa YadA-like C-terminal domain protein
2391 JADRGD010000004.1 GCA018206505_01353 CDS open 81419-82876 _na     485_aa cls cardiolipin synthase
2392 JADRGD010000004.1 GCA018206505_01354 CDS open 83013-83807 _na     264_aa SIR2-like domain-containing protein
2393 JADRGD010000004.1 GCA018206505_01355 CDS open 83849-84718 _na     289_aa hypothetical protein
2394 JADRGD010000004.1 GCA018206505_01356 CDS open 84738-85526 _na     262_aa GTP pyrophosphokinase
2395 JADRGD010000004.1 GCA018206505_01357 CDS open 85658-86323 _na     221_aa Zinc metalloprotease
2396 JADRGD010000004.1 GCA018206505_01358 CDS open 86499-87482 _na     327_aa asnA aspartate--ammonia ligase
2397 JADRGD010000004.1 GCA018206505_01359 CDS open 87768-88442 _na     224_aa artQ Arginine ABC transporter%2C permease protein ArtQ
2398 JADRGD010000004.1 GCA018206505_01360 CDS open 88435-89163 _na     242_aa glnQ Glutamine ABC transporter%2C ATP-binding protein GlnQ
2399 JADRGD010000004.1 GCA018206505_01361 CDS open 89209-89925 _na     238_aa Basic amino acid ABC transporter substrate-binding protein
2400 JADRGD010000004.1 GCA018206505_01362 CDS open 89937-90647 _na     236_aa putative 2-phosphosulfolactate phosphatase
2401 JADRGD010000004.1 GCA018206505_01363 CDS open 90684-91685 _na     333_aa Site-specific recombinase%2C phage integrase family
2402 JADRGD010000004.1 GCA018206505_01364 CDS open 91871-92416 _na     181_aa hypothetical protein
2403 JADRGD010000004.1 GCA018206505_01365 CDS open 92426-93349 _na     307_aa hypothetical protein
2404 JADRGD010000004.1 GCA018206505_01366 CDS open 93480-94277 _na     265_aa nikM Nickel transport complex%2C NikM subunit%2C transmembrane
2405 JADRGD010000004.1 GCA018206505_01367 CDS open 94310-94729 _na     139_aa Lipoprotein
2406 JADRGD010000004.1 GCA018206505_01368 CDS open 94759-95637 _na     292_aa Copper-binding protein
2407 JADRGD010000004.1 GCA018206505_01369 CDS open 95634-96533 _na     299_aa ABC 3 transport family protein
2408 JADRGD010000004.1 GCA018206505_01370 CDS open 96548-97264 _na     238_aa ABC transporter%2C ATP-binding protein
2409 JADRGD010000004.1 GCA018206505_01371 CDS open 97265-98176 _na     303_aa ABC transporter substrate-binding protein
2410 JADRGD010000004.1 GCA018206505_01372 CDS open 98188-98763 _na     191_aa DUF6162 domain-containing protein
2411 JADRGD010000004.1 GCA018206505_01373 CDS open 99101-99328 _na     75_aa relB type II toxin-antitoxin system RelB family antitoxin
2412 JADRGD010000004.1 GCA018206505_01374 CDS open 99313-99579 _na     88_aa Addiction module toxin%2C RelE/StbE family
2413 JADRGD010000004.1 GCA018206505_01375 CDS open 99771-99986 _na     71_aa hypothetical protein
2414 JADRGD010000004.1 GCA018206505_01376 CDS open 100200-101444 _na     414_aa gltS sodium/glutamate symporter
2415 JADRGD010000004.1 GCA018206505_01377 CDS open 101647-101895 _na     82_aa Acyl-CoA dehydrogenase/oxidase C-terminal domain-containing protein
2416 JADRGD010000004.1 GCA018206505_01284 gene open 69-2381
2417 JADRGD010000004.1 GCA018206505_01285 gene open 2381-2608
2418 JADRGD010000004.1 GCA018206505_01286 gene open 2725-2883
2419 JADRGD010000004.1 GCA018206505_01287 gene open 2887-3198
2420 JADRGD010000004.1 GCA018206505_01288 gene open 3388-4227
2421 JADRGD010000004.1 GCA018206505_01289 gene open 4301-4912
2422 JADRGD010000004.1 GCA018206505_01290 gene open 5003-6784 virD4
2423 JADRGD010000004.1 GCA018206505_01291 gene open 6781-7266
2424 JADRGD010000004.1 GCA018206505_01292 gene open 7266-7853
2425 JADRGD010000004.1 GCA018206505_01293 gene open 7837-8280
2426 JADRGD010000004.1 GCA018206505_01294 gene open 8359-8640
2427 JADRGD010000004.1 GCA018206505_01295 gene open 8659-10290 rlmD
2428 JADRGD010000004.1 GCA018206505_01296 gene open 10301-10561
2429 JADRGD010000004.1 GCA018206505_01297 gene open 10558-11499 rsmH
2430 JADRGD010000004.1 GCA018206505_01298 gene open 11515-11787
2431 JADRGD010000004.1 GCA018206505_01299 gene open 11797-12351 pgsA
2432 JADRGD010000004.1 GCA018206505_01300 gene open 12364-13698 rimO
2433 JADRGD010000004.1 GCA018206505_01301 gene open 13715-15946 pnp
2434 JADRGD010000004.1 GCA018206505_01302 gene open 15894-17294
2435 JADRGD010000004.1 GCA018206505_01303 gene open 17382-18173
