HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Staphylococcus lugdunensis (GCA_022569275.1)

Select a Genome:
BAKTA Annotations for GCA_022569275.1
Genome Selected: Staphylococcus lugdunensis
ContigsBases CDSrRNA tmRNAtRNA
17 2634709 2504 4 1 56
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 5254 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:6]    |    Number of Records Found: 5254 [11 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2501 JAKRKV010000001.1 GCA022569275_01237 gene open 1221566-1222399
2502 JAKRKV010000001.1 GCA022569275_01238 gene open 1222399-1223385 pta
2503 JAKRKV010000001.1 GCA022569275_01239 gene open 1223547-1224296 hemQ
2504 JAKRKV010000001.1 GCA022569275_01240 gene open 1224816-1224938
2505 JAKRKV010000001.1 GCA022569275_01241 gene open 1224969-1225391
2506 JAKRKV010000001.1 GCA022569275_01242 gene open 1225474-1225683
2507 JAKRKV010000001.1 GCA022569275_01244 gene open 1226103-1226870
2508 JAKRKV010000001.1 GCA022569275_01245 gene open 1226883-1227335 thrE
2509 JAKRKV010000001.1 GCA022569275_01246 gene open 1227443-1228918
2510 JAKRKV010000001.1 GCA022569275_01247 gene open 1228991-1229362
2511 JAKRKV010000001.1 GCA022569275_01248 gene open 1229383-1229778 ywdI
2512 JAKRKV010000001.1 GCA022569275_01249 gene open 1229771-1230439
2513 JAKRKV010000001.1 GCA022569275_01250 gene open 1230592-1231584
2514 JAKRKV010000001.1 GCA022569275_01251 gene open 1231673-1232503
2515 JAKRKV010000001.1 GCA022569275_01252 gene open 1232799-1233932
2516 JAKRKV010000001.1 GCA022569275_01253 gene open 1234083-1234253
2517 JAKRKV010000001.1 GCA022569275_01254 gene open 1234433-1235110 scdA
2518 JAKRKV010000001.1 GCA022569275_01255 gene open 1235284-1235826
2519 JAKRKV010000001.1 GCA022569275_01256 gene open 1236121-1236696
2520 JAKRKV010000001.1 GCA022569275_01257 gene open 1237367-1237915
2521 JAKRKV010000001.1 GCA022569275_01258 gene open 1237917-1238549 ulaD
2522 JAKRKV010000001.1 GCA022569275_01259 gene open 1238814-1239176
2523 JAKRKV010000001.1 GCA022569275_01260 gene open 1239190-1239855 bshB2
2524 JAKRKV010000001.1 GCA022569275_01261 gene open 1239870-1240751 folE2
2525 JAKRKV010000001.1 GCA022569275_01262 gene open 1240923-1244114
2526 JAKRKV010000001.1 GCA022569275_01263 gene open 1244294-1245712
2527 JAKRKV010000001.1 GCA022569275_01264 gene open 1245736-1245924
2528 JAKRKV010000001.1 GCA022569275_01265 gene open 1246040-1253419
2529 JAKRKV010000001.1 GCA022569275_01266 gene open 1253675-1254241
2530 JAKRKV010000001.1 GCA022569275_01267 gene open 1254257-1255126
2531 JAKRKV010000001.1 GCA022569275_01268 gene open 1255250-1255726 tadA
2532 JAKRKV010000001.1 GCA022569275_01269 gene open 1255790-1256407
2533 JAKRKV010000001.1 GCA022569275_01270 gene open 1256400-1257074
2534 JAKRKV010000001.1 GCA022569275_01271 gene open 1257263-1257955
2535 JAKRKV010000001.1 GCA022569275_01272 gene open 1258555-1259673
2536 JAKRKV010000001.1 GCA022569275_01273 gene open 1259769-1260809 tdcB
2537 JAKRKV010000001.1 GCA022569275_01274 gene open 1260838-1262157
2538 JAKRKV010000001.1 GCA022569275_01275 gene open 1262967-1264043
2539 JAKRKV010000001.1 GCA022569275_01276 gene open 1264264-1265217
2540 JAKRKV010000001.1 GCA022569275_01277 gene open 1265917-1266249 argO
2541 JAKRKV010000001.1 GCA022569275_01278 gene open 1266290-1266541 lysE
2542 JAKRKV010000001.1 GCA022569275_01279 gene open 1266591-1267010
2543 JAKRKV010000001.1 GCA022569275_01280 gene open 1267021-1267527
2544 JAKRKV010000001.1 GCA022569275_01281 gene open 1267646-1268608
2545 JAKRKV010000001.1 GCA022569275_01282 gene open 1268711-1269901 bioF
2546 JAKRKV010000001.1 GCA022569275_01283 gene open 1270471-1271637 abgB
2547 JAKRKV010000001.1 GCA022569275_01284 gene open 1271752-1272936 tuf
2548 JAKRKV010000001.1 GCA022569275_01285 gene open 1273155-1275236 fusA
2549 JAKRKV010000001.1 GCA022569275_01286 gene open 1275356-1275826 rpsG
2550 JAKRKV010000001.1 GCA022569275_01287 gene open 1275897-1276310 rpsL
2551 JAKRKV010000001.1 GCA022569275_01288 gene open 1276400-1276660
2552 JAKRKV010000001.1 GCA022569275_01289 gene open 1276922-1280545 rpoC
2553 JAKRKV010000001.1 GCA022569275_01290 gene open 1280704-1284258 rpoB
2554 JAKRKV010000001.1 GCA022569275_01291 gene open 1284460-1285068
2555 JAKRKV010000001.1 GCA022569275_01292 gene open 1285344-1285712 rplL
2556 JAKRKV010000001.1 GCA022569275_01293 gene open 1285750-1286250 rplJ
2557 JAKRKV010000001.1 GCA022569275_01294 gene open 1286525-1287220 rplA
2558 JAKRKV010000001.1 GCA022569275_01295 gene open 1287436-1287858 rplK
2559 JAKRKV010000001.1 GCA022569275_01296 gene open 1288059-1288607 nusG
2560 JAKRKV010000001.1 GCA022569275_01297 gene open 1288625-1288819 secE
2561 JAKRKV010000001.1 GCA022569275_01298 gene open 1289153-1289695 sigS
2562 JAKRKV010000001.1 GCA022569275_01299 gene open 1289806-1290333
2563 JAKRKV010000001.1 GCA022569275_01300 gene open 1290333-1291079 rlmB
2564 JAKRKV010000001.1 GCA022569275_01301 gene open 1291082-1291486
2565 JAKRKV010000001.1 GCA022569275_01302 gene open 1291479-1292879 cysS
2566 JAKRKV010000001.1 GCA022569275_01303 gene open 1292863-1293504 cysE
2567 JAKRKV010000001.1 GCA022569275_01304 gene open 1293867-1295324 gltX
2568 JAKRKV010000001.1 GCA022569275_01305 gene open 1295648-1296715
2569 JAKRKV010000001.1 GCA022569275_01306 gene open 1296750-1298117 radA
2570 JAKRKV010000001.1 GCA022569275_01307 gene open 1298348-1300807 clpC
2571 JAKRKV010000001.1 GCA022569275_01308 gene open 1300821-1301837
2572 JAKRKV010000001.1 GCA022569275_01309 gene open 1301827-1302384
2573 JAKRKV010000001.1 GCA022569275_01310 gene open 1302411-1302881 ctsR
2574 JAKRKV010000001.1 GCA022569275_01311 gene open 1303026-1304240
2575 JAKRKV010000001.1 GCA022569275_01312 gene open 1304471-1305025 pdxT
2576 JAKRKV010000001.1 GCA022569275_01313 gene open 1305029-1305916 pdxS
2577 JAKRKV010000001.1 GCA022569275_01314 gene open 1306014-1307396 gntR
2578 JAKRKV010000001.1 GCA022569275_00001 gene open 22-95 trnR
2579 JAKRKV010000001.1 GCA022569275_00002 gene open 107-180 trnP
2580 JAKRKV010000001.1 GCA022569275_00003 gene open 224-299 trnA
2581 JAKRKV010000001.1 GCA022569275_00004 gene open 316-389 trnM
2582 JAKRKV010000001.1 GCA022569275_00005 gene open 418-491 trnI
2583 JAKRKV010000001.1 GCA022569275_00006 gene open 501-590 trnS
2584 JAKRKV010000001.1 GCA022569275_00007 gene open 601-676 trnD
