BAKTAGenome Explorer: Staphylococcus lugdunensis (GCA_022689385.1)
Select a Genome:
|
BAKTA Annotations for GCA_022689385.1
|
Search & Sort all 5196 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1001 | JALCXO010000002.1 | GCA022689385_01417 | CDS | open | 20829-21143 | _na 104_aa | trxA | thioredoxin |
| 1002 | JALCXO010000002.1 | GCA022689385_01418 | CDS | open | 21306-23657 | _na 783_aa | mutS2 | endonuclease MutS2 |
| 1003 | JALCXO010000002.1 | GCA022689385_01419 | CDS | open | 23667-25379 | _na 570_aa | polX | DNA polymerase/3'-5' exonuclease PolX |
| 1004 | JALCXO010000002.1 | GCA022689385_01420 | CDS | open | 25435-25956 | _na 173_aa | cvpA | Colicin V production protein CvpA |
| 1005 | JALCXO010000002.1 | GCA022689385_01421 | CDS | open | 25958-26218 | _na 86_aa | zapA | Cell division protein ZapA |
| 1006 | JALCXO010000002.1 | GCA022689385_01422 | CDS | open | 26449-27381 | _na 310_aa | rnhC | ribonuclease HIII |
| 1007 | JALCXO010000002.1 | GCA022689385_01423 | CDS | open | 27869-30271 | _na 800_aa | pheT | phenylalanine--tRNA ligase subunit beta |
| 1008 | JALCXO010000002.1 | GCA022689385_01424 | CDS | open | 30271-31329 | _na 352_aa | pheS | phenylalanine--tRNA ligase subunit alpha |
| 1009 | JALCXO010000002.1 | GCA022689385_01425 | CDS | open | 31721-32461 | _na 246_aa | RNA methyltransferase | |
| 1010 | JALCXO010000002.1 | GCA022689385_01426 | CDS | open | 32716-32889 | _na 57_aa | rpmF | 50S ribosomal protein L32 |
| 1011 | JALCXO010000002.1 | GCA022689385_01427 | CDS | open | 32975-33526 | _na 183_aa | DNA-binding protein | |
| 1012 | JALCXO010000002.1 | GCA022689385_01428 | CDS | open | 33653-34786 | _na 377_aa | nucleotidyltransferase | |
| 1013 | JALCXO010000002.1 | GCA022689385_01429 | CDS | open | 34857-35339 | _na 160_aa | coaD | pantetheine-phosphate adenylyltransferase |
| 1014 | JALCXO010000002.1 | GCA022689385_01430 | CDS | open | 35332-35883 | _na 183_aa | rsmD | 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD |
| 1015 | JALCXO010000002.1 | GCA022689385_01431 | CDS | open | 35952-36341 | _na 129_aa | Methylthioribose kinase | |
| 1016 | JALCXO010000002.1 | GCA022689385_01432 | CDS | open | 36358-36609 | _na 83_aa | DUF2129 domain-containing protein | |
| 1017 | JALCXO010000002.1 | GCA022689385_01433 | CDS | open | 36768-37694 | _na 308_aa | Glycerophosphodiester phosphodiesterase | |
| 1018 | JALCXO010000002.1 | GCA022689385_01434 | CDS | open | 37782-38216 | _na 144_aa | ylbF | YlbF family regulator |
| 1019 | JALCXO010000002.1 | GCA022689385_01435 | CDS | open | 38233-39273 | _na 346_aa | SCP-like extracellular protein | |
| 1020 | JALCXO010000002.1 | GCA022689385_01436 | CDS | open | 39475-39936 | _na 153_aa | DUF420 domain-containing protein | |
| 1021 | JALCXO010000002.1 | GCA022689385_01437 | CDS | open | 39962-40873 | _na 303_aa | cyoE | heme o synthase |
| 1022 | JALCXO010000002.1 | GCA022689385_01438 | CDS | open | 41090-42019 | _na 309_aa | Heme A synthase | |
| 1023 | JALCXO010000002.1 | GCA022689385_01440 | CDS | open | 42663-46109 | _na 1148_aa | pyruvate carboxylase | |
| 1024 | JALCXO010000002.1 | GCA022689385_01441 | CDS | open | 46660-47898 | _na 412_aa | ftsW | putative peptidoglycan glycosyltransferase FtsW |
| 1025 | JALCXO010000002.1 | GCA022689385_01442 | CDS | open | 48199-48477 | _na 92_aa | UPF0358 protein HMPREF2709_05460 | |
| 1026 | JALCXO010000002.1 | GCA022689385_01443 | CDS | open | 48621-49106 | _na 161_aa | Peptidyl-prolyl cis-trans isomerase | |
| 1027 | JALCXO010000002.1 | GCA022689385_01444 | CDS | open | 49108-49362 | _na 84_aa | DUF2197 domain-containing protein | |
| 1028 | JALCXO010000002.1 | GCA022689385_01445 | CDS | open | 49408-51255 | _na 615_aa | typA | translational GTPase TypA |
| 1029 | JALCXO010000002.1 | GCA022689385_01446 | CDS | open | 51354-51551 | _na 65_aa | ylaF | YlaF family protein |
| 1030 | JALCXO010000002.1 | GCA022689385_01447 | CDS | open | 51725-52540 | _na 271_aa | Inositol monophosphatase | |
| 1031 | JALCXO010000002.1 | GCA022689385_01448 | CDS | open | 52723-53334 | _na 203_aa | UPF0637 protein HMPREF2709_05430 | |
| 1032 | JALCXO010000002.1 | GCA022689385_01449 | CDS | open | 53595-54947 | _na 450_aa | Nramp family divalent metal transporter | |
| 1033 | JALCXO010000002.1 | GCA022689385_01450 | CDS | open | 55210-55665 | _na 151_aa | DUF4064 domain-containing protein | |
| 1034 | JALCXO010000002.1 | GCA022689385_01451 | CDS | open | 55797-56843 | _na 348_aa | auxB | lipoteichoic acid stability factor AuxB |
| 1035 | JALCXO010000002.1 | GCA022689385_01452 | CDS | open | 56916-57989 | _na 357_aa | Spermidine/putrescine ABC transporter substrate-binding protein | |
| 1036 | JALCXO010000002.1 | GCA022689385_01453 | CDS | open | 57986-58798 | _na 270_aa | Spermidine/putrescine ABC transporter permease | |
| 1037 | JALCXO010000002.1 | GCA022689385_01454 | CDS | open | 58804-59604 | _na 266_aa | Spermidine/putrescine ABC transporter permease | |
| 1038 | JALCXO010000002.1 | GCA022689385_01455 | CDS | open | 59594-60688 | _na 364_aa | potA | Spermidine/putrescine import ATP-binding protein PotA |
| 1039 | JALCXO010000002.1 | GCA022689385_01456 | CDS | open | 60703-61242 | _na 179_aa | Cro/Cl family transcriptional regulator | |
| 1040 | JALCXO010000002.1 | GCA022689385_01458 | CDS | open | 61628-61915 | _na 95_aa | UPF0223 protein HMPREF2709_05385 | |
| 1041 | JALCXO010000002.1 | GCA022689385_01459 | CDS | open | 62119-63525 | _na 468_aa | lpdA | dihydrolipoyl dehydrogenase |
| 1042 | JALCXO010000002.1 | GCA022689385_01460 | CDS | open | 63529-64833 | _na 434_aa | pdhC | Dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex |
| 1043 | JALCXO010000002.1 | GCA022689385_01461 | CDS | open | 65046-66023 | _na 325_aa | Pyruvate dehydrogenase E1 component subunit beta | |
| 1044 | JALCXO010000002.1 | GCA022689385_01462 | CDS | open | 66027-67139 | _na 370_aa | pdhA | pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha |
| 1045 | JALCXO010000002.1 | GCA022689385_01463 | CDS | open | 67306-67935 | _na 209_aa | Cell-wall binding lipoprotein | |
| 1046 | JALCXO010000002.1 | GCA022689385_01464 | CDS | open | 68073-68624 | _na 183_aa | def | peptide deformylase |
| 1047 | JALCXO010000002.1 | GCA022689385_01465 | CDS | open | 69059-69277 | _na 72_aa | rpoY | DNA-directed RNA polymerase subunit epsilon |
| 1048 | JALCXO010000002.1 | GCA022689385_01466 | CDS | open | 69277-70956 | _na 559_aa | rnjA | ribonuclease J1 |
| 1049 | JALCXO010000002.1 | GCA022689385_01467 | CDS | open | 71054-71254 | _na 66_aa | Transposase | |
| 1050 | JALCXO010000002.1 | GCA022689385_01469 | CDS | open | 71551-72210 | _na 219_aa | trkA | TrkA family potassium uptake protein |
| 1051 | JALCXO010000002.1 | GCA022689385_01470 | CDS | open | 72280-73296 | _na 338_aa | Cytochrome D ubiquinol oxidase subunit II | |
