HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Streptococcus oralis subsp. oralis (GCA_023110385.1)

Select a Genome:
BAKTA Annotations for GCA_023110385.1
Genome Selected: Streptococcus oralis subsp. oralis
ContigsBases CDSrRNA tmRNAtRNA
17 1951473 1805 3 1 42
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3765 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 3765 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1 JALDVW010000001.1 GCA023110385_00638 gene open 692298-692642 ssrA
2 JALDVW010000001.1 GCA023110385_00638 tmRNA open 692298-692642 ssrA transfer-messenger RNA%2C SsrA
3 JALDVW010000001.1 rep_origin open 12989-13146
4 JALDVW010000001.1 rep_origin open 14080-14724
5 JALDVW010000001.1 GCA023110385_00043 gene open 43504-43548 SpF51_sRNA
6 JALDVW010000001.1 GCA023110385_00115 gene open 132131-132197 Spd-sr37
7 JALDVW010000001.1 GCA023110385_00146 gene open 159095-159141 SpR10_sRNA
8 JALDVW010000001.1 GCA023110385_00213 gene open 210300-210391 csRNA
9 JALDVW010000001.1 GCA023110385_00218 gene open 215236-215322 csRNA
10 JALDVW010000001.1 GCA023110385_00219 gene open 215538-215625 csRNA
11 JALDVW010000001.1 GCA023110385_00224 gene open 221136-221233 csRNA
12 JALDVW010000001.1 GCA023110385_00227 gene open 222853-222943 csRNA
13 JALDVW010000001.1 GCA023110385_00322 gene open 347694-348075 RNaseP_bact_b
14 JALDVW010000001.1 GCA023110385_00478 gene open 522129-522283 SpF22_sRNA
15 JALDVW010000001.1 GCA023110385_00613 gene open 671793-671913 SpR19_sRNA
16 JALDVW010000001.1 GCA023110385_00657 gene open 711204-711299 SpF44_sRNA
17 JALDVW010000001.1 GCA023110385_00662 gene open 715578-715676 SpF43_sRNA
18 JALDVW010000001.1 GCA023110385_00895 gene open 947719-947861 asd
19 JALDVW010000001.1 GCA023110385_01287 gene open 1351710-1351754 SpR20_sRNA
20 JALDVW010000001.1 GCA023110385_00043 ncRNA open 43504-43548 Streptococcus sRNA SpF51
21 JALDVW010000001.1 GCA023110385_00115 ncRNA open 132131-132197 Streptococcus sRNA Spd-sr37
22 JALDVW010000001.1 GCA023110385_00146 ncRNA open 159095-159141 Streptococcus sRNA SpR10
23 JALDVW010000001.1 GCA023110385_00213 ncRNA open 210300-210391 Cia-dependent small RNA csRNA1
24 JALDVW010000001.1 GCA023110385_00218 ncRNA open 215236-215322 Cia-dependent small RNA csRNA1
25 JALDVW010000001.1 GCA023110385_00219 ncRNA open 215538-215625 Cia-dependent small RNA csRNA1
26 JALDVW010000001.1 GCA023110385_00224 ncRNA open 221136-221233 Cia-dependent small RNA csRNA1
27 JALDVW010000001.1 GCA023110385_00227 ncRNA open 222853-222943 Cia-dependent small RNA csRNA1
28 JALDVW010000001.1 GCA023110385_00322 ncRNA open 347694-348075 Bacterial RNase P class B
29 JALDVW010000001.1 GCA023110385_00478 ncRNA open 522129-522283 Streptococcus sRNA SpF22
30 JALDVW010000001.1 GCA023110385_00613 ncRNA open 671793-671913 Streptococcus sRNA SpR19
31 JALDVW010000001.1 GCA023110385_00657 ncRNA open 711204-711299 Streptococcus sRNA SpF44
32 JALDVW010000001.1 GCA023110385_00662 ncRNA open 715578-715676 Streptococcus sRNA SpF43
33 JALDVW010000001.1 GCA023110385_00895 ncRNA open 947719-947861 MarS sRNA
34 JALDVW010000001.1 GCA023110385_01287 ncRNA open 1351710-1351754 Streptococcus sRNA SpR20
35 JALDVW010000001.1 regulatory_region open 177059-177210 M-box riboswitch aptamer (ykoK leader)
36 JALDVW010000001.1 regulatory_region open 208382-208454 L17 ribosomal protein downstream element
37 JALDVW010000001.1 regulatory_region open 243774-243831 Lacto-rpoB RNA
38 JALDVW010000001.1 regulatory_region open 370147-370235 Glycine riboswitch aptamer
39 JALDVW010000001.1 regulatory_region open 581606-581710 PyrR binding site
40 JALDVW010000001.1 regulatory_region open 586874-586962 TPP riboswitch aptamer (THI element)
41 JALDVW010000001.1 regulatory_region open 587974-588062 TPP riboswitch aptamer (THI element)
42 JALDVW010000001.1 regulatory_region open 594401-594499 TPP riboswitch aptamer (THI element)
