HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Fusobacterium polymorphum (GCA_022340115.1)

Select a Genome:
BAKTA Annotations for GCA_022340115.1
Genome Selected: Fusobacterium polymorphum
ContigsBases CDSrRNA tmRNAtRNA
42 2299006 2177 0 1 37
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4475 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:2]    |    Number of Records Found: 4475 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
501 JAIMZK010000002.1 GCA022340115_01208 CDS open 71374-72057 _na     227_aa hypothetical protein
502 JAIMZK010000002.1 GCA022340115_01209 CDS open 72137-72292 _na     51_aa hypothetical protein
503 JAIMZK010000002.1 GCA022340115_01210 CDS open 72456-73736 _na     426_aa purD Phosphoribosylamine--glycine ligase
504 JAIMZK010000002.1 GCA022340115_01211 CDS open 73760-74833 _na     357_aa Ankyrin repeat domain-containing protein
505 JAIMZK010000002.1 GCA022340115_01212 CDS open 74852-76366 _na     504_aa purH bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase
506 JAIMZK010000002.1 GCA022340115_01213 CDS open 76391-76726 _na     111_aa Lipoprotein
507 JAIMZK010000002.1 GCA022340115_01214 CDS open 76846-77430 _na     194_aa purN phosphoribosylglycinamide formyltransferase
508 JAIMZK010000002.1 GCA022340115_01215 CDS open 77418-78437 _na     339_aa purM Phosphoribosylformylglycinamidine cyclo-ligase
509 JAIMZK010000002.1 GCA022340115_01216 CDS open 78449-79795 _na     448_aa purF amidophosphoribosyltransferase
510 JAIMZK010000002.1 GCA022340115_01217 CDS open 79842-80555 _na     237_aa purC phosphoribosylaminoimidazolesuccinocarboxamide synthase
511 JAIMZK010000002.1 GCA022340115_01218 CDS open 80784-81257 _na     157_aa purE N5-carboxyaminoimidazole ribonucleotide mutase
512 JAIMZK010000002.1 GCA022340115_01219 CDS open 81270-85007 _na     1245_aa purL2 phosphoribosylformylglycinamidine synthase
513 JAIMZK010000002.1 GCA022340115_01220 CDS open 85458-86249 _na     263_aa pssA CDP-diacylglycerol--serine O-phosphatidyltransferase
514 JAIMZK010000002.1 GCA022340115_01221 CDS open 86252-87328 _na     358_aa rfaF Heptosyltransferase
515 JAIMZK010000002.1 GCA022340115_01222 CDS open 87331-88782 _na     483_aa trkH TrkH family potassium uptake protein
516 JAIMZK010000002.1 GCA022340115_01223 CDS open 88854-89552 _na     232_aa TIGR02206 family membrane protein
517 JAIMZK010000002.1 GCA022340115_01224 CDS open 89564-90214 _na     216_aa Ribonuclease H1 N-terminal domain-containing protein
518 JAIMZK010000002.1 GCA022340115_01225 CDS open 90480-91988 _na     502_aa Solute-binding protein family 5 domain-containing protein
519 JAIMZK010000002.1 GCA022340115_01226 CDS open 92002-93036 _na     344_aa frvX Peptidase M42
520 JAIMZK010000002.1 GCA022340115_01227 CDS open 93211-94293 _na     360_aa bioB biotin synthase BioB
521 JAIMZK010000002.1 GCA022340115_01228 CDS open 94283-94942 _na     219_aa bioD dethiobiotin synthase
522 JAIMZK010000002.1 GCA022340115_01229 CDS open 95026-96366 _na     446_aa bioA adenosylmethionine--8-amino-7-oxononanoate transaminase
523 JAIMZK010000002.1 GCA022340115_01230 CDS open 96462-97913 _na     483_aa Outer membrane protein P1
524 JAIMZK010000002.1 GCA022340115_01231 CDS open 97932-98498 _na     188_aa HTH tetR-type domain-containing protein
525 JAIMZK010000002.1 GCA022340115_01232 CDS open 98744-100123 _na     459_aa glutamate decarboxylase
526 JAIMZK010000002.1 GCA022340115_01233 CDS open 100143-101582 _na     479_aa Glutamate/gamma-aminobutyrate antiporter
527 JAIMZK010000002.1 GCA022340115_01234 CDS open 101625-102953 _na     442_aa BchE/P-methylase family protein
528 JAIMZK010000002.1 GCA022340115_01235 CDS open 102950-104497 _na     515_aa GH3 auxin-responsive promoter
529 JAIMZK010000002.1 GCA022340115_01236 CDS open 104677-105393 _na     238_aa N-acetyltransferase domain-containing protein
530 JAIMZK010000002.1 GCA022340115_01237 CDS open 105409-106314 _na     301_aa N-acetyltransferase domain-containing protein
531 JAIMZK010000002.1 GCA022340115_01238 CDS open 106307-107032 _na     241_aa MBL fold metallo-hydrolase
532 JAIMZK010000002.1 GCA022340115_01239 CDS open 107287-108150 _na     287_aa Lipid A biosynthesis lauroyl acyltransferase
533 JAIMZK010000002.1 GCA022340115_01240 CDS open 108299-110449 _na     716_aa terD TerD domain-containing protein
534 JAIMZK010000002.1 GCA022340115_01241 CDS open 110471-111805 _na     444_aa BchE/P-methylase
535 JAIMZK010000002.1 GCA022340115_01242 CDS open 111831-113153 _na     440_aa Radical SAM core domain-containing protein
536 JAIMZK010000002.1 GCA022340115_01243 CDS open 113150-114454 _na     434_aa Radical SAM core domain-containing protein
537 JAIMZK010000002.1 GCA022340115_01244 CDS open 114468-114866 _na     132_aa Acetyltransferase%2C GNAT family
538 JAIMZK010000002.1 GCA022340115_01245 CDS open 115059-115442 _na     127_aa Pyrimidine dimer DNA glycosylase
539 JAIMZK010000002.1 GCA022340115_01246 CDS open 115426-115830 _na     134_aa DUF1722 domain-containing protein
540 JAIMZK010000002.1 GCA022340115_01247 CDS open 115983-116510 _na     175_aa DUF3592 domain-containing protein
541 JAIMZK010000002.1 GCA022340115_01248 CDS open 116532-117338 _na     268_aa DUF1963 domain-containing protein
542 JAIMZK010000002.1 GCA022340115_01249 CDS open 117351-118334 _na     327_aa Sulfatase-modifying factor enzyme 1
543 JAIMZK010000002.1 GCA022340115_01250 CDS open 118418-118714 _na     98_aa sepF Cell division protein SepF
544 JAIMZK010000002.1 GCA022340115_01251 CDS open 118801-119766 _na     321_aa nrnA Adhesin