| 1052 | JALCXO010000002.1 | GCA022689385_01471 | CDS | open | 73296-73433 | _na 45_aa | hypothetical protein | |
| 1053 | JALCXO010000002.1 | GCA022689385_01472 | CDS | open | 73607-73840 | _na 77_aa | NrdH-redoxin | |
| 1054 | JALCXO010000002.1 | GCA022689385_01473 | CDS | open | 73936-75651 | _na 571_aa | ptsA | Phosphoenolpyruvate-protein phosphotransferase |
| 1055 | JALCXO010000002.1 | GCA022689385_01474 | CDS | open | 75654-75920 | _na 88_aa | ptsH | phosphocarrier protein HPr |
| 1056 | JALCXO010000002.1 | GCA022689385_01475 | CDS | open | 76072-76614 | _na 180_aa | DUF697 domain-containing protein | |
| 1057 | JALCXO010000002.1 | GCA022689385_01476 | CDS | open | 76669-77841 | _na 390_aa | Class I SAM-dependent rRNA methyltransferase | |
| 1058 | JALCXO010000002.1 | GCA022689385_01477 | CDS | open | 78544-79836 | _na 430_aa | auxA | lipoteichoic acid stability factor AuxA |
| 1059 | JALCXO010000002.1 | GCA022689385_01479 | CDS | open | 79982-80116 | _na 44_aa | graF | glycopeptide resistance-associated protein GraF |
| 1060 | JALCXO010000002.1 | GCA022689385_01480 | CDS | open | 80549-81124 | _na 191_aa | Thiamine ABC transporter permease | |
| 1061 | JALCXO010000002.1 | GCA022689385_01481 | CDS | open | 81137-82540 | _na 467_aa | ccmA | heme ABC exporter ATP-binding protein CcmA |
| 1062 | JALCXO010000002.1 | GCA022689385_01482 | CDS | open | 82533-83342 | _na 269_aa | Cobalt ABC transporter permease | |
| 1063 | JALCXO010000002.1 | GCA022689385_01483 | CDS | open | 83656-84903 | _na 415_aa | Phosphoribosylamine--glycine ligase | |
| 1064 | JALCXO010000002.1 | GCA022689385_01484 | CDS | open | 84926-86404 | _na 492_aa | purH | bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase |
| 1065 | JALCXO010000002.1 | GCA022689385_01485 | CDS | open | 86420-86986 | _na 188_aa | purN | phosphoribosylglycinamide formyltransferase |
| 1066 | JALCXO010000002.1 | GCA022689385_01486 | CDS | open | 86986-88017 | _na 343_aa | Phosphoribosylformylglycinamidine cyclo-ligase | |
| 1067 | JALCXO010000002.1 | GCA022689385_01487 | CDS | open | 88010-89494 | _na 494_aa | purF | amidophosphoribosyltransferase |
| 1068 | JALCXO010000002.1 | GCA022689385_01488 | CDS | open | 89473-91662 | _na 729_aa | purL | phosphoribosylformylglycinamidine synthase subunit PurL |
| 1069 | JALCXO010000002.1 | GCA022689385_01489 | CDS | open | 91655-92326 | _na 223_aa | purQ | phosphoribosylformylglycinamidine synthase I |
| 1070 | JALCXO010000002.1 | GCA022689385_01490 | CDS | open | 92328-92588 | _na 86_aa | purS | phosphoribosylformylglycinamidine synthase subunit PurS |
| 1071 | JALCXO010000002.1 | GCA022689385_01491 | CDS | open | 92588-93292 | _na 234_aa | purC | phosphoribosylaminoimidazolesuccinocarboxamide synthase |
| 1072 | JALCXO010000002.1 | GCA022689385_01492 | CDS | open | 93293-94420 | _na 375_aa | purK | 5-(carboxyamino)imidazole ribonucleotide synthase |
| 1073 | JALCXO010000002.1 | GCA022689385_01493 | CDS | open | 94407-94889 | _na 160_aa | N5-carboxyaminoimidazole ribonucleotide mutase | |
| 1074 | JALCXO010000002.1 | GCA022689385_01494 | CDS | open | 95100-95957 | _na 285_aa | folD | bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD |
| 1075 | JALCXO010000002.1 | GCA022689385_01495 | CDS | open | 96243-97388 | _na 381_aa | nitric oxide dioxygenase | |
| 1076 | JALCXO010000002.1 | GCA022689385_01496 | CDS | open | 97647-97964 | _na 105_aa | Pesticidal crystal protein Cry22Aa Ig-like domain-containing protein | |
| 1077 | JALCXO010000002.1 | GCA022689385_01497 | CDS | open | 98266-99378 | _na 370_aa | qoxA | cytochrome aa3 quinol oxidase subunit II |
| 1078 | JALCXO010000002.1 | GCA022689385_01498 | CDS | open | 99378-101366 | _na 662_aa | qoxB | cytochrome aa3 quinol oxidase subunit I |
| 1079 | JALCXO010000002.1 | GCA022689385_01499 | CDS | open | 101356-101961 | _na 201_aa | qoxC | cytochrome aa3 quinol oxidase subunit III |
| 1080 | JALCXO010000002.1 | GCA022689385_01500 | CDS | open | 101958-102248 | _na 96_aa | qoxD | cytochrome aa3 quinol oxidase subunit IV |
| 1081 | JALCXO010000002.1 | GCA022689385_01501 | CDS | open | 102377-103285 | _na 302_aa | rihC | ribonucleoside hydrolase RihC |
| 1082 | JALCXO010000002.1 | GCA022689385_01502 | CDS | open | 103640-104854 | _na 404_aa | fmtA | Methicillin resistance protein FmtA |
| 1083 | JALCXO010000002.1 | GCA022689385_01503 | CDS | open | 105202-106404 | _na 400_aa | Cell envelope-related transcriptional attenuator domain-containing protein | |
| 1084 | JALCXO010000002.1 | GCA022689385_01504 | CDS | open | 106425-106895 | _na 156_aa | lytR | LytR family transcriptional regulator |
| 1085 | JALCXO010000002.1 | GCA022689385_01505 | CDS | open | 107336-107764 | _na 142_aa | GCN5-related N-acetyltransferase | |
| 1086 | JALCXO010000002.1 | GCA022689385_01506 | CDS | open | 107990-111802 | _na 1270_aa | Bifunctional autolysin | |
| 1087 | JALCXO010000002.1 | GCA022689385_01507 | CDS | open | 111941-112360 | _na 139_aa | marR | MarR family transcriptional regulator |
| 1088 | JALCXO010000002.1 | GCA022689385_01508 | CDS | open | 112517-113524 | _na 335_aa | Acyltransferase | |
| 1089 | JALCXO010000002.1 | GCA022689385_01509 | CDS | open | 113647-114810 | _na 387_aa | Aminotransferase | |
| 1090 | JALCXO010000002.1 | GCA022689385_01510 | CDS | open | 114930-115748 | _na 272_aa | menB | 1%2C4-dihydroxy-2-naphthoyl-CoA synthase |
| 1091 | JALCXO010000002.1 | GCA022689385_01511 | CDS | open | 115741-116544 | _na 267_aa | menH | 2-succinyl-6-hydroxy-2%2C4-cyclohexadiene-1-carboxylate synthase |
| 1092 | JALCXO010000002.1 | GCA022689385_01512 | CDS | open | 116531-118201 | _na 556_aa | menD | 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase |
| 1093 | JALCXO010000002.1 | GCA022689385_01513 | CDS | open | 118191-119552 | _na 453_aa | isochorismate synthase | |
| 1094 | JALCXO010000002.1 | GCA022689385_01514 | CDS | open | 119730-120668 | _na 312_aa | 1%2C4-dihydroxy-2-naphthoate polyprenyltransferase | |
| 1095 | JALCXO010000002.1 | GCA022689385_01515 | CDS | open | 120903-121007 | _na 34_aa | hypothetical protein | |
| 1096 | JALCXO010000002.1 | GCA022689385_01516 | CDS | open | 121145-121330 | _na 61_aa | Lipoprotein | |
| 1097 | JALCXO010000002.1 | GCA022689385_01517 | CDS | open | 121726-122127 | _na 133_aa | DUF1433 domain-containing protein | |
| 1098 | JALCXO010000002.1 | GCA022689385_01518 | CDS | open | 122154-122645 | _na 163_aa | hypothetical protein | |
| 1099 | JALCXO010000002.1 | GCA022689385_01519 | CDS | open | 122648-122839 | _na 63_aa | Mid2-like cell wall stress sensor domain protein | |
| 1100 | JALCXO010000002.1 | GCA022689385_01520 | CDS | open | 123362-123556 | _na 64_aa | LSM domain protein | |