43 JALDVW010000001.1 regulatory_region open 717472-717607 PyrR binding site
44 JALDVW010000001.1 regulatory_region open 774888-775008 Ribosomal protein L21 leader
45 JALDVW010000001.1 regulatory_region open 795265-795396 Ribosomal protein L20 leader
46 JALDVW010000001.1 regulatory_region open 845268-845484 T-box leader
47 JALDVW010000001.1 regulatory_region open 946790-946886 PreQ1-II (pre queuosine) riboswitch aptamer
48 JALDVW010000001.1 regulatory_region open 1196937-1197072 Ribosomal protein L10 leader
49 JALDVW010000001.1 regulatory_region open 1496772-1496997 T-box leader
50 JALDVW010000001.1 regulatory_region open 1498334-1498559 T-box leader
51 JALDVW010000001.1 regulatory_region open 1506922-1507017 Purine riboswitch aptamer
52 JALDVW010000001.1 repeat_region open 766295-767726 CRISPR array with 22 repeats of length 36%2C consensus sequence GTTTTTGTACTCTCAAGATTTAAGTAACTGTACAAC and spacer length 30
53 JALDVW010000001.1 repeat_region open 1239672-1240017 CRISPR array with 5 repeats of length 37%2C consensus sequence GTTTCCGGCCCCTCGCGAGGTAGATAGGTATCTATAC and spacer length 37
54 JALDVW010000001.1 repeat_region open 1240189-1240829 CRISPR array with 9 repeats of length 28%2C consensus sequence GTTTCCGGCCCCTCTCGAGGTAGATAGG and spacer length 48
55 JALDVW010000001.1 repeat_region open 1241372-1242000 CRISPR array with 9 repeats of length 28%2C consensus sequence GTTTCCGGCCCCTCTCGAGGTAGATAGG and spacer length 45
56 JALDVW010000001.1 repeat_region open 1388563-1389062 CRISPR array with 8 repeats of length 35%2C consensus sequence GTTTTTGTAGTCTCCAAAATTGTGACCGATAAAAC and spacer length 30
57 JALDVW010000001.1 GCA023110385_00001 CDS open 377-2335 _na     652_aa ftsH ATP-dependent zinc metalloprotease FtsH
58 JALDVW010000001.1 GCA023110385_00002 CDS open 2351-2893 _na     180_aa hpt hypoxanthine phosphoribosyltransferase
59 JALDVW010000001.1 GCA023110385_00003 CDS open 2898-4175 _na     425_aa tRNA(Ile)-lysidine synthase
60 JALDVW010000001.1 GCA023110385_00004 CDS open 4172-5440 _na     422_aa beta-lactamase
61 JALDVW010000001.1 GCA023110385_00005 CDS open 5433-5555 _na     40_aa SP_0009 family protein
62 JALDVW010000001.1 GCA023110385_00006 CDS open 5560-5829 _na     89_aa putative septum formation initiator
63 JALDVW010000001.1 GCA023110385_00007 CDS open 5921-6187 _na     88_aa rqcP RQC P-site tRNA stabilizing factor
64 JALDVW010000001.1 GCA023110385_00008 CDS open 6245-9748 _na     1167_aa mfd transcription-repair coupling factor
65 JALDVW010000001.1 GCA023110385_00009 CDS open 9749-10318 _na     189_aa pth aminoacyl-tRNA hydrolase
66 JALDVW010000001.1 GCA023110385_00010 CDS open 10393-11508 _na     371_aa ychF redox-regulated ATPase YchF
67 JALDVW010000001.1 GCA023110385_00011 CDS open 11593-11787 _na     64_aa DUF951 domain-containing protein
68 JALDVW010000001.1 GCA023110385_00012 CDS open 11852-12988 _na     378_aa dnaN DNA polymerase III subunit beta
69 JALDVW010000001.1 GCA023110385_00013 CDS open 13147-14508 _na     453_aa dnaA chromosomal replication initiator protein DnaA
70 JALDVW010000001.1 GCA023110385_00014 CDS open 14725-15468 _na     247_aa Chromosome-partitioning protein Spo0J
71 JALDVW010000001.1 GCA023110385_00015 CDS open 15541-16737 _na     398_aa htrA Serine protease do-like htrA
72 JALDVW010000001.1 GCA023110385_00016 CDS open 16923-17402 _na     159_aa rlmH 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH
73 JALDVW010000001.1 GCA023110385_00018 CDS open 17684-17809 _na     41_aa comC competence-stimulating peptide ComC
74 JALDVW010000001.1 GCA023110385_00019 CDS open 17830-19149 _na     439_aa Histidine kinase
75 JALDVW010000001.1 GCA023110385_00020 CDS open 19146-19898 _na     250_aa lytT Accessory gene regulator protein A
76 JALDVW010000001.1 GCA023110385_00023 CDS open 20136-20678 _na     180_aa tetR TetR family transcriptional regulator
77 JALDVW010000001.1 GCA023110385_00024 CDS open 20806-23460 _na     884_aa ABC-2 type transporter transmembrane domain-containing protein