545 JAIMZK010000002.1 GCA022340115_01252 CDS open 119785-121632 _na     615_aa hprK HPr(Ser) kinase/phosphatase
546 JAIMZK010000002.1 GCA022340115_01253 CDS open 121655-122521 _na     288_aa hypothetical protein
547 JAIMZK010000002.1 GCA022340115_01254 CDS open 122514-123749 _na     411_aa folC tetrahydrofolate synthase
548 JAIMZK010000002.1 GCA022340115_01255 CDS open 123761-124462 _na     233_aa mtnN 5'-methylthioadenosine/adenosylhomocysteine nucleosidase
549 JAIMZK010000002.1 GCA022340115_01256 CDS open 124581-125471 _na     296_aa Lauroyl acyltransferase
550 JAIMZK010000002.1 GCA022340115_01257 CDS open 125474-126286 _na     270_aa Lipoprotein
551 JAIMZK010000002.1 GCA022340115_01258 CDS open 126283-127026 _na     247_aa Lipoprotein
552 JAIMZK010000002.1 GCA022340115_01259 CDS open 127023-127775 _na     250_aa DUF4292 domain-containing protein
553 JAIMZK010000002.1 GCA022340115_01260 CDS open 127792-128631 _na     279_aa fadB 3-hydroxybutyryl-CoA dehydrogenase
554 JAIMZK010000002.1 GCA022340115_01261 CDS open 128647-129423 _na     258_aa Enoyl-CoA hydratase
555 JAIMZK010000002.1 GCA022340115_01262 CDS open 129731-132319 _na     862_aa mgtA calcium-translocating P-type ATPase%2C PMCA-type
556 JAIMZK010000002.1 GCA022340115_01263 CDS open 132400-132864 _na     154_aa putative flavin-nucleotide-binding protein
557 JAIMZK010000002.1 GCA022340115_01264 CDS open 132954-133262 _na     102_aa hupA DNA-binding protein HU
558 JAIMZK010000002.1 GCA022340115_01265 CDS open 133405-134697 _na     430_aa nCS2 Guanine permease
559 JAIMZK010000002.1 GCA022340115_01266 CDS open 134734-135603 _na     289_aa rluA tRNA pseudouridine synthase A
560 JAIMZK010000002.1 GCA022340115_01267 CDS open 135603-136703 _na     366_aa rodA rod shape-determining protein RodA
561 JAIMZK010000002.1 GCA022340115_01268 CDS open 136723-137163 _na     146_aa dut dUTP diphosphatase
562 JAIMZK010000002.1 GCA022340115_01269 CDS open 137165-138391 _na     408_aa pqqL Peptidase M16
563 JAIMZK010000002.1 GCA022340115_01270 CDS open 138410-139501 _na     363_aa lptF Permease
564 JAIMZK010000002.1 GCA022340115_01271 CDS open 139501-140580 _na     359_aa lptF Permease
565 JAIMZK010000002.1 GCA022340115_01272 CDS open 140589-141128 _na     179_aa cvpA CvpA family protein
566 JAIMZK010000002.1 GCA022340115_01273 CDS open 141144-142325 _na     393_aa Methyltransferase
567 JAIMZK010000002.1 GCA022340115_01274 CDS open 142499-143095 _na     198_aa tetR TetR family transcriptional regulator
568 JAIMZK010000002.1 GCA022340115_01275 CDS open 143110-143589 _na     159_aa NADPH-dependent FMN reductase-like domain-containing protein
569 JAIMZK010000002.1 GCA022340115_01276 CDS open 143602-144228 _na     208_aa Flavodoxin-like fold domain-containing protein
570 JAIMZK010000002.1 GCA022340115_01277 CDS open 144264-145301 _na     345_aa Solute-binding protein family 3/N-terminal domain-containing protein
571 JAIMZK010000002.1 GCA022340115_01278 CDS open 145323-146084 _na     253_aa tauB putative nitrate/sulfonate/bicarbonate ABC superfamily ATP binding cassette transporter ABC protein TauB
572 JAIMZK010000002.1 GCA022340115_01279 CDS open 146097-146849 _na     250_aa ABC transmembrane type-1 domain-containing protein
573 JAIMZK010000002.1 GCA022340115_01280 CDS open 146863-148671 _na     602_aa Thioredoxin domain-containing protein
574 JAIMZK010000002.1 GCA022340115_01281 CDS open 148672-150252 _na     526_aa putative ferredoxin-nitrite reductase
575 JAIMZK010000002.1 GCA022340115_01282 CDS open 150591-151499 _na     302_aa rhaT EamA domain-containing protein
576 JAIMZK010000002.1 GCA022340115_01283 CDS open 151560-152264 _na     234_aa LIV-E family branched chain amino acid exporter
577 JAIMZK010000002.1 GCA022340115_01284 CDS open 152257-152580 _na     107_aa LIV-E family branched chain amino acid exporter
578 JAIMZK010000002.1 GCA022340115_01285 CDS open 152591-153766 _na     391_aa putative acetyltransferase
579 JAIMZK010000002.1 GCA022340115_01286 CDS open 153785-154321 _na     178_aa hypothetical protein
580 JAIMZK010000002.1 GCA022340115_01287 CDS open 154620-156215 _na     531_aa DUF2828 domain-containing protein
581 JAIMZK010000002.1 GCA022340115_01288 CDS open 156212-157057 _na     281_aa cvfB S1 motif domain-containing protein
582 JAIMZK010000002.1 GCA022340115_01289 CDS open 157075-157839 _na     254_aa RNA polymerase subunit sigma
583 JAIMZK010000002.1 GCA022340115_01290 CDS open 157843-158181 _na     112_aa HTH hxlR-type domain-containing protein
584 JAIMZK010000002.1 GCA022340115_01291 CDS open 158306-159109 _na     267_aa Amidohydrolase-related domain-containing protein
585 JAIMZK010000002.1 GCA022340115_01292 CDS open 159158-159898 _na     246_aa RNA polymerase subunit sigma
586 JAIMZK010000002.1 GCA022340115_01293 CDS open 160040-161509 _na     489_aa Lipoprotein
587 JAIMZK010000002.1 GCA022340115_01294 CDS open 161533-162261 _na     242_aa DUF3307 domain-containing protein
588 JAIMZK010000002.1 GCA022340115_01295 CDS open 162258-163067 _na     269_aa satD SatD family (SatD)
589 JAIMZK010000002.1 GCA022340115_01296 CDS open 163299-164450 _na     383_aa hocA Immunity 26/phosphotriesterase HocA family protein
590 JAIMZK010000002.1 GCA022340115_01297 CDS open 164450-165124 _na     224_aa DUF304 domain-containing protein
591 JAIMZK010000002.1 GCA022340115_01298 CDS open 165143-165907 _na     254_aa ABC transporter permease
592 JAIMZK010000002.1 GCA022340115_01299 CDS open 165927-166607 _na     226_aa DUF304 domain-containing protein