| 1101 | JALCXO010000002.1 | GCA022689385_01521 | CDS | open | 123558-124097 | _na 179_aa | Bacterial toxin 50 | |
| 1102 | JALCXO010000002.1 | GCA022689385_01524 | CDS | open | 124664-125233 | _na 189_aa | comK | Competence protein ComK |
| 1103 | JALCXO010000002.1 | GCA022689385_01525 | CDS | open | 125452-125670 | _na 72_aa | IDEAL domain protein | |
| 1104 | JALCXO010000002.1 | GCA022689385_01526 | CDS | open | 125746-126732 | _na 328_aa | lipoate--protein ligase | |
| 1105 | JALCXO010000002.1 | GCA022689385_01527 | CDS | open | 126932-127117 | _na 61_aa | ykvS | DUF2187 domain-containing protein |
| 1106 | JALCXO010000002.1 | GCA022689385_01528 | CDS | open | 127124-127726 | _na 200_aa | CAAX protease | |
| 1107 | JALCXO010000002.1 | GCA022689385_01529 | CDS | open | 127829-129343 | _na 504_aa | Bifunctional metallophosphatase/5'-nucleotidase | |
| 1108 | JALCXO010000002.1 | GCA022689385_01530 | CDS | open | 129572-130930 | _na 452_aa | ATP synthase | |
| 1109 | JALCXO010000002.1 | GCA022689385_01531 | CDS | open | 130947-132923 | _na 658_aa | Serine protease HtrA-like | |
| 1110 | JALCXO010000002.1 | GCA022689385_01532 | CDS | open | 133123-133920 | _na 265_aa | Toxic anion resistance protein | |
| 1111 | JALCXO010000002.1 | GCA022689385_01533 | CDS | open | 134228-135790 | _na 520_aa | prfC | peptide chain release factor 3 |
| 1112 | JALCXO010000002.1 | GCA022689385_01534 | CDS | open | 135791-136045 | _na 84_aa | YueH-like family protein | |
| 1113 | JALCXO010000002.1 | GCA022689385_01535 | CDS | open | 136035-137519 | _na 494_aa | UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L-lysine ligase | |
| 1114 | JALCXO010000002.1 | GCA022689385_01536 | CDS | open | 137928-139103 | _na 391_aa | diglucosyl diacylglycerol synthase | |
| 1115 | JALCXO010000002.1 | GCA022689385_01537 | CDS | open | 139081-140274 | _na 397_aa | ltaA | lipoteichoic acid biosynthesis MFS flippase LtaA |
| 1116 | JALCXO010000002.1 | GCA022689385_01538 | CDS | open | 140334-140840 | _na 168_aa | Putative phosphoesterase HMPREF2709_00785 | |
| 1117 | JALCXO010000002.1 | GCA022689385_01539 | CDS | open | 141178-141597 | _na 139_aa | merR | MerR family transcriptional regulator |
| 1118 | JALCXO010000002.1 | GCA022689385_01540 | CDS | open | 141601-142338 | _na 245_aa | Oxidoreductase%2C short chain dehydrogenase/reductase family protein | |
| 1119 | JALCXO010000002.1 | GCA022689385_01541 | CDS | open | 142650-143390 | _na 246_aa | Esterase | |
| 1120 | JALCXO010000002.1 | GCA022689385_01542 | CDS | open | 143611-144696 | _na 361_aa | AI-2E family transporter | |
| 1121 | JALCXO010000002.1 | GCA022689385_01543 | CDS | open | 145015-145785 | _na 256_aa | fabI | enoyl-ACP reductase FabI |
| 1122 | JALCXO010000002.1 | GCA022689385_01544 | CDS | open | 146073-147917 | _na 614_aa | Sodium:proton antiporter | |
| 1123 | JALCXO010000002.1 | GCA022689385_01545 | CDS | open | 147928-149313 | _na 461_aa | mgtE | magnesium transporter |
| 1124 | JALCXO010000002.1 | GCA022689385_01546 | CDS | open | 149339-150193 | _na 284_aa | RNA pseudouridine synthase | |
| 1125 | JALCXO010000002.1 | GCA022689385_01547 | CDS | open | 150190-150999 | _na 269_aa | nadK | NAD kinase |
| 1126 | JALCXO010000002.1 | GCA022689385_01548 | CDS | open | 151014-151649 | _na 211_aa | GTP pyrophosphokinase | |
| 1127 | JALCXO010000002.1 | GCA022689385_01549 | CDS | open | 151666-152013 | _na 115_aa | Family of unknown function (UPF0738) | |
| 1128 | JALCXO010000002.1 | GCA022689385_01550 | CDS | open | 152207-152779 | _na 190_aa | Adenylate cyclase | |
| 1129 | JALCXO010000002.1 | GCA022689385_01551 | CDS | open | 152879-153244 | _na 121_aa | yjbI | truncated hemoglobin YjbI |
| 1130 | JALCXO010000002.1 | GCA022689385_01552 | CDS | open | 153267-154064 | _na 265_aa | yjbH | protease adaptor protein YjbH |
| 1131 | JALCXO010000002.1 | GCA022689385_01554 | CDS | open | 154711-156519 | _na 602_aa | pepF | oligoendopeptidase F |
| 1132 | JALCXO010000002.1 | GCA022689385_01555 | CDS | open | 156571-157542 | _na 323_aa | coiA | Competence protein CoiA |
| 1133 | JALCXO010000002.1 | GCA022689385_01556 | CDS | open | 157643-158374 | _na 243_aa | mecA | adaptor protein MecA |
| 1134 | JALCXO010000002.1 | GCA022689385_01557 | CDS | open | 158595-158990 | _na 131_aa | spxA | transcriptional regulator SpxA |
| 1135 | JALCXO010000002.1 | GCA022689385_01558 | CDS | open | 159278-160267 | _na 329_aa | trpS | tryptophan--tRNA ligase |
| 1136 | JALCXO010000002.1 | GCA022689385_01559 | CDS | open | 160454-161209 | _na 251_aa | SAM-dependent methyltransferase | |
| 1137 | JALCXO010000002.1 | GCA022689385_01560 | CDS | open | 161418-163070 | _na 550_aa | Peptide ABC transporter substrate-binding protein | |
| 1138 | JALCXO010000002.1 | GCA022689385_01561 | CDS | open | 163096-164037 | _na 313_aa | Peptide ABC transporter ATP-binding protein | |
| 1139 | JALCXO010000002.1 | GCA022689385_01562 | CDS | open | 164027-165109 | _na 360_aa | Peptide ABC transporter ATP-binding protein | |
| 1140 | JALCXO010000002.1 | GCA022689385_01563 | CDS | open | 165124-166188 | _na 354_aa | opp3C | oligopeptide ABC transporter permease |
| 1141 | JALCXO010000002.1 | GCA022689385_01564 | CDS | open | 166185-167114 | _na 309_aa | opp3b | oligopeptide ABC transporter permease |
| 1142 | JALCXO010000002.1 | GCA022689385_01565 | CDS | open | 167349-167723 | _na 124_aa | DUF3899 domain-containing protein | |
| 1143 | JALCXO010000002.1 | GCA022689385_01566 | CDS | open | 167774-169018 | _na 414_aa | fabF | beta-ketoacyl-ACP synthase II |
| 1144 | JALCXO010000002.1 | GCA022689385_01567 | CDS | open | 169032-169973 | _na 313_aa | Beta-ketoacyl-[acyl-carrier-protein] synthase III | |
| 1145 | JALCXO010000002.1 | GCA022689385_01568 | CDS | open | 170222-170416 | _na 64_aa | DUF2929 domain-containing protein | |
| 1146 | JALCXO010000002.1 | GCA022689385_01569 | CDS | open | 170570-173164 | _na 864_aa | clpB | ATP-dependent chaperone ClpB |
| 1147 | JALCXO010000002.1 | GCA022689385_01570 | CDS | open | 173408-173716 | _na 102_aa | sufT | Fe-S protein maturation auxiliary factor SufT |
| 1148 | JALCXO010000002.1 | GCA022689385_01571 | CDS | open | 173826-174644 | _na 272_aa | Phosphatase | |
| 1149 | JALCXO010000002.1 | GCA022689385_01572 | CDS | open | 174687-176009 | _na 440_aa | CoA-disulfide reductase | |
| 1150 | JALCXO010000002.1 | GCA022689385_01573 | CDS | open | 176196-176585 | _na 129_aa | UPF0344 protein HMPREF2709_00955 | |
| 1151 | JALCXO010000002.1 | GCA022689385_01574 | CDS | open | 177058-177960 | _na 300_aa | ycgM | putative protein SERP0556 |
| 1152 | JALCXO010000002.1 | GCA022689385_01575 | CDS | open | 178117-181767 | _na 1216_aa | addA | helicase-exonuclease AddAB subunit AddA |
