HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Streptococcus oralis subsp. tigurinus (GCA_023109655.1)

Select a Genome:
BAKTA Annotations for GCA_023109655.1
Genome Selected: Streptococcus oralis subsp. tigurinus
ContigsBases CDSrRNA tmRNAtRNA
13 1,868,427 1769 3 1 33
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3666 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 3666 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1 JALDUQ010000001.1 GCA023109655_00403 gene open 425968-426312 ssrA
2 JALDUQ010000001.1 GCA023109655_00403 tmRNA open 425968-426312 ssrA transfer-messenger RNA%2C SsrA
3 JALDUQ010000001.1 GCA023109655_00096 gene open 118199-118580 RNaseP_bact_b
4 JALDUQ010000001.1 GCA023109655_00244 gene open 268181-268335 SpF22_sRNA
5 JALDUQ010000001.1 GCA023109655_00378 gene open 405431-405552 SpR19_sRNA
6 JALDUQ010000001.1 GCA023109655_00421 gene open 444734-444829 SpF44_sRNA
7 JALDUQ010000001.1 GCA023109655_00427 gene open 449867-449964 SpF43_sRNA
8 JALDUQ010000001.1 GCA023109655_00637 gene open 657480-657622 asd
9 JALDUQ010000001.1 GCA023109655_00096 ncRNA open 118199-118580 Bacterial RNase P class B
10 JALDUQ010000001.1 GCA023109655_00244 ncRNA open 268181-268335 Streptococcus sRNA SpF22
11 JALDUQ010000001.1 GCA023109655_00378 ncRNA open 405431-405552 Streptococcus sRNA SpR19
12 JALDUQ010000001.1 GCA023109655_00421 ncRNA open 444734-444829 Streptococcus sRNA SpF44
13 JALDUQ010000001.1 GCA023109655_00427 ncRNA open 449867-449964 Streptococcus sRNA SpF43
14 JALDUQ010000001.1 GCA023109655_00637 ncRNA open 657480-657622 MarS sRNA
15 JALDUQ010000001.1 regulatory_region open 18900-18957 Lacto-rpoB RNA
16 JALDUQ010000001.1 regulatory_region open 140648-140736 Glycine riboswitch aptamer
17 JALDUQ010000001.1 regulatory_region open 318960-319064 PyrR binding site
18 JALDUQ010000001.1 regulatory_region open 322012-322100 TPP riboswitch aptamer (THI element)
19 JALDUQ010000001.1 regulatory_region open 323109-323197 TPP riboswitch aptamer (THI element)
20 JALDUQ010000001.1 regulatory_region open 451760-451892 PyrR binding site
21 JALDUQ010000001.1 regulatory_region open 484599-484718 Ribosomal protein L21 leader
22 JALDUQ010000001.1 regulatory_region open 504981-505112 Ribosomal protein L20 leader
23 JALDUQ010000001.1 regulatory_region open 551800-552016 T-box leader
24 JALDUQ010000001.1 regulatory_region open 656554-656650 PreQ1-II (pre queuosine) riboswitch aptamer
25 JALDUQ010000001.1 repeat_region open 477379-478412 CRISPR array with 16 repeats of length 36%2C consensus sequence GTTTTTGTACTCTCAAGATTTAAGTAACTGTACAAC and spacer length 29
26 JALDUQ010000001.1 GCA023109655_00008 CDS open 31-1890 _na     619_aa Adhesin isopeptide-forming adherence domain protein
27 JALDUQ010000001.1 GCA023109655_00009 CDS open 2263-2562 _na     99_aa Transposase IS204/IS1001/IS1096/IS1165 DDE domain-containing protein
28 JALDUQ010000001.1 GCA023109655_00010 CDS open 2981-5719 _na     912_aa Type III restriction enzyme%2C res subunit
29 JALDUQ010000001.1 GCA023109655_00011 CDS open 5719-7677 _na     652_aa DNA methylase family protein
30 JALDUQ010000001.1 GCA023109655_00012 CDS open 8222-9079 _na     285_aa 5'-nucleotidase%2C lipoprotein e(P4) family
31 JALDUQ010000001.1 GCA023109655_00013 CDS open 9447-10451 _na     334_aa Uroporphyrinogen decarboxylase (URO-D) domain-containing protein
32 JALDUQ010000001.1 GCA023109655_00014 CDS open 10463-10666 _na     67_aa Enoyl-CoA hydratase
33 JALDUQ010000001.1 GCA023109655_00015 CDS open 10669-11667 _na     332_aa Uroporphyrinogen decarboxylase (URO-D) domain-containing protein
34 JALDUQ010000001.1 GCA023109655_00016 CDS open 11679-12557 _na     292_aa Solute-binding protein family 3/N-terminal domain-containing protein
35 JALDUQ010000001.1 GCA023109655_00017 CDS open 12590-13282 _na     230_aa ABC transmembrane type-1 domain-containing protein
36 JALDUQ010000001.1 GCA023109655_00018 CDS open 13286-14008 _na     240_aa ABC transmembrane type-1 domain-containing protein
37 JALDUQ010000001.1 GCA023109655_00019 CDS open 14018-14782 _na     254_aa glnQ Glutamine ABC transporter%2C ATP-binding protein GlnQ
38 JALDUQ010000001.1 GCA023109655_00020 CDS open 14985-18701 _na     1238_aa pullulanase
39 JALDUQ010000001.1 GCA023109655_00021 CDS open 19145-22756 _na     1203_aa rpoB DNA-directed RNA polymerase subunit beta
40 JALDUQ010000001.1 GCA023109655_00022 CDS open 22789-26454 _na     1221_aa rpoC DNA-directed RNA polymerase subunit beta'
41 JALDUQ010000001.1 GCA023109655_00023 CDS open 26563-26982 _na     139_aa ndk nucleoside-diphosphate kinase
42 JALDUQ010000001.1 GCA023109655_00024 CDS open 27114-27737 _na     207_aa Lipoprotein
43 JALDUQ010000001.1 GCA023109655_00025 CDS open 27823-28266 _na     147_aa tsaE tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE
44 JALDUQ010000001.1 GCA023109655_00026 CDS open 28256-28777 _na     173_aa Spermidine N(1)-acetyltransferase
45 JALDUQ010000001.1 GCA023109655_00027 CDS open 28770-29822 _na     350_aa brpA biofilm formation/cell division transcriptional regulator BrpA
46 JALDUQ010000001.1 GCA023109655_00028 CDS open 29897-31153 _na     418_aa competence/damage-inducible protein A
47 JALDUQ010000001.1 GCA023109655_00029 CDS open 31208-32356 _na     382_aa recA recombinase RecA
48 JALDUQ010000001.1 GCA023109655_00030 CDS open 32475-33029 _na     184_aa N-acetyltransferase domain-containing protein
49 JALDUQ010000001.1 GCA023109655_00031 CDS open 33139-34509 _na     456_aa MATE efflux family protein
50 JALDUQ010000001.1 GCA023109655_00032 CDS open 34606-35322 _na     238_aa tACO1 YebC/PmpR family DNA-binding transcriptional regulator
51 JALDUQ010000001.1 GCA023109655_00033 CDS open 35370-36038 _na     222_aa CD20-like family protein
52 JALDUQ010000001.1 GCA023109655_00034 CDS open 36253-36714 _na     153_aa marR Transcriptional regulator%2C MarR family
53 JALDUQ010000001.1 GCA023109655_00035 CDS open 36698-38467 _na     589_aa ABC transporter ATP-binding protein
54 JALDUQ010000001.1 GCA023109655_00036 CDS open 38457-40217 _na     586_aa ABC transporter ATP-binding protein
55 JALDUQ010000001.1 GCA023109655_00037 CDS open 40315-40818 _na     167_aa bcrC Undecaprenyl-diphosphatase BcrC
56 JALDUQ010000001.1 GCA023109655_00038 CDS open 40932-41378 _na     148_aa lytTR HTH LytTR-type domain-containing protein
57 JALDUQ010000001.1 GCA023109655_00039 CDS open 41384-42058 _na     224_aa liaF LiaF transmembrane domain-containing protein
58 JALDUQ010000001.1 GCA023109655_00040 CDS open 42163-42351 _na     62_aa rpmB 50S ribosomal protein L28
59 JALDUQ010000001.1 GCA023109655_00041 CDS open 42504-42869 _na     121_aa yloU Asp23/Gls24 family envelope stress response protein
60 JALDUQ010000001.1 GCA023109655_00042 CDS open 42872-44539 _na     555_aa fakA DhaL domain-containing protein
61 JALDUQ010000001.1 GCA023109655_00043 CDS open 44680-44871 _na     63_aa Alanine aminotransferase
62 JALDUQ010000001.1 GCA023109655_00044 CDS open 44868-45062 _na     64_aa Alanine aminotransferase
63 JALDUQ010000001.1 GCA023109655_00045 CDS open 45049-45924 _na     291_aa yxlF Putative ABC transporter ATP-binding protein YxlF
64 JALDUQ010000001.1 GCA023109655_00046 CDS open 45937-46671 _na     244_aa Multidrug ABC transporter permease
65 JALDUQ010000001.1 GCA023109655_00047 CDS open 46676-47773 _na     365_aa histidine kinase