2585 JAKRKV010000001.1 GCA022569275_00008 gene open 712-804 trnS
2586 JAKRKV010000001.1 GCA022569275_00009 gene open 816-889 trnfM
2587 JAKRKV010000001.1 GCA022569275_00010 gene open 900-975 trnD
2588 JAKRKV010000001.1 GCA022569275_00011 gene open 990-1062 trnF
2589 JAKRKV010000001.1 GCA022569275_00012 gene open 1073-1148 trnT
2590 JAKRKV010000001.1 GCA022569275_00013 gene open 1152-1232 trnY
2591 JAKRKV010000001.1 GCA022569275_00014 gene open 1244-1317 trnW
2592 JAKRKV010000001.1 GCA022569275_00015 gene open 1320-1392 trnH
2593 JAKRKV010000001.1 GCA022569275_00016 gene open 1404-1475 trnQ
2594 JAKRKV010000001.1 GCA022569275_00017 gene open 1481-1554 trnC
2595 JAKRKV010000001.1 GCA022569275_00018 gene open 1561-1635 trnG
2596 JAKRKV010000001.1 GCA022569275_00019 gene open 1652-1726 trnG
2597 JAKRKV010000001.1 GCA022569275_00020 gene open 1740-1814 trnG
2598 JAKRKV010000001.1 GCA022569275_00021 gene open 1853-1936 trnL
2599 JAKRKV010000001.1 GCA022569275_00053 gene open 33679-33752 trnfM
2600 JAKRKV010000001.1 GCA022569275_00054 gene open 33769-33844 trnD
2601 JAKRKV010000001.1 GCA022569275_00055 gene open 33859-33931 trnF
2602 JAKRKV010000001.1 GCA022569275_00056 gene open 33946-34021 trnH
2603 JAKRKV010000001.1 GCA022569275_00057 gene open 34037-34110 trnG
2604 JAKRKV010000001.1 GCA022569275_00058 gene open 34120-34194 trnN
2605 JAKRKV010000001.1 GCA022569275_00059 gene open 34196-34267 trnE
2606 JAKRKV010000001.1 GCA022569275_00060 gene open 34324-34413 trnS
2607 JAKRKV010000001.1 GCA022569275_00650 gene open 655119-655192 trnR
2608 JAKRKV010000001.1 GCA022569275_00765 gene open 767723-767811 trnS
2609 JAKRKV010000001.1 GCA022569275_00766 gene open 767813-767887 trnN
2610 JAKRKV010000001.1 GCA022569275_00987 gene open 988160-988231 trnR
2611 JAKRKV010000001.1 GCA022569275_00001 tRNA open 22-95 trnR tRNA-Arg(acg)
2612 JAKRKV010000001.1 GCA022569275_00002 tRNA open 107-180 trnP tRNA-Pro(tgg)
2613 JAKRKV010000001.1 GCA022569275_00003 tRNA open 224-299 trnA tRNA-Ala(tgc)
2614 JAKRKV010000001.1 GCA022569275_00004 tRNA open 316-389 trnM tRNA-Met(cat)
2615 JAKRKV010000001.1 GCA022569275_00005 tRNA open 418-491 trnI tRNA-Ile2(cat)
2616 JAKRKV010000001.1 GCA022569275_00006 tRNA open 501-590 trnS tRNA-Ser(tga)
2617 JAKRKV010000001.1 GCA022569275_00007 tRNA open 601-676 trnD tRNA-Asp(gtc)
2618 JAKRKV010000001.1 GCA022569275_00008 tRNA open 712-804 trnS tRNA-Ser(tga)
2619 JAKRKV010000001.1 GCA022569275_00009 tRNA open 816-889 trnfM tRNA-fMet(cat)
2620 JAKRKV010000001.1 GCA022569275_00010 tRNA open 900-975 trnD tRNA-Asp(gtc)
2621 JAKRKV010000001.1 GCA022569275_00011 tRNA open 990-1062 trnF tRNA-Phe(gaa)
2622 JAKRKV010000001.1 GCA022569275_00012 tRNA open 1073-1148 trnT tRNA-Thr(tgt)
2623 JAKRKV010000001.1 GCA022569275_00013 tRNA open 1152-1232 trnY tRNA-Tyr(gta)
2624 JAKRKV010000001.1 GCA022569275_00014 tRNA open 1244-1317 trnW tRNA-Trp(cca)
2625 JAKRKV010000001.1 GCA022569275_00015 tRNA open 1320-1392 trnH tRNA-His(gtg)
2626 JAKRKV010000001.1 GCA022569275_00016 tRNA open 1404-1475 trnQ tRNA-Gln(ttg)
2627 JAKRKV010000001.1 GCA022569275_00017 tRNA open 1481-1554 trnC tRNA-Cys(gca)
2628 JAKRKV010000001.1 GCA022569275_00018 tRNA open 1561-1635 trnG tRNA-Gly(tcc)
2629 JAKRKV010000001.1 GCA022569275_00019 tRNA open 1652-1726 trnG tRNA-Gly(tcc)
2630 JAKRKV010000001.1 GCA022569275_00020 tRNA open 1740-1814 trnG tRNA-Gly(tcc)
2631 JAKRKV010000001.1 GCA022569275_00021 tRNA open 1853-1936 trnL tRNA-Leu(caa)
2632 JAKRKV010000001.1 GCA022569275_00053 tRNA open 33679-33752 trnfM tRNA-fMet(cat)
2633 JAKRKV010000001.1 GCA022569275_00054 tRNA open 33769-33844 trnD tRNA-Asp(gtc)
2634 JAKRKV010000001.1 GCA022569275_00055 tRNA open 33859-33931 trnF tRNA-Phe(gaa)
2635 JAKRKV010000001.1 GCA022569275_00056 tRNA open 33946-34021 trnH tRNA-His(gtg)
2636 JAKRKV010000001.1 GCA022569275_00057 tRNA open 34037-34110 trnG tRNA-Gly(tcc)
2637 JAKRKV010000001.1 GCA022569275_00058 tRNA open 34120-34194 trnN tRNA-Asn(gtt)
2638 JAKRKV010000001.1 GCA022569275_00059 tRNA open 34196-34267 trnE tRNA-Glu(ttc)
2639 JAKRKV010000001.1 GCA022569275_00060 tRNA open 34324-34413 trnS tRNA-Ser(gga)
2640 JAKRKV010000001.1 GCA022569275_00650 tRNA open 655119-655192 trnR tRNA-Arg(tct)
2641 JAKRKV010000001.1 GCA022569275_00765 tRNA open 767723-767811 trnS tRNA-Ser(gct)
2642 JAKRKV010000001.1 GCA022569275_00766 tRNA open 767813-767887 trnN tRNA-Asn(gtt)
2643 JAKRKV010000001.1 GCA022569275_00987 tRNA open 988160-988231 trnR tRNA-Arg(ccg)
2644 JAKRKV010000002.1 rep_origin open 919033-919682
2645 JAKRKV010000002.1 GCA022569275_01448 gene open 132127-132276 RsaOG
2646 JAKRKV010000002.1 GCA022569275_01527 gene open 215564-215800 S35
2647 JAKRKV010000002.1 GCA022569275_01535 gene open 223204-223490 5_ureB_sRNA
2648 JAKRKV010000002.1 GCA022569275_01556 gene open 244950-245173 tsr24
2649 JAKRKV010000002.1 GCA022569275_01642 gene open 332002-332214 tsr24
2650 JAKRKV010000002.1 GCA022569275_01747 gene open 454162-454405 S35
2651 JAKRKV010000002.1 GCA022569275_01828 gene open 557617-557720 sau-13
2652 JAKRKV010000002.1 GCA022569275_01895 gene open 626757-626980 tsr24
2653 JAKRKV010000002.1 GCA022569275_01929 gene open 661227-661501 S35
2654 JAKRKV010000002.1 GCA022569275_01943 gene open 677730-677987 S35
2655 JAKRKV010000002.1 GCA022569275_01957 gene open 691639-691860 tsr24
2656 JAKRKV010000002.1 GCA022569275_02128 gene open 873015-873292 tsr24
2657 JAKRKV010000002.1 GCA022569275_01448 ncRNA open 132127-132276 RNA S.aureus Orsay G
2658 JAKRKV010000002.1 GCA022569275_01527 ncRNA open 215564-215800 Staphylococcus sRNA 35 (srn_0335)
2659 JAKRKV010000002.1 GCA022569275_01535 ncRNA open 223204-223490 5' ureB small RNA
2660 JAKRKV010000002.1 GCA022569275_01556 ncRNA open 244950-245173 S. aureus tsr24 small RNA
2661 JAKRKV010000002.1 GCA022569275_01642 ncRNA open 332002-332214 S. aureus tsr24 small RNA
2662 JAKRKV010000002.1 GCA022569275_01747 ncRNA open 454162-454405 Staphylococcus sRNA 35 (srn_0335)
2663 JAKRKV010000002.1 GCA022569275_01828 ncRNA open 557617-557720 Staphylococcus sRNA sau-13
2664 JAKRKV010000002.1 GCA022569275_01895 ncRNA open 626757-626980 S. aureus tsr24 small RNA
2665 JAKRKV010000002.1 GCA022569275_01929 ncRNA open 661227-661501 Staphylococcus sRNA 35 (srn_0335)
2666 JAKRKV010000002.1 GCA022569275_01943 ncRNA open 677730-677987 Staphylococcus sRNA 35 (srn_0335)