| 1153 | JALCXO010000002.1 | GCA022689385_01576 | CDS | open | 181764-185231 | _na 1155_aa | addB | helicase-exonuclease AddAB subunit AddB |
| 1154 | JALCXO010000002.1 | GCA022689385_01577 | CDS | open | 185391-185960 | _na 189_aa | lepB | signal peptidase I |
| 1155 | JALCXO010000002.1 | GCA022689385_01578 | CDS | open | 186229-186495 | _na 88_aa | lepB | signal peptidase I |
| 1156 | JALCXO010000002.1 | GCA022689385_01579 | CDS | open | 186500-187075 | _na 191_aa | TVP38/TMEM64 family membrane protein | |
| 1157 | JALCXO010000002.1 | GCA022689385_01580 | CDS | open | 187235-188566 | _na 443_aa | pgi | glucose-6-phosphate isomerase |
| 1158 | JALCXO010000002.1 | GCA022689385_01581 | CDS | open | 188897-190102 | _na 401_aa | argG | argininosuccinate synthase |
| 1159 | JALCXO010000002.1 | GCA022689385_01582 | CDS | open | 190092-191474 | _na 460_aa | argH | argininosuccinate lyase |
| 1160 | JALCXO010000002.1 | GCA022689385_01583 | CDS | open | 191690-192055 | _na 121_aa | Holin | |
| 1161 | JALCXO010000002.1 | GCA022689385_01584 | CDS | open | 192352-192633 | _na 93_aa | hypothetical protein | |
| 1162 | JALCXO010000002.1 | GCA022689385_01585 | CDS | open | 192662-194284 | _na 540_aa | Poly(Glycerol-phosphate) alpha-glucosyltransferase | |
| 1163 | JALCXO010000002.1 | GCA022689385_01586 | CDS | open | 194655-195899 | _na 414_aa | gluD | NAD-specific glutamate dehydrogenase |
| 1164 | JALCXO010000002.1 | GCA022689385_01587 | CDS | open | 196439-196972 | _na 177_aa | NADH-dependent flavin oxidoreductase | |
| 1165 | JALCXO010000002.1 | GCA022689385_01588 | CDS | open | 196911-197582 | _na 223_aa | NADH-dependent flavin oxidoreductase | |
| 1166 | JALCXO010000002.1 | GCA022689385_01589 | CDS | open | 197780-198160 | _na 126_aa | ygs | S1 domain-containing post-transcriptional regulator Ygs |
| 1167 | JALCXO010000002.1 | GCA022689385_01590 | CDS | open | 198446-199039 | _na 197_aa | Peptidyl-prolyl cis-trans isomerase | |
| 1168 | JALCXO010000002.1 | GCA022689385_01591 | CDS | open | 199108-199488 | _na 126_aa | Kinase | |
| 1169 | JALCXO010000002.1 | GCA022689385_01592 | CDS | open | 199618-202035 | _na 805_aa | Na+/H+ antiporter subunit A | |
| 1170 | JALCXO010000002.1 | GCA022689385_01593 | CDS | open | 202016-202444 | _na 142_aa | Na(+)/H(+) antiporter subunit B1 | |
| 1171 | JALCXO010000002.1 | GCA022689385_01594 | CDS | open | 202444-202791 | _na 115_aa | mnhC1 | Na+/H+ antiporter Mnh1 subunit C |
| 1172 | JALCXO010000002.1 | GCA022689385_01595 | CDS | open | 202778-204274 | _na 498_aa | Na+/H+ antiporter subunit D | |
| 1173 | JALCXO010000002.1 | GCA022689385_01596 | CDS | open | 204274-204756 | _na 160_aa | Na+/H+ antiporter subunit E | |
| 1174 | JALCXO010000002.1 | GCA022689385_01597 | CDS | open | 204753-205043 | _na 96_aa | Na(+)/H(+) antiporter subunit F1 | |
| 1175 | JALCXO010000002.1 | GCA022689385_01598 | CDS | open | 205021-205377 | _na 118_aa | mnhG1 | Na+/H+ antiporter Mnh1 subunit G |
| 1176 | JALCXO010000002.1 | GCA022689385_01599 | CDS | open | 205505-206674 | _na 389_aa | Pyridine nucleotide-disulfide oxidoreductase | |
| 1177 | JALCXO010000002.1 | GCA022689385_01600 | CDS | open | 206706-207080 | _na 124_aa | Thioesterase | |
| 1178 | JALCXO010000002.1 | GCA022689385_01601 | CDS | open | 207102-208421 | _na 439_aa | Sodium:proton antiporter | |
| 1179 | JALCXO010000002.1 | GCA022689385_01602 | CDS | open | 208737-210215 | _na 492_aa | Aminopeptidase | |
| 1180 | JALCXO010000002.1 | GCA022689385_01603 | CDS | open | 210431-211639 | _na 402_aa | Type II NADH:quinone oxidoreductase | |
| 1181 | JALCXO010000002.1 | GCA022689385_01604 | CDS | open | 211923-212960 | _na 345_aa | Saccharopine dehydrogenase | |
| 1182 | JALCXO010000002.1 | GCA022689385_01605 | CDS | open | 212961-214694 | _na 577_aa | Multidrug ABC transporter ATP-binding protein | |
| 1183 | JALCXO010000002.1 | GCA022689385_01606 | CDS | open | 214719-216473 | _na 584_aa | Multidrug ABC transporter permease | |
| 1184 | JALCXO010000002.1 | GCA022689385_01607 | CDS | open | 216497-217957 | _na 486_aa | energy-coupling factor transporter ATPase | |
| 1185 | JALCXO010000002.1 | GCA022689385_01608 | CDS | open | 217957-218682 | _na 241_aa | ECF transporter | |
| 1186 | JALCXO010000002.1 | GCA022689385_01609 | CDS | open | 218679-219257 | _na 192_aa | Transporter | |
| 1187 | JALCXO010000002.1 | GCA022689385_01610 | CDS | open | 219274-222027 | _na 917_aa | Polyketide synthetase | |
| 1188 | JALCXO010000002.1 | GCA022689385_01611 | CDS | open | 222033-222725 | _na 230_aa | Glyoxalase-like domain-containing protein | |
| 1189 | JALCXO010000002.1 | GCA022689385_01612 | CDS | open | 222728-224836 | _na 702_aa | Polyketide synthase | |
| 1190 | JALCXO010000002.1 | GCA022689385_01613 | CDS | open | 224839-230862 | _na 2007_aa | vraA | Putative long chain fatty acid-CoA ligase VraA |
| 1191 | JALCXO010000002.1 | GCA022689385_01614 | CDS | open | 230891-232474 | _na 527_aa | vraA | Putative long chain fatty acid-CoA ligase VraA |
| 1192 | JALCXO010000002.1 | GCA022689385_01615 | CDS | open | 232471-233169 | _na 232_aa | 4'-phosphopantetheinyl transferase | |
| 1193 | JALCXO010000002.1 | GCA022689385_01616 | CDS | open | 233159-233890 | _na 243_aa | Thioesterase | |
| 1194 | JALCXO010000002.1 | GCA022689385_01617 | CDS | open | 234130-234492 | _na 120_aa | iscA | FeS cluster biogenesis domain-containing protein |
| 1195 | JALCXO010000002.1 | GCA022689385_01618 | CDS | open | 234502-234738 | _na 78_aa | UPF0349 protein HMPREF2709_01175 | |
| 1196 | JALCXO010000002.1 | GCA022689385_01619 | CDS | open | 235036-236127 | _na 363_aa | Type II NADH:quinone oxidoreductase | |
| 1197 | JALCXO010000002.1 | GCA022689385_01620 | CDS | open | 236300-236626 | _na 108_aa | Disulfide oxidoreductase | |
| 1198 | JALCXO010000002.1 | GCA022689385_01621 | CDS | open | 236730-236972 | _na 80_aa | nifU | NIF system FeS cluster assembly NifU C-terminal domain-containing protein |
| 1199 | JALCXO010000002.1 | GCA022689385_01622 | CDS | open | 237197-238387 | _na 396_aa | dltD | D-alanyl-lipoteichoic acid biosynthesis protein DltD |
| 1200 | JALCXO010000002.1 | GCA022689385_01623 | CDS | open | 238384-238620 | _na 78_aa | dltC | D-alanine--poly(phosphoribitol) ligase subunit 2 |
| 1201 | JALCXO010000002.1 | GCA022689385_01624 | CDS | open | 238636-239850 | _na 404_aa | dltB | D-alanyl-lipoteichoic acid biosynthesis protein DltB |
| 1202 | JALCXO010000002.1 | GCA022689385_01625 | CDS | open | 239847-241304 | _na 485_aa | dltA | D-alanine--poly(phosphoribitol) ligase subunit DltA |
| 1203 | JALCXO010000002.1 | GCA022689385_01626 | CDS | open | 241323-241472 | _na 49_aa | D-alanyl-lipoteichoic acid biosynthesis protein | |
| 1204 | JALCXO010000002.1 | GCA022689385_01627 | CDS | open | 241789-242754 | _na 321_aa | D-lactate dehydrogenase | |