78 JALDVW010000001.1 GCA023110385_00025 CDS open 23482-26034 _na     850_aa yfhO Bacterial membrane protein YfhO
79 JALDVW010000001.1 GCA023110385_00026 CDS open 26096-27718 _na     540_aa uup ABC transporter ATP-binding protein
80 JALDVW010000001.1 GCA023110385_00027 CDS open 27914-28939 _na     341_aa trpS tryptophan--tRNA ligase
81 JALDVW010000001.1 GCA023110385_00028 CDS open 29102-30580 _na     492_aa guaB IMP dehydrogenase
82 JALDVW010000001.1 GCA023110385_00029 CDS open 30633-31730 _na     365_aa recF DNA replication/repair protein RecF
83 JALDVW010000001.1 GCA023110385_00030 CDS open 31733-32101 _na     122_aa yaaA S4 domain protein YaaA
84 JALDVW010000001.1 GCA023110385_00031 CDS open 32262-33512 _na     416_aa yfmF EF-P 5-aminopentanol modification-associated protein YfmF
85 JALDVW010000001.1 GCA023110385_00032 CDS open 33509-34792 _na     427_aa yfmH EF-P 5-aminopentanol modification-associated protein YfmH
86 JALDVW010000001.1 GCA023110385_00033 CDS open 34828-35649 _na     273_aa rodZ cytoskeleton protein RodZ
87 JALDVW010000001.1 GCA023110385_00034 CDS open 35660-36205 _na     181_aa pgsA CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase
88 JALDVW010000001.1 GCA023110385_00035 CDS open 36202-37029 _na     275_aa energy-coupling factor ABC transporter ATP-binding protein
89 JALDVW010000001.1 GCA023110385_00036 CDS open 37014-37853 _na     279_aa energy-coupling factor transporter ATPase
90 JALDVW010000001.1 GCA023110385_00037 CDS open 37846-38640 _na     264_aa ecfT Energy-coupling factor transporter transmembrane protein EcfT
91 JALDVW010000001.1 GCA023110385_00038 CDS open 38701-39516 _na     271_aa mreC rod shape-determining protein MreC
92 JALDVW010000001.1 GCA023110385_00039 CDS open 39519-40013 _na     164_aa mreD rod shape-determining protein MreD
93 JALDVW010000001.1 GCA023110385_00040 CDS open 40107-41318 _na     403_aa pcsB peptidoglycan hydrolase PcsB
94 JALDVW010000001.1 GCA023110385_00041 CDS open 41540-42319 _na     259_aa rpsB 30S ribosomal protein S2
95 JALDVW010000001.1 GCA023110385_00042 CDS open 42398-43438 _na     346_aa tsf translation elongation factor Ts
96 JALDVW010000001.1 GCA023110385_00044 CDS open 43542-44468 _na     308_aa cysK cysteine synthase A
97 JALDVW010000001.1 GCA023110385_00045 CDS open 44565-45008 _na     147_aa Bacterial Pleckstrin-like y domain-containing protein
98 JALDVW010000001.1 GCA023110385_00046 CDS open 45024-45659 _na     211_aa yIH1 Xaa-Pro dipeptidase
99 JALDVW010000001.1 GCA023110385_00047 CDS open 45716-47014 _na     432_aa recG ATP-dependent DNA helicase RecG
100 JALDVW010000001.1 GCA023110385_00048 CDS open 47011-47673 _na     220_aa putative amidophosphoribosyltransferases%2C involved in transformation
101 JALDVW010000001.1 GCA023110385_00049 CDS open 47753-48301 _na     182_aa hpf ribosome hibernation-promoting factor%2C HPF/YfiA family
102 JALDVW010000001.1 GCA023110385_00050 CDS open 48383-49561 _na     392_aa acetyl-CoA C-acetyltransferase
103 JALDVW010000001.1 GCA023110385_00051 CDS open 49718-51691 _na     657_aa Cyclic-di-AMP phosphodiesterase
104 JALDVW010000001.1 GCA023110385_00052 CDS open 51688-52140 _na     150_aa rplI 50S ribosomal protein L9
105 JALDVW010000001.1 GCA023110385_00053 CDS open 52184-53536 _na     450_aa dnaB replicative DNA helicase
106 JALDVW010000001.1 GCA023110385_00054 CDS open 53538-53804 _na     88_aa CAAX amino protease family protein
107 JALDVW010000001.1 GCA023110385_00055 CDS open 53904-55025 _na     373_aa N-acetylmuramoyl-L-alanine amidase
108 JALDVW010000001.1 GCA023110385_00056 CDS open 55142-58438 _na     1098_aa SIALI-17 repeat-containing surface protein
109 JALDVW010000001.1 GCA023110385_00057 CDS open 58532-61201 _na     889_aa DNA polymerase I
110 JALDVW010000001.1 GCA023110385_00058 CDS open 61478-61768 _na     96_aa yqgV Thiamine-binding protein domain-containing protein