2667 JAKRKV010000002.1 GCA022569275_01957 ncRNA open 691639-691860 S. aureus tsr24 small RNA
2668 JAKRKV010000002.1 GCA022569275_02128 ncRNA open 873015-873292 S. aureus tsr24 small RNA
2669 JAKRKV010000002.1 regulatory_region open 62613-62682 Ribosomal protein L13 leader
2670 JAKRKV010000002.1 regulatory_region open 218030-218131 TPP riboswitch aptamer (THI element)
2671 JAKRKV010000002.1 regulatory_region open 363852-363963 TPP riboswitch aptamer (THI element)
2672 JAKRKV010000002.1 regulatory_region open 486957-487063 SAM riboswitch aptamer (S box leader)
2673 JAKRKV010000002.1 regulatory_region open 547386-547488 TPP riboswitch aptamer (THI element)
2674 JAKRKV010000002.1 regulatory_region open 654027-654127 TPP riboswitch aptamer (THI element)
2675 JAKRKV010000002.1 regulatory_region open 678920-679018 TPP riboswitch aptamer (THI element)
2676 JAKRKV010000002.1 regulatory_region open 679116-679215 TPP riboswitch aptamer (THI element)
2677 JAKRKV010000002.1 regulatory_region open 769623-769837 T-box leader
2678 JAKRKV010000002.1 regulatory_region open 905598-905696 SAM riboswitch aptamer (S box leader)
2679 JAKRKV010000002.1 regulatory_region open 908444-908647 T-box leader
2680 JAKRKV010000002.1 regulatory_region open 967106-967498 T-box leader
2681 JAKRKV010000002.1 repeat_region open 852209-852822 CRISPR array with 9 repeats of length 36%2C consensus sequence GTTCTCGTCCCCTTTTATACGGGGTATTCTCTGATT and spacer length 35
2682 JAKRKV010000002.1 GCA022569275_01315 CDS open 393-1457 _na     354_aa Iron-sulfur cluster carrier protein
2683 JAKRKV010000002.1 GCA022569275_01316 CDS open 1591-3027 _na     478_aa Multidrug MFS transporter
2684 JAKRKV010000002.1 GCA022569275_01317 CDS open 3105-3572 _na     155_aa sepA Multidrug resistance efflux pump SepA
2685 JAKRKV010000002.1 GCA022569275_01318 CDS open 3678-5009 _na     443_aa sdrM multidrug efflux MFS transporter SdrM
2686 JAKRKV010000002.1 GCA022569275_01319 CDS open 5168-5854 _na     228_aa Hemolysin III
2687 JAKRKV010000002.1 GCA022569275_01320 CDS open 5870-7057 _na     395_aa Uridylyltransferase
2688 JAKRKV010000002.1 GCA022569275_01321 CDS open 7319-7834 _na     171_aa Metal-dependent hydrolase
2689 JAKRKV010000002.1 GCA022569275_01322 CDS open 8012-8272 _na     86_aa Cytosolic protein
2690 JAKRKV010000002.1 GCA022569275_01323 CDS open 8511-9881 _na     456_aa Nucleoside transporter/FeoB GTPase Gate domain-containing protein
2691 JAKRKV010000002.1 GCA022569275_01324 CDS open 10146-11111 _na     321_aa fecD Iron-dicitrate transporter subunit FecD
2692 JAKRKV010000002.1 GCA022569275_01325 CDS open 11104-12132 _na     342_aa Iron-siderophore ABC transporter permease
2693 JAKRKV010000002.1 GCA022569275_01326 CDS open 12150-13145 _na     331_aa Iron citrate ABC transporter substrate-binding protein
2694 JAKRKV010000002.1 GCA022569275_01327 CDS open 13625-14713 _na     362_aa Alanine racemase
2695 JAKRKV010000002.1 GCA022569275_01328 CDS open 14717-16477 _na     586_aa Siderophore biosynthesis protein
2696 JAKRKV010000002.1 GCA022569275_01329 CDS open 16703-17212 _na     169_aa asp23 Alkaline shock protein 23
2697 JAKRKV010000002.1 GCA022569275_01330 CDS open 17278-17517 _na     79_aa Small integral membrane protein-protein
2698 JAKRKV010000002.1 GCA022569275_01331 CDS open 17530-18066 _na     178_aa amaP alkaline shock response membrane anchor protein AmaP
2699 JAKRKV010000002.1 GCA022569275_01332 CDS open 18616-19623 _na     335_aa Zinc-type alcohol dehydrogenase-like protein
2700 JAKRKV010000002.1 GCA022569275_01333 CDS open 19650-20651 _na     333_aa NADP-dependent oxidoreductase
2701 JAKRKV010000002.1 GCA022569275_01334 CDS open 20746-21603 _na     285_aa Alpha/beta hydrolase
2702 JAKRKV010000002.1 GCA022569275_01335 CDS open 21827-23236 _na     469_aa lacG 6-phospho-beta-galactosidase
2703 JAKRKV010000002.1 GCA022569275_01336 CDS open 23255-24994 _na     579_aa PTS system lactose-specific EIICB component
2704 JAKRKV010000002.1 GCA022569275_01337 CDS open 25003-25314 _na     103_aa PTS system lactose-specific EIIA component
2705 JAKRKV010000002.1 GCA022569275_01338 CDS open 25334-26308 _na     324_aa lacD tagatose-bisphosphate aldolase
2706 JAKRKV010000002.1 GCA022569275_01339 CDS open 26312-27247 _na     311_aa tagatose-6-phosphate kinase
2707 JAKRKV010000002.1 GCA022569275_01340 CDS open 27260-27775 _na     171_aa lacB galactose-6-phosphate isomerase subunit LacB
2708 JAKRKV010000002.1 GCA022569275_01341 CDS open 27791-28219 _na     142_aa lacA galactose-6-phosphate isomerase subunit LacA
2709 JAKRKV010000002.1 GCA022569275_01342 CDS open 28450-29205 _na     251_aa Lactose phosphotransferase system repressor
2710 JAKRKV010000002.1 GCA022569275_01343 CDS open 29406-29837 _na     143_aa NAD-dependent protein deacylase
2711 JAKRKV010000002.1 GCA022569275_01344 CDS open 29795-30139 _na     114_aa NAD-dependent protein deacylase
2712 JAKRKV010000002.1 GCA022569275_01345 CDS open 30437-31096 _na     219_aa Signal transduction protein TRAP
2713 JAKRKV010000002.1 GCA022569275_01346 CDS open 32349-32609 _na     86_aa 4'-phosphopantetheinyl transferase
2714 JAKRKV010000002.1 GCA022569275_01347 CDS open 32609-33019 _na     136_aa 4'-phosphopantetheinyl transferase superfamily protein
2715 JAKRKV010000002.1 GCA022569275_01348 CDS open 33027-34766 _na     579_aa lugD lugdunin non-ribosomal peptide synthetase LugD
2716 JAKRKV010000002.1 GCA022569275_01349 CDS open 34804-35490 _na     228_aa Thioesterase
2717 JAKRKV010000002.1 GCA022569275_01350 CDS open 35487-40739 _na     1750_aa vraA Putative long chain fatty acid-CoA ligase VraA
2718 JAKRKV010000002.1 GCA022569275_01351 CDS open 40724-44299 _na     1191_aa vraA Putative long chain fatty acid-CoA ligase VraA
2719 JAKRKV010000002.1 GCA022569275_01352 CDS open 44317-44553 _na     78_aa Peptide synthetase
2720 JAKRKV010000002.1 GCA022569275_01353 CDS open 44586-47303 _na     905_aa AMP-binding enzyme
2721 JAKRKV010000002.1 GCA022569275_01354 CDS open 47294-48535 _na     413_aa hypothetical protein
2722 JAKRKV010000002.1 GCA022569275_01355 CDS open 48525-55649 _na     2374_aa lugA lugdunin non-ribosomal peptide synthetase LugA
2723 JAKRKV010000002.1 GCA022569275_01356 CDS open 55675-56247 _na     190_aa lugR lugdunin biosynthesis transcriptional regulator LugR
