BAKTAGenome Explorer: Fannyhessea vaginae (GCA_019400095.1)
Select a Genome:
|
BAKTA Annotations for GCA_019400095.1
|
Search & Sort all 2506 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 501 | JACUVO010000001.1 | GCA019400095_00111 | gene | open | 132639-133412 | |||
| 502 | JACUVO010000001.1 | GCA019400095_00112 | gene | open | 133427-133741 | spoIIAA | ||
| 503 | JACUVO010000001.1 | GCA019400095_00113 | gene | open | 133770-134684 | |||
| 504 | JACUVO010000001.1 | GCA019400095_00114 | gene | open | 134856-136151 | aRO8 | ||
| 505 | JACUVO010000001.1 | GCA019400095_00115 | gene | open | 136214-136519 | |||
| 506 | JACUVO010000001.1 | GCA019400095_00116 | gene | open | 136564-137931 | nhaA | ||
| 507 | JACUVO010000001.1 | GCA019400095_00117 | gene | open | 138193-139062 | degV | ||
| 508 | JACUVO010000001.1 | GCA019400095_00118 | gene | open | 139214-139699 | luxS | ||
| 509 | JACUVO010000001.1 | GCA019400095_00119 | gene | open | 139784-140485 | mtnN | ||
| 510 | JACUVO010000001.1 | GCA019400095_00120 | gene | open | 140571-143177 | uvrD | ||
| 511 | JACUVO010000001.1 | GCA019400095_00121 | gene | open | 143285-144067 | glnQ | ||
| 512 | JACUVO010000001.1 | GCA019400095_00122 | gene | open | 144077-144940 | hisM | ||
| 513 | JACUVO010000001.1 | GCA019400095_00123 | gene | open | 144937-145596 | hisM | ||
| 514 | JACUVO010000001.1 | GCA019400095_00124 | gene | open | 145658-146629 | hisJ | ||
| 515 | JACUVO010000001.1 | GCA019400095_00125 | gene | open | 146942-147844 | uppP | ||
| 516 | JACUVO010000001.1 | GCA019400095_00126 | gene | open | 148024-148488 | uspA | ||
| 517 | JACUVO010000001.1 | GCA019400095_00127 | gene | open | 148652-149707 | |||
| 518 | JACUVO010000001.1 | GCA019400095_00128 | gene | open | 149923-150924 | rhaT | ||
| 519 | JACUVO010000001.1 | GCA019400095_00129 | gene | open | 151147-154170 | cym1 | ||
| 520 | JACUVO010000001.1 | GCA019400095_00130 | gene | open | 154390-154938 | nrdG | ||
| 521 | JACUVO010000001.1 | GCA019400095_00131 | gene | open | 155217-157439 | nrdD | ||
| 522 | JACUVO010000001.1 | GCA019400095_00132 | gene | open | 157633-157773 | |||
| 523 | JACUVO010000001.1 | GCA019400095_00133 | gene | open | 157922-158713 | cof | ||
| 524 | JACUVO010000001.1 | GCA019400095_00134 | gene | open | 158828-160192 | |||
| 525 | JACUVO010000001.1 | GCA019400095_00135 | gene | open | 160312-161238 | murB | ||
| 526 | JACUVO010000001.1 | GCA019400095_00136 | gene | open | 161746-162423 | fmnP | ||
| 527 | JACUVO010000001.1 | GCA019400095_00137 | gene | open | 162435-164351 | yejF | ||
| 528 | JACUVO010000001.1 | GCA019400095_00138 | gene | open | 164348-165160 | ecfT | ||
| 529 | JACUVO010000001.1 | GCA019400095_00139 | gene | open | 165440-166501 | tdh | ||
| 530 | JACUVO010000001.1 | GCA019400095_00140 | gene | open | 166673-167713 | galE | ||
| 531 | JACUVO010000001.1 | GCA019400095_00141 | gene | open | 167671-168807 | ispA | ||
| 532 | JACUVO010000001.1 | GCA019400095_00142 | gene | open | 169147-170067 | pGRP | ||
| 533 | JACUVO010000001.1 | GCA019400095_00144 | gene | open | 170565-171971 | glmU | ||
| 534 | JACUVO010000001.1 | GCA019400095_00145 | gene | open | 171974-172969 | prsA | ||
| 535 | JACUVO010000001.1 | GCA019400095_00146 | gene | open | 172978-173583 | pth | ||
| 536 | JACUVO010000001.1 | GCA019400095_00147 | gene | open | 173707-174549 | mcr1 | ||
| 537 | JACUVO010000001.1 | GCA019400095_00148 | gene | open | 174537-175943 | gltA | ||
| 538 | JACUVO010000001.1 | GCA019400095_00149 | gene | open | 176678-177331 | pyrE | ||
| 539 | JACUVO010000001.1 | GCA019400095_00150 | gene | open | 177350-178420 | wcaA | ||
| 540 | JACUVO010000001.1 | GCA019400095_00151 | gene | open | 178730-179665 | truA | ||
| 541 | JACUVO010000001.1 | GCA019400095_00152 | gene | open | 179766-180584 | ecfT | ||
| 542 | JACUVO010000001.1 | GCA019400095_00153 | gene | open | 180886-184077 | |||
| 543 | JACUVO010000001.1 | GCA019400095_00154 | gene | open | 184077-185594 | |||
| 544 | JACUVO010000001.1 | GCA019400095_00155 | gene | open | 185601-186095 | |||
| 545 | JACUVO010000001.1 | GCA019400095_00156 | gene | open | 186082-186555 | |||
| 546 | JACUVO010000001.1 | GCA019400095_00157 | gene | open | 186552-186971 | |||
| 547 | JACUVO010000001.1 | GCA019400095_00158 | gene | open | 186968-187630 | |||
| 548 | JACUVO010000001.1 | GCA019400095_00159 | gene | open | 187645-188241 | |||
| 549 | JACUVO010000001.1 | GCA019400095_00160 | gene | open | 188234-190786 | |||
| 550 | JACUVO010000001.1 | GCA019400095_00161 | gene | open | 190915-191124 | |||
| 551 | JACUVO010000001.1 | GCA019400095_00162 | gene | open | 191370-191957 | |||
| 552 | JACUVO010000001.1 | GCA019400095_00163 | gene | open | 192109-192477 | padR | ||
| 553 | JACUVO010000001.1 | GCA019400095_00164 | gene | open | 192674-194011 | |||
| 554 | JACUVO010000001.1 | GCA019400095_00165 | gene | open | 194194-195801 | |||
| 555 | JACUVO010000001.1 | GCA019400095_00166 | gene | open | 196006-196494 | rplQ | ||
| 556 | JACUVO010000001.1 | GCA019400095_00167 | gene | open | 196530-197474 | rpoA | ||
| 557 | JACUVO010000001.1 | GCA019400095_00168 | gene | open | 197496-198089 | rpsD | ||
| 558 | JACUVO010000001.1 | GCA019400095_00169 | gene | open | 198108-198506 | rpsK | ||
| 559 | JACUVO010000001.1 | GCA019400095_00170 | gene | open | 198516-198887 | rpsM | ||
| 560 | JACUVO010000001.1 | GCA019400095_00171 | gene | open | 198903-199016 | rpmJ | ||
| 561 | JACUVO010000001.1 | GCA019400095_00172 | gene | open | 199131-199385 | infA | ||
| 562 | JACUVO010000001.1 | GCA019400095_00173 | gene | open | 199525-200319 | map | ||
| 563 | JACUVO010000001.1 | GCA019400095_00174 | gene | open | 200316-200942 | adk | ||
| 564 | JACUVO010000001.1 | GCA019400095_00175 | gene | open | 201220-202425 | secY | ||
| 565 | JACUVO010000001.1 | GCA019400095_00176 | gene | open | 202503-202943 | rplO | ||
| 566 | JACUVO010000001.1 | GCA019400095_00177 | gene | open | 202955-203143 | rpmD | ||
| 567 | JACUVO010000001.1 | GCA019400095_00178 | gene | open | 203149-203670 | rpsE | ||
| 568 | JACUVO010000001.1 | GCA019400095_00179 | gene | open | 203682-204050 | rplR | ||
| 569 | JACUVO010000001.1 | GCA019400095_00180 | gene | open | 204111-204647 | rplF | ||
| 570 | JACUVO010000001.1 | GCA019400095_00181 | gene | open | 204676-205074 | rpsH | ||
| 571 | JACUVO010000001.1 | GCA019400095_00182 | gene | open | 205160-205345 | rpsN | ||
| 572 | JACUVO010000001.1 | GCA019400095_00183 | gene | open | 205428-205991 | rplE | ||