66 JALDUQ010000001.1 GCA023109655_00048 CDS open 47775-48374 _na     199_aa citB Response regulator
67 JALDUQ010000001.1 GCA023109655_00049 CDS open 48677-49090 _na     137_aa rpsL 30S ribosomal protein S12
68 JALDUQ010000001.1 GCA023109655_00050 CDS open 49110-49580 _na     156_aa rpsG 30S ribosomal protein S7
69 JALDUQ010000001.1 GCA023109655_00051 CDS open 49857-51938 _na     693_aa fusA elongation factor G
70 JALDUQ010000001.1 GCA023109655_00052 CDS open 52269-53969 _na     566_aa ilvB acetolactate synthase large subunit
71 JALDUQ010000001.1 GCA023109655_00053 CDS open 53962-54438 _na     158_aa ilvN acetolactate synthase small subunit
72 JALDUQ010000001.1 GCA023109655_00054 CDS open 54529-55551 _na     340_aa ilvC ketol-acid reductoisomerase
73 JALDUQ010000001.1 GCA023109655_00055 CDS open 55631-56881 _na     416_aa ilvA threonine ammonia-lyase IlvA
74 JALDUQ010000001.1 GCA023109655_00056 CDS open 56964-57860 _na     298_aa hflK Modulator of FtsH protease HflK
75 JALDUQ010000001.1 GCA023109655_00057 CDS open 57967-58182 _na     71_aa Spermidine synthase
76 JALDUQ010000001.1 GCA023109655_00058 CDS open 58275-59015 _na     246_aa glnQ ABC transporter ATP-binding protein
77 JALDUQ010000001.1 GCA023109655_00059 CDS open 59012-60580 _na     522_aa hisJ Glutamine ABC transporter substrate-binding protein
78 JALDUQ010000001.1 GCA023109655_00060 CDS open 60711-62603 _na     630_aa Threonine dehydratase
79 JALDUQ010000001.1 GCA023109655_00061 CDS open 62663-63508 _na     281_aa uppP undecaprenyl-diphosphate phosphatase
80 JALDUQ010000001.1 GCA023109655_00062 CDS open 63542-64603 _na     353_aa dinB DNA polymerase IV
81 JALDUQ010000001.1 GCA023109655_00063 CDS open 64836-67151 _na     771_aa pflB formate C-acetyltransferase
82 JALDUQ010000001.1 GCA023109655_00064 CDS open 67547-69652 _na     701_aa clpL ATP-dependent Clp protease ATP-binding subunit ClpL
83 JALDUQ010000001.1 GCA023109655_00065 CDS open 69712-70194 _na     160_aa luxS S-ribosylhomocysteine lyase
84 JALDUQ010000001.1 GCA023109655_00066 CDS open 70481-71188 _na     235_aa Multidrug ABC transporter
85 JALDUQ010000001.1 GCA023109655_00067 CDS open 71190-71978 _na     262_aa ABC-2 family transporter protein
86 JALDUQ010000001.1 GCA023109655_00068 CDS open 71978-72700 _na     240_aa ABC-2 family transporter protein
87 JALDUQ010000001.1 GCA023109655_00069 CDS open 72713-73411 _na     232_aa arlR Response regulator ArlR
88 JALDUQ010000001.1 GCA023109655_00070 CDS open 73378-74409 _na     343_aa histidine kinase
89 JALDUQ010000001.1 GCA023109655_00071 CDS open 74542-76026 _na     494_aa UPF0371 protein SP70585_0405
90 JALDUQ010000001.1 GCA023109655_00072 CDS open 76179-77789 _na     536_aa dexB Glucan 1%2C6-alpha-glucosidase
91 JALDUQ010000001.1 GCA023109655_00073 CDS open 77958-79925 _na     655_aa amiA Oligopeptide-binding protein AmiA
92 JALDUQ010000001.1 GCA023109655_00074 CDS open 80082-82043 _na     653_aa sarA Oligopeptide-binding protein SarA
93 JALDUQ010000001.1 GCA023109655_00075 CDS open 82235-83680 _na     481_aa Cell envelope-related transcriptional attenuator domain-containing protein
94 JALDUQ010000001.1 GCA023109655_00076 CDS open 83682-84413 _na     243_aa cps4B capsular polysaccharide biosynthesis protein Cps4B
95 JALDUQ010000001.1 GCA023109655_00077 CDS open 84422-85114 _na     230_aa cpsC capsular polysaccharide biosynthesis protein CpsC
96 JALDUQ010000001.1 GCA023109655_00078 CDS open 85124-85807 _na     227_aa cpsD Tyrosine-protein kinase CpsD
97 JALDUQ010000001.1 GCA023109655_00079 CDS open 85830-87197 _na     455_aa epsL Putative sugar transferase EpsL
98 JALDUQ010000001.1 GCA023109655_00080 CDS open 87202-87987 _na     261_aa Putative LicD-family phosphotransferase
99 JALDUQ010000001.1 GCA023109655_00081 CDS open 87965-88729 _na     254_aa Putative N-acetylmannosaminyltransferase
100 JALDUQ010000001.1 GCA023109655_00082 CDS open 88704-89789 _na     361_aa Glycosyltransferase%2C group 1 family protein
101 JALDUQ010000001.1 GCA023109655_00083 CDS open 89786-90880 _na     364_aa wecB non-hydrolyzing UDP-N-acetylglucosamine 2-epimerase
102 JALDUQ010000001.1 GCA023109655_00084 CDS open 90880-91845 _na     321_aa epsJ Putative glycosyltransferase EpsJ
103 JALDUQ010000001.1 GCA023109655_00085 CDS open 91852-93267 _na     471_aa Polysaccharide biosynthesis protein
104 JALDUQ010000001.1 GCA023109655_00086 CDS open 93447-94595 _na     382_aa Putative membrane protein
105 JALDUQ010000001.1 GCA023109655_00087 CDS open 94739-95836 _na     365_aa glf UDP-galactopyranose mutase
106 JALDUQ010000001.1 GCA023109655_00088 CDS open 95861-96916 _na     351_aa Galactofuranosyltransferase
107 JALDUQ010000001.1 GCA023109655_00089 CDS open 97153-99135 _na     660_aa ABC transporter%2C substrate-binding protein%2C family 5
108 JALDUQ010000001.1 GCA023109655_00090 CDS open 99403-105870 _na     2155_aa SpGH101 family endo-alpha-N-acetylgalactosaminidase
109 JALDUQ010000001.1 GCA023109655_00091 CDS open 106010-114259 _na     2749_aa SIALI-17 repeat-containing surface protein
110 JALDUQ010000001.1 GCA023109655_00092 CDS open 114427-116592 _na     721_aa pbp1a penicillin-binding protein PBP1A
111 JALDUQ010000001.1 GCA023109655_00093 CDS open 116589-117185 _na     198_aa recU Holliday junction resolvase RecU
112 JALDUQ010000001.1 GCA023109655_00094 CDS open 117252-117779 _na     175_aa DUF1273 domain-containing protein
113 JALDUQ010000001.1 GCA023109655_00095 CDS open 117849-118175 _na     108_aa gpsB cell division regulator GpsB
114 JALDUQ010000001.1 GCA023109655_00097 CDS open 118664-119821 _na     385_aa rlmL THUMP domain-containing protein
115 JALDUQ010000001.1 GCA023109655_00098 CDS open 119834-121276 _na     480_aa Mid-cell-anchored protein Z
116 JALDUQ010000001.1 GCA023109655_00099 CDS open 121352-122776 _na     474_aa gndA NADP-dependent phosphogluconate dehydrogenase
117 JALDUQ010000001.1 GCA023109655_00100 CDS open 122788-123477 _na     229_aa arlR Response regulator ArlR
118 JALDUQ010000001.1 GCA023109655_00101 CDS open 123577-124491 _na     304_aa Cell wall-binding repeat protein
119 JALDUQ010000001.1 GCA023109655_00102 CDS open 124488-124610 _na     40_aa Cell wall-binding repeat protein
120 JALDUQ010000001.1 GCA023109655_00103 CDS open 124728-125606 _na     292_aa mvk mevalonate kinase
121 JALDUQ010000001.1 GCA023109655_00104 CDS open 125588-126541 _na     317_aa mvaD diphosphomevalonate decarboxylase
122 JALDUQ010000001.1 GCA023109655_00105 CDS open 126528-127535 _na     335_aa phosphomevalonate kinase
123 JALDUQ010000001.1 GCA023109655_00106 CDS open 127519-128520 _na     333_aa fni type 2 isopentenyl-diphosphate Delta-isomerase
124 JALDUQ010000001.1 GCA023109655_00107 CDS open 128686-129384 _na     232_aa liaF Cell wall-active antibiotics response LiaF-like C-terminal domain-containing protein
125 JALDUQ010000001.1 GCA023109655_00108 CDS open 129381-130379 _na     332_aa Sensor histidine kinase
126 JALDUQ010000001.1 GCA023109655_00109 CDS open 130389-131021 _na     210_aa citB Response regulator
127 JALDUQ010000001.1 GCA023109655_00110 CDS open 131022-131678 _na     218_aa DNA alkylation repair enzyme
128 JALDUQ010000001.1 GCA023109655_00111 CDS open 131769-133052 _na     427_aa tig trigger factor