2724 JAKRKV010000002.1 GCA022569275_01357 CDS open 56492-58033 _na     513_aa ABC transporter permease
2725 JAKRKV010000002.1 GCA022569275_01358 CDS open 58026-58739 _na     237_aa ABC transporter
2726 JAKRKV010000002.1 GCA022569275_01359 CDS open 58752-59516 _na     254_aa ABC-2 type transporter transmembrane domain-containing protein
2727 JAKRKV010000002.1 GCA022569275_01360 CDS open 59513-60403 _na     296_aa ABC transporter ATP-binding protein
2728 JAKRKV010000002.1 GCA022569275_01361 CDS open 60390-60629 _na     79_aa Cardiolipin synthase N-terminal domain-containing protein
2729 JAKRKV010000002.1 GCA022569275_01362 CDS open 60720-61229 _na     169_aa Transcriptional regulator
2730 JAKRKV010000002.1 GCA022569275_01363 CDS open 61610-62002 _na     130_aa rpsI 30S ribosomal protein S9
2731 JAKRKV010000002.1 GCA022569275_01364 CDS open 62022-62459 _na     145_aa rplM 50S ribosomal protein L13
2732 JAKRKV010000002.1 GCA022569275_01365 CDS open 62725-63528 _na     267_aa truA tRNA pseudouridine(38-40) synthase TruA
2733 JAKRKV010000002.1 GCA022569275_01366 CDS open 63533-64339 _na     268_aa ecfT Energy-coupling factor transporter transmembrane protein EcfT
2734 JAKRKV010000002.1 GCA022569275_01367 CDS open 64336-65193 _na     285_aa energy-coupling factor transporter ATPase
2735 JAKRKV010000002.1 GCA022569275_01368 CDS open 65190-65999 _na     269_aa energy-coupling factor transporter ATPase
2736 JAKRKV010000002.1 GCA022569275_01369 CDS open 66357-66725 _na     122_aa rplQ 50S ribosomal protein L17
2737 JAKRKV010000002.1 GCA022569275_01370 CDS open 66742-67686 _na     314_aa rpoA DNA-directed RNA polymerase subunit alpha
2738 JAKRKV010000002.1 GCA022569275_01371 CDS open 67774-68163 _na     129_aa rpsK 30S ribosomal protein S11
2739 JAKRKV010000002.1 GCA022569275_01372 CDS open 68186-68551 _na     121_aa rpsM 30S ribosomal protein S13
2740 JAKRKV010000002.1 GCA022569275_01373 CDS open 68575-68688 _na     37_aa rpmJ 50S ribosomal protein L36
2741 JAKRKV010000002.1 GCA022569275_01374 CDS open 68720-68938 _na     72_aa infA translation initiation factor IF-1
2742 JAKRKV010000002.1 GCA022569275_01375 CDS open 69132-69782 _na     216_aa adk adenylate kinase
2743 JAKRKV010000002.1 GCA022569275_01376 CDS open 69800-71092 _na     430_aa secY preprotein translocase subunit SecY
2744 JAKRKV010000002.1 GCA022569275_01377 CDS open 71092-71532 _na     146_aa rplO 50S ribosomal protein L15
2745 JAKRKV010000002.1 GCA022569275_01378 CDS open 71552-71731 _na     59_aa rpmD 50S ribosomal protein L30
2746 JAKRKV010000002.1 GCA022569275_01379 CDS open 71748-72248 _na     166_aa rpsE 30S ribosomal protein S5
2747 JAKRKV010000002.1 GCA022569275_01380 CDS open 72269-72631 _na     120_aa rplR 50S ribosomal protein L18
2748 JAKRKV010000002.1 GCA022569275_01381 CDS open 72663-73199 _na     178_aa rplF 50S ribosomal protein L6
2749 JAKRKV010000002.1 GCA022569275_01382 CDS open 73224-73622 _na     132_aa rpsH 30S ribosomal protein S8
2750 JAKRKV010000002.1 GCA022569275_01383 CDS open 73654-73839 _na     61_aa rpsZ type Z 30S ribosomal protein S14
2751 JAKRKV010000002.1 GCA022569275_01384 CDS open 73864-74403 _na     179_aa rplE 50S ribosomal protein L5
2752 JAKRKV010000002.1 GCA022569275_01385 CDS open 74429-74746 _na     105_aa rplX 50S ribosomal protein L24
2753 JAKRKV010000002.1 GCA022569275_01386 CDS open 74783-75151 _na     122_aa rplN 50S ribosomal protein L14
2754 JAKRKV010000002.1 GCA022569275_01387 CDS open 75183-75446 _na     87_aa rpsQ 30S ribosomal protein S17
2755 JAKRKV010000002.1 GCA022569275_01388 CDS open 75464-75673 _na     69_aa rpmC 50S ribosomal protein L29
2756 JAKRKV010000002.1 GCA022569275_01389 CDS open 75663-76097 _na     144_aa rplP 50S ribosomal protein L16
2757 JAKRKV010000002.1 GCA022569275_01390 CDS open 76100-76753 _na     217_aa rpsC 30S ribosomal protein S3
2758 JAKRKV010000002.1 GCA022569275_01391 CDS open 76777-77130 _na     117_aa rplV 50S ribosomal protein L22
2759 JAKRKV010000002.1 GCA022569275_01392 CDS open 77158-77436 _na     92_aa rpsS 30S ribosomal protein S19
2760 JAKRKV010000002.1 GCA022569275_01393 CDS open 77503-78336 _na     277_aa rplB 50S ribosomal protein L2
2761 JAKRKV010000002.1 GCA022569275_01394 CDS open 78368-78643 _na     91_aa rplW 50S ribosomal protein L23
2762 JAKRKV010000002.1 GCA022569275_01395 CDS open 78643-79266 _na     207_aa rplD 50S ribosomal protein L4
2763 JAKRKV010000002.1 GCA022569275_01396 CDS open 79295-79957 _na     220_aa rplC 50S ribosomal protein L3
2764 JAKRKV010000002.1 GCA022569275_01397 CDS open 79985-80293 _na     102_aa rpsJ_Y58D 30S ribosomal protein S10
2765 JAKRKV010000002.1 GCA022569275_01398 CDS open 80646-81041 _na     131_aa Permease
2766 JAKRKV010000002.1 GCA022569275_01399 CDS open 81217-82551 _na     444_aa nCS2 NCS2 family permease
2767 JAKRKV010000002.1 GCA022569275_01400 CDS open 82663-84798 _na     711_aa DNA topoisomerase 3
2768 JAKRKV010000002.1 GCA022569275_01401 CDS open 84949-85833 _na     294_aa GNAT family acetyltransferase
2769 JAKRKV010000002.1 GCA022569275_01402 CDS open 86039-86950 _na     303_aa Malonate transporter
2770 JAKRKV010000002.1 GCA022569275_01403 CDS open 87087-87254 _na     55_aa SE1832 family protein
2771 JAKRKV010000002.1 GCA022569275_01404 CDS open 87317-87634 _na     105_aa mspA membrane stabilizing protein MspA
2772 JAKRKV010000002.1 GCA022569275_01405 CDS open 87714-90899 _na     1061_aa Multidrug transporter
2773 JAKRKV010000002.1 GCA022569275_01406 CDS open 90999-92249 _na     416_aa Lipid II:glycine glycyltransferase
2774 JAKRKV010000002.1 GCA022569275_01407 CDS open 92341-93117 _na     258_aa Sulfurtransferase
2775 JAKRKV010000002.1 GCA022569275_01408 CDS open 93279-93713 _na     144_aa marR MarR family transcriptional regulator
2776 JAKRKV010000002.1 GCA022569275_01409 CDS open 93710-94915 _na     401_aa Multidrug MFS transporter
2777 JAKRKV010000002.1 GCA022569275_01410 CDS open 95104-95454 _na     116_aa marR MarR family transcriptional regulator
2778 JAKRKV010000002.1 GCA022569275_01411 CDS open 95885-96907 _na     340_aa moaA GTP 3'%2C8-cyclase MoaA
2779 JAKRKV010000002.1 GCA022569275_01412 CDS open 96925-97527 _na     200_aa mobA molybdenum cofactor guanylyltransferase MobA
2780 JAKRKV010000002.1 GCA022569275_01413 CDS open 97536-97769 _na     77_aa moaD molybdopterin converting factor subunit 1