593 JAIMZK010000002.1 GCA022340115_01300 CDS open 166627-167691 _na     354_aa ABC transporter permease
594 JAIMZK010000002.1 GCA022340115_01301 CDS open 167737-168048 _na     103_aa Phage protein
595 JAIMZK010000002.1 GCA022340115_01302 CDS open 168063-168446 _na     127_aa gloA Lactoylglutathione lyase
596 JAIMZK010000002.1 GCA022340115_01303 CDS open 168466-169182 _na     238_aa Beta-carotene 15%2C15'-monooxygenase
597 JAIMZK010000002.1 GCA022340115_01304 CDS open 169269-169613 _na     114_aa DUF3601 domain-containing protein
598 JAIMZK010000002.1 GCA022340115_01132 gene open 54-443
599 JAIMZK010000002.1 GCA022340115_01133 gene open 562-885
600 JAIMZK010000002.1 GCA022340115_01134 gene open 904-1911 gpsA
601 JAIMZK010000002.1 GCA022340115_01135 gene open 1930-2601
602 JAIMZK010000002.1 GCA022340115_01136 gene open 2603-3541 yaaT
603 JAIMZK010000002.1 GCA022340115_01137 gene open 3561-4259 radC
604 JAIMZK010000002.1 GCA022340115_01138 gene open 4270-5334 cobT
605 JAIMZK010000002.1 GCA022340115_01139 gene open 5349-5924
606 JAIMZK010000002.1 GCA022340115_01140 gene open 5929-6765 cobS
607 JAIMZK010000002.1 GCA022340115_01141 gene open 6777-7340 cobU
608 JAIMZK010000002.1 GCA022340115_01142 gene open 7402-8133
609 JAIMZK010000002.1 GCA022340115_01143 gene open 8148-8642 nagE
610 JAIMZK010000002.1 GCA022340115_01144 gene open 8675-9145 hslJ
611 JAIMZK010000002.1 GCA022340115_01145 gene open 9246-10259
612 JAIMZK010000002.1 GCA022340115_01146 gene open 10288-11211
613 JAIMZK010000002.1 GCA022340115_01147 gene open 11217-12164
614 JAIMZK010000002.1 GCA022340115_01148 gene open 12392-13321
615 JAIMZK010000002.1 GCA022340115_01149 gene open 13333-14772 cls
616 JAIMZK010000002.1 GCA022340115_01150 gene open 14929-15726
617 JAIMZK010000002.1 GCA022340115_01151 gene open 15972-16697 fliM
618 JAIMZK010000002.1 GCA022340115_01152 gene open 16710-17489 yjbM
619 JAIMZK010000002.1 GCA022340115_01153 gene open 17543-18202
620 JAIMZK010000002.1 GCA022340115_01154 gene open 18223-19233
621 JAIMZK010000002.1 GCA022340115_01155 gene open 19243-20628
622 JAIMZK010000002.1 GCA022340115_01156 gene open 20632-22650
623 JAIMZK010000002.1 GCA022340115_01157 gene open 22838-23482 tsaB
624 JAIMZK010000002.1 GCA022340115_01158 gene open 23463-23924 tsaE
625 JAIMZK010000002.1 GCA022340115_01159 gene open 23938-24402 rfaE
626 JAIMZK010000002.1 GCA022340115_01160 gene open 24389-25006
627 JAIMZK010000002.1 GCA022340115_01161 gene open 25148-25879
628 JAIMZK010000002.1 GCA022340115_01162 gene open 25914-26399
629 JAIMZK010000002.1 GCA022340115_01163 gene open 26409-27671 aroA
630 JAIMZK010000002.1 GCA022340115_01164 gene open 27655-28728 aroC
631 JAIMZK010000002.1 GCA022340115_01165 gene open 28752-30116 norM
632 JAIMZK010000002.1 GCA022340115_01166 gene open 30251-30937
633 JAIMZK010000002.1 GCA022340115_01167 gene open 31126-32193 asrA
634 JAIMZK010000002.1 GCA022340115_01168 gene open 32197-33000 asrB
635 JAIMZK010000002.1 GCA022340115_01169 gene open 33016-33990 asrC
636 JAIMZK010000002.1 GCA022340115_01170 gene open 34004-34606
637 JAIMZK010000002.1 GCA022340115_01171 gene open 34706-35356
638 JAIMZK010000002.1 GCA022340115_01172 gene open 35489-36301
639 JAIMZK010000002.1 GCA022340115_01173 gene open 36358-37476 fieF
640 JAIMZK010000002.1 GCA022340115_01174 gene open 37463-41890 ycjD
641 JAIMZK010000002.1 GCA022340115_01175 gene open 41958-42704 cobK
642 JAIMZK010000002.1 GCA022340115_01176 gene open 42730-43479
643 JAIMZK010000002.1 GCA022340115_01177 gene open 43472-44482 cbiG
644 JAIMZK010000002.1 GCA022340115_01178 gene open 44495-45226
645 JAIMZK010000002.1 GCA022340115_01179 gene open 45337-46584
646 JAIMZK010000002.1 GCA022340115_01180 gene open 46669-47571
647 JAIMZK010000002.1 GCA022340115_01181 gene open 47604-48131
648 JAIMZK010000002.1 GCA022340115_01182 gene open 48134-48361
649 JAIMZK010000002.1 GCA022340115_01183 gene open 48388-49089
650 JAIMZK010000002.1 GCA022340115_01184 gene open 49090-49629
651 JAIMZK010000002.1 GCA022340115_01185 gene open 49663-50916
652 JAIMZK010000002.1 GCA022340115_01186 gene open 51041-51427
653 JAIMZK010000002.1 GCA022340115_01187 gene open 51445-52206 cobM
654 JAIMZK010000002.1 GCA022340115_01188 gene open 52185-52907 cobI
655 JAIMZK010000002.1 GCA022340115_01189 gene open 52932-53591
656 JAIMZK010000002.1 GCA022340115_01190 gene open 53638-54144 psbP
657 JAIMZK010000002.1 GCA022340115_01191 gene open 54150-55388
658 JAIMZK010000002.1 GCA022340115_01192 gene open 55575-56144 cbiT
659 JAIMZK010000002.1 GCA022340115_01193 gene open 56166-57131 ldhA
660 JAIMZK010000002.1 GCA022340115_01194 gene open 57118-57816 cbiE
661 JAIMZK010000002.1 GCA022340115_01195 gene open 57761-58888 cbiD
662 JAIMZK010000002.1 GCA022340115_01196 gene open 58904-59650
663 JAIMZK010000002.1 GCA022340115_01197 gene open 59647-60405
664 JAIMZK010000002.1 GCA022340115_01198 gene open 60402-61175
665 JAIMZK010000002.1 GCA022340115_01199 gene open 61200-61850 cobH
666 JAIMZK010000002.1 GCA022340115_01200 gene open 61878-62870
667 JAIMZK010000002.1 GCA022340115_01201 gene open 62870-64204 cbiA
668 JAIMZK010000002.1 GCA022340115_01202 gene open 64220-65299 hisC
669 JAIMZK010000002.1 GCA022340115_01203 gene open 65304-66281 cbiB
670 JAIMZK010000002.1 GCA022340115_01204 gene open 66301-67218
671 JAIMZK010000002.1 GCA022340115_01205 gene open 67307-68260
672 JAIMZK010000002.1 GCA022340115_01206 gene open 68285-69775
673 JAIMZK010000002.1 GCA022340115_01207 gene open 69845-71155