129 JALDUQ010000001.1 GCA023109655_00112 CDS open 133100-135466 _na     788_aa recD ATP-dependent RecD2 DNA helicase
130 JALDUQ010000001.1 GCA023109655_00113 CDS open 135596-136210 _na     204_aa lepB signal peptidase I
131 JALDUQ010000001.1 GCA023109655_00114 CDS open 136214-137095 _na     293_aa rnhC ribonuclease HIII
132 JALDUQ010000001.1 GCA023109655_00115 CDS open 137182-137484 _na     100_aa zapA Cell division protein ZapA
133 JALDUQ010000001.1 GCA023109655_00116 CDS open 137481-138029 _na     182_aa cvpA CvpA family protein
134 JALDUQ010000001.1 GCA023109655_00117 CDS open 138143-140479 _na     778_aa mutS2 endonuclease MutS2
135 JALDUQ010000001.1 GCA023109655_00118 CDS open 140826-142148 _na     440_aa alsT Amino acid carrier family protein
136 JALDUQ010000001.1 GCA023109655_00119 CDS open 142280-142828 _na     182_aa yciW Carboxymuconolactone decarboxylase-like domain-containing protein
137 JALDUQ010000001.1 GCA023109655_00120 CDS open 142938-143837 _na     299_aa tehA Exfoliative toxin A
138 JALDUQ010000001.1 GCA023109655_00121 CDS open 143863-145137 _na     424_aa serS serine--tRNA ligase
139 JALDUQ010000001.1 GCA023109655_00122 CDS open 145351-145722 _na     123_aa manO PTS mannose transporter accessory protein ManO
140 JALDUQ010000001.1 GCA023109655_00123 CDS open 145725-147089 _na     454_aa metL1 aspartate kinase
141 JALDUQ010000001.1 GCA023109655_00124 CDS open 147373-148158 _na     261_aa enoyl-CoA hydratase
142 JALDUQ010000001.1 GCA023109655_00125 CDS open 148249-148683 _na     144_aa HTH marR-type domain-containing protein
143 JALDUQ010000001.1 GCA023109655_00126 CDS open 148683-149657 _na     324_aa Beta-ketoacyl-[acyl-carrier-protein] synthase III
144 JALDUQ010000001.1 GCA023109655_00127 CDS open 149714-149938 _na     74_aa acpP Acyl carrier protein
145 JALDUQ010000001.1 GCA023109655_00128 CDS open 150056-151030 _na     324_aa fabK enoyl-[acyl-carrier-protein] reductase FabK
146 JALDUQ010000001.1 GCA023109655_00129 CDS open 151023-151943 _na     306_aa fabD ACP S-malonyltransferase
147 JALDUQ010000001.1 GCA023109655_00130 CDS open 151988-152719 _na     243_aa fabG 3-oxoacyl-[acyl-carrier-protein] reductase
148 JALDUQ010000001.1 GCA023109655_00131 CDS open 152748-153983 _na     411_aa fabF beta-ketoacyl-ACP synthase II
149 JALDUQ010000001.1 GCA023109655_00132 CDS open 153986-154468 _na     160_aa accB acetyl-CoA carboxylase biotin carboxyl carrier protein
150 JALDUQ010000001.1 GCA023109655_00133 CDS open 154465-154887 _na     140_aa fabZ 3-hydroxyacyl-ACP dehydratase FabZ
151 JALDUQ010000001.1 GCA023109655_00134 CDS open 154899-156266 _na     455_aa accC acetyl-CoA carboxylase biotin carboxylase subunit
152 JALDUQ010000001.1 GCA023109655_00135 CDS open 156302-157168 _na     288_aa accD acetyl-CoA carboxylase%2C carboxyltransferase subunit beta
153 JALDUQ010000001.1 GCA023109655_00136 CDS open 157165-157932 _na     255_aa acetyl-CoA carboxylase carboxyl transferase subunit alpha
154 JALDUQ010000001.1 GCA023109655_00137 CDS open 158288-159013 _na     241_aa CPBP family intramembrane metalloprotease
155 JALDUQ010000001.1 GCA023109655_00138 CDS open 159085-159393 _na     102_aa briC biofilm-regulating peptide BriC
156 JALDUQ010000001.1 GCA023109655_00139 CDS open 159412-160134 _na     240_aa CAAX amino terminal protease family protein
157 JALDUQ010000001.1 GCA023109655_00140 CDS open 160185-160607 _na     140_aa nusB transcription antitermination factor NusB
158 JALDUQ010000001.1 GCA023109655_00141 CDS open 160600-160989 _na     129_aa yloU General stress protein%2C Gls24 family
159 JALDUQ010000001.1 GCA023109655_00142 CDS open 161011-161571 _na     186_aa efp elongation factor P
160 JALDUQ010000001.1 GCA023109655_00143 CDS open 161653-162780 _na     375_aa SPFH domain-containing protein
161 JALDUQ010000001.1 GCA023109655_00144 CDS open 162789-163733 _na     314_aa Tim44-like domain-containing protein
162 JALDUQ010000001.1 GCA023109655_00145 CDS open 163796-164191 _na     131_aa Aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B
163 JALDUQ010000001.1 GCA023109655_00146 CDS open 164280-164675 _na     131_aa Membrane protein (TMS4)
164 JALDUQ010000001.1 GCA023109655_00147 CDS open 164733-166178 _na     481_aa gatB Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB
165 JALDUQ010000001.1 GCA023109655_00148 CDS open 166178-167644 _na     488_aa gatA Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA
166 JALDUQ010000001.1 GCA023109655_00149 CDS open 167644-167946 _na     100_aa gatC Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC
167 JALDUQ010000001.1 GCA023109655_00150 CDS open 168112-168804 _na     230_aa Integral membrane protein
168 JALDUQ010000001.1 GCA023109655_00151 CDS open 168948-170492 _na     514_aa prfC peptide chain release factor 3
169 JALDUQ010000001.1 GCA023109655_00152 CDS open 171015-171968 _na     317_aa Putative aromatic acid exporter C-terminal domain-containing protein
170 JALDUQ010000001.1 GCA023109655_00153 CDS open 172018-173229 _na     403_aa sstT serine/threonine transporter SstT
171 JALDUQ010000001.1 GCA023109655_00154 CDS open 173379-173939 _na     186_aa Small conductance mechanosensitive ion channel protein
172 JALDUQ010000001.1 GCA023109655_00155 CDS open 173997-174905 _na     302_aa corA Magnesium and cobalt transporter CorA
173 JALDUQ010000001.1 GCA023109655_00156 CDS open 174920-175447 _na     175_aa UMP phosphatase
174 JALDUQ010000001.1 GCA023109655_00157 CDS open 175450-176556 _na     368_aa yqeH ribosome biogenesis GTPase YqeH
175 JALDUQ010000001.1 GCA023109655_00158 CDS open 176770-177081 _na     103_aa yhbY ribosome assembly RNA-binding protein YhbY
176 JALDUQ010000001.1 GCA023109655_00159 CDS open 177132-177761 _na     209_aa nadD nicotinate-nucleotide adenylyltransferase
177 JALDUQ010000001.1 GCA023109655_00160 CDS open 177761-178354 _na     197_aa yqeK bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK
178 JALDUQ010000001.1 GCA023109655_00161 CDS open 178355-178855 _na     166_aa Isochorismatase family protein
179 JALDUQ010000001.1 GCA023109655_00162 CDS open 178868-179221 _na     117_aa rsfS ribosome silencing factor
180 JALDUQ010000001.1 GCA023109655_00163 CDS open 179368-180168 _na     266_aa SAM-dependent methyltransferase
181 JALDUQ010000001.1 GCA023109655_00164 CDS open 180178-181275 _na     365_aa tmcAL nucleotidyltransferase
182 JALDUQ010000001.1 GCA023109655_00165 CDS open 181479-183092 _na     537_aa rny ribonuclease Y
183 JALDUQ010000001.1 GCA023109655_00166 CDS open 183227-183853 _na     208_aa gmk guanylate kinase
184 JALDUQ010000001.1 GCA023109655_00167 CDS open 183878-184192 _na     104_aa rpoZ DNA-directed RNA polymerase subunit omega
185 JALDUQ010000001.1 GCA023109655_00168 CDS open 184258-186654 _na     798_aa priA primosomal protein N'
186 JALDUQ010000001.1 GCA023109655_00169 CDS open 186667-187602 _na     311_aa fmt methionyl-tRNA formyltransferase
187 JALDUQ010000001.1 GCA023109655_00170 CDS open 187595-188908 _na     437_aa rsmB 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB
188 JALDUQ010000001.1 GCA023109655_00171 CDS open 188924-189664 _na     246_aa phpP Stp1/IreP family PP2C-type Ser/Thr phosphatase
189 JALDUQ010000001.1 GCA023109655_00172 CDS open 189661-191541 _na     626_aa pknB Stk1 family PASTA domain-containing Ser/Thr kinase