| 573 | JACUVO010000001.1 | GCA019400095_00184 | gene | open | 206338-208605 | inlB | ||
| 574 | JACUVO010000001.1 | GCA019400095_00185 | gene | open | 208959-210653 | |||
| 575 | JACUVO010000001.1 | GCA019400095_00186 | gene | open | 210870-212834 | |||
| 576 | JACUVO010000001.1 | GCA019400095_00187 | gene | open | 212864-213019 | |||
| 577 | JACUVO010000001.1 | GCA019400095_00188 | gene | open | 213277-214206 | rbbA | ||
| 578 | JACUVO010000001.1 | GCA019400095_00189 | gene | open | 214257-215870 | |||
| 579 | JACUVO010000001.1 | GCA019400095_00190 | gene | open | 216168-216488 | rplX | ||
| 580 | JACUVO010000001.1 | GCA019400095_00191 | gene | open | 216503-216871 | rplN | ||
| 581 | JACUVO010000001.1 | GCA019400095_00192 | gene | open | 216945-217211 | rpsQ | ||
| 582 | JACUVO010000001.1 | GCA019400095_00193 | gene | open | 217230-217442 | rpmC | ||
| 583 | JACUVO010000001.1 | GCA019400095_00194 | gene | open | 217448-217873 | rplP | ||
| 584 | JACUVO010000001.1 | GCA019400095_00195 | gene | open | 217873-218583 | rpsC | ||
| 585 | JACUVO010000001.1 | GCA019400095_00196 | gene | open | 218591-218950 | rplV | ||
| 586 | JACUVO010000001.1 | GCA019400095_00197 | gene | open | 218966-219223 | rpsS | ||
| 587 | JACUVO010000001.1 | GCA019400095_00198 | gene | open | 219255-220091 | rplB | ||
| 588 | JACUVO010000001.1 | GCA019400095_00199 | gene | open | 220221-220526 | rplW | ||
| 589 | JACUVO010000001.1 | GCA019400095_00200 | gene | open | 220526-221152 | rplD | ||
| 590 | JACUVO010000001.1 | GCA019400095_00201 | gene | open | 221190-221810 | rplC | ||
| 591 | JACUVO010000001.1 | GCA019400095_00202 | gene | open | 222322-223896 | |||
| 592 | JACUVO010000001.1 | GCA019400095_00203 | gene | open | 224058-225206 | penP | ||
| 593 | JACUVO010000001.1 | GCA019400095_00204 | gene | open | 225430-226407 | |||
| 594 | JACUVO010000001.1 | GCA019400095_00205 | gene | open | 226589-228076 | |||
| 595 | JACUVO010000001.1 | GCA019400095_00206 | gene | open | 228275-229531 | sstT | ||
| 596 | JACUVO010000001.1 | GCA019400095_00207 | gene | open | 229849-230157 | rpsJ | ||
| 597 | JACUVO010000001.1 | GCA019400095_00208 | gene | open | 230208-232304 | fusA | ||
| 598 | JACUVO010000001.1 | GCA019400095_00209 | gene | open | 232339-232809 | rpsG | ||
| 599 | JACUVO010000001.1 | GCA019400095_00210 | gene | open | 232880-233254 | rpsL | ||
| 600 | JACUVO010000001.1 | GCA019400095_00211 | gene | open | 233665-234000 | qdoI | ||
| 601 | JACUVO010000001.1 | GCA019400095_00212 | gene | open | 234130-234921 | ubiE | ||
| 602 | JACUVO010000001.1 | GCA019400095_00213 | gene | open | 235148-235594 | |||
| 603 | JACUVO010000001.1 | GCA019400095_00214 | gene | open | 235704-235925 | |||
| 604 | JACUVO010000001.1 | GCA019400095_00215 | gene | open | 235942-236082 | |||
| 605 | JACUVO010000001.1 | GCA019400095_00216 | gene | open | 236075-236686 | |||
| 606 | JACUVO010000001.1 | GCA019400095_00217 | gene | open | 236936-241393 | rpoA | ||
| 607 | JACUVO010000001.1 | GCA019400095_00218 | gene | open | 241399-244926 | rpoB | ||
| 608 | JACUVO010000001.1 | GCA019400095_00219 | gene | open | 245238-245615 | rplL | ||
| 609 | JACUVO010000001.1 | GCA019400095_00220 | gene | open | 245698-246216 | rplJ | ||
| 610 | JACUVO010000001.1 | GCA019400095_00221 | gene | open | 246794-247501 | rplA | ||
| 611 | JACUVO010000001.1 | GCA019400095_00222 | gene | open | 247645-248070 | rplK | ||
| 612 | JACUVO010000001.1 | GCA019400095_00223 | gene | open | 248268-248813 | nusG | ||
| 613 | JACUVO010000001.1 | GCA019400095_00224 | gene | open | 248816-249181 | secE | ||
| 614 | JACUVO010000001.1 | GCA019400095_00226 | gene | open | 249763-250968 | tuf | ||
| 615 | JACUVO010000001.1 | GCA019400095_00230 | gene | open | 251656-254418 | |||
| 616 | JACUVO010000001.1 | GCA019400095_00232 | gene | open | 254884-255639 | rae1 | ||
| 617 | JACUVO010000001.1 | GCA019400095_00233 | gene | open | 255685-256788 | rlmB | ||
| 618 | JACUVO010000001.1 | GCA019400095_00234 | gene | open | 256853-258325 | cysS | ||
| 619 | JACUVO010000001.1 | GCA019400095_00235 | gene | open | 258374-258865 | ispF | ||
| 620 | JACUVO010000001.1 | GCA019400095_00236 | gene | open | 258878-259594 | ispD | ||
| 621 | JACUVO010000001.1 | GCA019400095_00237 | gene | open | 259591-260667 | disA | ||
| 622 | JACUVO010000001.1 | GCA019400095_00238 | gene | open | 260854-263481 | clpA | ||
| 623 | JACUVO010000001.1 | GCA019400095_00239 | gene | open | 263499-265055 | lysS | ||
| 624 | JACUVO010000001.1 | GCA019400095_00240 | gene | open | 265227-265700 | greA | ||
| 625 | JACUVO010000001.1 | GCA019400095_00241 | gene | open | 265797-266033 | tatA | ||
| 626 | JACUVO010000001.1 | GCA019400095_00242 | gene | open | 266199-267104 | speE | ||
| 627 | JACUVO010000001.1 | GCA019400095_00243 | gene | open | 267161-267811 | tadA | ||
| 628 | JACUVO010000001.1 | GCA019400095_00245 | gene | open | 268399-268953 | lemA | ||
| 629 | JACUVO010000001.1 | GCA019400095_00246 | gene | open | 269095-270435 | |||
| 630 | JACUVO010000001.1 | GCA019400095_00247 | gene | open | 270647-271609 | tktA2 | ||
| 631 | JACUVO010000001.1 | GCA019400095_00248 | gene | open | 271638-272573 | tktA1 | ||
| 632 | JACUVO010000001.1 | GCA019400095_00249 | gene | open | 272652-272933 | sgaB | ||
| 633 | JACUVO010000001.1 | GCA019400095_00250 | gene | open | 273185-274639 | ulaA | ||
| 634 | JACUVO010000001.1 | GCA019400095_00251 | gene | open | 274790-275239 | ptsN | ||
| 635 | JACUVO010000001.1 | GCA019400095_00252 | gene | open | 275682-276572 | glpR | ||
| 636 | JACUVO010000001.1 | GCA019400095_00253 | gene | open | 276653-278125 | dcuC | ||
| 637 | JACUVO010000001.1 | GCA019400095_00254 | gene | open | 278204-279148 | rihC | ||
| 638 | JACUVO010000001.1 | GCA019400095_00255 | gene | open | 279281-280222 | rbsK | ||
| 639 | JACUVO010000001.1 | GCA019400095_00256 | gene | open | 280608-282683 | purR | ||
| 640 | JACUVO010000001.1 | GCA019400095_00258 | gene | open | 284637-285617 | cof | ||
| 641 | JACUVO010000001.1 | GCA019400095_00259 | gene | open | 285760-287967 | |||
| 642 | JACUVO010000001.1 | GCA019400095_00261 | gene | open | 288340-290352 | |||
| 643 | JACUVO010000001.1 | GCA019400095_00262 | gene | open | 290601-294164 | |||
| 644 | JACUVO010000001.1 | GCA019400095_00263 | gene | open | 294495-296969 | xFP | ||
| 645 | JACUVO010000001.1 | GCA019400095_00264 | gene | open | 297189-297962 | araD | ||
| 646 | JACUVO010000001.1 | GCA019400095_00265 | gene | open | 297952-298809 | sgaU | ||