674 JAIMZK010000002.1 GCA022340115_01208 gene open 71374-72057
675 JAIMZK010000002.1 GCA022340115_01209 gene open 72137-72292
676 JAIMZK010000002.1 GCA022340115_01210 gene open 72456-73736 purD
677 JAIMZK010000002.1 GCA022340115_01211 gene open 73760-74833
678 JAIMZK010000002.1 GCA022340115_01212 gene open 74852-76366 purH
679 JAIMZK010000002.1 GCA022340115_01213 gene open 76391-76726
680 JAIMZK010000002.1 GCA022340115_01214 gene open 76846-77430 purN
681 JAIMZK010000002.1 GCA022340115_01215 gene open 77418-78437 purM
682 JAIMZK010000002.1 GCA022340115_01216 gene open 78449-79795 purF
683 JAIMZK010000002.1 GCA022340115_01217 gene open 79842-80555 purC
684 JAIMZK010000002.1 GCA022340115_01218 gene open 80784-81257 purE
685 JAIMZK010000002.1 GCA022340115_01219 gene open 81270-85007 purL2
686 JAIMZK010000002.1 GCA022340115_01220 gene open 85458-86249 pssA
687 JAIMZK010000002.1 GCA022340115_01221 gene open 86252-87328 rfaF
688 JAIMZK010000002.1 GCA022340115_01222 gene open 87331-88782 trkH
689 JAIMZK010000002.1 GCA022340115_01223 gene open 88854-89552
690 JAIMZK010000002.1 GCA022340115_01224 gene open 89564-90214
691 JAIMZK010000002.1 GCA022340115_01225 gene open 90480-91988
692 JAIMZK010000002.1 GCA022340115_01226 gene open 92002-93036 frvX
693 JAIMZK010000002.1 GCA022340115_01227 gene open 93211-94293 bioB
694 JAIMZK010000002.1 GCA022340115_01228 gene open 94283-94942 bioD
695 JAIMZK010000002.1 GCA022340115_01229 gene open 95026-96366 bioA
696 JAIMZK010000002.1 GCA022340115_01230 gene open 96462-97913
697 JAIMZK010000002.1 GCA022340115_01231 gene open 97932-98498
698 JAIMZK010000002.1 GCA022340115_01232 gene open 98744-100123
699 JAIMZK010000002.1 GCA022340115_01233 gene open 100143-101582
700 JAIMZK010000002.1 GCA022340115_01234 gene open 101625-102953
701 JAIMZK010000002.1 GCA022340115_01235 gene open 102950-104497
702 JAIMZK010000002.1 GCA022340115_01236 gene open 104677-105393
703 JAIMZK010000002.1 GCA022340115_01237 gene open 105409-106314
704 JAIMZK010000002.1 GCA022340115_01238 gene open 106307-107032
705 JAIMZK010000002.1 GCA022340115_01239 gene open 107287-108150
706 JAIMZK010000002.1 GCA022340115_01240 gene open 108299-110449 terD
707 JAIMZK010000002.1 GCA022340115_01241 gene open 110471-111805
708 JAIMZK010000002.1 GCA022340115_01242 gene open 111831-113153
709 JAIMZK010000002.1 GCA022340115_01243 gene open 113150-114454
710 JAIMZK010000002.1 GCA022340115_01244 gene open 114468-114866
711 JAIMZK010000002.1 GCA022340115_01245 gene open 115059-115442
712 JAIMZK010000002.1 GCA022340115_01246 gene open 115426-115830
713 JAIMZK010000002.1 GCA022340115_01247 gene open 115983-116510
714 JAIMZK010000002.1 GCA022340115_01248 gene open 116532-117338
715 JAIMZK010000002.1 GCA022340115_01249 gene open 117351-118334
716 JAIMZK010000002.1 GCA022340115_01250 gene open 118418-118714 sepF
717 JAIMZK010000002.1 GCA022340115_01251 gene open 118801-119766 nrnA
718 JAIMZK010000002.1 GCA022340115_01252 gene open 119785-121632 hprK
719 JAIMZK010000002.1 GCA022340115_01253 gene open 121655-122521
720 JAIMZK010000002.1 GCA022340115_01254 gene open 122514-123749 folC
721 JAIMZK010000002.1 GCA022340115_01255 gene open 123761-124462 mtnN
722 JAIMZK010000002.1 GCA022340115_01256 gene open 124581-125471
723 JAIMZK010000002.1 GCA022340115_01257 gene open 125474-126286
724 JAIMZK010000002.1 GCA022340115_01258 gene open 126283-127026
725 JAIMZK010000002.1 GCA022340115_01259 gene open 127023-127775
726 JAIMZK010000002.1 GCA022340115_01260 gene open 127792-128631 fadB
727 JAIMZK010000002.1 GCA022340115_01261 gene open 128647-129423
728 JAIMZK010000002.1 GCA022340115_01262 gene open 129731-132319 mgtA
729 JAIMZK010000002.1 GCA022340115_01263 gene open 132400-132864
730 JAIMZK010000002.1 GCA022340115_01264 gene open 132954-133262 hupA
731 JAIMZK010000002.1 GCA022340115_01265 gene open 133405-134697 nCS2
732 JAIMZK010000002.1 GCA022340115_01266 gene open 134734-135603 rluA
733 JAIMZK010000002.1 GCA022340115_01267 gene open 135603-136703 rodA
734 JAIMZK010000002.1 GCA022340115_01268 gene open 136723-137163 dut
735 JAIMZK010000002.1 GCA022340115_01269 gene open 137165-138391 pqqL
736 JAIMZK010000002.1 GCA022340115_01270 gene open 138410-139501 lptF
737 JAIMZK010000002.1 GCA022340115_01271 gene open 139501-140580 lptF
738 JAIMZK010000002.1 GCA022340115_01272 gene open 140589-141128 cvpA
739 JAIMZK010000002.1 GCA022340115_01273 gene open 141144-142325
740 JAIMZK010000002.1 GCA022340115_01274 gene open 142499-143095 tetR
741 JAIMZK010000002.1 GCA022340115_01275 gene open 143110-143589
742 JAIMZK010000002.1 GCA022340115_01276 gene open 143602-144228
743 JAIMZK010000002.1 GCA022340115_01277 gene open 144264-145301
744 JAIMZK010000002.1 GCA022340115_01278 gene open 145323-146084 tauB
745 JAIMZK010000002.1 GCA022340115_01279 gene open 146097-146849
746 JAIMZK010000002.1 GCA022340115_01280 gene open 146863-148671
747 JAIMZK010000002.1 GCA022340115_01281 gene open 148672-150252
748 JAIMZK010000002.1 GCA022340115_01282 gene open 150591-151499 rhaT
749 JAIMZK010000002.1 GCA022340115_01283 gene open 151560-152264
750 JAIMZK010000002.1 GCA022340115_01284 gene open 152257-152580
751 JAIMZK010000002.1 GCA022340115_01285 gene open 152591-153766
752 JAIMZK010000002.1 GCA022340115_01286 gene open 153785-154321
753 JAIMZK010000002.1 GCA022340115_01287 gene open 154620-156215
754 JAIMZK010000002.1 GCA022340115_01288 gene open 156212-157057 cvfB
755 JAIMZK010000002.1 GCA022340115_01289 gene open 157075-157839
756 JAIMZK010000002.1 GCA022340115_01290 gene open 157843-158181