111 JALDVW010000001.1 GCA023110385_00059 CDS open 61731-62489 _na     252_aa tauC ABC transmembrane type-1 domain-containing protein
112 JALDVW010000001.1 GCA023110385_00060 CDS open 62527-63534 _na     335_aa tauA SsuA/THI5-like domain-containing protein
113 JALDVW010000001.1 GCA023110385_00061 CDS open 63534-64262 _na     242_aa tauB ABC transporter domain-containing protein
114 JALDVW010000001.1 GCA023110385_00062 CDS open 66692-68959 _na     755_aa Cell wall surface anchor family protein
115 JALDVW010000001.1 GCA023110385_00063 CDS open 69131-69589 _na     152_aa ctsR Transcriptional regulator CtsR
116 JALDVW010000001.1 GCA023110385_00064 CDS open 69591-72023 _na     810_aa clpA ATP-dependent Clp protease%2C ATP-binding subunit
117 JALDVW010000001.1 GCA023110385_00065 CDS open 72169-73227 _na     352_aa nadR Bifunctional NadR protein
118 JALDVW010000001.1 GCA023110385_00066 CDS open 73237-74016 _na     259_aa pnuC nicotinamide riboside transporter PnuC
119 JALDVW010000001.1 GCA023110385_00067 CDS open 74018-74791 _na     257_aa Nudix hydrolase domain-containing protein
120 JALDVW010000001.1 GCA023110385_00068 CDS open 75089-75772 _na     227_aa fliK Flagellar hook-length control protein FliK
121 JALDVW010000001.1 GCA023110385_00069 CDS open 75837-76817 _na     326_aa dusB tRNA dihydrouridine synthase DusB
122 JALDVW010000001.1 GCA023110385_00070 CDS open 76804-77676 _na     290_aa hslO Hsp33 family molecular chaperone HslO
123 JALDVW010000001.1 GCA023110385_00071 CDS open 77841-79268 _na     475_aa Mga helix-turn-helix domain-containing protein
124 JALDVW010000001.1 GCA023110385_00072 CDS open 79425-80933 _na     502_aa glpK glycerol kinase GlpK
125 JALDVW010000001.1 GCA023110385_00073 CDS open 80975-82801 _na     608_aa glpO type 1 glycerol-3-phosphate oxidase
126 JALDVW010000001.1 GCA023110385_00074 CDS open 82872-83576 _na     234_aa MIP family channel protein
127 JALDVW010000001.1 GCA023110385_00075 CDS open 83953-85503 _na     516_aa dltA D-alanine--poly(phosphoribitol) ligase subunit DltA
128 JALDVW010000001.1 GCA023110385_00076 CDS open 85500-86744 _na     414_aa dltB D-alanyl-lipoteichoic acid biosynthesis protein DltB
129 JALDVW010000001.1 GCA023110385_00077 CDS open 86758-86997 _na     79_aa dltC D-alanine--poly(phosphoribitol) ligase subunit DltC
130 JALDVW010000001.1 GCA023110385_00078 CDS open 86990-88258 _na     422_aa dltD D-alanyl-lipoteichoic acid biosynthesis protein DltD
131 JALDVW010000001.1 GCA023110385_00079 CDS open 88401-90452 _na     683_aa nt5e cell surface ecto-5'-nucleotidase Nt5e
132 JALDVW010000001.1 GCA023110385_00080 CDS open 90601-91041 _na     146_aa adcR zinc-dependent transcriptional regulator AdcR
133 JALDVW010000001.1 GCA023110385_00081 CDS open 91041-91745 _na     234_aa adcC Zinc transport system ATP-binding protein AdcC
134 JALDVW010000001.1 GCA023110385_00082 CDS open 91738-92544 _na     268_aa znuB ABC transporter membrane-spanning permease-Zinc (Zn2+) transport
135 JALDVW010000001.1 GCA023110385_00083 CDS open 92554-94059 _na     501_aa adcA zinc ABC transporter substrate-binding lipoprotein AdcA
136 JALDVW010000001.1 GCA023110385_00084 CDS open 94768-96447 _na     559_aa F5/8 type C domain-containing protein
137 JALDVW010000001.1 GCA023110385_00085 CDS open 96484-98571 _na     695_aa Sugar hydrolase
138 JALDVW010000001.1 GCA023110385_00086 CDS open 98742-100022 _na     426_aa Twin-arginine translocation pathway signal
139 JALDVW010000001.1 GCA023110385_00087 CDS open 100078-102723 _na     881_aa mngB Alpha-mannosidase
140 JALDVW010000001.1 GCA023110385_00088 CDS open 102820-103689 _na     289_aa Beta-glucoside kinase
141 JALDVW010000001.1 GCA023110385_00089 CDS open 103683-105563 _na     626_aa Glycosyl hydrolase-related protein
142 JALDVW010000001.1 GCA023110385_00090 CDS open 105920-106849 _na     309_aa lplB ABC transporter permease