| 647 | JACUVO010000001.1 | GCA019400095_00266 | gene | open | 298856-299494 | ulaD | ||
| 648 | JACUVO010000001.1 | GCA019400095_00267 | gene | open | 299533-299832 | sgaB | ||
| 649 | JACUVO010000001.1 | GCA019400095_00268 | gene | open | 299961-301436 | ulaA | ||
| 650 | JACUVO010000001.1 | GCA019400095_00269 | gene | open | 301508-301957 | ptsN | ||
| 651 | JACUVO010000001.1 | GCA019400095_00270 | gene | open | 301999-303063 | ulaG | ||
| 652 | JACUVO010000001.1 | GCA019400095_00271 | gene | open | 303341-304195 | glpR | ||
| 653 | JACUVO010000001.1 | GCA019400095_00272 | gene | open | 304332-305774 | gnd | ||
| 654 | JACUVO010000001.1 | GCA019400095_00273 | gene | open | 306017-307945 | oafA | ||
| 655 | JACUVO010000001.1 | GCA019400095_00274 | gene | open | 308097-309380 | serS | ||
| 656 | JACUVO010000001.1 | GCA019400095_00275 | gene | open | 309562-309783 | |||
| 657 | JACUVO010000001.1 | GCA019400095_00277 | gene | open | 310099-312081 | sPS1 | ||
| 658 | JACUVO010000001.1 | GCA019400095_00278 | gene | open | 312062-313375 | fHA | ||
| 659 | JACUVO010000001.1 | GCA019400095_00279 | gene | open | 313377-313790 | |||
| 660 | JACUVO010000001.1 | GCA019400095_00280 | gene | open | 313787-315139 | pTC1 | ||
| 661 | JACUVO010000001.1 | GCA019400095_00281 | gene | open | 315136-318024 | ftsW | ||
| 662 | JACUVO010000001.1 | GCA019400095_00282 | gene | open | 318208-320115 | pknB | ||
| 663 | JACUVO010000001.1 | GCA019400095_00283 | gene | open | 320261-322342 | |||
| 664 | JACUVO010000001.1 | GCA019400095_00284 | gene | open | 322326-323201 | lolD | ||
| 665 | JACUVO010000001.1 | GCA019400095_00285 | gene | open | 323365-324399 | baeS | ||
| 666 | JACUVO010000001.1 | GCA019400095_00286 | gene | open | 324411-325106 | ompR | ||
| 667 | JACUVO010000001.1 | GCA019400095_00287 | gene | open | 325410-327575 | zntA | ||
| 668 | JACUVO010000001.1 | GCA019400095_00288 | gene | open | 327598-327951 | |||
| 669 | JACUVO010000001.1 | GCA019400095_00290 | gene | open | 328508-329179 | |||
| 670 | JACUVO010000001.1 | GCA019400095_00291 | gene | open | 329328-330923 | baeS | ||
| 671 | JACUVO010000001.1 | GCA019400095_00292 | gene | open | 331033-331758 | ompR | ||
| 672 | JACUVO010000001.1 | GCA019400095_00293 | gene | open | 331841-333130 | |||
| 673 | JACUVO010000001.1 | GCA019400095_00294 | gene | open | 333160-334659 | purB | ||
| 674 | JACUVO010000001.1 | GCA019400095_00296 | gene | open | 335025-335213 | |||
| 675 | JACUVO010000001.1 | GCA019400095_00297 | gene | open | 335315-336088 | |||
| 676 | JACUVO010000001.1 | GCA019400095_00298 | gene | open | 336433-337515 | nlpA | ||
| 677 | JACUVO010000001.1 | GCA019400095_00299 | gene | open | 337693-338847 | abcC | ||
| 678 | JACUVO010000001.1 | GCA019400095_00300 | gene | open | 338875-339609 | metP | ||
| 679 | JACUVO010000001.1 | GCA019400095_00302 | gene | open | 339897-343151 | |||
| 680 | JACUVO010000001.1 | GCA019400095_00303 | gene | open | 343458-345740 | |||
| 681 | JACUVO010000001.1 | GCA019400095_00304 | gene | open | 345783-348818 | polC | ||
| 682 | JACUVO010000001.1 | GCA019400095_00305 | gene | open | 348833-349786 | ddlA | ||
| 683 | JACUVO010000001.1 | GCA019400095_00306 | gene | open | 349903-351153 | rlmN | ||
| 684 | JACUVO010000001.1 | GCA019400095_00307 | gene | open | 351285-352148 | spo0J | ||
| 685 | JACUVO010000001.1 | GCA019400095_00308 | gene | open | 352141-352932 | parA | ||
| 686 | JACUVO010000001.1 | GCA019400095_00309 | gene | open | 352972-353817 | rsmG | ||
| 687 | JACUVO010000001.1 | GCA019400095_00310 | gene | open | 354064-354891 | jag | ||
| 688 | JACUVO010000001.1 | GCA019400095_00311 | gene | open | 354922-355680 | yidC | ||
| 689 | JACUVO010000001.1 | GCA019400095_00312 | gene | open | 355978-356295 | rnpA | ||
| 690 | JACUVO010000001.1 | GCA019400095_00313 | gene | open | 356325-356465 | rpmH | ||
| 691 | JACUVO010000001.1 | GCA019400095_00314 | gene | open | 356942-358081 | |||
| 692 | JACUVO010000001.1 | GCA019400095_00315 | gene | open | 358298-360001 | dnaA | ||
| 693 | JACUVO010000001.1 | GCA019400095_00316 | gene | open | 360270-361379 | dnaN | ||
| 694 | JACUVO010000001.1 | GCA019400095_00317 | gene | open | 361395-362543 | recF | ||
| 695 | JACUVO010000001.1 | GCA019400095_00318 | gene | open | 362527-363090 | |||
| 696 | JACUVO010000001.1 | GCA019400095_00319 | gene | open | 363251-365197 | gyrB | ||
| 697 | JACUVO010000001.1 | GCA019400095_00320 | gene | open | 365212-368049 | gyrA | ||
| 698 | JACUVO010000001.1 | GCA019400095_00321 | gene | open | 368205-368789 | |||
| 699 | JACUVO010000001.1 | GCA019400095_00324 | gene | open | 369385-369840 | |||
| 700 | JACUVO010000001.1 | GCA019400095_00325 | gene | open | 369974-371812 | typA | ||
| 701 | JACUVO010000001.1 | GCA019400095_00326 | gene | open | 371878-372654 | yadS | ||
| 702 | JACUVO010000001.1 | GCA019400095_00329 | gene | open | 373562-374392 | |||
| 703 | JACUVO010000001.1 | GCA019400095_00330 | gene | open | 374706-374999 | rpsF | ||
| 704 | JACUVO010000001.1 | GCA019400095_00331 | gene | open | 375044-375571 | ssb | ||
| 705 | JACUVO010000001.1 | GCA019400095_00332 | gene | open | 375635-375907 | rpsR | ||
| 706 | JACUVO010000001.1 | GCA019400095_00333 | gene | open | 375964-376512 | rplI | ||
| 707 | JACUVO010000001.1 | GCA019400095_00334 | gene | open | 377056-378471 | dnaB | ||
| 708 | JACUVO010000001.1 | GCA019400095_00335 | gene | open | 378612-379892 | purA | ||
| 709 | JACUVO010000001.1 | GCA019400095_00336 | gene | open | 379973-380908 | degV | ||
| 710 | JACUVO010000001.1 | GCA019400095_00337 | gene | open | 381097-381747 | mutT | ||
| 711 | JACUVO010000001.1 | GCA019400095_00338 | gene | open | 381781-382833 | |||
| 712 | JACUVO010000001.1 | GCA019400095_00339 | gene | open | 383024-383944 | pdxK | ||
| 713 | JACUVO010000001.1 | GCA019400095_00340 | gene | open | 384168-385067 | |||
| 714 | JACUVO010000001.1 | GCA019400095_00341 | gene | open | 385157-386200 | dacC | ||
| 715 | JACUVO010000001.1 | GCA019400095_00342 | gene | open | 386401-387774 | argE | ||
| 716 | JACUVO010000001.1 | GCA019400095_00343 | gene | open | 387843-388292 | |||
| 717 | JACUVO010000001.1 | GCA019400095_00344 | gene | open | 388810-389844 | lacI | ||
| 718 | JACUVO010000001.1 | GCA019400095_00345 | gene | open | 390755-391378 | |||
| 719 | JACUVO010000001.1 | GCA019400095_00346 | gene | open | 391417-391857 | |||
| 720 | JACUVO010000001.1 | GCA019400095_00347 | gene | open | 391879-392163 | |||