757 JAIMZK010000002.1 GCA022340115_01291 gene open 158306-159109
758 JAIMZK010000002.1 GCA022340115_01292 gene open 159158-159898
759 JAIMZK010000002.1 GCA022340115_01293 gene open 160040-161509
760 JAIMZK010000002.1 GCA022340115_01294 gene open 161533-162261
761 JAIMZK010000002.1 GCA022340115_01295 gene open 162258-163067 satD
762 JAIMZK010000002.1 GCA022340115_01296 gene open 163299-164450 hocA
763 JAIMZK010000002.1 GCA022340115_01297 gene open 164450-165124
764 JAIMZK010000002.1 GCA022340115_01298 gene open 165143-165907
765 JAIMZK010000002.1 GCA022340115_01299 gene open 165927-166607
766 JAIMZK010000002.1 GCA022340115_01300 gene open 166627-167691
767 JAIMZK010000002.1 GCA022340115_01301 gene open 167737-168048
768 JAIMZK010000002.1 GCA022340115_01302 gene open 168063-168446 gloA
769 JAIMZK010000002.1 GCA022340115_01303 gene open 168466-169182
770 JAIMZK010000002.1 GCA022340115_01304 gene open 169269-169613
771 JAIMZK010000003.1 regulatory_region open 7651-7797 glmS glucosamine-6-phosphate activated ribozyme aptamer
772 JAIMZK010000003.1 repeat_region open 114464-117834 CRISPR array with 45 repeats of length 36%2C consensus sequence ATAAGAAAGAATATAACTCCGATAGGAGACGGAAAC and spacer length 39
773 JAIMZK010000003.1 GCA022340115_01519 CDS open 220-933 _na     237_aa Glutaminase
774 JAIMZK010000003.1 GCA022340115_01520 CDS open 951-1658 _na     235_aa deoD purine-nucleoside phosphorylase
775 JAIMZK010000003.1 GCA022340115_01521 CDS open 1720-2730 _na     336_aa pxpC Carboxyltransferase domain-containing protein
776 JAIMZK010000003.1 GCA022340115_01522 CDS open 2723-3472 _na     249_aa pxpB 5-oxoprolinase subunit PxpB
777 JAIMZK010000003.1 GCA022340115_01523 CDS open 3485-4672 _na     395_aa mntH Transporter%2C branched chain amino acid:cation symporter (LIVCS) family protein
778 JAIMZK010000003.1 GCA022340115_01524 CDS open 4687-5460 _na     257_aa pxpA 5-oxoprolinase subunit A
779 JAIMZK010000003.1 GCA022340115_01528 CDS open 6340-7269 _na     309_aa Phage-Barnase-EndoU-ColicinE5/D-RelE like nuclease 4 domain-containing protein
780 JAIMZK010000003.1 GCA022340115_01529 CDS open 7835-9658 _na     607_aa glmS glutamine--fructose-6-phosphate transaminase (isomerizing)
781 JAIMZK010000003.1 GCA022340115_01530 CDS open 9721-11475 _na     584_aa pepP Peptidase M24
782 JAIMZK010000003.1 GCA022340115_01531 CDS open 11494-12054 _na     186_aa Flavin reductase like domain-containing protein
783 JAIMZK010000003.1 GCA022340115_01532 CDS open 12182-13657 _na     491_aa adhE Aldehyde dehydrogenase domain-containing protein
784 JAIMZK010000003.1 GCA022340115_01533 CDS open 13852-14391 _na     179_aa rbr rubrerythrin
785 JAIMZK010000003.1 GCA022340115_01534 CDS open 14510-15916 _na     468_aa DUF4015 domain-containing protein
786 JAIMZK010000003.1 GCA022340115_01535 CDS open 15936-16376 _na     146_aa CAAX prenyl protease 1 N-terminal domain-containing protein
787 JAIMZK010000003.1 GCA022340115_01536 CDS open 16391-17233 _na     280_aa MORN repeat protein
788 JAIMZK010000003.1 GCA022340115_01537 CDS open 17249-18136 _na     295_aa MORN repeat protein
789 JAIMZK010000003.1 GCA022340115_01538 CDS open 18149-19117 _na     322_aa hemB porphobilinogen synthase
790 JAIMZK010000003.1 GCA022340115_01539 CDS open 19189-19734 _na     181_aa hpf ribosome hibernation-promoting factor%2C HPF/YfiA family
791 JAIMZK010000003.1 GCA022340115_01540 CDS open 19881-21815 _na     644_aa mutL DNA mismatch repair endonuclease MutL
792 JAIMZK010000003.1 GCA022340115_01541 CDS open 21826-22293 _na     155_aa Ribosomal RNA large subunit methyltransferase H
793 JAIMZK010000003.1 GCA022340115_01542 CDS open 22375-22707 _na     110_aa DUF1934 domain-containing protein
794 JAIMZK010000003.1 GCA022340115_01543 CDS open 22725-24002 _na     425_aa Lipoprotein
795 JAIMZK010000003.1 GCA022340115_01544 CDS open 24032-25513 _na     493_aa lysS lysine--tRNA ligase
796 JAIMZK010000003.1 GCA022340115_01545 CDS open 25580-25936 _na     118_aa yohJ CidA/LrgA family protein
797 JAIMZK010000003.1 GCA022340115_01546 CDS open 25936-26628 _na     230_aa lrgB Murein hydrolase transporter LrgB
798 JAIMZK010000003.1 GCA022340115_01547 CDS open 26642-27250 _na     202_aa cutC PF03932 family protein CutC
799 JAIMZK010000003.1 GCA022340115_01548 CDS open 27479-29017 _na     512_aa abgT AbgT transporter
800 JAIMZK010000003.1 GCA022340115_01549 CDS open 29169-29672 _na     167_aa fldA flavodoxin
801 JAIMZK010000003.1 GCA022340115_01550 CDS open 29966-31273 _na     435_aa miaB tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB
802 JAIMZK010000003.1 GCA022340115_01551 CDS open 31296-32537 _na     413_aa rho transcription termination factor Rho
803 JAIMZK010000003.1 GCA022340115_01552 CDS open 32588-33685 _na     365_aa nlpD LysM domain-containing protein
804 JAIMZK010000003.1 GCA022340115_01553 CDS open 33731-34804 _na     357_aa ispG flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase
805 JAIMZK010000003.1 GCA022340115_01554 CDS open 34850-35299 _na     149_aa rpoE DNA-directed RNA polymerase sigma subunit RpoE
806 JAIMZK010000003.1 GCA022340115_01555 CDS open 35301-35609 _na     102_aa Gram-positive signal peptide protein%2C YSIRK family
807 JAIMZK010000003.1 GCA022340115_01556 CDS open 35626-36024 _na     132_aa Adhesin
808 JAIMZK010000003.1 GCA022340115_01557 CDS open 36143-36388 _na     81_aa rpmE type B 50S ribosomal protein L31
809 JAIMZK010000003.1 GCA022340115_01558 CDS open 36447-37070 _na     207_aa upp uracil phosphoribosyltransferase