190 JALDUQ010000001.1 GCA023109655_00173 CDS open 191627-192385 _na     252_aa Threonine/serine exporter-like N-terminal domain-containing protein
191 JALDUQ010000001.1 GCA023109655_00174 CDS open 192387-192842 _na     151_aa thrE Threonine/Serine exporter ThrE domain-containing protein
192 JALDUQ010000001.1 GCA023109655_00175 CDS open 192961-194133 _na     390_aa hydroxymethylglutaryl-CoA synthase
193 JALDUQ010000001.1 GCA023109655_00176 CDS open 194133-195407 _na     424_aa hMG1 hydroxymethylglutaryl-CoA reductase%2C degradative
194 JALDUQ010000001.1 GCA023109655_00177 CDS open 195441-196406 _na     321_aa purR HTH lacI-type domain-containing protein
195 JALDUQ010000001.1 GCA023109655_00178 CDS open 196387-197841 _na     484_aa sacC Sucrose-6-phosphate hydrolase
196 JALDUQ010000001.1 GCA023109655_00179 CDS open 198219-200105 _na     628_aa PTS system sucrose-specific IIBC component
197 JALDUQ010000001.1 GCA023109655_00180 CDS open 200264-201151 _na     295_aa scrK fructokinase ScrK
198 JALDUQ010000001.1 GCA023109655_00181 CDS open 201475-202092 _na     205_aa tVP38 TVP38/TMEM64 family membrane protein
199 JALDUQ010000001.1 GCA023109655_00182 CDS open 202226-204850 _na     874_aa Helicase ATP-binding domain-containing protein
200 JALDUQ010000001.1 GCA023109655_00183 CDS open 204930-207920 _na     996_aa Type I restriction enzyme endonuclease subunit
201 JALDUQ010000001.1 GCA023109655_00184 CDS open 208465-209202 _na     245_aa Hemagglutinin
202 JALDUQ010000001.1 GCA023109655_00185 CDS open 209658-209930 _na     90_aa hypothetical protein
203 JALDUQ010000001.1 GCA023109655_00186 CDS open 209930-210877 _na     315_aa RNA-directed DNA polymerase
204 JALDUQ010000001.1 GCA023109655_00187 CDS open 210858-212108 _na     416_aa Type I restriction modification DNA specificity domain protein
205 JALDUQ010000001.1 GCA023109655_00188 CDS open 212118-213986 _na     622_aa AAA domain protein
206 JALDUQ010000001.1 GCA023109655_00189 CDS open 214031-215632 _na     533_aa hsdM type I restriction-modification system subunit M
207 JALDUQ010000001.1 GCA023109655_00190 CDS open 215669-216457 _na     262_aa hypothetical protein
208 JALDUQ010000001.1 GCA023109655_00191 CDS open 216472-216909 _na     145_aa DUF1722 domain-containing protein
209 JALDUQ010000001.1 GCA023109655_00192 CDS open 216893-217255 _na     120_aa Pyrimidine dimer DNA glycosylase
210 JALDUQ010000001.1 GCA023109655_00193 CDS open 217413-217736 _na     107_aa Phage-related protein
211 JALDUQ010000001.1 GCA023109655_00194 CDS open 217769-218062 _na     97_aa aF2118 HTH cro/C1-type domain-containing protein
212 JALDUQ010000001.1 GCA023109655_00195 CDS open 218414-220663 _na     749_aa metE 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase
213 JALDUQ010000001.1 GCA023109655_00196 CDS open 220725-221591 _na     288_aa metF methylenetetrahydrofolate reductase [NAD(P)H]
214 JALDUQ010000001.1 GCA023109655_00197 CDS open 222047-224260 _na     737_aa pnp polyribonucleotide nucleotidyltransferase
215 JALDUQ010000001.1 GCA023109655_00198 CDS open 224276-224893 _na     205_aa cysE serine O-acetyltransferase
216 JALDUQ010000001.1 GCA023109655_00199 CDS open 224905-225771 _na     288_aa N-acetyltransferase domain-containing protein
217 JALDUQ010000001.1 GCA023109655_00200 CDS open 225776-226540 _na     254_aa Uridine phosphorylase
218 JALDUQ010000001.1 GCA023109655_00201 CDS open 226549-227070 _na     173_aa Diacylglycerol kinase
219 JALDUQ010000001.1 GCA023109655_00202 CDS open 227088-228431 _na     447_aa cysS cysteine--tRNA ligase
220 JALDUQ010000001.1 GCA023109655_00203 CDS open 228424-228810 _na     128_aa mrnC Mini-ribonuclease 3
221 JALDUQ010000001.1 GCA023109655_00204 CDS open 228814-229683 _na     289_aa pucR PucR C-terminal helix-turn-helix domain-containing protein
222 JALDUQ010000001.1 GCA023109655_00205 CDS open 229797-230927 _na     376_aa malK ABC transporter family protein
223 JALDUQ010000001.1 GCA023109655_00206 CDS open 231066-233282 _na     738_aa spoT GTP diphosphokinase
224 JALDUQ010000001.1 GCA023109655_00207 CDS open 233312-233755 _na     147_aa dtd D-aminoacyl-tRNA deacylase
225 JALDUQ010000001.1 GCA023109655_00208 CDS open 233787-234200 _na     137_aa Histidine kinase
226 JALDUQ010000001.1 GCA023109655_00209 CDS open 234308-234958 _na     216_aa mntR Transcriptional regulator MntR
227 JALDUQ010000001.1 GCA023109655_00210 CDS open 235042-235536 _na     164_aa tpx thiol peroxidase
228 JALDUQ010000001.1 GCA023109655_00211 CDS open 235659-236588 _na     309_aa psaA Manganese ABC transporter substrate-binding lipoprotein PsaA
229 JALDUQ010000001.1 GCA023109655_00212 CDS open 236615-237463 _na     282_aa znuB Manganese ABC transporter permease
230 JALDUQ010000001.1 GCA023109655_00213 CDS open 237460-238182 _na     240_aa znuC High-affinity zinc uptake system ATP-binding protein ZnuC
231 JALDUQ010000001.1 GCA023109655_00214 CDS open 238362-240254 _na     630_aa pepO Neutral endopeptidase
232 JALDUQ010000001.1 GCA023109655_00215 CDS open 240293-240922 _na     209_aa gloB Hydroxyacylglutathione hydrolase
233 JALDUQ010000001.1 GCA023109655_00216 CDS open 241007-242080 _na     357_aa Triacylglycerol lipase
234 JALDUQ010000001.1 GCA023109655_00217 CDS open 242237-242914 _na     225_aa ompR Response regulator protein GraR
235 JALDUQ010000001.1 GCA023109655_00218 CDS open 242907-243881 _na     324_aa histidine kinase
236 JALDUQ010000001.1 GCA023109655_00219 CDS open 243929-245872 _na     647_aa thrS threonine--tRNA ligase
237 JALDUQ010000001.1 GCA023109655_00220 CDS open 246207-246581 _na     124_aa Multipass membrane protein
238 JALDUQ010000001.1 GCA023109655_00221 CDS open 246779-247621 _na     280_aa Ser/Thr phosphatase family protein
239 JALDUQ010000001.1 GCA023109655_00222 CDS open 247694-248131 _na     145_aa ywnA Putative HTH-type transcriptional regulator YwnA
240 JALDUQ010000001.1 GCA023109655_00223 CDS open 248199-249221 _na     340_aa DUF218 domain-containing protein
241 JALDUQ010000001.1 GCA023109655_00224 CDS open 249511-249948 _na     145_aa ROK domain protein
242 JALDUQ010000001.1 GCA023109655_00225 CDS open 250173-250310 _na     45_aa hypothetical protein
243 JALDUQ010000001.1 GCA023109655_00226 CDS open 250358-250570 _na     70_aa abrB SpoVT-AbrB domain-containing protein
244 JALDUQ010000001.1 GCA023109655_00227 CDS open 250572-251306 _na     244_aa ABC transporter ATP-binding protein
245 JALDUQ010000001.1 GCA023109655_00228 CDS open 251306-251956 _na     216_aa ABC-2 type transporter
246 JALDUQ010000001.1 GCA023109655_00229 CDS open 252258-252917 _na     219_aa hisM ABC transmembrane type-1 domain-containing protein
247 JALDUQ010000001.1 GCA023109655_00230 CDS open 252927-253604 _na     225_aa hisM ABC transporter permease subunit
248 JALDUQ010000001.1 GCA023109655_00231 CDS open 253617-254411 _na     264_aa hisJ Major cell-binding factor
249 JALDUQ010000001.1 GCA023109655_00232 CDS open 254422-255180 _na     252_aa glnQ Glutamine ABC transporter%2C ATP-binding protein GlnQ
250 JALDUQ010000001.1 GCA023109655_00233 CDS open 255358-257577 _na     739_aa recJ single-stranded-DNA-specific exonuclease RecJ
251 JALDUQ010000001.1 GCA023109655_00234 CDS open 257753-259414 _na     553_aa rnjA Ribonuclease J
252 JALDUQ010000001.1 GCA023109655_00235 CDS open 259483-260262 _na     259_aa Esterase