| 721 | JACUVO010000001.1 | GCA019400095_00348 | gene | open | 392176-393468 | |||
| 722 | JACUVO010000001.1 | GCA019400095_00349 | gene | open | 393572-394468 | |||
| 723 | JACUVO010000001.1 | GCA019400095_00352 | gene | open | 396185-396829 | |||
| 724 | JACUVO010000001.1 | GCA019400095_00353 | gene | open | 396888-397847 | yitT | ||
| 725 | JACUVO010000001.1 | GCA019400095_00354 | gene | open | 398091-398768 | queT | ||
| 726 | JACUVO010000001.1 | GCA019400095_00355 | gene | open | 398890-400230 | lytS | ||
| 727 | JACUVO010000001.1 | GCA019400095_00356 | gene | open | 400389-401132 | lytT | ||
| 728 | JACUVO010000001.1 | GCA019400095_00357 | gene | open | 401197-401655 | yfcE | ||
| 729 | JACUVO010000001.1 | GCA019400095_00358 | gene | open | 401717-402436 | pgpB | ||
| 730 | JACUVO010000001.1 | GCA019400095_00359 | gene | open | 402617-402934 | trxA | ||
| 731 | JACUVO010000001.1 | GCA019400095_00360 | gene | open | 403294-403728 | |||
| 732 | JACUVO010000001.1 | GCA019400095_00361 | gene | open | 403826-405532 | pgi | ||
| 733 | JACUVO010000001.1 | GCA019400095_00363 | gene | open | 405772-406410 | dedA | ||
| 734 | JACUVO010000001.1 | GCA019400095_00364 | gene | open | 406532-408769 | dnaX | ||
| 735 | JACUVO010000001.1 | GCA019400095_00365 | gene | open | 408830-409138 | ybaB | ||
| 736 | JACUVO010000001.1 | GCA019400095_00366 | gene | open | 409146-409748 | recR | ||
| 737 | JACUVO010000001.1 | GCA019400095_00367 | gene | open | 409846-410625 | |||
| 738 | JACUVO010000001.1 | GCA019400095_00369 | gene | open | 411002-411730 | serB | ||
| 739 | JACUVO010000001.1 | GCA019400095_00370 | gene | open | 411737-412639 | mutY | ||
| 740 | JACUVO010000001.1 | GCA019400095_00371 | gene | open | 412916-415822 | |||
| 741 | JACUVO010000001.1 | GCA019400095_00372 | gene | open | 416219-417238 | nrdF | ||
| 742 | JACUVO010000001.1 | GCA019400095_00373 | gene | open | 417241-417681 | nrdI | ||
| 743 | JACUVO010000001.1 | GCA019400095_00374 | gene | open | 417825-420032 | nrdE | ||
| 744 | JACUVO010000001.1 | GCA019400095_00375 | gene | open | 420322-421644 | mntH | ||
| 745 | JACUVO010000001.1 | GCA019400095_00376 | gene | open | 421641-423515 | mgtE | ||
| 746 | JACUVO010000001.1 | GCA019400095_00377 | gene | open | 423682-424344 | nth | ||
| 747 | JACUVO010000001.1 | GCA019400095_00378 | gene | open | 424728-426914 | glgB | ||
| 748 | JACUVO010000001.1 | GCA019400095_00379 | gene | open | 426968-429385 | glgP | ||
| 749 | JACUVO010000001.1 | GCA019400095_00380 | gene | open | 429431-430585 | glgC | ||
| 750 | JACUVO010000001.1 | GCA019400095_00381 | gene | open | 430582-431673 | glgD | ||
| 751 | JACUVO010000001.1 | GCA019400095_00382 | gene | open | 431753-433261 | glgA | ||
| 752 | JACUVO010000001.1 | GCA019400095_00383 | gene | open | 433266-436643 | malQ | ||
| 753 | JACUVO010000001.1 | GCA019400095_00384 | gene | open | 436645-440241 | mfd | ||
| 754 | JACUVO010000001.1 | GCA019400095_00385 | gene | open | 440231-441226 | mazG | ||
| 755 | JACUVO010000001.1 | GCA019400095_00386 | gene | open | 441262-441993 | |||
| 756 | JACUVO010000001.1 | GCA019400095_00387 | gene | open | 442308-443342 | gppA | ||
| 757 | JACUVO010000001.1 | GCA019400095_00389 | gene | open | 443652-444320 | |||
| 758 | JACUVO010000001.1 | GCA019400095_00390 | gene | open | 444692-445831 | afuA | ||
| 759 | JACUVO010000001.1 | GCA019400095_00391 | gene | open | 445961-446419 | |||
| 760 | JACUVO010000001.1 | GCA019400095_00392 | gene | open | 446591-447022 | |||
| 761 | JACUVO010000001.1 | GCA019400095_00393 | gene | open | 447053-447955 | murQ | ||
| 762 | JACUVO010000001.1 | GCA019400095_00394 | gene | open | 448040-448354 | celC | ||
| 763 | JACUVO010000001.1 | GCA019400095_00395 | gene | open | 448773-449630 | rpiR | ||
| 764 | JACUVO010000001.1 | GCA019400095_00396 | gene | open | 449855-450073 | |||
| 765 | JACUVO010000001.1 | GCA019400095_00397 | gene | open | 450095-451357 | |||
| 766 | JACUVO010000001.1 | GCA019400095_00398 | gene | open | 451439-452476 | mupG | ||
| 767 | JACUVO010000001.1 | GCA019400095_00399 | gene | open | 452533-452853 | |||
| 768 | JACUVO010000001.1 | GCA019400095_00400 | gene | open | 452893-453195 | celA | ||
| 769 | JACUVO010000001.1 | GCA019400095_00401 | gene | open | 453307-454596 | celB | ||
| 770 | JACUVO010000001.1 | GCA019400095_00402 | gene | open | 454860-455957 | mupG | ||
| 771 | JACUVO010000001.1 | GCA019400095_00403 | gene | open | 455997-456953 | badF | ||
| 772 | JACUVO010000001.1 | GCA019400095_00404 | gene | open | 456991-458211 | anmK | ||
| 773 | JACUVO010000001.1 | GCA019400095_00405 | gene | open | 458201-458656 | |||
| 774 | JACUVO010000001.1 | GCA019400095_00406 | gene | open | 458731-460131 | baeS | ||
| 775 | JACUVO010000001.1 | GCA019400095_00407 | gene | open | 460133-460840 | ompR | ||
| 776 | JACUVO010000001.1 | GCA019400095_00408 | gene | open | 460983-461747 | rbbA | ||
| 777 | JACUVO010000001.1 | GCA019400095_00409 | gene | open | 461744-462469 | |||
| 778 | JACUVO010000001.1 | GCA019400095_00410 | gene | open | 462481-463245 | efiE | ||
| 779 | JACUVO010000001.1 | GCA019400095_00411 | gene | open | 463456-464403 | dacC | ||
| 780 | JACUVO010000001.1 | GCA019400095_00412 | gene | open | 464586-465440 | |||
| 781 | JACUVO010000001.1 | GCA019400095_00044 | gene | open | 50112-50198 | trnL | ||
| 782 | JACUVO010000001.1 | GCA019400095_00078 | gene | open | 99988-100063 | trnT | ||
| 783 | JACUVO010000001.1 | GCA019400095_00143 | gene | open | 170240-170313 | trnQ | ||
| 784 | JACUVO010000001.1 | GCA019400095_00225 | gene | open | 249259-249334 | trnW | ||
| 785 | JACUVO010000001.1 | GCA019400095_00227 | gene | open | 251082-251158 | trnM | ||
| 786 | JACUVO010000001.1 | GCA019400095_00228 | gene | open | 251175-251250 | trnT | ||
| 787 | JACUVO010000001.1 | GCA019400095_00229 | gene | open | 251255-251338 | trnY | ||
| 788 | JACUVO010000001.1 | GCA019400095_00231 | gene | open | 254606-254680 | trnT | ||
| 789 | JACUVO010000001.1 | GCA019400095_00244 | gene | open | 268038-268128 | trnS | ||
| 790 | JACUVO010000001.1 | GCA019400095_00257 | gene | open | 282743-282818 | trnV | ||
| 791 | JACUVO010000001.1 | GCA019400095_00260 | gene | open | 288101-288175 | trnE | ||
| 792 | JACUVO010000001.1 | GCA019400095_00276 | gene | open | 309881-309967 | trnL | ||
| 793 | JACUVO010000001.1 | GCA019400095_00289 | gene | open | 328369-328444 | trnR | ||
| 794 | JACUVO010000001.1 | GCA019400095_00295 | gene | open | 334858-334933 | trnK | ||