810 JAIMZK010000003.1 GCA022340115_01559 CDS open 37328-38116 _na     262_aa estA Lipase
811 JAIMZK010000003.1 GCA022340115_01560 CDS open 38335-39345 _na     336_aa ldhA 4-phosphoerythronate dehydrogenase
812 JAIMZK010000003.1 GCA022340115_01561 CDS open 39733-41010 _na     425_aa gdhA Glutamate dehydrogenase
813 JAIMZK010000003.1 GCA022340115_01562 CDS open 41237-42445 _na     402_aa gltS sodium/glutamate symporter
814 JAIMZK010000003.1 GCA022340115_01563 CDS open 42638-43432 _na     264_aa murI glutamate racemase
815 JAIMZK010000003.1 GCA022340115_01564 CDS open 43517-44377 _na     286_aa lgt prolipoprotein diacylglyceryl transferase
816 JAIMZK010000003.1 GCA022340115_01565 CDS open 44401-45183 _na     260_aa undP DUF368 domain-containing protein
817 JAIMZK010000003.1 GCA022340115_01566 CDS open 45188-46267 _na     359_aa alr Alanine racemase
818 JAIMZK010000003.1 GCA022340115_01567 CDS open 46405-46557 _na     50_aa DUF3096 domain-containing protein
819 JAIMZK010000003.1 GCA022340115_01568 CDS open 46957-47676 _na     239_aa fabG 3-oxoacyl-[acyl-carrier-protein] reductase
820 JAIMZK010000003.1 GCA022340115_01569 CDS open 47726-48934 _na     402_aa paaJ Acetyl-CoA C-acetyltransferase
821 JAIMZK010000003.1 GCA022340115_01570 CDS open 49094-53113 _na     1339_aa Autotransporter domain-containing protein
822 JAIMZK010000003.1 GCA022340115_01571 CDS open 53132-55366 _na     744_aa Hemin receptor
823 JAIMZK010000003.1 GCA022340115_01572 CDS open 55640-56497 _na     285_aa Glycoside-hydrolase family GH114 TIM-barrel domain-containing protein
824 JAIMZK010000003.1 GCA022340115_01573 CDS open 56523-57320 _na     265_aa N-acetylmuramoyl-L-alanine amidase
825 JAIMZK010000003.1 GCA022340115_01574 CDS open 57486-59837 _na     783_aa ldcC arginase
826 JAIMZK010000003.1 GCA022340115_01575 CDS open 59962-60546 _na     194_aa gmhA D-sedoheptulose 7-phosphate isomerase
827 JAIMZK010000003.1 GCA022340115_01576 CDS open 60563-61450 _na     295_aa lysR HTH lysR-type domain-containing protein
828 JAIMZK010000003.1 GCA022340115_01577 CDS open 61547-62926 _na     459_aa Amino acid permease
829 JAIMZK010000003.1 GCA022340115_01578 CDS open 62942-63673 _na     243_aa Glutamine amidotransferase class-I domain protein
830 JAIMZK010000003.1 GCA022340115_01579 CDS open 63705-65414 _na     569_aa argS arginine--tRNA ligase
831 JAIMZK010000003.1 GCA022340115_01580 CDS open 65710-66555 _na     281_aa yjjU Serine protease
832 JAIMZK010000003.1 GCA022340115_01581 CDS open 66679-67683 _na     334_aa D-lactate dehydrogenase
833 JAIMZK010000003.1 GCA022340115_01582 CDS open 67929-69140 _na     403_aa norV Flavodoxin-like domain-containing protein
834 JAIMZK010000003.1 GCA022340115_01583 CDS open 69307-69735 _na     142_aa fldA flavodoxin
835 JAIMZK010000003.1 GCA022340115_01584 CDS open 69982-70422 _na     146_aa Lipoprotein
836 JAIMZK010000003.1 GCA022340115_01585 CDS open 70478-71461 _na     327_aa Deacetylase sirtuin-type domain-containing protein
837 JAIMZK010000003.1 GCA022340115_01586 CDS open 71445-72242 _na     265_aa protein-ADP-ribose hydrolase
838 JAIMZK010000003.1 GCA022340115_01587 CDS open 72246-72863 _na     205_aa 4Fe-4S ferredoxin-type domain-containing protein
839 JAIMZK010000003.1 GCA022340115_01588 CDS open 72887-73321 _na     144_aa Transcriptional regulator
840 JAIMZK010000003.1 GCA022340115_01589 CDS open 73352-74122 _na     256_aa SnoaL-like domain-containing protein
841 JAIMZK010000003.1 GCA022340115_01590 CDS open 74381-75394 _na     337_aa MORN repeat protein
842 JAIMZK010000003.1 GCA022340115_01591 CDS open 75403-76020 _na     205_aa DUF2179 domain-containing protein
843 JAIMZK010000003.1 GCA022340115_01592 CDS open 76013-76681 _na     222_aa queH Epoxyqueuosine reductase QueH
844 JAIMZK010000003.1 GCA022340115_01593 CDS open 76690-79455 _na     921_aa Exonuclease SBCC
845 JAIMZK010000003.1 GCA022340115_01594 CDS open 79445-80611 _na     388_aa sbcD Calcineurin-like phosphoesterase domain-containing protein
846 JAIMZK010000003.1 GCA022340115_01595 CDS open 80608-83367 _na     919_aa cas4 DNA 3'-5' helicase
847 JAIMZK010000003.1 GCA022340115_01596 CDS open 83369-85624 _na     751_aa mrcB peptidoglycan glycosyltransferase
848 JAIMZK010000003.1 GCA022340115_01597 CDS open 85628-86704 _na     358_aa rlmN 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN
849 JAIMZK010000003.1 GCA022340115_01598 CDS open 86704-87825 _na     373_aa alaX Alanyl-transfer RNA synthetases family profile domain-containing protein
850 JAIMZK010000003.1 GCA022340115_01599 CDS open 87970-89304 _na     444_aa nox H2O-forming NADH oxidase
851 JAIMZK010000003.1 GCA022340115_01600 CDS open 89742-89942 _na     66_aa cspC Cold shock protein
852 JAIMZK010000003.1 GCA022340115_01601 CDS open 89997-91052 _na     351_aa abrB Membrane protein AbrB duplication
853 JAIMZK010000003.1 GCA022340115_01602 CDS open 91266-91802 _na     178_aa VanZ-like domain-containing protein
854 JAIMZK010000003.1 GCA022340115_01603 CDS open 91867-92445 _na     192_aa ppnN Cytokinin riboside 5'-monophosphate phosphoribohydrolase
855 JAIMZK010000003.1 GCA022340115_01604 CDS open 92469-93617 _na     382_aa dnaN DNA polymerase III subunit beta
856 JAIMZK010000003.1 GCA022340115_01605 CDS open 93635-94219 _na     194_aa plsY glycerol-3-phosphate 1-O-acyltransferase PlsY
857 JAIMZK010000003.1 GCA022340115_01606 CDS open 94363-94587 _na     74_aa secG preprotein translocase subunit SecG
858 JAIMZK010000003.1 GCA022340115_01607 CDS open 94655-95113 _na     152_aa precorrin-2 dehydrogenase