253 JALDUQ010000001.1 GCA023109655_00236 CDS open 260367-261068 _na     233_aa Matrixin
254 JALDUQ010000001.1 GCA023109655_00237 CDS open 261170-262993 _na     607_aa uvrC excinuclease ABC subunit UvrC
255 JALDUQ010000001.1 GCA023109655_00238 CDS open 263619-264458 _na     279_aa yfcE Serine/threonine protein phosphatase
256 JALDUQ010000001.1 GCA023109655_00239 CDS open 264620-265141 _na     173_aa Lipoprotein
257 JALDUQ010000001.1 GCA023109655_00240 CDS open 265327-265932 _na     201_aa nfnB Nitroreductase
258 JALDUQ010000001.1 GCA023109655_00241 CDS open 265944-267344 _na     466_aa pepV dipeptidase PepV
259 JALDUQ010000001.1 GCA023109655_00242 CDS open 267398-267988 _na     196_aa Uracil-DNA glycosylase-like domain-containing protein
260 JALDUQ010000001.1 GCA023109655_00243 CDS open 267985-268272 _na     95_aa moeZ Putative adenylyltransferase/sulfurtransferase MoeZ
261 JALDUQ010000001.1 GCA023109655_00245 CDS open 268458-269783 _na     441_aa brnQ branched-chain amino acid transport system II carrier protein
262 JALDUQ010000001.1 GCA023109655_00246 CDS open 269832-270383 _na     183_aa DUF1307 domain-containing protein
263 JALDUQ010000001.1 GCA023109655_00247 CDS open 270522-271559 _na     345_aa frvX Deblocking aminopeptidase
264 JALDUQ010000001.1 GCA023109655_00248 CDS open 271561-272022 _na     153_aa HIT domain-containing protein
265 JALDUQ010000001.1 GCA023109655_00249 CDS open 272038-272754 _na     238_aa ldcB LD-carboxypeptidase LdcB/DacB
266 JALDUQ010000001.1 GCA023109655_00250 CDS open 272877-273302 _na     141_aa Large ribosomal subunit protein uL11
267 JALDUQ010000001.1 GCA023109655_00251 CDS open 273510-274199 _na     229_aa rplA 50S ribosomal protein L1
268 JALDUQ010000001.1 GCA023109655_00252 CDS open 274375-274887 _na     170_aa apt adenine phosphoribosyltransferase
269 JALDUQ010000001.1 GCA023109655_00253 CDS open 275074-276018 _na     314_aa metA homoserine O-succinyltransferase
270 JALDUQ010000001.1 GCA023109655_00254 CDS open 276027-276704 _na     225_aa dnaD DnaD domain protein
271 JALDUQ010000001.1 GCA023109655_00255 CDS open 276801-277559 _na     252_aa tpiA triose-phosphate isomerase
272 JALDUQ010000001.1 GCA023109655_00256 CDS open 277739-279475 _na     578_aa msbA Lipid A export ATP-binding/permease protein MsbA
273 JALDUQ010000001.1 GCA023109655_00257 CDS open 279484-281265 _na     593_aa ABC transporter%2C ATP-binding protein
274 JALDUQ010000001.1 GCA023109655_00258 CDS open 281415-281933 _na     172_aa DNA protection during starvation protein
275 JALDUQ010000001.1 GCA023109655_00259 CDS open 282144-282482 _na     112_aa yjdM Protein YjdM
276 JALDUQ010000001.1 GCA023109655_00260 CDS open 282485-283108 _na     207_aa Pr6Pr family membrane protein
277 JALDUQ010000001.1 GCA023109655_00261 CDS open 283221-284372 _na     383_aa Transporter%2C major facilitator family protein
278 JALDUQ010000001.1 GCA023109655_00262 CDS open 284472-285221 _na     249_aa truA tRNA pseudouridine(38-40) synthase TruA
279 JALDUQ010000001.1 GCA023109655_00263 CDS open 285211-285984 _na     257_aa thiD bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase
280 JALDUQ010000001.1 GCA023109655_00264 CDS open 285962-286423 _na     153_aa eCF-S Integral membrane protein
281 JALDUQ010000001.1 GCA023109655_00265 CDS open 286526-287608 _na     360_aa pepP Proline dipeptidase
282 JALDUQ010000001.1 GCA023109655_00266 CDS open 287736-288518 _na     260_aa gatD lipid II isoglutaminyl synthase subunit GatD
283 JALDUQ010000001.1 GCA023109655_00267 CDS open 288518-289861 _na     447_aa murT lipid II isoglutaminyl synthase subunit MurT
284 JALDUQ010000001.1 GCA023109655_00268 CDS open 290153-290908 _na     251_aa Aminoglycoside 6-adenylyltransferase
285 JALDUQ010000001.1 GCA023109655_00269 CDS open 291510-292826 _na     438_aa lpd FAD-containing oxidoreductase
286 JALDUQ010000001.1 GCA023109655_00270 CDS open 293175-294737 _na     520_aa cshA DEAD-box ATP-dependent RNA helicase CshA
287 JALDUQ010000001.1 GCA023109655_00271 CDS open 295019-295807 _na     262_aa codY GTP-sensing pleiotropic transcriptional regulator CodY
288 JALDUQ010000001.1 GCA023109655_00272 CDS open 295807-296382 _na     191_aa Isochorismatase family protein
289 JALDUQ010000001.1 GCA023109655_00274 CDS open 296926-298203 _na     425_aa lolE Macrolide export ATP-binding/permease protein MacB
290 JALDUQ010000001.1 GCA023109655_00275 CDS open 298216-298863 _na     215_aa lolD ABC transporter ATP-binding subunit Vex2
291 JALDUQ010000001.1 GCA023109655_00276 CDS open 298914-300293 _na     459_aa lolE ABC transporter permease subunit Vex3
292 JALDUQ010000001.1 GCA023109655_00277 CDS open 300542-301198 _na     218_aa vncR response regulator transcription factor VncR
293 JALDUQ010000001.1 GCA023109655_00278 CDS open 301195-302523 _na     442_aa vncS sensor histidine kinase VncS
294 JALDUQ010000001.1 GCA023109655_00279 CDS open 302663-303544 _na     293_aa fba class II fructose-bisphosphate aldolase
295 JALDUQ010000001.1 GCA023109655_00280 CDS open 303816-304808 _na     330_aa ATP-binding cassette domain-containing protein
296 JALDUQ010000001.1 GCA023109655_00281 CDS open 304810-305628 _na     272_aa Antibiotic ABC transporter permease
297 JALDUQ010000001.1 GCA023109655_00282 CDS open 305630-306415 _na     261_aa Multidrug ABC transporter permease
298 JALDUQ010000001.1 GCA023109655_00284 CDS open 306883-307782 _na     299_aa DUF6287 domain-containing protein
299 JALDUQ010000001.1 GCA023109655_00285 CDS open 308009-308326 _na     105_aa liaF LiaF transmembrane domain-containing protein
300 JALDUQ010000001.1 GCA023109655_00286 CDS open 308354-310153 _na     599_aa N-acetylmuramoyl-L-alanine amidase
301 JALDUQ010000001.1 GCA023109655_00287 CDS open 310199-311107 _na     302_aa lysR HTH lysR-type domain-containing protein
302 JALDUQ010000001.1 GCA023109655_00288 CDS open 311183-311440 _na     85_aa DUF910 domain-containing protein
303 JALDUQ010000001.1 GCA023109655_00289 CDS open 311440-311820 _na     126_aa pspE Thiosulfate sulfurtransferase GlpE
304 JALDUQ010000001.1 GCA023109655_00290 CDS open 311907-312140 _na     77_aa DUF4190 domain-containing protein
305 JALDUQ010000001.1 GCA023109655_00291 CDS open 312181-312906 _na     241_aa Pseudouridine synthase
306 JALDUQ010000001.1 GCA023109655_00292 CDS open 313066-314907 _na     613_aa typA translational GTPase TypA
307 JALDUQ010000001.1 GCA023109655_00293 CDS open 314927-315181 _na     84_aa Monovalent cation/H+ antiporter subunit F domain protein
308 JALDUQ010000001.1 GCA023109655_00294 CDS open 315299-316651 _na     450_aa murD UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase
309 JALDUQ010000001.1 GCA023109655_00295 CDS open 316653-317711 _na     352_aa murG UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase
310 JALDUQ010000001.1 GCA023109655_00296 CDS open 317721-318869 _na     382_aa Cell division protein DivIB
311 JALDUQ010000001.1 GCA023109655_00297 CDS open 319116-319811 _na     231_aa pyrF orotidine-5'-phosphate decarboxylase
312 JALDUQ010000001.1 GCA023109655_00298 CDS open 319851-320483 _na     210_aa pyrE Orotate phosphoribosyltransferase
313 JALDUQ010000001.1 GCA023109655_00299 CDS open 320727-321863 _na     378_aa lctO L-lactate oxidase
314 JALDUQ010000001.1 GCA023109655_00300 CDS open 322317-322985 _na     222_aa tenA Aminopyrimidine aminohydrolase