| 795 | JACUVO010000001.1 | GCA019400095_00301 | gene | open | 339752-339826 | trnG | ||
| 796 | JACUVO010000001.1 | GCA019400095_00322 | gene | open | 369103-369179 | trnI | ||
| 797 | JACUVO010000001.1 | GCA019400095_00323 | gene | open | 369256-369331 | trnA | ||
| 798 | JACUVO010000001.1 | GCA019400095_00327 | gene | open | 372914-373004 | trnS | ||
| 799 | JACUVO010000001.1 | GCA019400095_00328 | gene | open | 373161-373252 | trnS | ||
| 800 | JACUVO010000001.1 | GCA019400095_00350 | gene | open | 395688-395764 | trnR | ||
| 801 | JACUVO010000001.1 | GCA019400095_00351 | gene | open | 395982-396073 | trnS | ||
| 802 | JACUVO010000001.1 | GCA019400095_00368 | gene | open | 410808-410884 | trnD | ||
| 803 | JACUVO010000001.1 | GCA019400095_00388 | gene | open | 443479-443563 | trnL | ||
| 804 | JACUVO010000001.1 | GCA019400095_00044 | tRNA | open | 50112-50198 | trnL | tRNA-Leu(caa) | |
| 805 | JACUVO010000001.1 | GCA019400095_00078 | tRNA | open | 99988-100063 | trnT | tRNA-Thr(cgt) | |
| 806 | JACUVO010000001.1 | GCA019400095_00143 | tRNA | open | 170240-170313 | trnQ | tRNA-Gln(ttg) | |
| 807 | JACUVO010000001.1 | GCA019400095_00225 | tRNA | open | 249259-249334 | trnW | tRNA-Trp(cca) | |
| 808 | JACUVO010000001.1 | GCA019400095_00227 | tRNA | open | 251082-251158 | trnM | tRNA-Met(cat) | |
| 809 | JACUVO010000001.1 | GCA019400095_00228 | tRNA | open | 251175-251250 | trnT | tRNA-Thr(ggt) | |
| 810 | JACUVO010000001.1 | GCA019400095_00229 | tRNA | open | 251255-251338 | trnY | tRNA-Tyr(gta) | |
| 811 | JACUVO010000001.1 | GCA019400095_00231 | tRNA | open | 254606-254680 | trnT | tRNA-Thr(tgt) | |
| 812 | JACUVO010000001.1 | GCA019400095_00244 | tRNA | open | 268038-268128 | trnS | tRNA-Ser(tga) | |
| 813 | JACUVO010000001.1 | GCA019400095_00257 | tRNA | open | 282743-282818 | trnV | tRNA-Val(tac) | |
| 814 | JACUVO010000001.1 | GCA019400095_00260 | tRNA | open | 288101-288175 | trnE | tRNA-Glu(ttc) | |
| 815 | JACUVO010000001.1 | GCA019400095_00276 | tRNA | open | 309881-309967 | trnL | tRNA-Leu(cag) | |
| 816 | JACUVO010000001.1 | GCA019400095_00289 | tRNA | open | 328369-328444 | trnR | tRNA-Arg(cct) | |
| 817 | JACUVO010000001.1 | GCA019400095_00295 | tRNA | open | 334858-334933 | trnK | tRNA-Lys(ttt) | |
| 818 | JACUVO010000001.1 | GCA019400095_00301 | tRNA | open | 339752-339826 | trnG | tRNA-Gly(ccc) | |
| 819 | JACUVO010000001.1 | GCA019400095_00322 | tRNA | open | 369103-369179 | trnI | tRNA-Ile(gat) | |
| 820 | JACUVO010000001.1 | GCA019400095_00323 | tRNA | open | 369256-369331 | trnA | tRNA-Ala(tgc) | |
| 821 | JACUVO010000001.1 | GCA019400095_00327 | tRNA | open | 372914-373004 | trnS | tRNA-Ser(gga) | |
| 822 | JACUVO010000001.1 | GCA019400095_00328 | tRNA | open | 373161-373252 | trnS | tRNA-Ser(cga) | |
| 823 | JACUVO010000001.1 | GCA019400095_00350 | tRNA | open | 395688-395764 | trnR | tRNA-Arg(acg) | |
| 824 | JACUVO010000001.1 | GCA019400095_00351 | tRNA | open | 395982-396073 | trnS | tRNA-Ser(gct) | |
| 825 | JACUVO010000001.1 | GCA019400095_00368 | tRNA | open | 410808-410884 | trnD | tRNA-Asp(gtc) | |
| 826 | JACUVO010000001.1 | GCA019400095_00388 | tRNA | open | 443479-443563 | trnL | tRNA-Leu(taa) | |
| 827 | JACUVO010000002.1 | GCA019400095_00492 | gene | open | 82723-82828 | SpF41_sRNA | ||
| 828 | JACUVO010000002.1 | GCA019400095_00686 | gene | open | 295274-295402 | SpR18_sRNA | ||
| 829 | JACUVO010000002.1 | GCA019400095_00689 | gene | open | 297811-297940 | SpR18_sRNA | ||
| 830 | JACUVO010000002.1 | GCA019400095_00722 | gene | open | 339460-339819 | RNaseP_bact_a | ||
| 831 | JACUVO010000002.1 | GCA019400095_00492 | ncRNA | open | 82723-82828 | Streptococcus sRNA SpF41 | ||
| 832 | JACUVO010000002.1 | GCA019400095_00686 | ncRNA | open | 295274-295402 | Streptococcus sRNA SpR18 | ||
| 833 | JACUVO010000002.1 | GCA019400095_00689 | ncRNA | open | 297811-297940 | Streptococcus sRNA SpR18 | ||
| 834 | JACUVO010000002.1 | GCA019400095_00722 | ncRNA | open | 339460-339819 | Bacterial RNase P class A | ||
| 835 | JACUVO010000002.1 | regulatory_region | open | 298782-298881 | azaaromatic riboswitch aptamer (yjdF RNA) | |||
| 836 | JACUVO010000002.1 | repeat_region | open | 256399-258267 | CRISPR array with 31 repeats of length 28%2C consensus sequence GGATCACCCCCGCGTGTGCGGGAAATAC and spacer length 33 | |||
| 837 | JACUVO010000002.1 | GCA019400095_00413 | CDS | open | 35-904 | _na 289_aa | CAP domain-containing protein | |
| 838 | JACUVO010000002.1 | GCA019400095_00414 | CDS | open | 1280-2314 | _na 344_aa | znuA | ABC transporter%2C substrate-binding protein |
| 839 | JACUVO010000002.1 | GCA019400095_00415 | CDS | open | 2307-2984 | _na 225_aa | ABC transporter%2C ATP-binding protein | |
| 840 | JACUVO010000002.1 | GCA019400095_00416 | CDS | open | 2977-3783 | _na 268_aa | znuB | ABC 3 transport family protein |
| 841 | JACUVO010000002.1 | GCA019400095_00417 | CDS | open | 3850-5757 | _na 635_aa | hypothetical protein | |
| 842 | JACUVO010000002.1 | GCA019400095_00418 | CDS | open | 5942-6757 | _na 271_aa | tagG | Transport permease protein |
| 843 | JACUVO010000002.1 | GCA019400095_00419 | CDS | open | 6857-8086 | _na 409_aa | tagH | ABC transporter%2C ATP-binding protein |
| 844 | JACUVO010000002.1 | GCA019400095_00420 | CDS | open | 8089-9231 | _na 380_aa | wcaA | Glycosyltransferase%2C group 2 family protein |
| 845 | JACUVO010000002.1 | GCA019400095_00421 | CDS | open | 9244-10308 | _na 354_aa | wcaA | Glycosyltransferase%2C group 2 family protein |
| 846 | JACUVO010000002.1 | GCA019400095_00422 | CDS | open | 10305-11420 | _na 371_aa | wcaA | Glycosyltransferase%2C group 2 family protein |
| 847 | JACUVO010000002.1 | GCA019400095_00423 | CDS | open | 11682-12245 | _na 187_aa | pyrR | bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR |
| 848 | JACUVO010000002.1 | GCA019400095_00424 | CDS | open | 12239-13180 | _na 313_aa | pyrB | aspartate carbamoyltransferase catalytic subunit |
| 849 | JACUVO010000002.1 | GCA019400095_00425 | CDS | open | 13164-14459 | _na 431_aa | allB | Dihydroorotase |
| 850 | JACUVO010000002.1 | GCA019400095_00426 | CDS | open | 14711-15502 | _na 263_aa | mcr1 | Oxidoreductase NAD-binding domain protein |
| 851 | JACUVO010000002.1 | GCA019400095_00427 | CDS | open | 15496-16425 | _na 309_aa | pyrD | dihydroorotate dehydrogenase |
| 852 | JACUVO010000002.1 | GCA019400095_00428 | CDS | open | 16419-17144 | _na 241_aa | pyrF | orotidine-5'-phosphate decarboxylase |