143 JALDVW010000001.1 GCA023110385_00091 CDS open 106863-107786 _na     307_aa ugpE ABC transmembrane type-1 domain-containing protein
144 JALDVW010000001.1 GCA023110385_00092 CDS open 107895-109379 _na     494_aa ugpB Carbohydrate ABC transporter substrate-binding protein
145 JALDVW010000001.1 GCA023110385_00093 CDS open 109540-110229 _na     229_aa CAAX protease self-immunity
146 JALDVW010000001.1 GCA023110385_00094 CDS open 110298-110594 _na     98_aa Enterocin A Immunity
147 JALDVW010000001.1 GCA023110385_00095 CDS open 110726-111712 _na     328_aa trhO rhodanese-related sulfurtransferase
148 JALDVW010000001.1 GCA023110385_00096 CDS open 111833-112693 _na     286_aa tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase
149 JALDVW010000001.1 GCA023110385_00097 CDS open 112757-113719 _na     320_aa Response regulator (Homolog to RR11 Spn)
150 JALDVW010000001.1 GCA023110385_00098 CDS open 113781-114710 _na     309_aa DUF4097 domain-containing protein
151 JALDVW010000001.1 GCA023110385_00099 CDS open 114703-115296 _na     197_aa DUF1700 domain-containing protein
152 JALDVW010000001.1 GCA023110385_00100 CDS open 115283-115609 _na     108_aa padR Transcription regulator PadR N-terminal domain-containing protein
153 JALDVW010000001.1 GCA023110385_00101 CDS open 115745-116911 _na     388_aa Major facilitator superfamily (MFS) profile domain-containing protein
154 JALDVW010000001.1 GCA023110385_00102 CDS open 117133-117963 _na     276_aa Glycosyltransferase%2C group 2 family protein
155 JALDVW010000001.1 GCA023110385_00103 CDS open 118039-119889 _na     616_aa flaA1 Nucleoside-diphosphate sugar isomerase
156 JALDVW010000001.1 GCA023110385_00104 CDS open 119985-120614 _na     209_aa HAD hydrolase%2C family IA%2C variant 1
157 JALDVW010000001.1 GCA023110385_00105 CDS open 120642-121514 _na     290_aa sdaAA L-serine ammonia-lyase%2C iron-sulfur-dependent%2C subunit alpha
158 JALDVW010000001.1 GCA023110385_00106 CDS open 121523-122194 _na     223_aa sdaAB L-serine ammonia-lyase%2C iron-sulfur-dependent subunit beta
159 JALDVW010000001.1 GCA023110385_00107 CDS open 122436-123071 _na     211_aa lytE Putative peptidoglycan endopeptidase LytE
160 JALDVW010000001.1 GCA023110385_00108 CDS open 123093-123959 _na     288_aa HTH cro/C1-type domain-containing protein
161 JALDVW010000001.1 GCA023110385_00109 CDS open 124144-126252 _na     702_aa Amino acid ABC transporter permease
162 JALDVW010000001.1 GCA023110385_00110 CDS open 126249-126878 _na     209_aa Bacteriocin ABC transporter ATP-binding protein
163 JALDVW010000001.1 GCA023110385_00111 CDS open 127107-127913 _na     268_aa Amino acid ABC transporter ATP-binding protein
164 JALDVW010000001.1 GCA023110385_00112 CDS open 127929-129125 _na     398_aa argininosuccinate synthase
165 JALDVW010000001.1 GCA023110385_00113 CDS open 129153-130544 _na     463_aa argH argininosuccinate lyase
166 JALDVW010000001.1 GCA023110385_00114 CDS open 130972-132093 _na     373_aa mnmA tRNA 2-thiouridine(34) synthase MnmA
167 JALDVW010000001.1 GCA023110385_00116 CDS open 132234-132689 _na     151_aa MutT/nudix family protein
168 JALDVW010000001.1 GCA023110385_00117 CDS open 132698-134611 _na     637_aa mnmG tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG
169 JALDVW010000001.1 GCA023110385_00118 CDS open 134750-136429 _na     559_aa rnjA ribonuclease J1
170 JALDVW010000001.1 GCA023110385_00119 CDS open 136431-136664 _na     77_aa rpoY DNA-directed RNA polymerase subunit epsilon
171 JALDVW010000001.1 GCA023110385_00120 CDS open 137269-137412 _na     47_aa Bacteriocin
172 JALDVW010000001.1 GCA023110385_00121 CDS open 137414-137596 _na     60_aa cibA fratricide two-peptide bacteriocin subunit CibA
173 JALDVW010000001.1 GCA023110385_00122 CDS open 137784-138467 _na     227_aa tsaB tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB
174 JALDVW010000001.1 GCA023110385_00123 CDS open 138464-138901 _na     145_aa rimI ribosomal protein S18-alanine N-acetyltransferase