| 1205 | JALCXO010000002.1 | GCA022689385_01628 | CDS | open | 242782-243561 | _na 259_aa | Acid sugar phosphatase | |
| 1206 | JALCXO010000002.1 | GCA022689385_01629 | CDS | open | 243564-243995 | _na 143_aa | DUF86 domain-containing protein | |
| 1207 | JALCXO010000002.1 | GCA022689385_01630 | CDS | open | 244097-244363 | _na 88_aa | Cytosolic protein | |
| 1208 | JALCXO010000002.1 | GCA022689385_01631 | CDS | open | 244515-244913 | _na 132_aa | Transcriptional regulator | |
| 1209 | JALCXO010000002.1 | GCA022689385_01632 | CDS | open | 245066-245989 | _na 307_aa | lipA | lipoyl synthase |
| 1210 | JALCXO010000002.1 | GCA022689385_01633 | CDS | open | 246073-247392 | _na 439_aa | Bifunctional metallophosphatase/5'-nucleotidase | |
| 1211 | JALCXO010000002.1 | GCA022689385_01634 | CDS | open | 247413-248240 | _na 275_aa | putative membrane transporter protein | |
| 1212 | JALCXO010000002.1 | GCA022689385_01635 | CDS | open | 248253-249122 | _na 289_aa | Cytosolic protein | |
| 1213 | JALCXO010000002.1 | GCA022689385_01636 | CDS | open | 249181-250254 | _na 357_aa | putative nitronate monooxygenase | |
| 1214 | JALCXO010000002.1 | GCA022689385_01637 | CDS | open | 250271-251314 | _na 347_aa | Hemolysin | |
| 1215 | JALCXO010000002.1 | GCA022689385_01638 | CDS | open | 251637-252290 | _na 217_aa | DUF5079 domain-containing protein | |
| 1216 | JALCXO010000002.1 | GCA022689385_01639 | CDS | open | 252359-253021 | _na 220_aa | DUF5080 domain-containing protein | |
| 1217 | JALCXO010000002.1 | GCA022689385_01640 | CDS | open | 253056-253730 | _na 224_aa | DUF5079 domain-containing protein | |
| 1218 | JALCXO010000002.1 | GCA022689385_01641 | CDS | open | 254035-254553 | _na 172_aa | DUF5079 domain-containing protein | |
| 1219 | JALCXO010000002.1 | GCA022689385_01642 | CDS | open | 254637-255101 | _na 154_aa | lipoprotein | |
| 1220 | JALCXO010000002.1 | GCA022689385_01643 | CDS | open | 255698-255904 | _na 68_aa | Mid2-like cell wall stress sensor domain protein | |
| 1221 | JALCXO010000002.1 | GCA022689385_01644 | CDS | open | 255990-256361 | _na 123_aa | DUF4467 domain-containing protein | |
| 1222 | JALCXO010000002.1 | GCA022689385_01645 | CDS | open | 256583-257794 | _na 403_aa | Beta-carotene 15%2C15'-monooxygenase | |
| 1223 | JALCXO010000002.1 | GCA022689385_01646 | CDS | open | 257849-258304 | _na 151_aa | TIGR01741 family protein | |
| 1224 | JALCXO010000002.1 | GCA022689385_01647 | CDS | open | 258581-259684 | _na 367_aa | tyrosine-type recombinase/integrase | |
| 1225 | JALCXO010000002.1 | GCA022689385_01648 | CDS | open | 259695-261767 | _na 690_aa | tyrosine-type recombinase/integrase | |
| 1226 | JALCXO010000002.1 | GCA022689385_01649 | CDS | open | 261776-262141 | _na 121_aa | DUF6262 domain-containing protein | |
| 1227 | JALCXO010000002.1 | GCA022689385_01650 | CDS | open | 262243-262656 | _na 137_aa | YolD-like family protein | |
| 1228 | JALCXO010000002.1 | GCA022689385_01651 | CDS | open | 262805-262996 | _na 63_aa | Phage protein | |
| 1229 | JALCXO010000002.1 | GCA022689385_01652 | CDS | open | 263029-263349 | _na 106_aa | arsR | ArsR family transcriptional regulator |
| 1230 | JALCXO010000002.1 | GCA022689385_01399 | gene | open | 965-2239 | |||
| 1231 | JALCXO010000002.1 | GCA022689385_01400 | gene | open | 2255-3604 | murD | ||
| 1232 | JALCXO010000002.1 | GCA022689385_01401 | gene | open | 3606-4571 | mraY | ||
| 1233 | JALCXO010000002.1 | GCA022689385_01402 | gene | open | 4931-7237 | |||
| 1234 | JALCXO010000002.1 | GCA022689385_01403 | gene | open | 7215-7616 | ftsL | ||
| 1235 | JALCXO010000002.1 | GCA022689385_01404 | gene | open | 7630-8565 | rsmH | ||
| 1236 | JALCXO010000002.1 | GCA022689385_01405 | gene | open | 8580-9011 | mraZ | ||
| 1237 | JALCXO010000002.1 | GCA022689385_01406 | gene | open | 9155-10768 | bshC | ||
| 1238 | JALCXO010000002.1 | GCA022689385_01407 | gene | open | 10943-11389 | |||
| 1239 | JALCXO010000002.1 | GCA022689385_01409 | gene | open | 12178-12870 | yjjG | ||
| 1240 | JALCXO010000002.1 | GCA022689385_01410 | gene | open | 13039-13548 | |||
| 1241 | JALCXO010000002.1 | GCA022689385_01411 | gene | open | 13548-14129 | |||
| 1242 | JALCXO010000002.1 | GCA022689385_01412 | gene | open | 14141-14941 | racE | ||
| 1243 | JALCXO010000002.1 | GCA022689385_01413 | gene | open | 15348-16184 | sdhB | ||
| 1244 | JALCXO010000002.1 | GCA022689385_01414 | gene | open | 16184-17950 | sdhA | ||
| 1245 | JALCXO010000002.1 | GCA022689385_01415 | gene | open | 18002-18616 | sdhC | ||
| 1246 | JALCXO010000002.1 | GCA022689385_01416 | gene | open | 18961-20739 | uvrC | ||
| 1247 | JALCXO010000002.1 | GCA022689385_01417 | gene | open | 20829-21143 | trxA | ||
| 1248 | JALCXO010000002.1 | GCA022689385_01418 | gene | open | 21306-23657 | mutS2 | ||
| 1249 | JALCXO010000002.1 | GCA022689385_01419 | gene | open | 23667-25379 | polX | ||
| 1250 | JALCXO010000002.1 | GCA022689385_01420 | gene | open | 25435-25956 | cvpA | ||
| 1251 | JALCXO010000002.1 | GCA022689385_01421 | gene | open | 25958-26218 | zapA | ||
| 1252 | JALCXO010000002.1 | GCA022689385_01422 | gene | open | 26449-27381 | rnhC | ||
| 1253 | JALCXO010000002.1 | GCA022689385_01423 | gene | open | 27869-30271 | pheT | ||
| 1254 | JALCXO010000002.1 | GCA022689385_01424 | gene | open | 30271-31329 | pheS | ||
| 1255 | JALCXO010000002.1 | GCA022689385_01425 | gene | open | 31721-32461 | |||
| 1256 | JALCXO010000002.1 | GCA022689385_01426 | gene | open | 32716-32889 | rpmF | ||
| 1257 | JALCXO010000002.1 | GCA022689385_01427 | gene | open | 32975-33526 | |||
| 1258 | JALCXO010000002.1 | GCA022689385_01428 | gene | open | 33653-34786 | |||
| 1259 | JALCXO010000002.1 | GCA022689385_01429 | gene | open | 34857-35339 | coaD | ||
| 1260 | JALCXO010000002.1 | GCA022689385_01430 | gene | open | 35332-35883 | rsmD | ||
| 1261 | JALCXO010000002.1 | GCA022689385_01431 | gene | open | 35952-36341 | |||
| 1262 | JALCXO010000002.1 | GCA022689385_01432 | gene | open | 36358-36609 | |||
| 1263 | JALCXO010000002.1 | GCA022689385_01433 | gene | open | 36768-37694 | |||
| 1264 | JALCXO010000002.1 | GCA022689385_01434 | gene | open | 37782-38216 | ylbF | ||
| 1265 | JALCXO010000002.1 | GCA022689385_01435 | gene | open | 38233-39273 | |||
| 1266 | JALCXO010000002.1 | GCA022689385_01436 | gene | open | 39475-39936 | |||
| 1267 | JALCXO010000002.1 | GCA022689385_01437 | gene | open | 39962-40873 | cyoE | ||
| 1268 | JALCXO010000002.1 | GCA022689385_01438 | gene | open | 41090-42019 | |||
| 1269 | JALCXO010000002.1 | GCA022689385_01440 | gene | open | 42663-46109 | |||
| 1270 | JALCXO010000002.1 | GCA022689385_01441 | gene | open | 46660-47898 | ftsW | ||
| 1271 | JALCXO010000002.1 | GCA022689385_01442 | gene | open | 48199-48477 | |||