| 853 | JACUVO010000002.1 | GCA019400095_00429 | CDS | open | 17327-17635 | _na 102_aa | Integration host factor-like helix-two turn-helix domain-containing protein | |
| 854 | JACUVO010000002.1 | GCA019400095_00430 | CDS | open | 17737-18210 | _na 157_aa | gmk | guanylate kinase |
| 855 | JACUVO010000002.1 | GCA019400095_00431 | CDS | open | 18214-18537 | _na 107_aa | DNA-directed RNA polymerase subunit omega | |
| 856 | JACUVO010000002.1 | GCA019400095_00432 | CDS | open | 18624-19922 | _na 432_aa | thiI | putative tRNA sulfurtransferase |
| 857 | JACUVO010000002.1 | GCA019400095_00433 | CDS | open | 20119-20958 | _na 279_aa | helix-hairpin-helix domain-containing protein | |
| 858 | JACUVO010000002.1 | GCA019400095_00434 | CDS | open | 20951-22645 | _na 564_aa | ComEC/Rec2-like protein | |
| 859 | JACUVO010000002.1 | GCA019400095_00435 | CDS | open | 22730-23734 | _na 334_aa | holA | DNA polymerase III subunit delta |
| 860 | JACUVO010000002.1 | GCA019400095_00436 | CDS | open | 23872-24159 | _na 95_aa | rpsT | 30S ribosomal protein S20 |
| 861 | JACUVO010000002.1 | GCA019400095_00437 | CDS | open | 24178-26094 | _na 638_aa | lepA | translation elongation factor 4 |
| 862 | JACUVO010000002.1 | GCA019400095_00438 | CDS | open | 26170-27342 | _na 390_aa | dusA | tRNA-dihydrouridine synthase |
| 863 | JACUVO010000002.1 | GCA019400095_00439 | CDS | open | 27347-28606 | _na 419_aa | hemN | Coproporphyrinogen III oxidase family protein |
| 864 | JACUVO010000002.1 | GCA019400095_00440 | CDS | open | 28693-29820 | _na 375_aa | dnaJ | DnaJ domain protein |
| 865 | JACUVO010000002.1 | GCA019400095_00441 | CDS | open | 29853-30938 | _na 361_aa | dnaJ | molecular chaperone DnaJ |
| 866 | JACUVO010000002.1 | GCA019400095_00442 | CDS | open | 30938-32203 | _na 421_aa | mtaB | tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB |
| 867 | JACUVO010000002.1 | GCA019400095_00443 | CDS | open | 32283-33239 | _na 318_aa | phoH | PhoH-like protein |
| 868 | JACUVO010000002.1 | GCA019400095_00444 | CDS | open | 33331-33834 | _na 167_aa | ybeY | rRNA maturation RNase YbeY |
| 869 | JACUVO010000002.1 | GCA019400095_00445 | CDS | open | 33837-34214 | _na 125_aa | dgkA | Prokaryotic diacylglycerol kinase |
| 870 | JACUVO010000002.1 | GCA019400095_00446 | CDS | open | 34259-35152 | _na 297_aa | era | GTPase Era |
| 871 | JACUVO010000002.1 | GCA019400095_00447 | CDS | open | 35274-36026 | _na 250_aa | recO | DNA repair protein RecO |
| 872 | JACUVO010000002.1 | GCA019400095_00448 | CDS | open | 36532-36810 | _na 92_aa | rpsO | 30S ribosomal protein S15 |
| 873 | JACUVO010000002.1 | GCA019400095_00449 | CDS | open | 36897-39152 | _na 751_aa | pnp | polyribonucleotide nucleotidyltransferase |
| 874 | JACUVO010000002.1 | GCA019400095_00450 | CDS | open | 39393-41051 | _na 552_aa | rnjA | Ribonuclease J |
| 875 | JACUVO010000002.1 | GCA019400095_00451 | CDS | open | 41052-43781 | _na 909_aa | ftsK | FtsK/SpoIIIE family protein |
| 876 | JACUVO010000002.1 | GCA019400095_00452 | CDS | open | 43784-45298 | _na 504_aa | rodZ | Cytoskeleton protein RodZ-like C-terminal domain-containing protein |
| 877 | JACUVO010000002.1 | GCA019400095_00453 | CDS | open | 45364-45861 | _na 165_aa | yajQ | YajQ family cyclic di-GMP-binding protein |
| 878 | JACUVO010000002.1 | GCA019400095_00454 | CDS | open | 46004-47506 | _na 500_aa | rimO | 30S ribosomal protein S12 methylthiotransferase RimO |
| 879 | JACUVO010000002.1 | GCA019400095_00455 | CDS | open | 47512-48192 | _na 226_aa | pgsA | CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase |
| 880 | JACUVO010000002.1 | GCA019400095_00456 | CDS | open | 48176-48862 | _na 228_aa | pncC | Competence/damage-inducible domain protein CinA |
| 881 | JACUVO010000002.1 | GCA019400095_00457 | CDS | open | 49097-50188 | _na 363_aa | recA | recombinase RecA |
| 882 | JACUVO010000002.1 | GCA019400095_00458 | CDS | open | 50247-50936 | _na 229_aa | recX | Regulatory protein RecX |
| 883 | JACUVO010000002.1 | GCA019400095_00459 | CDS | open | 51164-52147 | _na 327_aa | trpA | tryptophan synthase subunit alpha |
| 884 | JACUVO010000002.1 | GCA019400095_00460 | CDS | open | 52104-53294 | _na 396_aa | trpB | tryptophan synthase subunit beta |
| 885 | JACUVO010000002.1 | GCA019400095_00461 | CDS | open | 53287-53943 | _na 218_aa | phosphoribosylanthranilate isomerase | |
| 886 | JACUVO010000002.1 | GCA019400095_00462 | CDS | open | 53956-54819 | _na 287_aa | trpC | indole-3-glycerol phosphate synthase TrpC |
| 887 | JACUVO010000002.1 | GCA019400095_00463 | CDS | open | 54822-55880 | _na 352_aa | trpD | Anthranilate phosphoribosyltransferase |
| 888 | JACUVO010000002.1 | GCA019400095_00464 | CDS | open | 55873-56463 | _na 196_aa | pabA | Glutamine amidotransferase%2C class I |
| 889 | JACUVO010000002.1 | GCA019400095_00465 | CDS | open | 56517-58004 | _na 495_aa | trpE | Anthranilate synthase component 1 |
| 890 | JACUVO010000002.1 | GCA019400095_00466 | CDS | open | 58925-60490 | _na 521_aa | rny | ribonuclease Y |
| 891 | JACUVO010000002.1 | GCA019400095_00467 | CDS | open | 60587-61717 | _na 376_aa | mutL | ATPase/histidine kinase/DNA gyrase B/HSP90 domain protein |
| 892 | JACUVO010000002.1 | GCA019400095_00468 | CDS | open | 61810-62094 | _na 94_aa | spoVS | Stage V sporulation protein S |
| 893 | JACUVO010000002.1 | GCA019400095_00469 | CDS | open | 62230-63597 | _na 455_aa | miaB | tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB |
| 894 | JACUVO010000002.1 | GCA019400095_00470 | CDS | open | 63604-64521 | _na 305_aa | miaA | tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA |
| 895 | JACUVO010000002.1 | GCA019400095_00471 | CDS | open | 64531-65916 | _na 461_aa | hflX | GTPase HflX |
| 896 | JACUVO010000002.1 | GCA019400095_00472 | CDS | open | 65921-66793 | _na 290_aa | heparan-alpha-glucosaminide N-acetyltransferase domain-containing protein | |
| 897 | JACUVO010000002.1 | GCA019400095_00473 | CDS | open | 66804-67448 | _na 214_aa | lexA | transcriptional repressor LexA |
| 898 | JACUVO010000002.1 | GCA019400095_00474 | CDS | open | 67682-68038 | _na 118_aa | lysM | LysM domain-containing protein |
| 899 | JACUVO010000002.1 | GCA019400095_00475 | CDS | open | 68153-68677 | _na 174_aa | nrdR | transcriptional regulator NrdR |
| 900 | JACUVO010000002.1 | GCA019400095_00476 | CDS | open | 68670-69125 | _na 151_aa | dut | dUTP diphosphatase |
| 901 | JACUVO010000002.1 | GCA019400095_00477 | CDS | open | 69180-70499 | _na 439_aa | nCS2 | NCS2 family permease |