2781 JAKRKV010000002.1 GCA022569275_01414 CDS open 97769-98221 _na     150_aa Molybdopterin synthase catalytic subunit
2782 JAKRKV010000002.1 GCA022569275_01415 CDS open 98227-98697 _na     156_aa mobB molybdopterin-guanine dinucleotide biosynthesis protein B
2783 JAKRKV010000002.1 GCA022569275_01416 CDS open 98694-99953 _na     419_aa glp gephyrin-like molybdotransferase Glp
2784 JAKRKV010000002.1 GCA022569275_01417 CDS open 100015-100500 _na     161_aa moaC cyclic pyranopterin monophosphate synthase MoaC
2785 JAKRKV010000002.1 GCA022569275_01418 CDS open 100524-101030 _na     168_aa Molybdenum cofactor biosynthesis protein B
2786 JAKRKV010000002.1 GCA022569275_01419 CDS open 101044-102048 _na     334_aa moeB Molybdopterin biosynthesis protein MoeB
2787 JAKRKV010000002.1 GCA022569275_01420 CDS open 102264-102869 _na     201_aa Molybdenum ABC transporter ATP-binding protein
2788 JAKRKV010000002.1 GCA022569275_01421 CDS open 102870-103541 _na     223_aa modB molybdate ABC transporter permease subunit
2789 JAKRKV010000002.1 GCA022569275_01422 CDS open 103555-104331 _na     258_aa modA molybdate ABC transporter substrate-binding protein
2790 JAKRKV010000002.1 GCA022569275_01423 CDS open 104516-105304 _na     262_aa fdhD formate dehydrogenase accessory sulfurtransferase FdhD
2791 JAKRKV010000002.1 GCA022569275_01424 CDS open 105411-106175 _na     254_aa Acetyltransferase
2792 JAKRKV010000002.1 GCA022569275_01425 CDS open 106199-106744 _na     181_aa Biotin transporter
2793 JAKRKV010000002.1 GCA022569275_01426 CDS open 106814-107755 _na     313_aa Purine nucleosidase
2794 JAKRKV010000002.1 GCA022569275_01427 CDS open 107934-108842 _na     302_aa Ferrichrome ABC transporter substrate-binding protein
2795 JAKRKV010000002.1 GCA022569275_01428 CDS open 109082-110227 _na     381_aa Acyl-CoA dehydrogenase
2796 JAKRKV010000002.1 GCA022569275_01429 CDS open 110434-112527 _na     697_aa clpL ATP-dependent Clp protease ATP-binding subunit ClpL
2797 JAKRKV010000002.1 GCA022569275_01430 CDS open 112685-113026 _na     113_aa marR MarR family transcriptional regulator
2798 JAKRKV010000002.1 GCA022569275_01431 CDS open 113398-113718 _na     106_aa YokE-like PH domain-containing protein
2799 JAKRKV010000002.1 GCA022569275_01432 CDS open 113748-114488 _na     246_aa Regulator
2800 JAKRKV010000002.1 GCA022569275_01433 CDS open 114525-116516 _na     663_aa araC AraC family transcriptional regulator
2801 JAKRKV010000002.1 GCA022569275_01434 CDS open 117072-117809 _na     245_aa CHAP domain-containing protein
2802 JAKRKV010000002.1 GCA022569275_01435 CDS open 118520-119911 _na     463_aa nhaC Na+/H+ antiporter NhaC
2803 JAKRKV010000002.1 GCA022569275_01436 CDS open 119954-121027 _na     357_aa 6-phosphogluconate dehydrogenase%2C decarboxylating
2804 JAKRKV010000002.1 GCA022569275_01437 CDS open 121259-121681 _na     140_aa DUF4870 domain-containing protein
2805 JAKRKV010000002.1 GCA022569275_01438 CDS open 121980-122516 _na     178_aa CHAP domain-containing protein
2806 JAKRKV010000002.1 GCA022569275_01439 CDS open 122929-123261 _na     110_aa Multidrug resistance protein SMR
2807 JAKRKV010000002.1 GCA022569275_01440 CDS open 123261-123575 _na     104_aa Multidrug resistance protein SMR
2808 JAKRKV010000002.1 GCA022569275_01441 CDS open 123641-124597 _na     318_aa ldhA Putative 2-hydroxyacid dehydrogenase SH0752
2809 JAKRKV010000002.1 GCA022569275_01442 CDS open 125072-125176 _na     34_aa hypothetical protein
2810 JAKRKV010000002.1 GCA022569275_01443 CDS open 125265-126038 _na     257_aa Autolysin
2811 JAKRKV010000002.1 GCA022569275_01444 CDS open 126474-126944 _na     156_aa DUF1641 domain-containing protein
2812 JAKRKV010000002.1 GCA022569275_01445 CDS open 126944-129898 _na     984_aa fdhF formate dehydrogenase subunit alpha
2813 JAKRKV010000002.1 GCA022569275_01446 CDS open 130198-131148 _na     316_aa lytR LytR family transcriptional regulator
2814 JAKRKV010000002.1 GCA022569275_01447 CDS open 131267-132043 _na     258_aa Inositol monophosphatase
2815 JAKRKV010000002.1 GCA022569275_01449 CDS open 132434-133123 _na     229_aa DNA-binding transcriptional regulator
2816 JAKRKV010000002.1 GCA022569275_01450 CDS open 133292-134341 _na     349_aa Cell surface protein
2817 JAKRKV010000002.1 GCA022569275_01451 CDS open 134338-135225 _na     295_aa murQ N-acetylmuramic acid 6-phosphate etherase
2818 JAKRKV010000002.1 GCA022569275_01452 CDS open 135239-136627 _na     462_aa PTS system MurNAc-GlcNAc-specific EIIBC component
2819 JAKRKV010000002.1 GCA022569275_01453 CDS open 136631-137503 _na     290_aa rpiR RpiR family transcriptional regulator
2820 JAKRKV010000002.1 GCA022569275_01454 CDS open 137644-139023 _na     459_aa Gamma-aminobutyrate permease
2821 JAKRKV010000002.1 GCA022569275_01455 CDS open 139298-139654 _na     118_aa hypothetical protein
2822 JAKRKV010000002.1 GCA022569275_01456 CDS open 139651-139839 _na     62_aa Mid2-like cell wall stress sensor domain protein
2823 JAKRKV010000002.1 GCA022569275_01457 CDS open 140188-140835 _na     215_aa HAD family hydrolase
2824 JAKRKV010000002.1 GCA022569275_01458 CDS open 141216-141746 _na     176_aa Homing endonuclease LAGLIDADG domain-containing protein
2825 JAKRKV010000002.1 GCA022569275_01459 CDS open 141948-143543 _na     531_aa PTS alpha-glucoside transporter subunit IIBC
2826 JAKRKV010000002.1 GCA022569275_01460 CDS open 143751-144512 _na     253_aa rpiR RpiR family transcriptional regulator
2827 JAKRKV010000002.1 GCA022569275_01461 CDS open 144550-145059 _na     169_aa Activator of Hsp90 ATPase-like ue 1/2-like C-terminal domain-containing protein
2828 JAKRKV010000002.1 GCA022569275_01462 CDS open 145185-146480 _na     431_aa Sodium:proton antiporter
2829 JAKRKV010000002.1 GCA022569275_01463 CDS open 146766-147350 _na     194_aa ABC transporter permease
2830 JAKRKV010000002.1 GCA022569275_01464 CDS open 147532-148413 _na     293_aa NAD(P)-dependent oxidoreductase
2831 JAKRKV010000002.1 GCA022569275_01465 CDS open 148493-149623 _na     376_aa Amidohydrolase
2832 JAKRKV010000002.1 GCA022569275_01466 CDS open 150105-151307 _na     400_aa Lysostaphin resistance protein A
2833 JAKRKV010000002.1 GCA022569275_01467 CDS open 151351-152037 _na     228_aa ribose 5-phosphate isomerase A
2834 JAKRKV010000002.1 GCA022569275_01468 CDS open 152193-152846 _na     217_aa Molybdenum cofactor biosysynthesis protein