| 1272 | JALCXO010000002.1 | GCA022689385_01443 | gene | open | 48621-49106 | |||
| 1273 | JALCXO010000002.1 | GCA022689385_01444 | gene | open | 49108-49362 | |||
| 1274 | JALCXO010000002.1 | GCA022689385_01445 | gene | open | 49408-51255 | typA | ||
| 1275 | JALCXO010000002.1 | GCA022689385_01446 | gene | open | 51354-51551 | ylaF | ||
| 1276 | JALCXO010000002.1 | GCA022689385_01447 | gene | open | 51725-52540 | |||
| 1277 | JALCXO010000002.1 | GCA022689385_01448 | gene | open | 52723-53334 | |||
| 1278 | JALCXO010000002.1 | GCA022689385_01449 | gene | open | 53595-54947 | |||
| 1279 | JALCXO010000002.1 | GCA022689385_01450 | gene | open | 55210-55665 | |||
| 1280 | JALCXO010000002.1 | GCA022689385_01451 | gene | open | 55797-56843 | auxB | ||
| 1281 | JALCXO010000002.1 | GCA022689385_01452 | gene | open | 56916-57989 | |||
| 1282 | JALCXO010000002.1 | GCA022689385_01453 | gene | open | 57986-58798 | |||
| 1283 | JALCXO010000002.1 | GCA022689385_01454 | gene | open | 58804-59604 | |||
| 1284 | JALCXO010000002.1 | GCA022689385_01455 | gene | open | 59594-60688 | potA | ||
| 1285 | JALCXO010000002.1 | GCA022689385_01456 | gene | open | 60703-61242 | |||
| 1286 | JALCXO010000002.1 | GCA022689385_01458 | gene | open | 61628-61915 | |||
| 1287 | JALCXO010000002.1 | GCA022689385_01459 | gene | open | 62119-63525 | lpdA | ||
| 1288 | JALCXO010000002.1 | GCA022689385_01460 | gene | open | 63529-64833 | pdhC | ||
| 1289 | JALCXO010000002.1 | GCA022689385_01461 | gene | open | 65046-66023 | |||
| 1290 | JALCXO010000002.1 | GCA022689385_01462 | gene | open | 66027-67139 | pdhA | ||
| 1291 | JALCXO010000002.1 | GCA022689385_01463 | gene | open | 67306-67935 | |||
| 1292 | JALCXO010000002.1 | GCA022689385_01464 | gene | open | 68073-68624 | def | ||
| 1293 | JALCXO010000002.1 | GCA022689385_01465 | gene | open | 69059-69277 | rpoY | ||
| 1294 | JALCXO010000002.1 | GCA022689385_01466 | gene | open | 69277-70956 | rnjA | ||
| 1295 | JALCXO010000002.1 | GCA022689385_01467 | gene | open | 71054-71254 | |||
| 1296 | JALCXO010000002.1 | GCA022689385_01469 | gene | open | 71551-72210 | trkA | ||
| 1297 | JALCXO010000002.1 | GCA022689385_01470 | gene | open | 72280-73296 | |||
| 1298 | JALCXO010000002.1 | GCA022689385_01471 | gene | open | 73296-73433 | |||
| 1299 | JALCXO010000002.1 | GCA022689385_01472 | gene | open | 73607-73840 | |||
| 1300 | JALCXO010000002.1 | GCA022689385_01473 | gene | open | 73936-75651 | ptsA | ||
| 1301 | JALCXO010000002.1 | GCA022689385_01474 | gene | open | 75654-75920 | ptsH | ||
| 1302 | JALCXO010000002.1 | GCA022689385_01475 | gene | open | 76072-76614 | |||
| 1303 | JALCXO010000002.1 | GCA022689385_01476 | gene | open | 76669-77841 | |||
| 1304 | JALCXO010000002.1 | GCA022689385_01477 | gene | open | 78544-79836 | auxA | ||
| 1305 | JALCXO010000002.1 | GCA022689385_01479 | gene | open | 79982-80116 | graF | ||
| 1306 | JALCXO010000002.1 | GCA022689385_01480 | gene | open | 80549-81124 | |||
| 1307 | JALCXO010000002.1 | GCA022689385_01481 | gene | open | 81137-82540 | ccmA | ||
| 1308 | JALCXO010000002.1 | GCA022689385_01482 | gene | open | 82533-83342 | |||
| 1309 | JALCXO010000002.1 | GCA022689385_01483 | gene | open | 83656-84903 | |||
| 1310 | JALCXO010000002.1 | GCA022689385_01484 | gene | open | 84926-86404 | purH | ||
| 1311 | JALCXO010000002.1 | GCA022689385_01485 | gene | open | 86420-86986 | purN | ||
| 1312 | JALCXO010000002.1 | GCA022689385_01486 | gene | open | 86986-88017 | |||
| 1313 | JALCXO010000002.1 | GCA022689385_01487 | gene | open | 88010-89494 | purF | ||
| 1314 | JALCXO010000002.1 | GCA022689385_01488 | gene | open | 89473-91662 | purL | ||
| 1315 | JALCXO010000002.1 | GCA022689385_01489 | gene | open | 91655-92326 | purQ | ||
| 1316 | JALCXO010000002.1 | GCA022689385_01490 | gene | open | 92328-92588 | purS | ||
| 1317 | JALCXO010000002.1 | GCA022689385_01491 | gene | open | 92588-93292 | purC | ||
| 1318 | JALCXO010000002.1 | GCA022689385_01492 | gene | open | 93293-94420 | purK | ||
| 1319 | JALCXO010000002.1 | GCA022689385_01493 | gene | open | 94407-94889 | |||
| 1320 | JALCXO010000002.1 | GCA022689385_01494 | gene | open | 95100-95957 | folD | ||
| 1321 | JALCXO010000002.1 | GCA022689385_01495 | gene | open | 96243-97388 | |||
| 1322 | JALCXO010000002.1 | GCA022689385_01496 | gene | open | 97647-97964 | |||
| 1323 | JALCXO010000002.1 | GCA022689385_01497 | gene | open | 98266-99378 | qoxA | ||
| 1324 | JALCXO010000002.1 | GCA022689385_01498 | gene | open | 99378-101366 | qoxB | ||
| 1325 | JALCXO010000002.1 | GCA022689385_01499 | gene | open | 101356-101961 | qoxC | ||
| 1326 | JALCXO010000002.1 | GCA022689385_01500 | gene | open | 101958-102248 | qoxD | ||
| 1327 | JALCXO010000002.1 | GCA022689385_01501 | gene | open | 102377-103285 | rihC | ||
| 1328 | JALCXO010000002.1 | GCA022689385_01502 | gene | open | 103640-104854 | fmtA | ||
| 1329 | JALCXO010000002.1 | GCA022689385_01503 | gene | open | 105202-106404 | |||
| 1330 | JALCXO010000002.1 | GCA022689385_01504 | gene | open | 106425-106895 | lytR | ||
| 1331 | JALCXO010000002.1 | GCA022689385_01505 | gene | open | 107336-107764 | |||
| 1332 | JALCXO010000002.1 | GCA022689385_01506 | gene | open | 107990-111802 | |||
| 1333 | JALCXO010000002.1 | GCA022689385_01507 | gene | open | 111941-112360 | marR | ||
| 1334 | JALCXO010000002.1 | GCA022689385_01508 | gene | open | 112517-113524 | |||
| 1335 | JALCXO010000002.1 | GCA022689385_01509 | gene | open | 113647-114810 | |||
| 1336 | JALCXO010000002.1 | GCA022689385_01510 | gene | open | 114930-115748 | menB | ||
| 1337 | JALCXO010000002.1 | GCA022689385_01511 | gene | open | 115741-116544 | menH | ||
| 1338 | JALCXO010000002.1 | GCA022689385_01512 | gene | open | 116531-118201 | menD | ||
| 1339 | JALCXO010000002.1 | GCA022689385_01513 | gene | open | 118191-119552 | |||
| 1340 | JALCXO010000002.1 | GCA022689385_01514 | gene | open | 119730-120668 | |||
| 1341 | JALCXO010000002.1 | GCA022689385_01515 | gene | open | 120903-121007 | |||
| 1342 | JALCXO010000002.1 | GCA022689385_01516 | gene | open | 121145-121330 | |||
| 1343 | JALCXO010000002.1 | GCA022689385_01517 | gene | open | 121726-122127 | |||
| 1344 | JALCXO010000002.1 | GCA022689385_01518 | gene | open | 122154-122645 | |||
| 1345 | JALCXO010000002.1 | GCA022689385_01519 | gene | open | 122648-122839 | |||
| 1346 | JALCXO010000002.1 | GCA022689385_01520 | gene | open | 123362-123556 | |||
| 1347 | JALCXO010000002.1 | GCA022689385_01521 | gene | open | 123558-124097 | |||
| 1348 | JALCXO010000002.1 | GCA022689385_01524 | gene | open | 124664-125233 | comK | ||
| 1349 | JALCXO010000002.1 | GCA022689385_01525 | gene | open | 125452-125670 | |||
| 1350 | JALCXO010000002.1 | GCA022689385_01526 | gene | open | 125746-126732 | |||