| 902 | JACUVO010000002.1 | GCA019400095_00478 | CDS | open | 70614-71876 | _na 420_aa | uraA | Uracil permease |
| 903 | JACUVO010000002.1 | GCA019400095_00479 | CDS | open | 72163-73167 | _na 334_aa | trxB | FAD-dependent oxidoreductase |
| 904 | JACUVO010000002.1 | GCA019400095_00480 | CDS | open | 73380-75029 | _na 549_aa | clcA | Chloride transporter%2C ClC family |
| 905 | JACUVO010000002.1 | GCA019400095_00481 | CDS | open | 75044-76216 | _na 390_aa | cwlO1 | NlpC/P60 family protein |
| 906 | JACUVO010000002.1 | GCA019400095_00482 | CDS | open | 76365-76898 | _na 177_aa | apt | adenine phosphoribosyltransferase |
| 907 | JACUVO010000002.1 | GCA019400095_00483 | CDS | open | 76943-77674 | _na 243_aa | soxR | Transcriptional regulator%2C MerR family |
| 908 | JACUVO010000002.1 | GCA019400095_00484 | CDS | open | 77682-78122 | _na 146_aa | fHA | FHA domain protein |
| 909 | JACUVO010000002.1 | GCA019400095_00485 | CDS | open | 78185-78598 | _na 137_aa | ridA | Endoribonuclease L-PSP |
| 910 | JACUVO010000002.1 | GCA019400095_00486 | CDS | open | 78582-79463 | _na 293_aa | gcvT | Aminomethyltransferase folate-binding domain-containing protein |
| 911 | JACUVO010000002.1 | GCA019400095_00487 | CDS | open | 79473-80243 | _na 256_aa | pgsA | CDP-alcohol phosphatidyltransferase family protein |
| 912 | JACUVO010000002.1 | GCA019400095_00489 | CDS | open | 80746-81465 | _na 239_aa | glpF | MIP family channel protein |
| 913 | JACUVO010000002.1 | GCA019400095_00490 | CDS | open | 81667-81804 | _na 45_aa | hypothetical protein | |
| 914 | JACUVO010000002.1 | GCA019400095_00491 | CDS | open | 82003-82620 | _na 205_aa | hypothetical protein | |
| 915 | JACUVO010000002.1 | GCA019400095_00493 | CDS | open | 82877-83107 | _na 76_aa | hypothetical protein | |
| 916 | JACUVO010000002.1 | GCA019400095_00494 | CDS | open | 83262-83456 | _na 64_aa | Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix domain protein | |
| 917 | JACUVO010000002.1 | GCA019400095_00497 | CDS | open | 84312-86156 | _na 614_aa | proS | proline--tRNA ligase |
| 918 | JACUVO010000002.1 | GCA019400095_00498 | CDS | open | 86174-87208 | _na 344_aa | ispG | flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase |
| 919 | JACUVO010000002.1 | GCA019400095_00499 | CDS | open | 87352-88719 | _na 455_aa | rseP | RIP metalloprotease RseP |
| 920 | JACUVO010000002.1 | GCA019400095_00500 | CDS | open | 88733-89947 | _na 404_aa | dxr | 1-deoxy-D-xylulose-5-phosphate reductoisomerase |
| 921 | JACUVO010000002.1 | GCA019400095_00501 | CDS | open | 89944-90933 | _na 329_aa | cdsA | Phosphatidate cytidylyltransferase |
| 922 | JACUVO010000002.1 | GCA019400095_00502 | CDS | open | 90930-91709 | _na 259_aa | uppS | isoprenyl transferase |
| 923 | JACUVO010000002.1 | GCA019400095_00503 | CDS | open | 91710-92255 | _na 181_aa | frr | ribosome recycling factor |
| 924 | JACUVO010000002.1 | GCA019400095_00504 | CDS | open | 92321-93049 | _na 242_aa | pyrH | UMP kinase |
| 925 | JACUVO010000002.1 | GCA019400095_00505 | CDS | open | 93261-94136 | _na 291_aa | tsf | translation elongation factor Ts |
| 926 | JACUVO010000002.1 | GCA019400095_00506 | CDS | open | 94173-94946 | _na 257_aa | rpsB | 30S ribosomal protein S2 |
| 927 | JACUVO010000002.1 | GCA019400095_00507 | CDS | open | 95229-96242 | _na 337_aa | xerC | Tyrosine recombinase XerC |
| 928 | JACUVO010000002.1 | GCA019400095_00508 | CDS | open | 96250-97674 | _na 474_aa | trmFO | methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO |
| 929 | JACUVO010000002.1 | GCA019400095_00509 | CDS | open | 97755-98777 | _na 340_aa | dprA | DNA-protecting protein DprA |
| 930 | JACUVO010000002.1 | GCA019400095_00510 | CDS | open | 98774-100339 | _na 521_aa | yifB | Mg chelatase-like protein |
| 931 | JACUVO010000002.1 | GCA019400095_00511 | CDS | open | 100332-100862 | _na 176_aa | yraN | YraN family protein |
| 932 | JACUVO010000002.1 | GCA019400095_00512 | CDS | open | 101008-101820 | _na 270_aa | rnhB | ribonuclease HII |
| 933 | JACUVO010000002.1 | GCA019400095_00513 | CDS | open | 101948-102289 | _na 113_aa | rplS | 50S ribosomal protein L19 |
| 934 | JACUVO010000002.1 | GCA019400095_00514 | CDS | open | 102493-103545 | _na 350_aa | oafA | Acyltransferase |
| 935 | JACUVO010000002.1 | GCA019400095_00515 | CDS | open | 103723-106488 | _na 921_aa | ppdK | pyruvate%2C phosphate dikinase |
| 936 | JACUVO010000002.1 | GCA019400095_00516 | CDS | open | 106802-108430 | _na 542_aa | murJ | Murein biosynthesis integral membrane protein MurJ |
| 937 | JACUVO010000002.1 | GCA019400095_00517 | CDS | open | 108520-109038 | _na 172_aa | ybaK | Cys-tRNA(Pro) deacylase |
| 938 | JACUVO010000002.1 | GCA019400095_00518 | CDS | open | 109158-112049 | _na 963_aa | uvrA | excinuclease ABC subunit UvrA |
| 939 | JACUVO010000002.1 | GCA019400095_00519 | CDS | open | 112126-113064 | _na 312_aa | ribN | DMT family transporter |
| 940 | JACUVO010000002.1 | GCA019400095_00520 | CDS | open | 113143-114936 | _na 597_aa | licC | Choline/ethanolamine kinase |
| 941 | JACUVO010000002.1 | GCA019400095_00521 | CDS | open | 115109-116365 | _na 418_aa | rfbX | Polysaccharide biosynthesis protein |
| 942 | JACUVO010000002.1 | GCA019400095_00522 | CDS | open | 116369-117235 | _na 288_aa | licD | LICD family protein |
| 943 | JACUVO010000002.1 | GCA019400095_00523 | CDS | open | 117366-118166 | _na 266_aa | wcaA | Glycosyltransferase%2C group 2 family protein |
| 944 | JACUVO010000002.1 | GCA019400095_00524 | CDS | open | 118299-119453 | _na 384_aa | wcaA | Glycosyltransferase%2C group 2 family protein |
| 945 | JACUVO010000002.1 | GCA019400095_00525 | CDS | open | 119581-120177 | _na 198_aa | rfbC | dTDP-4-dehydrorhamnose 3%2C5-epimerase |
| 946 | JACUVO010000002.1 | GCA019400095_00526 | CDS | open | 120385-121065 | _na 226_aa | wcaA | Glycosyltransferase%2C group 2 family protein |
| 947 | JACUVO010000002.1 | GCA019400095_00527 | CDS | open | 121130-121528 | _na 132_aa | DUF2304 domain-containing protein | |
| 948 | JACUVO010000002.1 | GCA019400095_00528 | CDS | open | 121607-123742 | _na 711_aa | DUF6541 domain-containing protein | |
| 949 | JACUVO010000002.1 | GCA019400095_00529 | CDS | open | 123901-125004 | _na 367_aa | rfbB | dTDP-glucose 4%2C6-dehydratase |
| 950 | JACUVO010000002.1 | GCA019400095_00530 | CDS | open | 125057-125986 | _na 309_aa | rfbD | dTDP-4-dehydrorhamnose reductase |