315 JALDUQ010000001.1 GCA023109655_00301 CDS open 323356-323916 _na     186_aa ykoE Cobalt ABC transporter permease
316 JALDUQ010000001.1 GCA023109655_00302 CDS open 323917-325302 _na     461_aa ccmA heme ABC exporter ATP-binding protein CcmA
317 JALDUQ010000001.1 GCA023109655_00303 CDS open 325304-325954 _na     216_aa Cobalt ABC transporter domain-containing protein
318 JALDUQ010000001.1 GCA023109655_00304 CDS open 325965-326657 _na     230_aa tenA thiaminase II
319 JALDUQ010000001.1 GCA023109655_00305 CDS open 326661-327185 _na     174_aa thiW energy coupling factor transporter S component ThiW
320 JALDUQ010000001.1 GCA023109655_00306 CDS open 327185-327988 _na     267_aa Hydroxyethylthiazole kinase
321 JALDUQ010000001.1 GCA023109655_00307 CDS open 327981-328613 _na     210_aa thiE2 Thiamine-phosphate synthase 2
322 JALDUQ010000001.1 GCA023109655_00308 CDS open 328662-329453 _na     263_aa thiD Hydroxymethylpyrimidine/phosphomethylpyrimidine kinase
323 JALDUQ010000001.1 GCA023109655_00309 CDS open 329816-330211 _na     131_aa copY CopY/TcrY family copper transport repressor
324 JALDUQ010000001.1 GCA023109655_00310 CDS open 330222-330593 _na     123_aa Copper-exporting ATPase
325 JALDUQ010000001.1 GCA023109655_00311 CDS open 330603-332825 _na     740_aa zntA P-type Cu(+) transporter
326 JALDUQ010000001.1 GCA023109655_00312 CDS open 333038-334813 _na     591_aa spxB pyruvate oxidase
327 JALDUQ010000001.1 GCA023109655_00313 CDS open 334923-335270 _na     115_aa VOC domain-containing protein
328 JALDUQ010000001.1 GCA023109655_00314 CDS open 335488-335748 _na     86_aa MtN3/saliva family protein
329 JALDUQ010000001.1 GCA023109655_00315 CDS open 335995-336165 _na     56_aa hypothetical protein
330 JALDUQ010000001.1 GCA023109655_00316 CDS open 336306-337607 _na     433_aa ABC transporter%2C solute-binding protein
331 JALDUQ010000001.1 GCA023109655_00317 CDS open 337680-338567 _na     295_aa ABC transporter%2C permease protein
332 JALDUQ010000001.1 GCA023109655_00318 CDS open 338564-339391 _na     275_aa ABC transporter%2C permease protein
333 JALDUQ010000001.1 GCA023109655_00319 CDS open 339410-339982 _na     190_aa hypothetical protein
334 JALDUQ010000001.1 GCA023109655_00320 CDS open 339979-342207 _na     742_aa Alpha-galactosidase
335 JALDUQ010000001.1 GCA023109655_00321 CDS open 342243-342956 _na     237_aa gmuR Putative HTH-type transcriptional regulator GmuR
336 JALDUQ010000001.1 GCA023109655_00322 CDS open 342967-343857 _na     296_aa ROK family protein
337 JALDUQ010000001.1 GCA023109655_00323 CDS open 343838-344476 _na     212_aa GDSL-like protein
338 JALDUQ010000001.1 GCA023109655_00324 CDS open 344478-345446 _na     322_aa Peptidase%2C S9A/B/C family%2C catalytic domain protein
339 JALDUQ010000001.1 GCA023109655_00325 CDS open 345443-346834 _na     463_aa gmuD 6-phospho-beta-glucosidase GmuD
340 JALDUQ010000001.1 GCA023109655_00326 CDS open 346926-349886 _na     986_aa Glycosyl hydrolase family 26
341 JALDUQ010000001.1 GCA023109655_00327 CDS open 350024-351463 _na     479_aa 6-phospho-beta-glucosidase
342 JALDUQ010000001.1 GCA023109655_00328 CDS open 351583-352527 _na     314_aa manA mannose-6-phosphate isomerase%2C class I
343 JALDUQ010000001.1 GCA023109655_00329 CDS open 352568-353908 _na     446_aa Transporter
344 JALDUQ010000001.1 GCA023109655_00330 CDS open 354162-354902 _na     246_aa soxR Regulator of the multidrug efflux pump pmrA
345 JALDUQ010000001.1 GCA023109655_00331 CDS open 354931-355386 _na     151_aa yjhB 8-oxo-dGTP diphosphatase
346 JALDUQ010000001.1 GCA023109655_00332 CDS open 355397-355918 _na     173_aa DUF1697 domain-containing protein
347 JALDUQ010000001.1 GCA023109655_00333 CDS open 355932-357152 _na     406_aa yhiN BaiN-like insert domain-containing protein
348 JALDUQ010000001.1 GCA023109655_00334 CDS open 357171-358016 _na     281_aa degV EDD domain protein%2C DegV family
349 JALDUQ010000001.1 GCA023109655_00335 CDS open 358141-358698 _na     185_aa acrR HTH tetR-type domain-containing protein
350 JALDUQ010000001.1 GCA023109655_00336 CDS open 358717-359184 _na     155_aa comEB Cytidine and deoxycytidylate deaminase zinc-binding region family protein
351 JALDUQ010000001.1 GCA023109655_00337 CDS open 359273-359902 _na     209_aa upp uracil phosphoribosyltransferase
352 JALDUQ010000001.1 GCA023109655_00338 CDS open 360075-360665 _na     196_aa clpP ATP-dependent Clp protease proteolytic subunit
353 JALDUQ010000001.1 GCA023109655_00339 CDS open 360744-361013 _na     89_aa UPF0298 protein HMPREF9184_01783
354 JALDUQ010000001.1 GCA023109655_00340 CDS open 361102-362262 _na     386_aa livK Branched chain amino acid ABC transporter substrate+B481-binding protein
355 JALDUQ010000001.1 GCA023109655_00341 CDS open 362382-363251 _na     289_aa livH ABC transporter membrane-spanning permease-branched chain amino acid transport
356 JALDUQ010000001.1 GCA023109655_00342 CDS open 363255-364211 _na     318_aa livM ABC transporter membrane-spanning permease-branched chain amino acid transport
357 JALDUQ010000001.1 GCA023109655_00343 CDS open 364211-364975 _na     254_aa livG ATP-binding cassette domain-containing protein
358 JALDUQ010000001.1 GCA023109655_00344 CDS open 364975-365685 _na     236_aa livF ABC transporter%2C ATP-binding protein
359 JALDUQ010000001.1 GCA023109655_00345 CDS open 365998-367776 _na     592_aa Cholinephosphate cytidylyltransferase / Choline kinase
360 JALDUQ010000001.1 GCA023109655_00346 CDS open 367778-367963 _na     61_aa Accessory secretory protein Asp4
361 JALDUQ010000001.1 GCA023109655_00347 CDS open 367965-369392 _na     475_aa Permease
362 JALDUQ010000001.1 GCA023109655_00348 CDS open 369545-370201 _na     218_aa cBS Inosine-5'-monophosphate dehydrogenase
363 JALDUQ010000001.1 GCA023109655_00350 CDS open 370430-371407 _na     325_aa prfB peptide chain release factor 2
364 JALDUQ010000001.1 GCA023109655_00351 CDS open 371425-372117 _na     230_aa ftsE cell division ATP-binding protein FtsE
365 JALDUQ010000001.1 GCA023109655_00352 CDS open 372110-373036 _na     308_aa ftsX permease-like cell division protein FtsX
366 JALDUQ010000001.1 GCA023109655_00353 CDS open 373255-375438 _na     727_aa exp5 PTS system glucose-specific EIICBA component
367 JALDUQ010000001.1 GCA023109655_00354 CDS open 375490-376305 _na     271_aa Endonuclease/exonuclease/phosphatase family protein
368 JALDUQ010000001.1 GCA023109655_00355 CDS open 376409-377752 _na     447_aa srmB DEAD-box ATP-dependent RNA helicase CshB
369 JALDUQ010000001.1 GCA023109655_00356 CDS open 377949-379139 _na     396_aa metK methionine adenosyltransferase
370 JALDUQ010000001.1 GCA023109655_00357 CDS open 379211-379510 _na     99_aa Ribose-5-phosphate isomerase A
371 JALDUQ010000001.1 GCA023109655_00358 CDS open 379569-380021 _na     150_aa Nudix hydrolase domain-containing protein
372 JALDUQ010000001.1 GCA023109655_00359 CDS open 380198-381100 _na     300_aa DNA-binding transcriptional regulator
373 JALDUQ010000001.1 GCA023109655_00360 CDS open 381155-381769 _na     204_aa GyrI-like small molecule binding domain-containing protein
374 JALDUQ010000001.1 GCA023109655_00361 CDS open 381812-384073 _na     753_aa clpE ATP-dependent Clp protease ATP-binding subunit ClpE
375 JALDUQ010000001.1 GCA023109655_00362 CDS open 384311-384541 _na     76_aa Cytoplasmic protein