175 JALDVW010000001.1 GCA023110385_00124 CDS open 138891-139901 _na     336_aa tsaD tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD
176 JALDVW010000001.1 GCA023110385_00125 CDS open 139998-140861 _na     287_aa HTH cro/C1-type domain-containing protein
177 JALDVW010000001.1 GCA023110385_00126 CDS open 141148-141360 _na     70_aa peptide pheromone VP1
178 JALDVW010000001.1 GCA023110385_00127 CDS open 141427-142095 _na     222_aa CPBP family intramembrane metalloprotease
179 JALDVW010000001.1 GCA023110385_00128 CDS open 142350-142907 _na     185_aa Lipoprotein
180 JALDVW010000001.1 GCA023110385_00129 CDS open 143044-143739 _na     231_aa azlC AzlC protein
181 JALDVW010000001.1 GCA023110385_00130 CDS open 143729-144052 _na     107_aa Branched-chain amino acid permease
182 JALDVW010000001.1 GCA023110385_00131 CDS open 144155-144997 _na     280_aa hisJ ABC transporter substrate-binding protein-amino acid transport
183 JALDVW010000001.1 GCA023110385_00132 CDS open 145152-146006 _na     284_aa nlpA Lipoprotein
184 JALDVW010000001.1 GCA023110385_00133 CDS open 146125-147498 _na     457_aa argE Deacylase
185 JALDVW010000001.1 GCA023110385_00134 CDS open 147491-148552 _na     353_aa metN Methionine import ATP-binding protein MetN
186 JALDVW010000001.1 GCA023110385_00135 CDS open 148554-149246 _na     230_aa metP ABC transmembrane type-1 domain-containing protein
187 JALDVW010000001.1 GCA023110385_00136 CDS open 149275-149844 _na     189_aa TIGR02185 family protein
188 JALDVW010000001.1 GCA023110385_00137 CDS open 149978-150592 _na     204_aa PF04854 family protein
189 JALDVW010000001.1 GCA023110385_00138 CDS open 150558-152240 _na     560_aa Histidine kinase
190 JALDVW010000001.1 GCA023110385_00139 CDS open 152252-153538 _na     428_aa araC DNA-binding response regulator%2C AraC family
191 JALDVW010000001.1 GCA023110385_00140 CDS open 153597-154130 _na     177_aa ABC transporter permease
192 JALDVW010000001.1 GCA023110385_00141 CDS open 154207-154677 _na     156_aa nrdI class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI
193 JALDVW010000001.1 GCA023110385_00142 CDS open 154759-156021 _na     420_aa mntH Nramp family divalent metal transporter
194 JALDVW010000001.1 GCA023110385_00143 CDS open 156219-156464 _na     81_aa marR MarR family transcriptional regulator
195 JALDVW010000001.1 GCA023110385_00144 CDS open 156795-158486 _na     563_aa argS arginine--tRNA ligase
196 JALDVW010000001.1 GCA023110385_00145 CDS open 158641-159087 _na     148_aa argR arginine repressor
197 JALDVW010000001.1 GCA023110385_00147 CDS open 159138-161672 _na     844_aa mutS DNA mismatch repair protein MutS
198 JALDVW010000001.1 GCA023110385_00148 CDS open 161715-162173 _na     152_aa Gram-positive signal peptide protein%2C YSIRK family
199 JALDVW010000001.1 GCA023110385_00149 CDS open 162170-162610 _na     146_aa DNA-binding protein
200 JALDVW010000001.1 GCA023110385_00150 CDS open 162819-164768 _na     649_aa mutL DNA mismatch repair endonuclease MutL
201 JALDVW010000001.1 GCA023110385_00151 CDS open 164804-165325 _na     173_aa RDD domain-containing protein
202 JALDVW010000001.1 GCA023110385_00152 CDS open 165309-165812 _na     167_aa immR HTH-type transcriptional regulator ImmR
203 JALDVW010000001.1 GCA023110385_00153 CDS open 165985-167217 _na     410_aa Major facilitator superfamily protein
204 JALDVW010000001.1 GCA023110385_00154 CDS open 167230-167823 _na     197_aa ruvA Holliday junction branch migration protein RuvA
205 JALDVW010000001.1 GCA023110385_00155 CDS open 167833-168399 _na     188_aa DNA-3-methyladenine glycosylase I
206 JALDVW010000001.1 GCA023110385_00156 CDS open 168480-168743 _na     87_aa LD-carboxypeptidase
207 JALDVW010000001.1 GCA023110385_00157 CDS open 168849-169883 _na     344_aa ldcA Muramoyltetrapeptide carboxypeptidase
208 JALDVW010000001.1 GCA023110385_00158 CDS open 170043-170390 _na     115_aa tfoX TfoX N-terminal domain-containing protein