859 JAIMZK010000003.1 GCA022340115_01608 CDS open 95103-96407 _na     434_aa hemL glutamate-1-semialdehyde 2%2C1-aminomutase
860 JAIMZK010000003.1 GCA022340115_01609 CDS open 96635-97729 _na     364_aa pgaB NodB-like y domain-containing protein
861 JAIMZK010000003.1 GCA022340115_01610 CDS open 97748-98527 _na     259_aa Glycosyltransferase 2-like domain-containing protein
862 JAIMZK010000003.1 GCA022340115_01611 CDS open 98517-99536 _na     339_aa rfaF Lipopolysaccharide heptosyltransferase
863 JAIMZK010000003.1 GCA022340115_01612 CDS open 99533-100561 _na     342_aa rfaF ADP-heptose--LPS heptosyltransferase
864 JAIMZK010000003.1 GCA022340115_01613 CDS open 100554-101156 _na     200_aa Lipopolysaccharide biosynthesis protein
865 JAIMZK010000003.1 GCA022340115_01614 CDS open 101158-102165 _na     335_aa rfaQ Lipopolysaccharide core biosynthesis protein rfaQ
866 JAIMZK010000003.1 GCA022340115_01615 CDS open 102173-103312 _na     379_aa recA recombinase RecA
867 JAIMZK010000003.1 GCA022340115_01616 CDS open 103284-103853 _na     189_aa recX Regulatory protein RecX
868 JAIMZK010000003.1 GCA022340115_01617 CDS open 103850-104875 _na     341_aa tsaD tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD
869 JAIMZK010000003.1 GCA022340115_01618 CDS open 105079-107613 _na     844_aa CRISPR system single-strand-specific deoxyribonuclease Cas10/Csm1 (subtype III-A)
870 JAIMZK010000003.1 GCA022340115_01619 CDS open 107617-107976 _na     119_aa type III-A CRISPR-associated protein Csm2
871 JAIMZK010000003.1 GCA022340115_01620 CDS open 108012-108719 _na     235_aa csm3 type III-A CRISPR-associated RAMP protein Csm3
872 JAIMZK010000003.1 GCA022340115_01621 CDS open 108719-109735 _na     338_aa csm4 type III-A CRISPR-associated RAMP protein Csm4
873 JAIMZK010000003.1 GCA022340115_01622 CDS open 109728-110897 _na     389_aa csm5 type III-A CRISPR-associated RAMP protein Csm5
874 JAIMZK010000003.1 GCA022340115_01623 CDS open 110872-111600 _na     242_aa CRISPR-associated protein Cas6 C-terminal domain-containing protein
875 JAIMZK010000003.1 GCA022340115_01624 CDS open 111593-112975 _na     460_aa csm6 type III-A CRISPR-associated CARF protein Csm6
876 JAIMZK010000003.1 GCA022340115_01625 CDS open 112989-113996 _na     335_aa cas1 CRISPR-associated endonuclease Cas1
877 JAIMZK010000003.1 GCA022340115_01626 CDS open 114002-114325 _na     107_aa cas2 CRISPR-associated endonuclease Cas2
878 JAIMZK010000003.1 GCA022340115_01519 gene open 220-933
879 JAIMZK010000003.1 GCA022340115_01520 gene open 951-1658 deoD
880 JAIMZK010000003.1 GCA022340115_01521 gene open 1720-2730 pxpC
881 JAIMZK010000003.1 GCA022340115_01522 gene open 2723-3472 pxpB
882 JAIMZK010000003.1 GCA022340115_01523 gene open 3485-4672 mntH
883 JAIMZK010000003.1 GCA022340115_01524 gene open 4687-5460 pxpA
884 JAIMZK010000003.1 GCA022340115_01528 gene open 6340-7269
885 JAIMZK010000003.1 GCA022340115_01529 gene open 7835-9658 glmS
886 JAIMZK010000003.1 GCA022340115_01530 gene open 9721-11475 pepP
887 JAIMZK010000003.1 GCA022340115_01531 gene open 11494-12054
888 JAIMZK010000003.1 GCA022340115_01532 gene open 12182-13657 adhE
889 JAIMZK010000003.1 GCA022340115_01533 gene open 13852-14391 rbr
890 JAIMZK010000003.1 GCA022340115_01534 gene open 14510-15916
891 JAIMZK010000003.1 GCA022340115_01535 gene open 15936-16376
892 JAIMZK010000003.1 GCA022340115_01536 gene open 16391-17233
893 JAIMZK010000003.1 GCA022340115_01537 gene open 17249-18136
894 JAIMZK010000003.1 GCA022340115_01538 gene open 18149-19117 hemB
895 JAIMZK010000003.1 GCA022340115_01539 gene open 19189-19734 hpf
896 JAIMZK010000003.1 GCA022340115_01540 gene open 19881-21815 mutL
897 JAIMZK010000003.1 GCA022340115_01541 gene open 21826-22293
898 JAIMZK010000003.1 GCA022340115_01542 gene open 22375-22707
899 JAIMZK010000003.1 GCA022340115_01543 gene open 22725-24002
900 JAIMZK010000003.1 GCA022340115_01544 gene open 24032-25513 lysS
901 JAIMZK010000003.1 GCA022340115_01545 gene open 25580-25936 yohJ
902 JAIMZK010000003.1 GCA022340115_01546 gene open 25936-26628 lrgB
903 JAIMZK010000003.1 GCA022340115_01547 gene open 26642-27250 cutC
904 JAIMZK010000003.1 GCA022340115_01548 gene open 27479-29017 abgT
905 JAIMZK010000003.1 GCA022340115_01549 gene open 29169-29672 fldA
906 JAIMZK010000003.1 GCA022340115_01550 gene open 29966-31273 miaB
907 JAIMZK010000003.1 GCA022340115_01551 gene open 31296-32537 rho
908 JAIMZK010000003.1 GCA022340115_01552 gene open 32588-33685 nlpD
909 JAIMZK010000003.1 GCA022340115_01553 gene open 33731-34804 ispG
910 JAIMZK010000003.1 GCA022340115_01554 gene open 34850-35299 rpoE
911 JAIMZK010000003.1 GCA022340115_01555 gene open 35301-35609
912 JAIMZK010000003.1 GCA022340115_01556 gene open 35626-36024
913 JAIMZK010000003.1 GCA022340115_01557 gene open 36143-36388 rpmE
914 JAIMZK010000003.1 GCA022340115_01558 gene open 36447-37070 upp
915 JAIMZK010000003.1 GCA022340115_01559 gene open 37328-38116 estA
916 JAIMZK010000003.1 GCA022340115_01560 gene open 38335-39345 ldhA
917 JAIMZK010000003.1 GCA022340115_01561 gene open 39733-41010 gdhA
918 JAIMZK010000003.1 GCA022340115_01562 gene open 41237-42445 gltS
919 JAIMZK010000003.1 GCA022340115_01563 gene open 42638-43432 murI
920 JAIMZK010000003.1 GCA022340115_01564 gene open 43517-44377 lgt
921 JAIMZK010000003.1 GCA022340115_01565 gene open 44401-45183 undP
922 JAIMZK010000003.1 GCA022340115_01566 gene open 45188-46267 alr
923 JAIMZK010000003.1 GCA022340115_01567 gene open 46405-46557
924 JAIMZK010000003.1 GCA022340115_01568 gene open 46957-47676 fabG