376 JALDUQ010000001.1 GCA023109655_00363 CDS open 384733-385416 _na     227_aa hisM ABC transporter membrane-spanning permease-glutamine transport
377 JALDUQ010000001.1 GCA023109655_00364 CDS open 385416-386150 _na     244_aa glnQ Glutamine transport ATP-binding protein GlnQ
378 JALDUQ010000001.1 GCA023109655_00365 CDS open 386184-386504 _na     106_aa tfoX TfoX N-terminal domain-containing protein
379 JALDUQ010000001.1 GCA023109655_00366 CDS open 386653-387510 _na     285_aa folD bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase
380 JALDUQ010000001.1 GCA023109655_00367 CDS open 387515-388288 _na     257_aa HMP-PP phosphatase
381 JALDUQ010000001.1 GCA023109655_00368 CDS open 388346-389197 _na     283_aa ADP-dependent (S)-NAD(P)H-hydrate dehydratase
382 JALDUQ010000001.1 GCA023109655_00369 CDS open 389394-391886 _na     830_aa dnaQ bifunctional DnaQ family exonuclease/ATP-dependent helicase
383 JALDUQ010000001.1 GCA023109655_00370 CDS open 391892-393115 _na     407_aa ftsW Rod shape determining protein
384 JALDUQ010000001.1 GCA023109655_00371 CDS open 393126-393674 _na     182_aa DJ-1 family glyoxalase III
385 JALDUQ010000001.1 GCA023109655_00372 CDS open 393755-394327 _na     190_aa Phosphoglycolate phosphatase
386 JALDUQ010000001.1 GCA023109655_00373 CDS open 394341-396287 _na     648_aa gyrB DNA topoisomerase (ATP-hydrolyzing) subunit B
387 JALDUQ010000001.1 GCA023109655_00374 CDS open 396368-398095 _na     575_aa ezrA septation ring formation regulator EzrA
388 JALDUQ010000001.1 GCA023109655_00375 CDS open 398199-399587 _na     462_aa pgdA peptidoglycan-N-acetylglucosamine deacetylase PgdA
389 JALDUQ010000001.1 GCA023109655_00376 CDS open 399669-400511 _na     280_aa Glyoxal reductase
390 JALDUQ010000001.1 GCA023109655_00377 CDS open 400801-405312 _na     1503_aa Gram-positive signal peptide protein%2C YSIRK family
391 JALDUQ010000001.1 GCA023109655_00379 CDS open 405630-406001 _na     123_aa S-(Hydroxymethyl)glutathione synthase
392 JALDUQ010000001.1 GCA023109655_00380 CDS open 406213-407130 _na     305_aa glyQ glycine--tRNA ligase subunit alpha
393 JALDUQ010000001.1 GCA023109655_00381 CDS open 407391-409427 _na     678_aa glyS Glycine--tRNA ligase beta subunit
394 JALDUQ010000001.1 GCA023109655_00382 CDS open 409472-409729 _na     85_aa ynzC DUF896 domain-containing protein
395 JALDUQ010000001.1 GCA023109655_00383 CDS open 409812-411056 _na     414_aa Flavin reductase
396 JALDUQ010000001.1 GCA023109655_00384 CDS open 411074-411679 _na     201_aa ssuE NAD(P)H-dependent oxidoreductase
397 JALDUQ010000001.1 GCA023109655_00385 CDS open 411698-412660 _na     320_aa FAD:protein FMN transferase
398 JALDUQ010000001.1 GCA023109655_00386 CDS open 412935-414314 _na     459_aa nox H2O-forming NADH oxidase
399 JALDUQ010000001.1 GCA023109655_00387 CDS open 414467-415342 _na     291_aa pdxS pyridoxal 5'-phosphate synthase lyase subunit PdxS
400 JALDUQ010000001.1 GCA023109655_00388 CDS open 415343-415924 _na     193_aa pdxT pyridoxal 5'-phosphate synthase glutaminase subunit PdxT
401 JALDUQ010000001.1 GCA023109655_00389 CDS open 415944-416591 _na     215_aa yqfA Hemolysin III family protein
402 JALDUQ010000001.1 GCA023109655_00390 CDS open 416588-417034 _na     148_aa DUF1836 domain-containing protein
403 JALDUQ010000001.1 GCA023109655_00391 CDS open 417169-417663 _na     164_aa mnaT N-acetyltransferase domain-containing protein
404 JALDUQ010000001.1 GCA023109655_00392 CDS open 417660-418175 _na     171_aa Methylated-DNA--protein-cysteine methyltransferase
405 JALDUQ010000001.1 GCA023109655_00393 CDS open 418188-418544 _na     118_aa Arsenate reductase
406 JALDUQ010000001.1 GCA023109655_00394 CDS open 418701-419501 _na     266_aa hisM ABC transporter membrane-spanning permease-aspartate/glutamate transport
407 JALDUQ010000001.1 GCA023109655_00395 CDS open 419501-420244 _na     247_aa glnQ ABC transporter domain-containing protein
408 JALDUQ010000001.1 GCA023109655_00396 CDS open 420322-420546 _na     74_aa Amino acid ABC transporter
409 JALDUQ010000001.1 GCA023109655_00397 CDS open 420612-421523 _na     303_aa trxB thioredoxin-disulfide reductase
410 JALDUQ010000001.1 GCA023109655_00398 CDS open 421562-422290 _na     242_aa rlmB 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
411 JALDUQ010000001.1 GCA023109655_00399 CDS open 422335-422946 _na     203_aa def peptide deformylase
412 JALDUQ010000001.1 GCA023109655_00400 CDS open 423102-424421 _na     439_aa capA Capsule synthesis protein CapA domain-containing protein
413 JALDUQ010000001.1 GCA023109655_00401 CDS open 424445-425272 _na     275_aa ybiV Sugar phosphatase YbiV
414 JALDUQ010000001.1 GCA023109655_00402 CDS open 425274-425909 _na     211_aa N-acylneuraminate cytidylyltransferase
415 JALDUQ010000001.1 GCA023109655_00405 CDS open 426795-427535 _na     246_aa glpR DeoR family transcriptional regulator
416 JALDUQ010000001.1 GCA023109655_00406 CDS open 427532-428443 _na     303_aa pfkB 1-phosphofructokinase
417 JALDUQ010000001.1 GCA023109655_00407 CDS open 428440-430395 _na     651_aa ptsN Fructose specific-phosphotransferase system IIBC component
418 JALDUQ010000001.1 GCA023109655_00408 CDS open 430556-431344 _na     262_aa HEAT repeat protein
419 JALDUQ010000001.1 GCA023109655_00409 CDS open 431476-433782 _na     768_aa ftsK DNA translocase FtsK
420 JALDUQ010000001.1 GCA023109655_00410 CDS open 433826-434251 _na     141_aa Signal peptide protein%2C YSIRK family
421 JALDUQ010000001.1 GCA023109655_00411 CDS open 434389-435531 _na     380_aa nifS Class-V aminotransferase
422 JALDUQ010000001.1 GCA023109655_00412 CDS open 435540-436754 _na     404_aa thiI putative tRNA sulfurtransferase
423 JALDUQ010000001.1 GCA023109655_00413 CDS open 436891-437715 _na     274_aa ybbA Esterase
424 JALDUQ010000001.1 GCA023109655_00414 CDS open 437736-438476 _na     246_aa Esterase
425 JALDUQ010000001.1 GCA023109655_00415 CDS open 438489-439655 _na     388_aa accC ATP-grasp domain-containing protein
426 JALDUQ010000001.1 GCA023109655_00416 CDS open 439812-440681 _na     289_aa gla aquaglyceroporin Gla
427 JALDUQ010000001.1 GCA023109655_00417 CDS open 440793-441518 _na     241_aa Proteinase
428 JALDUQ010000001.1 GCA023109655_00418 CDS open 441515-442450 _na     311_aa ampH D-alanyl-D-alanine-carboxypeptidase/endopeptidase AmpH
429 JALDUQ010000001.1 GCA023109655_00419 CDS open 442459-443364 _na     301_aa eamA EamA domain-containing protein
430 JALDUQ010000001.1 GCA023109655_00420 CDS open 443409-444692 _na     427_aa uraA Uracil permease
431 JALDUQ010000001.1 GCA023109655_00422 CDS open 444966-445679 _na     237_aa rsmG 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG
432 JALDUQ010000001.1 GCA023109655_00423 CDS open 445773-446333 _na     186_aa lemA LemA family protein
433 JALDUQ010000001.1 GCA023109655_00424 CDS open 446335-447234 _na     299_aa htpX zinc metalloprotease HtpX
434 JALDUQ010000001.1 GCA023109655_00425 CDS open 447346-447942 _na     198_aa CAAX amino terminal protease family protein
435 JALDUQ010000001.1 GCA023109655_00426 CDS open 448133-449692 _na     519_aa ABC transporter domain-containing protein
436 JALDUQ010000001.1 GCA023109655_00428 CDS open 450023-450352 _na     109_aa blpT Helicase BlpT
437 JALDUQ010000001.1 GCA023109655_00429 CDS open 450521-451063 _na     180_aa yceD DNA-binding protein