| 1351 | JALCXO010000002.1 | GCA022689385_01527 | gene | open | 126932-127117 | ykvS | ||
| 1352 | JALCXO010000002.1 | GCA022689385_01528 | gene | open | 127124-127726 | |||
| 1353 | JALCXO010000002.1 | GCA022689385_01529 | gene | open | 127829-129343 | |||
| 1354 | JALCXO010000002.1 | GCA022689385_01530 | gene | open | 129572-130930 | |||
| 1355 | JALCXO010000002.1 | GCA022689385_01531 | gene | open | 130947-132923 | |||
| 1356 | JALCXO010000002.1 | GCA022689385_01532 | gene | open | 133123-133920 | |||
| 1357 | JALCXO010000002.1 | GCA022689385_01533 | gene | open | 134228-135790 | prfC | ||
| 1358 | JALCXO010000002.1 | GCA022689385_01534 | gene | open | 135791-136045 | |||
| 1359 | JALCXO010000002.1 | GCA022689385_01535 | gene | open | 136035-137519 | |||
| 1360 | JALCXO010000002.1 | GCA022689385_01536 | gene | open | 137928-139103 | |||
| 1361 | JALCXO010000002.1 | GCA022689385_01537 | gene | open | 139081-140274 | ltaA | ||
| 1362 | JALCXO010000002.1 | GCA022689385_01538 | gene | open | 140334-140840 | |||
| 1363 | JALCXO010000002.1 | GCA022689385_01539 | gene | open | 141178-141597 | merR | ||
| 1364 | JALCXO010000002.1 | GCA022689385_01540 | gene | open | 141601-142338 | |||
| 1365 | JALCXO010000002.1 | GCA022689385_01541 | gene | open | 142650-143390 | |||
| 1366 | JALCXO010000002.1 | GCA022689385_01542 | gene | open | 143611-144696 | |||
| 1367 | JALCXO010000002.1 | GCA022689385_01543 | gene | open | 145015-145785 | fabI | ||
| 1368 | JALCXO010000002.1 | GCA022689385_01544 | gene | open | 146073-147917 | |||
| 1369 | JALCXO010000002.1 | GCA022689385_01545 | gene | open | 147928-149313 | mgtE | ||
| 1370 | JALCXO010000002.1 | GCA022689385_01546 | gene | open | 149339-150193 | |||
| 1371 | JALCXO010000002.1 | GCA022689385_01547 | gene | open | 150190-150999 | nadK | ||
| 1372 | JALCXO010000002.1 | GCA022689385_01548 | gene | open | 151014-151649 | |||
| 1373 | JALCXO010000002.1 | GCA022689385_01549 | gene | open | 151666-152013 | |||
| 1374 | JALCXO010000002.1 | GCA022689385_01550 | gene | open | 152207-152779 | |||
| 1375 | JALCXO010000002.1 | GCA022689385_01551 | gene | open | 152879-153244 | yjbI | ||
| 1376 | JALCXO010000002.1 | GCA022689385_01552 | gene | open | 153267-154064 | yjbH | ||
| 1377 | JALCXO010000002.1 | GCA022689385_01554 | gene | open | 154711-156519 | pepF | ||
| 1378 | JALCXO010000002.1 | GCA022689385_01555 | gene | open | 156571-157542 | coiA | ||
| 1379 | JALCXO010000002.1 | GCA022689385_01556 | gene | open | 157643-158374 | mecA | ||
| 1380 | JALCXO010000002.1 | GCA022689385_01557 | gene | open | 158595-158990 | spxA | ||
| 1381 | JALCXO010000002.1 | GCA022689385_01558 | gene | open | 159278-160267 | trpS | ||
| 1382 | JALCXO010000002.1 | GCA022689385_01559 | gene | open | 160454-161209 | |||
| 1383 | JALCXO010000002.1 | GCA022689385_01560 | gene | open | 161418-163070 | |||
| 1384 | JALCXO010000002.1 | GCA022689385_01561 | gene | open | 163096-164037 | |||
| 1385 | JALCXO010000002.1 | GCA022689385_01562 | gene | open | 164027-165109 | |||
| 1386 | JALCXO010000002.1 | GCA022689385_01563 | gene | open | 165124-166188 | opp3C | ||
| 1387 | JALCXO010000002.1 | GCA022689385_01564 | gene | open | 166185-167114 | opp3b | ||
| 1388 | JALCXO010000002.1 | GCA022689385_01565 | gene | open | 167349-167723 | |||
| 1389 | JALCXO010000002.1 | GCA022689385_01566 | gene | open | 167774-169018 | fabF | ||
| 1390 | JALCXO010000002.1 | GCA022689385_01567 | gene | open | 169032-169973 | |||
| 1391 | JALCXO010000002.1 | GCA022689385_01568 | gene | open | 170222-170416 | |||
| 1392 | JALCXO010000002.1 | GCA022689385_01569 | gene | open | 170570-173164 | clpB | ||
| 1393 | JALCXO010000002.1 | GCA022689385_01570 | gene | open | 173408-173716 | sufT | ||
| 1394 | JALCXO010000002.1 | GCA022689385_01571 | gene | open | 173826-174644 | |||
| 1395 | JALCXO010000002.1 | GCA022689385_01572 | gene | open | 174687-176009 | |||
| 1396 | JALCXO010000002.1 | GCA022689385_01573 | gene | open | 176196-176585 | |||
| 1397 | JALCXO010000002.1 | GCA022689385_01574 | gene | open | 177058-177960 | ycgM | ||
| 1398 | JALCXO010000002.1 | GCA022689385_01575 | gene | open | 178117-181767 | addA | ||
| 1399 | JALCXO010000002.1 | GCA022689385_01576 | gene | open | 181764-185231 | addB | ||
| 1400 | JALCXO010000002.1 | GCA022689385_01577 | gene | open | 185391-185960 | lepB | ||
| 1401 | JALCXO010000002.1 | GCA022689385_01578 | gene | open | 186229-186495 | lepB | ||
| 1402 | JALCXO010000002.1 | GCA022689385_01579 | gene | open | 186500-187075 | |||
| 1403 | JALCXO010000002.1 | GCA022689385_01580 | gene | open | 187235-188566 | pgi | ||
| 1404 | JALCXO010000002.1 | GCA022689385_01581 | gene | open | 188897-190102 | argG | ||
| 1405 | JALCXO010000002.1 | GCA022689385_01582 | gene | open | 190092-191474 | argH | ||
| 1406 | JALCXO010000002.1 | GCA022689385_01583 | gene | open | 191690-192055 | |||
| 1407 | JALCXO010000002.1 | GCA022689385_01584 | gene | open | 192352-192633 | |||
| 1408 | JALCXO010000002.1 | GCA022689385_01585 | gene | open | 192662-194284 | |||
| 1409 | JALCXO010000002.1 | GCA022689385_01586 | gene | open | 194655-195899 | gluD | ||
| 1410 | JALCXO010000002.1 | GCA022689385_01587 | gene | open | 196439-196972 | |||
| 1411 | JALCXO010000002.1 | GCA022689385_01588 | gene | open | 196911-197582 | |||
| 1412 | JALCXO010000002.1 | GCA022689385_01589 | gene | open | 197780-198160 | ygs | ||
| 1413 | JALCXO010000002.1 | GCA022689385_01590 | gene | open | 198446-199039 | |||
| 1414 | JALCXO010000002.1 | GCA022689385_01591 | gene | open | 199108-199488 | |||
| 1415 | JALCXO010000002.1 | GCA022689385_01592 | gene | open | 199618-202035 | |||
| 1416 | JALCXO010000002.1 | GCA022689385_01593 | gene | open | 202016-202444 | |||
| 1417 | JALCXO010000002.1 | GCA022689385_01594 | gene | open | 202444-202791 | mnhC1 | ||
| 1418 | JALCXO010000002.1 | GCA022689385_01595 | gene | open | 202778-204274 | |||
| 1419 | JALCXO010000002.1 | GCA022689385_01596 | gene | open | 204274-204756 | |||
| 1420 | JALCXO010000002.1 | GCA022689385_01597 | gene | open | 204753-205043 | |||
| 1421 | JALCXO010000002.1 | GCA022689385_01598 | gene | open | 205021-205377 | mnhG1 | ||
| 1422 | JALCXO010000002.1 | GCA022689385_01599 | gene | open | 205505-206674 | |||
| 1423 | JALCXO010000002.1 | GCA022689385_01600 | gene | open | 206706-207080 | |||
| 1424 | JALCXO010000002.1 | GCA022689385_01601 | gene | open | 207102-208421 | |||
| 1425 | JALCXO010000002.1 | GCA022689385_01602 | gene | open | 208737-210215 | |||
| 1426 | JALCXO010000002.1 | GCA022689385_01603 | gene | open | 210431-211639 | |||
| 1427 | JALCXO010000002.1 | GCA022689385_01604 | gene | open | 211923-212960 | |||
| 1428 | JALCXO010000002.1 | GCA022689385_01605 | gene | open | 212961-214694 | |||
| 1429 | JALCXO010000002.1 | GCA022689385_01606 | gene | open | 214719-216473 | |||