925 JAIMZK010000003.1 GCA022340115_01569 gene open 47726-48934 paaJ
926 JAIMZK010000003.1 GCA022340115_01570 gene open 49094-53113
927 JAIMZK010000003.1 GCA022340115_01571 gene open 53132-55366
928 JAIMZK010000003.1 GCA022340115_01572 gene open 55640-56497
929 JAIMZK010000003.1 GCA022340115_01573 gene open 56523-57320
930 JAIMZK010000003.1 GCA022340115_01574 gene open 57486-59837 ldcC
931 JAIMZK010000003.1 GCA022340115_01575 gene open 59962-60546 gmhA
932 JAIMZK010000003.1 GCA022340115_01576 gene open 60563-61450 lysR
933 JAIMZK010000003.1 GCA022340115_01577 gene open 61547-62926
934 JAIMZK010000003.1 GCA022340115_01578 gene open 62942-63673
935 JAIMZK010000003.1 GCA022340115_01579 gene open 63705-65414 argS
936 JAIMZK010000003.1 GCA022340115_01580 gene open 65710-66555 yjjU
937 JAIMZK010000003.1 GCA022340115_01581 gene open 66679-67683
938 JAIMZK010000003.1 GCA022340115_01582 gene open 67929-69140 norV
939 JAIMZK010000003.1 GCA022340115_01583 gene open 69307-69735 fldA
940 JAIMZK010000003.1 GCA022340115_01584 gene open 69982-70422
941 JAIMZK010000003.1 GCA022340115_01585 gene open 70478-71461
942 JAIMZK010000003.1 GCA022340115_01586 gene open 71445-72242
943 JAIMZK010000003.1 GCA022340115_01587 gene open 72246-72863
944 JAIMZK010000003.1 GCA022340115_01588 gene open 72887-73321
945 JAIMZK010000003.1 GCA022340115_01589 gene open 73352-74122
946 JAIMZK010000003.1 GCA022340115_01590 gene open 74381-75394
947 JAIMZK010000003.1 GCA022340115_01591 gene open 75403-76020
948 JAIMZK010000003.1 GCA022340115_01592 gene open 76013-76681 queH
949 JAIMZK010000003.1 GCA022340115_01593 gene open 76690-79455
950 JAIMZK010000003.1 GCA022340115_01594 gene open 79445-80611 sbcD
951 JAIMZK010000003.1 GCA022340115_01595 gene open 80608-83367 cas4
952 JAIMZK010000003.1 GCA022340115_01596 gene open 83369-85624 mrcB
953 JAIMZK010000003.1 GCA022340115_01597 gene open 85628-86704 rlmN
954 JAIMZK010000003.1 GCA022340115_01598 gene open 86704-87825 alaX
955 JAIMZK010000003.1 GCA022340115_01599 gene open 87970-89304 nox
956 JAIMZK010000003.1 GCA022340115_01600 gene open 89742-89942 cspC
957 JAIMZK010000003.1 GCA022340115_01601 gene open 89997-91052 abrB
958 JAIMZK010000003.1 GCA022340115_01602 gene open 91266-91802
959 JAIMZK010000003.1 GCA022340115_01603 gene open 91867-92445 ppnN
960 JAIMZK010000003.1 GCA022340115_01604 gene open 92469-93617 dnaN
961 JAIMZK010000003.1 GCA022340115_01605 gene open 93635-94219 plsY
962 JAIMZK010000003.1 GCA022340115_01606 gene open 94363-94587 secG
963 JAIMZK010000003.1 GCA022340115_01607 gene open 94655-95113
964 JAIMZK010000003.1 GCA022340115_01608 gene open 95103-96407 hemL
965 JAIMZK010000003.1 GCA022340115_01609 gene open 96635-97729 pgaB
966 JAIMZK010000003.1 GCA022340115_01610 gene open 97748-98527
967 JAIMZK010000003.1 GCA022340115_01611 gene open 98517-99536 rfaF
968 JAIMZK010000003.1 GCA022340115_01612 gene open 99533-100561 rfaF
969 JAIMZK010000003.1 GCA022340115_01613 gene open 100554-101156
970 JAIMZK010000003.1 GCA022340115_01614 gene open 101158-102165 rfaQ
971 JAIMZK010000003.1 GCA022340115_01615 gene open 102173-103312 recA
972 JAIMZK010000003.1 GCA022340115_01616 gene open 103284-103853 recX
973 JAIMZK010000003.1 GCA022340115_01617 gene open 103850-104875 tsaD
974 JAIMZK010000003.1 GCA022340115_01618 gene open 105079-107613
975 JAIMZK010000003.1 GCA022340115_01619 gene open 107617-107976
976 JAIMZK010000003.1 GCA022340115_01620 gene open 108012-108719 csm3
977 JAIMZK010000003.1 GCA022340115_01621 gene open 108719-109735 csm4
978 JAIMZK010000003.1 GCA022340115_01622 gene open 109728-110897 csm5
979 JAIMZK010000003.1 GCA022340115_01623 gene open 110872-111600
980 JAIMZK010000003.1 GCA022340115_01624 gene open 111593-112975 csm6
981 JAIMZK010000003.1 GCA022340115_01625 gene open 112989-113996 cas1
982 JAIMZK010000003.1 GCA022340115_01626 gene open 114002-114325 cas2
983 JAIMZK010000003.1 GCA022340115_01518 gene open 56-131 trnN
984 JAIMZK010000003.1 GCA022340115_01525 gene open 5679-5755 trnR
985 JAIMZK010000003.1 GCA022340115_01526 gene open 5816-5892 trnR
986 JAIMZK010000003.1 GCA022340115_01527 gene open 5901-5987 trnL
987 JAIMZK010000003.1 GCA022340115_01518 tRNA open 56-131 trnN tRNA-Asn(gtt)
988 JAIMZK010000003.1 GCA022340115_01525 tRNA open 5679-5755 trnR tRNA-Arg(tcg)
989 JAIMZK010000003.1 GCA022340115_01526 tRNA open 5816-5892 trnR tRNA-Arg(acg)
990 JAIMZK010000003.1 GCA022340115_01527 tRNA open 5901-5987 trnL tRNA-Leu(caa)
991 JAIMZK010000004.1 GCA022340115_01666 CDS open 214-1191 _na     325_aa SWIM-type domain-containing protein
992 JAIMZK010000004.1 GCA022340115_01667 CDS open 1261-2301 _na     346_aa glpX class II fructose-bisphosphatase
993 JAIMZK010000004.1 GCA022340115_01668 CDS open 2298-2612 _na     104_aa Septum formation initiator subfamily
994 JAIMZK010000004.1 GCA022340115_01669 CDS open 2605-3129 _na     174_aa def peptide deformylase
995 JAIMZK010000004.1 GCA022340115_01670 CDS open 3139-5439 _na     766_aa Primosomal protein N'
996 JAIMZK010000004.1 GCA022340115_01671 CDS open 5454-7625 _na     723_aa ftsI Cell division protein FtsI
997 JAIMZK010000004.1 GCA022340115_01672 CDS open 7609-8859 _na     416_aa brkB YihY family protein
998 JAIMZK010000004.1 GCA022340115_01673 CDS open 8875-9204 _na     109_aa Lipoprotein
999 JAIMZK010000004.1 GCA022340115_01674 CDS open 9223-10413 _na     396_aa aspB Aminotransferase
1000 JAIMZK010000004.1 GCA022340115_01675 CDS open 10584-11930 _na     448_aa norM Multidrug-efflux transporter