438 JALDUQ010000001.1 GCA023109655_00430 CDS open 451064-451693 _na     209_aa nth endonuclease III
439 JALDUQ010000001.1 GCA023109655_00431 CDS open 451723-451857 _na     44_aa hypothetical protein
440 JALDUQ010000001.1 GCA023109655_00432 CDS open 451904-452425 _na     173_aa pyrR bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR
441 JALDUQ010000001.1 GCA023109655_00433 CDS open 452444-453367 _na     307_aa pyrB aspartate carbamoyltransferase catalytic subunit
442 JALDUQ010000001.1 GCA023109655_00434 CDS open 453417-454496 _na     359_aa carA carbamoyl phosphate synthase small subunit
443 JALDUQ010000001.1 GCA023109655_00435 CDS open 454945-458121 _na     1058_aa carB carbamoyl-phosphate synthase large subunit
444 JALDUQ010000001.1 GCA023109655_00436 CDS open 458342-459676 _na     444_aa Nramp family divalent metal transporter
445 JALDUQ010000001.1 GCA023109655_00437 CDS open 460346-460438 _na     30_aa Type I toxin-antitoxin system Fst family toxin
446 JALDUQ010000001.1 GCA023109655_00438 CDS open 460674-461132 _na     152_aa hypothetical protein
447 JALDUQ010000001.1 GCA023109655_00439 CDS open 461297-462538 _na     413_aa mobV MobV family relaxase
448 JALDUQ010000001.1 GCA023109655_00440 CDS open 462856-463257 _na     133_aa Phage protein
449 JALDUQ010000001.1 GCA023109655_00441 CDS open 463265-464167 _na     300_aa Replication initiation protein
450 JALDUQ010000001.1 GCA023109655_00442 CDS open 464460-465101 _na     213_aa Arsenate reductase
451 JALDUQ010000001.1 GCA023109655_00443 CDS open 465107-465430 _na     107_aa repA Replication-associated protein RepA
452 JALDUQ010000001.1 GCA023109655_00444 CDS open 465436-465714 _na     92_aa DNA-binding protein
453 JALDUQ010000001.1 GCA023109655_00445 CDS open 465871-466464 _na     197_aa HTH cro/C1-type domain-containing protein
454 JALDUQ010000001.1 GCA023109655_00446 CDS open 466529-467686 _na     385_aa Phage integrase family site specific recombinase
455 JALDUQ010000001.1 GCA023109655_00447 CDS open 467791-468033 _na     80_aa rpmE2 type B 50S ribosomal protein L31
456 JALDUQ010000001.1 GCA023109655_00448 CDS open 468129-469064 _na     311_aa nrnA Putative bifunctional oligoribonuclease and PAP phosphatase NrnA
457 JALDUQ010000001.1 GCA023109655_00449 CDS open 469168-469611 _na     147_aa fldA flavodoxin
458 JALDUQ010000001.1 GCA023109655_00450 CDS open 469729-469995 _na     88_aa pheA Chorismate mutase
459 JALDUQ010000001.1 GCA023109655_00451 CDS open 469992-470366 _na     124_aa crcB fluoride efflux transporter CrcB
460 JALDUQ010000001.1 GCA023109655_00452 CDS open 470360-470689 _na     109_aa crcB fluoride efflux transporter CrcB
461 JALDUQ010000001.1 GCA023109655_00453 CDS open 470808-471155 _na     115_aa rplS 50S ribosomal protein L19
462 JALDUQ010000001.1 GCA023109655_00455 CDS open 471488-474853 _na     1121_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
463 JALDUQ010000001.1 GCA023109655_00456 CDS open 475031-475939 _na     302_aa cas1 type II CRISPR-associated endonuclease Cas1
464 JALDUQ010000001.1 GCA023109655_00457 CDS open 475944-476267 _na     107_aa cas2 CRISPR-associated endonuclease Cas2
465 JALDUQ010000001.1 GCA023109655_00458 CDS open 476264-477307 _na     347_aa CRISPR-associated protein Cas7
466 JALDUQ010000001.1 GCA023109655_00459 CDS open 478589-478768 _na     59_aa DNA-binding protein
467 JALDUQ010000001.1 GCA023109655_00460 CDS open 479040-479846 _na     268_aa yidA sugar-phosphatase
468 JALDUQ010000001.1 GCA023109655_00461 CDS open 479859-481163 _na     434_aa ydhJ HD domain-containing protein
469 JALDUQ010000001.1 GCA023109655_00462 CDS open 481235-481612 _na     125_aa ywiB DUF1934 domain-containing protein
470 JALDUQ010000001.1 GCA023109655_00463 CDS open 481637-482719 _na     360_aa srmB ATP-dependent RNA helicase
471 JALDUQ010000001.1 GCA023109655_00464 CDS open 482716-483693 _na     325_aa mviM Gfo/Idh/MocA family oxidoreductase
472 JALDUQ010000001.1 GCA023109655_00465 CDS open 483849-484544 _na     231_aa DUF1275 domain-containing protein
473 JALDUQ010000001.1 GCA023109655_00466 CDS open 484753-485067 _na     104_aa rplU 50S ribosomal protein L21
474 JALDUQ010000001.1 GCA023109655_00467 CDS open 485083-485427 _na     114_aa ysxB Ribosomal processing cysteine protease Prp
475 JALDUQ010000001.1 GCA023109655_00468 CDS open 485444-485737 _na     97_aa rpmA 50S ribosomal protein L27
476 JALDUQ010000001.1 GCA023109655_00469 CDS open 485971-486879 _na     302_aa lysR HTH lysR-type domain-containing protein
477 JALDUQ010000001.1 GCA023109655_00470 CDS open 486876-487343 _na     155_aa lspA signal peptidase II
478 JALDUQ010000001.1 GCA023109655_00471 CDS open 487327-488226 _na     299_aa rluA Pseudouridine synthase
479 JALDUQ010000001.1 GCA023109655_00472 CDS open 488327-489436 _na     369_aa proB Glutamate 5-kinase
480 JALDUQ010000001.1 GCA023109655_00473 CDS open 489446-490708 _na     420_aa proA glutamate-5-semialdehyde dehydrogenase
481 JALDUQ010000001.1 GCA023109655_00474 CDS open 490712-491509 _na     265_aa proC pyrroline-5-carboxylate reductase
482 JALDUQ010000001.1 GCA023109655_00475 CDS open 491626-492264 _na     212_aa tmk dTMP kinase
483 JALDUQ010000001.1 GCA023109655_00476 CDS open 492261-493151 _na     296_aa holB DNA polymerase III subunit delta'
484 JALDUQ010000001.1 GCA023109655_00477 CDS open 493188-493505 _na     105_aa yabA DNA replication initiation control protein YabA
485 JALDUQ010000001.1 GCA023109655_00478 CDS open 493508-494386 _na     292_aa rsmI 16S rRNA (cytidine(1402)-2'-O)-methyltransferase
486 JALDUQ010000001.1 GCA023109655_00479 CDS open 494520-495854 _na     444_aa trmFO methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO
487 JALDUQ010000001.1 GCA023109655_00480 CDS open 495938-496675 _na     245_aa pyrH UMP kinase
488 JALDUQ010000001.1 GCA023109655_00481 CDS open 496683-497240 _na     185_aa frr ribosome recycling factor
489 JALDUQ010000001.1 GCA023109655_00482 CDS open 497300-498154 _na     284_aa cvfB RNA-binding virulence regulatory protein CvfB
490 JALDUQ010000001.1 GCA023109655_00483 CDS open 498187-498744 _na     185_aa Dephospho-CoA kinase/protein folding accessory domain-containing protein
491 JALDUQ010000001.1 GCA023109655_00484 CDS open 498768-498983 _na     71_aa yozE UPF0346 protein SPG_0874
492 JALDUQ010000001.1 GCA023109655_00485 CDS open 499064-500050 _na     328_aa PhoH-like protein
493 JALDUQ010000001.1 GCA023109655_00486 CDS open 500108-501220 _na     370_aa ald alanine dehydrogenase
494 JALDUQ010000001.1 GCA023109655_00487 CDS open 501397-501966 _na     189_aa rimL Acetyltransferase
495 JALDUQ010000001.1 GCA023109655_00488 CDS open 502034-502684 _na     216_aa ComEA protein
496 JALDUQ010000001.1 GCA023109655_00489 CDS open 502668-504908 _na     746_aa DNA internalization-related competence protein ComEC/Rec2
497 JALDUQ010000001.1 GCA023109655_00490 CDS open 505101-505658 _na     185_aa infC translation initiation factor IF-3
498 JALDUQ010000001.1 GCA023109655_00491 CDS open 505691-505891 _na     66_aa rpmI 50S ribosomal protein L35
499 JALDUQ010000001.1 GCA023109655_00492 CDS open 505943-506302 _na     119_aa rplT 50S ribosomal protein L20
500 JALDUQ010000001.1 GCA023109655_00493 CDS open 506360-506740 _na     126_aa gloA Aldoketomutase