2835 JAKRKV010000002.1 GCA022569275_01469 CDS open 152922-153932 _na     336_aa Aldose 1-epimerase
2836 JAKRKV010000002.1 GCA022569275_01470 CDS open 154487-154702 _na     71_aa Transcriptional regulator
2837 JAKRKV010000002.1 GCA022569275_01471 CDS open 154940-155548 _na     202_aa Putative 3-methyladenine DNA glycosylase
2838 JAKRKV010000002.1 GCA022569275_01472 CDS open 155673-156725 _na     350_aa fni type 2 isopentenyl-diphosphate Delta-isomerase
2839 JAKRKV010000002.1 GCA022569275_01473 CDS open 156771-157718 _na     315_aa corA magnesium/cobalt transporter CorA
2840 JAKRKV010000002.1 GCA022569275_01474 CDS open 157837-158304 _na     155_aa 3-hydroxyacyl-CoA dehydrogenase
2841 JAKRKV010000002.1 GCA022569275_01475 CDS open 158310-158699 _na     129_aa hypothetical protein
2842 JAKRKV010000002.1 GCA022569275_01476 CDS open 158732-159625 _na     297_aa Esterase
2843 JAKRKV010000002.1 GCA022569275_01477 CDS open 159849-160556 _na     235_aa hypothetical protein
2844 JAKRKV010000002.1 GCA022569275_01478 CDS open 160893-162857 _na     654_aa norB Quinolone resistance protein NorB
2845 JAKRKV010000002.1 GCA022569275_01479 CDS open 162870-163517 _na     215_aa Multidrug efflux protein
2846 JAKRKV010000002.1 GCA022569275_01480 CDS open 163650-164201 _na     183_aa tetR TetR family transcriptional regulator
2847 JAKRKV010000002.1 GCA022569275_01481 CDS open 164643-165848 _na     401_aa Bcr/CflA family efflux transporter
2848 JAKRKV010000002.1 GCA022569275_01482 CDS open 165950-167323 _na     457_aa Membrane-associated protein
2849 JAKRKV010000002.1 GCA022569275_01483 CDS open 167421-167882 _na     153_aa marR MarR family transcriptional regulator
2850 JAKRKV010000002.1 GCA022569275_01484 CDS open 168058-169011 _na     317_aa DUF218 domain-containing protein
2851 JAKRKV010000002.1 GCA022569275_01485 CDS open 169102-169770 _na     222_aa hrtA Putative hemin import ATP-binding protein HrtA
2852 JAKRKV010000002.1 GCA022569275_01486 CDS open 169767-170828 _na     353_aa hrtB Putative hemin transport system permease protein HrtB
2853 JAKRKV010000002.1 GCA022569275_01487 CDS open 170956-171630 _na     224_aa hssR Heme response regulator HssR
2854 JAKRKV010000002.1 GCA022569275_01488 CDS open 171623-172993 _na     456_aa hssS Heme sensor protein HssS
2855 JAKRKV010000002.1 GCA022569275_01489 CDS open 173281-173721 _na     146_aa LytTR family transcriptional regulator
2856 JAKRKV010000002.1 GCA022569275_01490 CDS open 173718-174176 _na     152_aa DUF3021 domain-containing protein
2857 JAKRKV010000002.1 GCA022569275_01491 CDS open 174273-175751 _na     492_aa mqo malate dehydrogenase (quinone)
2858 JAKRKV010000002.1 GCA022569275_01492 CDS open 176051-177199 _na     382_aa Glycoside hydrolase
2859 JAKRKV010000002.1 GCA022569275_01493 CDS open 177407-179008 _na     533_aa lldP L-lactate permease
2860 JAKRKV010000002.1 GCA022569275_01494 CDS open 179301-181001 _na     566_aa Teichoic acid biosynthesis protein F
2861 JAKRKV010000002.1 GCA022569275_01495 CDS open 181046-181687 _na     213_aa Lipoprotein
2862 JAKRKV010000002.1 GCA022569275_01496 CDS open 181980-182504 _na     174_aa Acetyltransferase
2863 JAKRKV010000002.1 GCA022569275_01497 CDS open 182651-182875 _na     74_aa tatA Sec-independent protein translocase protein TatA
2864 JAKRKV010000002.1 GCA022569275_01498 CDS open 182940-183572 _na     210_aa tatC twin-arginine translocase subunit TatC
2865 JAKRKV010000002.1 GCA022569275_01499 CDS open 183873-185603 _na     576_aa FTR1 family iron permease
2866 JAKRKV010000002.1 GCA022569275_01500 CDS open 185584-186813 _na     409_aa efeB iron uptake transporter deferrochelatase/peroxidase subunit
2867 JAKRKV010000002.1 GCA022569275_01501 CDS open 186810-187664 _na     284_aa efeO iron uptake system protein EfeO
2868 JAKRKV010000002.1 GCA022569275_01502 CDS open 188007-188999 _na     330_aa Quinone oxidoreductase
2869 JAKRKV010000002.1 GCA022569275_01503 CDS open 189345-189539 _na     64_aa Doubtful CDS
2870 JAKRKV010000002.1 GCA022569275_01504 CDS open 189906-190307 _na     133_aa GNAT family acetyltransferase
2871 JAKRKV010000002.1 GCA022569275_01505 CDS open 190327-191358 _na     343_aa Ferredoxin--NADP reductase
2872 JAKRKV010000002.1 GCA022569275_01506 CDS open 191671-192021 _na     116_aa NINE protein
2873 JAKRKV010000002.1 GCA022569275_01507 CDS open 192208-193041 _na     277_aa CAAX protease
2874 JAKRKV010000002.1 GCA022569275_01508 CDS open 193079-193417 _na     112_aa Transcriptional regulator
2875 JAKRKV010000002.1 GCA022569275_01509 CDS open 193729-193824 _na     31_aa hypothetical protein
2876 JAKRKV010000002.1 GCA022569275_01510 CDS open 193934-194845 _na     303_aa hypothetical protein
2877 JAKRKV010000002.1 GCA022569275_01511 CDS open 195143-197929 _na     928_aa type I restriction endonuclease subunit R
2878 JAKRKV010000002.1 GCA022569275_01512 CDS open 198028-199584 _na     518_aa type I restriction-modification system subunit M
2879 JAKRKV010000002.1 GCA022569275_01513 CDS open 199577-200752 _na     391_aa restriction endonuclease subunit S
2880 JAKRKV010000002.1 GCA022569275_01514 CDS open 201506-202318 _na     270_aa CPBP family intramembrane glutamic endopeptidase
2881 JAKRKV010000002.1 GCA022569275_01515 CDS open 202619-203404 _na     261_aa hypothetical protein
2882 JAKRKV010000002.1 GCA022569275_01516 CDS open 204229-204840 _na     203_aa helix-turn-helix domain-containing protein
2883 JAKRKV010000002.1 GCA022569275_01517 CDS open 205267-205797 _na     176_aa GCN5 family acetyltransferase
2884 JAKRKV010000002.1 GCA022569275_01518 CDS open 205873-206691 _na     272_aa lysR LysR family transcriptional regulator
2885 JAKRKV010000002.1 GCA022569275_01519 CDS open 206834-207979 _na     381_aa MFS transporter
2886 JAKRKV010000002.1 GCA022569275_01520 CDS open 208255-208821 _na     188_aa DUF443 domain-containing protein
2887 JAKRKV010000002.1 GCA022569275_01521 CDS open 209800-210012 _na     70_aa hypothetical protein
2888 JAKRKV010000002.1 GCA022569275_01522 CDS open 210030-210407 _na     125_aa hypothetical protein
2889 JAKRKV010000002.1 GCA022569275_01523 CDS open 210608-212221 _na     537_aa abc-f ribosomal protection-like ABC-F family protein
2890 JAKRKV010000002.1 GCA022569275_01524 CDS open 212549-213181 _na     210_aa Stage II sporulation protein M