209 JALDVW010000001.1 GCA023110385_00159 CDS open 170406-171083 _na     225_aa DUF1129 domain-containing protein
210 JALDVW010000001.1 GCA023110385_00160 CDS open 171095-172039 _na     314_aa HTH cro/C1-type domain-containing protein
211 JALDVW010000001.1 GCA023110385_00161 CDS open 172143-175001 _na     952_aa uvrA excinuclease ABC subunit UvrA
212 JALDVW010000001.1 GCA023110385_00162 CDS open 175039-175794 _na     251_aa Aminoglycoside 6-adenylyltransferase
213 JALDVW010000001.1 GCA023110385_00163 CDS open 175942-177003 _na     353_aa X-Pro aminopeptidase
214 JALDVW010000001.1 GCA023110385_00164 CDS open 177406-180066 _na     886_aa mgtA magnesium-translocating P-type ATPase
215 JALDVW010000001.1 GCA023110385_00165 CDS open 180201-180599 _na     132_aa spx transcriptional regulator Spx
216 JALDVW010000001.1 GCA023110385_00166 CDS open 180666-181235 _na     189_aa SP-0191-like C-terminal domain-containing protein
217 JALDVW010000001.1 GCA023110385_00167 CDS open 181322-181588 _na     88_aa ireB IreB family regulatory phosphoprotein
218 JALDVW010000001.1 GCA023110385_00168 CDS open 181592-182011 _na     139_aa ruvX Holliday junction resolvase RuvX
219 JALDVW010000001.1 GCA023110385_00169 CDS open 182027-182332 _na     101_aa yrzB UPF0473 protein SPH_0311
220 JALDVW010000001.1 GCA023110385_00170 CDS open 182641-183891 _na     416_aa folC Bifunctional FolC family protein
221 JALDVW010000001.1 GCA023110385_00171 CDS open 183982-184434 _na     150_aa SP_0198 family lipoprotein
222 JALDVW010000001.1 GCA023110385_00172 CDS open 184782-186314 _na     510_aa cls cardiolipin synthase
223 JALDVW010000001.1 GCA023110385_00173 CDS open 186389-186532 _na     47_aa Induced during competence
224 JALDVW010000001.1 GCA023110385_00174 CDS open 186568-188085 _na     505_aa Competence-induced protein Ccs4
225 JALDVW010000001.1 GCA023110385_00175 CDS open 188215-190422 _na     735_aa nrdD anaerobic ribonucleoside-triphosphate reductase
226 JALDVW010000001.1 GCA023110385_00176 CDS open 190434-190574 _na     46_aa 30S ribosomal protein S10
227 JALDVW010000001.1 GCA023110385_00177 CDS open 190618-191118 _na     166_aa Acetyltransferase%2C GNAT family protein
228 JALDVW010000001.1 GCA023110385_00178 CDS open 191123-191719 _na     198_aa nrdG anaerobic ribonucleoside-triphosphate reductase activating protein
229 JALDVW010000001.1 GCA023110385_00179 CDS open 191716-192342 _na     208_aa Phosphoribulokinase/uridine kinase domain-containing protein
230 JALDVW010000001.1 GCA023110385_00180 CDS open 192910-193323 _na     137_aa Integron-associated effector binding protein domain-containing protein
231 JALDVW010000001.1 GCA023110385_00181 CDS open 193580-193888 _na     102_aa rpsJ 30S ribosomal protein S10
232 JALDVW010000001.1 GCA023110385_00182 CDS open 193971-194597 _na     208_aa rplC 50S ribosomal protein L3
233 JALDVW010000001.1 GCA023110385_00183 CDS open 194622-195245 _na     207_aa rplD 50S ribosomal protein L4
234 JALDVW010000001.1 GCA023110385_00184 CDS open 195245-195541 _na     98_aa rplW 50S ribosomal protein L23
235 JALDVW010000001.1 GCA023110385_00185 CDS open 195559-196392 _na     277_aa rplB 50S ribosomal protein L2
236 JALDVW010000001.1 GCA023110385_00186 CDS open 196496-196777 _na     93_aa rpsS 30S ribosomal protein S19
237 JALDVW010000001.1 GCA023110385_00187 CDS open 196789-197133 _na     114_aa Large ribosomal subunit protein uL22
238 JALDVW010000001.1 GCA023110385_00188 CDS open 197146-197799 _na     217_aa rpsC 30S ribosomal protein S3
239 JALDVW010000001.1 GCA023110385_00189 CDS open 197803-198216 _na     137_aa rplP 50S ribosomal protein L16
240 JALDVW010000001.1 GCA023110385_00190 CDS open 198226-198432 _na     68_aa rpmC 50S ribosomal protein L29
241 JALDVW010000001.1 GCA023110385_00191 CDS open 198457-198717 _na     86_aa rpsQ 30S ribosomal protein S17
242 JALDVW010000001.1 GCA023110385_00192 CDS open 198743-199111 _na     122_aa rplN 50S ribosomal protein L14