| 1430 | JALCXO010000002.1 | GCA022689385_01607 | gene | open | 216497-217957 | |||
| 1431 | JALCXO010000002.1 | GCA022689385_01608 | gene | open | 217957-218682 | |||
| 1432 | JALCXO010000002.1 | GCA022689385_01609 | gene | open | 218679-219257 | |||
| 1433 | JALCXO010000002.1 | GCA022689385_01610 | gene | open | 219274-222027 | |||
| 1434 | JALCXO010000002.1 | GCA022689385_01611 | gene | open | 222033-222725 | |||
| 1435 | JALCXO010000002.1 | GCA022689385_01612 | gene | open | 222728-224836 | |||
| 1436 | JALCXO010000002.1 | GCA022689385_01613 | gene | open | 224839-230862 | vraA | ||
| 1437 | JALCXO010000002.1 | GCA022689385_01614 | gene | open | 230891-232474 | vraA | ||
| 1438 | JALCXO010000002.1 | GCA022689385_01615 | gene | open | 232471-233169 | |||
| 1439 | JALCXO010000002.1 | GCA022689385_01616 | gene | open | 233159-233890 | |||
| 1440 | JALCXO010000002.1 | GCA022689385_01617 | gene | open | 234130-234492 | iscA | ||
| 1441 | JALCXO010000002.1 | GCA022689385_01618 | gene | open | 234502-234738 | |||
| 1442 | JALCXO010000002.1 | GCA022689385_01619 | gene | open | 235036-236127 | |||
| 1443 | JALCXO010000002.1 | GCA022689385_01620 | gene | open | 236300-236626 | |||
| 1444 | JALCXO010000002.1 | GCA022689385_01621 | gene | open | 236730-236972 | nifU | ||
| 1445 | JALCXO010000002.1 | GCA022689385_01622 | gene | open | 237197-238387 | dltD | ||
| 1446 | JALCXO010000002.1 | GCA022689385_01623 | gene | open | 238384-238620 | dltC | ||
| 1447 | JALCXO010000002.1 | GCA022689385_01624 | gene | open | 238636-239850 | dltB | ||
| 1448 | JALCXO010000002.1 | GCA022689385_01625 | gene | open | 239847-241304 | dltA | ||
| 1449 | JALCXO010000002.1 | GCA022689385_01626 | gene | open | 241323-241472 | |||
| 1450 | JALCXO010000002.1 | GCA022689385_01627 | gene | open | 241789-242754 | |||
| 1451 | JALCXO010000002.1 | GCA022689385_01628 | gene | open | 242782-243561 | |||
| 1452 | JALCXO010000002.1 | GCA022689385_01629 | gene | open | 243564-243995 | |||
| 1453 | JALCXO010000002.1 | GCA022689385_01630 | gene | open | 244097-244363 | |||
| 1454 | JALCXO010000002.1 | GCA022689385_01631 | gene | open | 244515-244913 | |||
| 1455 | JALCXO010000002.1 | GCA022689385_01632 | gene | open | 245066-245989 | lipA | ||
| 1456 | JALCXO010000002.1 | GCA022689385_01633 | gene | open | 246073-247392 | |||
| 1457 | JALCXO010000002.1 | GCA022689385_01634 | gene | open | 247413-248240 | |||
| 1458 | JALCXO010000002.1 | GCA022689385_01635 | gene | open | 248253-249122 | |||
| 1459 | JALCXO010000002.1 | GCA022689385_01636 | gene | open | 249181-250254 | |||
| 1460 | JALCXO010000002.1 | GCA022689385_01637 | gene | open | 250271-251314 | |||
| 1461 | JALCXO010000002.1 | GCA022689385_01638 | gene | open | 251637-252290 | |||
| 1462 | JALCXO010000002.1 | GCA022689385_01639 | gene | open | 252359-253021 | |||
| 1463 | JALCXO010000002.1 | GCA022689385_01640 | gene | open | 253056-253730 | |||
| 1464 | JALCXO010000002.1 | GCA022689385_01641 | gene | open | 254035-254553 | |||
| 1465 | JALCXO010000002.1 | GCA022689385_01642 | gene | open | 254637-255101 | |||
| 1466 | JALCXO010000002.1 | GCA022689385_01643 | gene | open | 255698-255904 | |||
| 1467 | JALCXO010000002.1 | GCA022689385_01644 | gene | open | 255990-256361 | |||
| 1468 | JALCXO010000002.1 | GCA022689385_01645 | gene | open | 256583-257794 | |||
| 1469 | JALCXO010000002.1 | GCA022689385_01646 | gene | open | 257849-258304 | |||
| 1470 | JALCXO010000002.1 | GCA022689385_01647 | gene | open | 258581-259684 | |||
| 1471 | JALCXO010000002.1 | GCA022689385_01648 | gene | open | 259695-261767 | |||
| 1472 | JALCXO010000002.1 | GCA022689385_01649 | gene | open | 261776-262141 | |||
| 1473 | JALCXO010000002.1 | GCA022689385_01650 | gene | open | 262243-262656 | |||
| 1474 | JALCXO010000002.1 | GCA022689385_01651 | gene | open | 262805-262996 | |||
| 1475 | JALCXO010000002.1 | GCA022689385_01652 | gene | open | 263029-263349 | arsR | ||
| 1476 | JALCXO010000002.1 | GCA022689385_01408 | gene | open | 11858-11931 | trnR | ||
| 1477 | JALCXO010000002.1 | GCA022689385_01522 | gene | open | 124356-124444 | trnS | ||
| 1478 | JALCXO010000002.1 | GCA022689385_01523 | gene | open | 124446-124520 | trnN | ||
| 1479 | JALCXO010000002.1 | GCA022689385_01408 | tRNA | open | 11858-11931 | trnR | tRNA-Arg(tct) | |
| 1480 | JALCXO010000002.1 | GCA022689385_01522 | tRNA | open | 124356-124444 | trnS | tRNA-Ser(gct) | |
| 1481 | JALCXO010000002.1 | GCA022689385_01523 | tRNA | open | 124446-124520 | trnN | tRNA-Asn(gtt) | |
| 1482 | JALCXO010000003.1 | rep_origin | open | 119206-119855 | ||||
| 1483 | JALCXO010000003.1 | GCA022689385_01716 | gene | open | 4626-4895 | Bacteria_large_SRP | ||
| 1484 | JALCXO010000003.1 | GCA022689385_01717 | gene | open | 4678-4777 | Bacteria_small_SRP | ||
| 1485 | JALCXO010000003.1 | GCA022689385_01765 | gene | open | 60764-60869 | sRNA71 | ||
| 1486 | JALCXO010000003.1 | GCA022689385_01716 | ncRNA | open | 4626-4895 | Bacterial large signal recognition particle RNA | ||
| 1487 | JALCXO010000003.1 | GCA022689385_01717 | ncRNA | open | 4678-4777 | Bacterial small signal recognition particle RNA | ||
| 1488 | JALCXO010000003.1 | GCA022689385_01765 | ncRNA | open | 60764-60869 | Staphylococcus sRNA71 small RNA | ||
| 1489 | JALCXO010000003.1 | regulatory_region | open | 48999-49101 | Purine riboswitch aptamer | |||
| 1490 | JALCXO010000003.1 | regulatory_region | open | 71390-71782 | T-box leader | |||
| 1491 | JALCXO010000003.1 | regulatory_region | open | 130241-130444 | T-box leader | |||
| 1492 | JALCXO010000003.1 | regulatory_region | open | 133192-133290 | SAM riboswitch aptamer (S box leader) | |||
| 1493 | JALCXO010000003.1 | repeat_region | open | 182792-183204 | CRISPR array with 6 repeats of length 37%2C consensus sequence AATCAGAGAATACCCCGTATAAAAGGGGACGAGAACT and spacer length 36 | |||
| 1494 | JALCXO010000003.1 | GCA022689385_01712 | CDS | open | 970-1566 | _na 198_aa | recR | recombination mediator RecR |
| 1495 | JALCXO010000003.1 | GCA022689385_01713 | CDS | open | 1573-1890 | _na 105_aa | ybaB | YbaB/EbfC family nucleoid-associated protein |
| 1496 | JALCXO010000003.1 | GCA022689385_01714 | CDS | open | 1978-3708 | _na 576_aa | dnaX | DNA polymerase III subunit gamma/tau |
| 1497 | JALCXO010000003.1 | GCA022689385_01715 | CDS | open | 3774-4298 | _na 174_aa | Acetyltransferase | |
| 1498 | JALCXO010000003.1 | GCA022689385_01718 | CDS | open | 4983-5720 | _na 245_aa | treR | trehalose operon repressor |
| 1499 | JALCXO010000003.1 | GCA022689385_01719 | CDS | open | 5732-7369 | _na 545_aa | treC | alpha%2Calpha-phosphotrehalase |
| 1500 | JALCXO010000003.1 | GCA022689385_01720 | CDS | open | 7446-8891 | _na 481_aa | treB | PTS trehalose transporter subunit IIBC |