2436 JADRGD010000004.1 GCA018206505_01304 gene open 18176-20416
2437 JADRGD010000004.1 GCA018206505_01305 gene open 20706-20954
2438 JADRGD010000004.1 GCA018206505_01306 gene open 20973-21521
2439 JADRGD010000004.1 GCA018206505_01307 gene open 21652-21831
2440 JADRGD010000004.1 GCA018206505_01308 gene open 21873-22430
2441 JADRGD010000004.1 GCA018206505_01309 gene open 22451-23041
2442 JADRGD010000004.1 GCA018206505_01310 gene open 23066-25576 pglZ
2443 JADRGD010000004.1 GCA018206505_01311 gene open 26709-30044 cas13c
2444 JADRGD010000004.1 GCA018206505_01312 gene open 30068-33718 pglX
2445 JADRGD010000004.1 GCA018206505_01313 gene open 33814-37536 brxC
2446 JADRGD010000004.1 GCA018206505_01314 gene open 37667-38227
2447 JADRGD010000004.1 GCA018206505_01315 gene open 38224-38802
2448 JADRGD010000004.1 GCA018206505_01316 gene open 38887-40164
2449 JADRGD010000004.1 GCA018206505_01317 gene open 40176-40880 trmB
2450 JADRGD010000004.1 GCA018206505_01318 gene open 40856-42085
2451 JADRGD010000004.1 GCA018206505_01319 gene open 42095-42751 cmk
2452 JADRGD010000004.1 GCA018206505_01320 gene open 42760-43689 prmA
2453 JADRGD010000004.1 GCA018206505_01321 gene open 43686-44489
2454 JADRGD010000004.1 GCA018206505_01322 gene open 44602-44919
2455 JADRGD010000004.1 GCA018206505_01323 gene open 45083-47002
2456 JADRGD010000004.1 GCA018206505_01324 gene open 47061-47660
2457 JADRGD010000004.1 GCA018206505_01325 gene open 47676-51509
2458 JADRGD010000004.1 GCA018206505_01326 gene open 52039-53904
2459 JADRGD010000004.1 GCA018206505_01327 gene open 53913-54833 pfkB
2460 JADRGD010000004.1 GCA018206505_01328 gene open 54830-55531
2461 JADRGD010000004.1 GCA018206505_01329 gene open 55720-57141
2462 JADRGD010000004.1 GCA018206505_01330 gene open 57152-58315 glgD
2463 JADRGD010000004.1 GCA018206505_01331 gene open 58334-59479
2464 JADRGD010000004.1 GCA018206505_01332 gene open 59506-61341 glgB
2465 JADRGD010000004.1 GCA018206505_01333 gene open 61347-63710
2466 JADRGD010000004.1 GCA018206505_01334 gene open 63900-64439 rbr
2467 JADRGD010000004.1 GCA018206505_01335 gene open 64648-64758
2468 JADRGD010000004.1 GCA018206505_01336 gene open 64724-66538
2469 JADRGD010000004.1 GCA018206505_01337 gene open 66540-67346
2470 JADRGD010000004.1 GCA018206505_01338 gene open 67369-68205
2471 JADRGD010000004.1 GCA018206505_01339 gene open 68227-68907
2472 JADRGD010000004.1 GCA018206505_01340 gene open 68929-70110
2473 JADRGD010000004.1 GCA018206505_01341 gene open 70148-71722
2474 JADRGD010000004.1 GCA018206505_01342 gene open 71719-72096
2475 JADRGD010000004.1 GCA018206505_01343 gene open 72181-73389
2476 JADRGD010000004.1 GCA018206505_01344 gene open 73473-74198 fabG
2477 JADRGD010000004.1 GCA018206505_01345 gene open 74383-75609 aroA
2478 JADRGD010000004.1 GCA018206505_01346 gene open 75596-76591 aroC
2479 JADRGD010000004.1 GCA018206505_01347 gene open 76569-76826
2480 JADRGD010000004.1 GCA018206505_01348 gene open 76823-77626
2481 JADRGD010000004.1 GCA018206505_01349 gene open 77598-78032
2482 JADRGD010000004.1 GCA018206505_01350 gene open 78037-79674
2483 JADRGD010000004.1 GCA018206505_01351 gene open 79752-81107
2484 JADRGD010000004.1 GCA018206505_01353 gene open 81419-82876 cls
2485 JADRGD010000004.1 GCA018206505_01354 gene open 83013-83807
2486 JADRGD010000004.1 GCA018206505_01355 gene open 83849-84718
2487 JADRGD010000004.1 GCA018206505_01356 gene open 84738-85526
2488 JADRGD010000004.1 GCA018206505_01357 gene open 85658-86323
2489 JADRGD010000004.1 GCA018206505_01358 gene open 86499-87482 asnA
2490 JADRGD010000004.1 GCA018206505_01359 gene open 87768-88442 artQ
2491 JADRGD010000004.1 GCA018206505_01360 gene open 88435-89163 glnQ
2492 JADRGD010000004.1 GCA018206505_01361 gene open 89209-89925
2493 JADRGD010000004.1 GCA018206505_01362 gene open 89937-90647
2494 JADRGD010000004.1 GCA018206505_01363 gene open 90684-91685
2495 JADRGD010000004.1 GCA018206505_01364 gene open 91871-92416
2496 JADRGD010000004.1 GCA018206505_01365 gene open 92426-93349
2497 JADRGD010000004.1 GCA018206505_01366 gene open 93480-94277 nikM
2498 JADRGD010000004.1 GCA018206505_01367 gene open 94310-94729
2499 JADRGD010000004.1 GCA018206505_01368 gene open 94759-95637
2500 JADRGD010000004.1 GCA018206505_01369 gene open 95634-96533