2891 JAKRKV010000002.1 GCA022569275_01525 CDS open 213647-214291 _na     214_aa DUF443 domain-containing protein
2892 JAKRKV010000002.1 GCA022569275_01526 CDS open 214522-215427 _na     301_aa rarD EamA family transporter RarD
2893 JAKRKV010000002.1 GCA022569275_01528 CDS open 215982-217718 _na     578_aa thiC phosphomethylpyrimidine synthase ThiC
2894 JAKRKV010000002.1 GCA022569275_01529 CDS open 218436-220211 _na     591_aa oleate hydratase
2895 JAKRKV010000002.1 GCA022569275_01530 CDS open 220415-221002 _na     195_aa tetR TetR family transcriptional regulator
2896 JAKRKV010000002.1 GCA022569275_01531 CDS open 221222-222118 _na     298_aa yut urea transporter
2897 JAKRKV010000002.1 GCA022569275_01532 CDS open 222327-222629 _na     100_aa ureA urease subunit gamma
2898 JAKRKV010000002.1 GCA022569275_01533 CDS open 222642-223049 _na     135_aa urease subunit beta
2899 JAKRKV010000002.1 GCA022569275_01534 CDS open 223049-224764 _na     571_aa ureC urease subunit alpha
2900 JAKRKV010000002.1 GCA022569275_01536 CDS open 224777-225229 _na     150_aa ureE urease accessory protein UreE
2901 JAKRKV010000002.1 GCA022569275_01537 CDS open 225222-225911 _na     229_aa ureF Urease accessory protein UreF
2902 JAKRKV010000002.1 GCA022569275_01538 CDS open 225925-226539 _na     204_aa ureG urease accessory protein UreG
2903 JAKRKV010000002.1 GCA022569275_01539 CDS open 226539-227396 _na     285_aa ureD Urease accessory protein UreD
2904 JAKRKV010000002.1 GCA022569275_01540 CDS open 227716-229278 _na     520_aa Nickel ABC transporter substrate-binding protein
2905 JAKRKV010000002.1 GCA022569275_01541 CDS open 229271-230230 _na     319_aa Peptide ABC transporter permease
2906 JAKRKV010000002.1 GCA022569275_01542 CDS open 230220-230987 _na     255_aa ABC transmembrane type-1 domain-containing protein
2907 JAKRKV010000002.1 GCA022569275_01543 CDS open 230954-231727 _na     257_aa ABC transporter ATP-binding protein
2908 JAKRKV010000002.1 GCA022569275_01544 CDS open 231714-232346 _na     210_aa NAD+ synthetase
2909 JAKRKV010000002.1 GCA022569275_01545 CDS open 232618-233064 _na     148_aa DUF2871 domain-containing protein
2910 JAKRKV010000002.1 GCA022569275_01546 CDS open 233246-234604 _na     452_aa mepA Multidrug export protein MepA
2911 JAKRKV010000002.1 GCA022569275_01547 CDS open 234705-235133 _na     142_aa marR MarR family transcriptional regulator
2912 JAKRKV010000002.1 GCA022569275_01548 CDS open 235466-236743 _na     425_aa Phage infection protein
2913 JAKRKV010000002.1 GCA022569275_01549 CDS open 236900-237514 _na     204_aa tetR TetR family transcriptional regulator
2914 JAKRKV010000002.1 GCA022569275_01550 CDS open 237583-238524 _na     313_aa corA Magnesium transporter CorA
2915 JAKRKV010000002.1 GCA022569275_01551 CDS open 238679-240121 _na     480_aa protein-N(pi)-phosphohistidine--sucrose phosphotransferase
2916 JAKRKV010000002.1 GCA022569275_01552 CDS open 240278-240661 _na     127_aa Type II DNA modification enzyme
2917 JAKRKV010000002.1 GCA022569275_01553 CDS open 241401-243506 _na     701_aa rsp AraC family transcriptional regulator Rsp
2918 JAKRKV010000002.1 GCA022569275_01554 CDS open 243569-243997 _na     142_aa General stress protein
2919 JAKRKV010000002.1 GCA022569275_01555 CDS open 244201-244545 _na     114_aa DUF4889 domain-containing protein
2920 JAKRKV010000002.1 GCA022569275_01557 CDS open 245340-246617 _na     425_aa Glutamate:protein symporter
2921 JAKRKV010000002.1 GCA022569275_01558 CDS open 246782-247141 _na     119_aa DUF3139 domain-containing protein
2922 JAKRKV010000002.1 GCA022569275_01559 CDS open 247391-247819 _na     142_aa sarZ HTH-type transcriptional regulator SarZ
2923 JAKRKV010000002.1 GCA022569275_01560 CDS open 248043-249197 _na     384_aa narT Nitrate transporter NarT
2924 JAKRKV010000002.1 GCA022569275_01561 CDS open 249553-250206 _na     217_aa nreC nitrate respiration regulation response regulator NreC
2925 JAKRKV010000002.1 GCA022569275_01562 CDS open 250227-251270 _na     347_aa nreB nitrate respiration regulation sensor histidine kinase NreB
2926 JAKRKV010000002.1 GCA022569275_01563 CDS open 251274-251723 _na     149_aa nreA nitrate respiration regulation accessory nitrate sensor NreA
2927 JAKRKV010000002.1 GCA022569275_01564 CDS open 251746-252420 _na     224_aa narI respiratory nitrate reductase subunit gamma
2928 JAKRKV010000002.1 GCA022569275_01565 CDS open 252413-252988 _na     191_aa narJ nitrate reductase molybdenum cofactor assembly chaperone
2929 JAKRKV010000002.1 GCA022569275_01566 CDS open 252981-254534 _na     517_aa narH nitrate reductase subunit beta
2930 JAKRKV010000002.1 GCA022569275_01567 CDS open 254524-258207 _na     1227_aa nitrate reductase subunit alpha
2931 JAKRKV010000002.1 GCA022569275_01568 CDS open 258462-259394 _na     310_aa uroporphyrinogen-III C-methyltransferase
2932 JAKRKV010000002.1 GCA022569275_01569 CDS open 259385-259699 _na     104_aa Nitrite reductase
2933 JAKRKV010000002.1 GCA022569275_01570 CDS open 259703-262108 _na     801_aa Nitrite reductase large subunit
2934 JAKRKV010000002.1 GCA022569275_01571 CDS open 262340-263059 _na     239_aa Sirohydrochlorin cobaltochelatase
2935 JAKRKV010000002.1 GCA022569275_01572 CDS open 263245-264063 _na     272_aa Formate/nitrite transporter
2936 JAKRKV010000002.1 GCA022569275_01573 CDS open 264376-265380 _na     334_aa DUF218 domain-containing protein
2937 JAKRKV010000002.1 GCA022569275_01574 CDS open 265515-266204 _na     229_aa Lantibiotic ABC transporter ATP-binding protein
2938 JAKRKV010000002.1 GCA022569275_01575 CDS open 266208-266969 _na     253_aa Lantibiotic ABC transporter permease
2939 JAKRKV010000002.1 GCA022569275_01576 CDS open 266966-267658 _na     230_aa bsaG BsaG protein
2940 JAKRKV010000002.1 GCA022569275_01577 CDS open 267635-267763 _na     42_aa hypothetical protein
2941 JAKRKV010000002.1 GCA022569275_01578 CDS open 267818-267997 _na     59_aa hypothetical protein
2942 JAKRKV010000002.1 GCA022569275_01579 CDS open 268059-268538 _na     159_aa Glutathione S-transferase
2943 JAKRKV010000002.1 GCA022569275_01580 CDS open 268592-269200 _na     202_aa Protein-disulfide isomerase
2944 JAKRKV010000002.1 GCA022569275_01581 CDS open 269222-269581 _na     119_aa DUF4467 domain-containing protein