| 951 | JACUVO010000002.1 | GCA019400095_00531 | CDS | open | 125986-126888 | _na 300_aa | rfbA | glucose-1-phosphate thymidylyltransferase RfbA |
| 952 | JACUVO010000002.1 | GCA019400095_00532 | CDS | open | 127158-128027 | _na 289_aa | mrp | Iron-sulfur cluster carrier protein |
| 953 | JACUVO010000002.1 | GCA019400095_00533 | CDS | open | 128129-129511 | _na 460_aa | yhiN | Flavoprotein family protein |
| 954 | JACUVO010000002.1 | GCA019400095_00534 | CDS | open | 129514-131268 | _na 584_aa | FAD dependent oxidoreductase | |
| 955 | JACUVO010000002.1 | GCA019400095_00535 | CDS | open | 131323-131613 | _na 96_aa | PTS glucose transporter subunit IIABC | |
| 956 | JACUVO010000002.1 | GCA019400095_00536 | CDS | open | 131716-132363 | _na 215_aa | gntR | Transcriptional regulator%2C GntR family |
| 957 | JACUVO010000002.1 | GCA019400095_00537 | CDS | open | 132747-134975 | _na 742_aa | uvrB | excinuclease ABC subunit UvrB |
| 958 | JACUVO010000002.1 | GCA019400095_00538 | CDS | open | 134986-135573 | _na 195_aa | mltE | Transglycosylase SLT domain protein |
| 959 | JACUVO010000002.1 | GCA019400095_00539 | CDS | open | 135576-136223 | _na 215_aa | coaE | dephospho-CoA kinase |
| 960 | JACUVO010000002.1 | GCA019400095_00540 | CDS | open | 136226-136672 | _na 148_aa | MJ0042 family finger-like domain protein | |
| 961 | JACUVO010000002.1 | GCA019400095_00541 | CDS | open | 136870-137049 | _na 59_aa | pptA | 2-hydroxymuconate tautomerase |
| 962 | JACUVO010000002.1 | GCA019400095_00542 | CDS | open | 137301-138470 | _na 389_aa | ackA | Acetate kinase |
| 963 | JACUVO010000002.1 | GCA019400095_00543 | CDS | open | 138566-138916 | _na 116_aa | hinT | Histidine triad domain protein |
| 964 | JACUVO010000002.1 | GCA019400095_00544 | CDS | open | 138925-139218 | _na 97_aa | xseB | exodeoxyribonuclease VII small subunit |
| 965 | JACUVO010000002.1 | GCA019400095_00545 | CDS | open | 139316-140668 | _na 450_aa | xseA | exodeoxyribonuclease VII large subunit |
| 966 | JACUVO010000002.1 | GCA019400095_00546 | CDS | open | 140770-141465 | _na 231_aa | Zinc metallopeptidase | |
| 967 | JACUVO010000002.1 | GCA019400095_00547 | CDS | open | 141593-142723 | _na 376_aa | rnd | ribonuclease D |
| 968 | JACUVO010000002.1 | GCA019400095_00548 | CDS | open | 142917-143336 | _na 139_aa | yjhB | 8-oxo-dGTP diphosphatase |
| 969 | JACUVO010000002.1 | GCA019400095_00549 | CDS | open | 143449-144297 | _na 282_aa | thyA | thymidylate synthase |
| 970 | JACUVO010000002.1 | GCA019400095_00550 | CDS | open | 144364-144894 | _na 176_aa | folA | dihydrofolate reductase |
| 971 | JACUVO010000002.1 | GCA019400095_00551 | CDS | open | 144977-146455 | _na 492_aa | CCA tRNA nucleotidyltransferase | |
| 972 | JACUVO010000002.1 | GCA019400095_00552 | CDS | open | 146596-148119 | _na 507_aa | pepC | Aminopeptidase |
| 973 | JACUVO010000002.1 | GCA019400095_00553 | CDS | open | 148283-148924 | _na 213_aa | yIH1 | YigZ family protein |
| 974 | JACUVO010000002.1 | GCA019400095_00554 | CDS | open | 148957-150090 | _na 377_aa | afuA | Tat pathway signal sequence domain protein |
| 975 | JACUVO010000002.1 | GCA019400095_00555 | CDS | open | 150564-153632 | _na 1022_aa | clfA | LPXTG-motif cell wall anchor domain protein |
| 976 | JACUVO010000002.1 | GCA019400095_00556 | CDS | open | 153690-153860 | _na 56_aa | hypothetical protein | |
| 977 | JACUVO010000002.1 | GCA019400095_00557 | CDS | open | 153999-154430 | _na 143_aa | DUF2871 domain-containing protein | |
| 978 | JACUVO010000002.1 | GCA019400095_00558 | CDS | open | 154427-155104 | _na 225_aa | Histidine kinase N-terminal 7TM region domain-containing protein | |
| 979 | JACUVO010000002.1 | GCA019400095_00559 | CDS | open | 155191-155754 | _na 187_aa | acrR | Transcriptional regulator%2C TetR family |
| 980 | JACUVO010000002.1 | GCA019400095_00560 | CDS | open | 156075-157292 | _na 405_aa | nifS | Aminotransferase%2C class V |
| 981 | JACUVO010000002.1 | GCA019400095_00561 | CDS | open | 157376-158608 | _na 410_aa | mnmA | tRNA 2-thiouridine(34) synthase MnmA |
| 982 | JACUVO010000002.1 | GCA019400095_00562 | CDS | open | 158694-159983 | _na 429_aa | aglD2 | TIGR00374 family protein |
| 983 | JACUVO010000002.1 | GCA019400095_00564 | CDS | open | 160380-161429 | _na 349_aa | trpS | tryptophan--tRNA ligase |
| 984 | JACUVO010000002.1 | GCA019400095_00565 | CDS | open | 161575-161823 | _na 82_aa | rpmA | 50S ribosomal protein L27 |
| 985 | JACUVO010000002.1 | GCA019400095_00566 | CDS | open | 161875-162225 | _na 116_aa | rplU | 50S ribosomal protein L21 |
| 986 | JACUVO010000002.1 | GCA019400095_00567 | CDS | open | 162452-163786 | _na 444_aa | hypothetical protein | |
| 987 | JACUVO010000002.1 | GCA019400095_00568 | CDS | open | 163862-165148 | _na 428_aa | ftsW | Cell cycle protein%2C FtsW/RodA/SpoVE family |
| 988 | JACUVO010000002.1 | GCA019400095_00569 | CDS | open | 165157-167190 | _na 677_aa | mrdA | penicillin-binding protein 2 |
| 989 | JACUVO010000002.1 | GCA019400095_00570 | CDS | open | 167200-167757 | _na 185_aa | mreD | rod shape-determining protein MreD |
| 990 | JACUVO010000002.1 | GCA019400095_00571 | CDS | open | 167759-168784 | _na 341_aa | mreC | rod shape-determining protein MreC |
| 991 | JACUVO010000002.1 | GCA019400095_00572 | CDS | open | 168800-169843 | _na 347_aa | mreB | Cell shape-determining protein MreB |
| 992 | JACUVO010000002.1 | GCA019400095_00573 | CDS | open | 169882-171201 | _na 439_aa | bepA | Tetratricopeptide repeat protein |
| 993 | JACUVO010000002.1 | GCA019400095_00574 | CDS | open | 171228-171761 | _na 177_aa | ppiB | Peptidyl-prolyl cis-trans isomerase |
| 994 | JACUVO010000002.1 | GCA019400095_00575 | CDS | open | 171910-172932 | _na 340_aa | zinc ribbon domain-containing protein | |
| 995 | JACUVO010000002.1 | GCA019400095_00576 | CDS | open | 173087-175531 | _na 814_aa | mgtA | E1-E2 ATPase |
| 996 | JACUVO010000002.1 | GCA019400095_00578 | CDS | open | 175811-176776 | _na 321_aa | tyrA | Prephenate dehydrogenase |
| 997 | JACUVO010000002.1 | GCA019400095_00579 | CDS | open | 176773-177885 | _na 370_aa | aroB | 3-dehydroquinate synthase |
| 998 | JACUVO010000002.1 | GCA019400095_00580 | CDS | open | 178041-179393 | _na 450_aa | aroA | 3-phosphoshikimate 1-carboxyvinyltransferase |
| 999 | JACUVO010000002.1 | GCA019400095_00581 | CDS | open | 179393-180565 | _na 390_aa | aroC | chorismate synthase |
| 1000 | JACUVO010000002.1 | GCA019400095_00582 | CDS | open | 180575-181735 | _na 386_aa | pheA | Bifunctional chorismate mutase/prephenate dehydratase |