2945 JAKRKV010000002.1 GCA022569275_01582 CDS open 269834-271081 _na     415_aa femA Aminoacyltransferase FemA
2946 JAKRKV010000002.1 GCA022569275_01583 CDS open 271503-272234 _na     243_aa Amino acid ABC transporter ATP-binding protein
2947 JAKRKV010000002.1 GCA022569275_01584 CDS open 272231-272959 _na     242_aa hisM Amino acid ABC transproter%2C permease protein%2C putative
2948 JAKRKV010000002.1 GCA022569275_01585 CDS open 272931-273710 _na     259_aa Amino acid ABC transporter substrate-binding protein
2949 JAKRKV010000002.1 GCA022569275_01586 CDS open 273831-274685 _na     284_aa Drug:proton antiporter
2950 JAKRKV010000002.1 GCA022569275_01587 CDS open 274713-275252 _na     179_aa Putative transport system protein
2951 JAKRKV010000002.1 GCA022569275_01588 CDS open 275420-275521 _na     33_aa Metal homeostasis protein
2952 JAKRKV010000002.1 GCA022569275_01589 CDS open 275702-276388 _na     228_aa 2%2C3-diphosphoglycerate-dependent phosphoglycerate mutase
2953 JAKRKV010000002.1 GCA022569275_01590 CDS open 276701-277126 _na     141_aa Transglycosylase
2954 JAKRKV010000002.1 GCA022569275_01591 CDS open 277362-278228 _na     288_aa Transporter
2955 JAKRKV010000002.1 GCA022569275_01592 CDS open 278388-278774 _na     128_aa Polysaccharide biosynthesis protein
2956 JAKRKV010000002.1 GCA022569275_01593 CDS open 278929-280104 _na     391_aa Glycerate kinase
2957 JAKRKV010000002.1 GCA022569275_01594 CDS open 280142-280855 _na     237_aa hypothetical protein
2958 JAKRKV010000002.1 GCA022569275_01595 CDS open 281066-282265 _na     399_aa Bcr/CflA family efflux transporter
2959 JAKRKV010000002.1 GCA022569275_01596 CDS open 282466-282939 _na     157_aa Transcriptional regulator
2960 JAKRKV010000002.1 GCA022569275_01597 CDS open 283102-283749 _na     215_aa Peptidase C39-like domain-containing protein
2961 JAKRKV010000002.1 GCA022569275_01598 CDS open 283917-284279 _na     120_aa Phosphohydrolase
2962 JAKRKV010000002.1 GCA022569275_01599 CDS open 284287-284733 _na     148_aa Phosphohydrolase
2963 JAKRKV010000002.1 GCA022569275_01600 CDS open 284986-286344 _na     452_aa Gamma-aminobutyrate permease
2964 JAKRKV010000002.1 GCA022569275_01601 CDS open 286474-288537 _na     687_aa Sodium:proton antiporter
2965 JAKRKV010000002.1 GCA022569275_01602 CDS open 288597-289541 _na     314_aa Lipoprotein
2966 JAKRKV010000002.1 GCA022569275_01603 CDS open 289930-291756 _na     608_aa Amino acid permease
2967 JAKRKV010000002.1 GCA022569275_01604 CDS open 292080-293549 _na     489_aa Serine hydrolase FLP
2968 JAKRKV010000002.1 GCA022569275_01605 CDS open 293661-294482 _na     273_aa Membrane insertase YidC/Oxa/ALB C-terminal domain-containing protein
2969 JAKRKV010000002.1 GCA022569275_01606 CDS open 294546-295397 _na     283_aa Epimerase
2970 JAKRKV010000002.1 GCA022569275_01607 CDS open 295601-295867 _na     88_aa GNAT family acetyltransferase
2971 JAKRKV010000002.1 GCA022569275_01608 CDS open 296049-296981 _na     310_aa 2-dehydropantoate 2-reductase
2972 JAKRKV010000002.1 GCA022569275_01609 CDS open 297164-298558 _na     464_aa norB Quinolone resistance protein NorB
2973 JAKRKV010000002.1 GCA022569275_01610 CDS open 298866-300620 _na     584_aa histidine kinase
2974 JAKRKV010000002.1 GCA022569275_01611 CDS open 300621-301382 _na     253_aa lytR response regulator transcription factor LytR
2975 JAKRKV010000002.1 GCA022569275_01612 CDS open 301893-302354 _na     153_aa lrgA antiholin-like murein hydrolase modulator LrgA
2976 JAKRKV010000002.1 GCA022569275_01613 CDS open 302354-303055 _na     233_aa lrgB antiholin-like protein LrgB
2977 JAKRKV010000002.1 GCA022569275_01614 CDS open 303327-303968 _na     213_aa DUF443 domain-containing protein
2978 JAKRKV010000002.1 GCA022569275_01615 CDS open 304102-304413 _na     103_aa Type II secretion protein
2979 JAKRKV010000002.1 GCA022569275_01616 CDS open 304410-305045 _na     211_aa DUF443 domain-containing protein
2980 JAKRKV010000002.1 GCA022569275_01617 CDS open 305116-305742 _na     208_aa DUF443 domain-containing protein
2981 JAKRKV010000002.1 GCA022569275_01618 CDS open 305745-307202 _na     485_aa T7SS effector LXG polymorphic toxin
2982 JAKRKV010000002.1 GCA022569275_01619 CDS open 307192-307557 _na     121_aa DUF3958 domain-containing protein
2983 JAKRKV010000002.1 GCA022569275_01620 CDS open 307573-307845 _na     90_aa TIGR04197 family type VII secretion effector
2984 JAKRKV010000002.1 GCA022569275_01621 CDS open 308155-308835 _na     226_aa Amino acid ABC transporter permease
2985 JAKRKV010000002.1 GCA022569275_01622 CDS open 308835-309776 _na     313_aa Glycine/betaine ABC transporter substrate-binding protein
2986 JAKRKV010000002.1 GCA022569275_01623 CDS open 309799-310434 _na     211_aa Choline ABC transporter permease
2987 JAKRKV010000002.1 GCA022569275_01624 CDS open 310434-311684 _na     416_aa Quaternary amine transport ATP-binding protein
2988 JAKRKV010000002.1 GCA022569275_01625 CDS open 312071-313123 _na     350_aa tdh Zinc dependent dehydrogenase
2989 JAKRKV010000002.1 GCA022569275_01626 CDS open 313284-313880 _na     198_aa YdhG-like domain-containing protein
2990 JAKRKV010000002.1 GCA022569275_01627 CDS open 314001-315350 _na     449_aa Carboxylic ester hydrolase
2991 JAKRKV010000002.1 GCA022569275_01628 CDS open 315507-316682 _na     391_aa Chloramphenicol resistance protein
2992 JAKRKV010000002.1 GCA022569275_01629 CDS open 317193-317870 _na     225_aa arlR Response regulator ArlR
2993 JAKRKV010000002.1 GCA022569275_01630 CDS open 317863-319326 _na     487_aa histidine kinase
2994 JAKRKV010000002.1 GCA022569275_01631 CDS open 319817-320593 _na     258_aa fetB Iron export ABC transporter permease subunit FetB
2995 JAKRKV010000002.1 GCA022569275_01632 CDS open 320586-321248 _na     220_aa Methionine ABC transporter ATP-binding protein
2996 JAKRKV010000002.1 GCA022569275_01633 CDS open 321375-322154 _na     259_aa Abortive phage infection protein
2997 JAKRKV010000002.1 GCA022569275_01634 CDS open 322177-322941 _na     254_aa Abortive infection protein
2998 JAKRKV010000002.1 GCA022569275_01635 CDS open 323257-324834 _na     525_aa Glutamate synthase domain-containing protein
2999 JAKRKV010000002.1 GCA022569275_01636 CDS open 325086-326624 _na     512_aa Bifunctional metallophosphatase/5'-nucleotidase
3000 JAKRKV010000002.1 GCA022569275_01637 CDS open 326641-328164 _na     507_aa DNA-binding protein