243 JALDVW010000001.1 GCA023110385_00193 CDS open 199189-199494 _na     101_aa rplX 50S ribosomal protein L24
244 JALDVW010000001.1 GCA023110385_00194 CDS open 199518-200060 _na     180_aa rplE 50S ribosomal protein L5
245 JALDVW010000001.1 GCA023110385_00195 CDS open 200078-200263 _na     61_aa rpsZ type Z 30S ribosomal protein S14
246 JALDVW010000001.1 GCA023110385_00196 CDS open 200548-200946 _na     132_aa rpsH 30S ribosomal protein S8
247 JALDVW010000001.1 GCA023110385_00197 CDS open 201113-201292 _na     59_aa Phage protein
248 JALDVW010000001.1 GCA023110385_00198 CDS open 201354-201890 _na     178_aa rplF 50S ribosomal protein L6
249 JALDVW010000001.1 GCA023110385_00199 CDS open 201974-202330 _na     118_aa rplR 50S ribosomal protein L18
250 JALDVW010000001.1 GCA023110385_00200 CDS open 202348-202842 _na     164_aa rpsE 30S ribosomal protein S5
251 JALDVW010000001.1 GCA023110385_00201 CDS open 202856-203038 _na     60_aa rpmD 50S ribosomal protein L30
252 JALDVW010000001.1 GCA023110385_00202 CDS open 203183-203623 _na     146_aa rplO 50S ribosomal protein L15
253 JALDVW010000001.1 GCA023110385_00203 CDS open 203636-204946 _na     436_aa secY preprotein translocase subunit SecY
254 JALDVW010000001.1 GCA023110385_00204 CDS open 205092-205730 _na     212_aa adk adenylate kinase
255 JALDVW010000001.1 GCA023110385_00205 CDS open 205847-206065 _na     72_aa infA translation initiation factor IF-1
256 JALDVW010000001.1 GCA023110385_00206 CDS open 206090-206206 _na     38_aa rpmJ 50S ribosomal protein L36
257 JALDVW010000001.1 GCA023110385_00207 CDS open 206224-206589 _na     121_aa rpsM 30S ribosomal protein S13
258 JALDVW010000001.1 GCA023110385_00208 CDS open 206607-206990 _na     127_aa rpsK 30S ribosomal protein S11
259 JALDVW010000001.1 GCA023110385_00209 CDS open 207033-207968 _na     311_aa rpoA DNA-directed RNA polymerase subunit alpha
260 JALDVW010000001.1 GCA023110385_00210 CDS open 207980-208366 _na     128_aa rplQ 50S ribosomal protein L17
261 JALDVW010000001.1 GCA023110385_00211 CDS open 208631-208897 _na     88_aa ACT domain-containing protein
262 JALDVW010000001.1 GCA023110385_00212 CDS open 208907-210244 _na     445_aa UPF0210 protein SPJ_0248
263 JALDVW010000001.1 GCA023110385_00214 CDS open 210481-211173 _na     230_aa phoE 2%2C3-bisphosphoglycerate-dependent phosphoglycerate mutase
264 JALDVW010000001.1 GCA023110385_00215 CDS open 211333-213834 _na     833_aa leuS leucine--tRNA ligase
265 JALDVW010000001.1 GCA023110385_00216 CDS open 213944-214639 _na     231_aa rimL GNAT family protein
266 JALDVW010000001.1 GCA023110385_00217 CDS open 214651-215067 _na     138_aa Acetyltransferase%2C GNAT family protein
267 JALDVW010000001.1 GCA023110385_00220 CDS open 215665-216543 _na     292_aa araC AraC family transcriptional regulator
268 JALDVW010000001.1 GCA023110385_00221 CDS open 216619-217818 _na     399_aa OFA family MFS transporter
269 JALDVW010000001.1 GCA023110385_00222 CDS open 218037-218645 _na     202_aa NADPH-dependent FMN reductase domain-containing protein
270 JALDVW010000001.1 GCA023110385_00223 CDS open 218671-221082 _na     803_aa urdA Urocanate reductase
271 JALDVW010000001.1 GCA023110385_00225 CDS open 221267-222265 _na     332_aa ruvB Holliday junction branch migration DNA helicase RuvB
272 JALDVW010000001.1 GCA023110385_00226 CDS open 222246-222830 _na     194_aa Nucleotidyltransferase family protein
273 JALDVW010000001.1 GCA023110385_00228 CDS open 223037-223795 _na     252_aa uppS isoprenyl transferase
274 JALDVW010000001.1 GCA023110385_00229 CDS open 223804-224607 _na     267_aa Phosphatidate cytidylyltransferase
275 JALDVW010000001.1 GCA023110385_00230 CDS open 224623-225879 _na     418_aa rseP RIP metalloprotease RseP
276 JALDVW010000001.1 GCA023110385_00231 CDS open 225896-227749 _na     617_aa proS proline--tRNA ligase
277 JALDVW010000001.1 GCA023110385_00232 CDS open 227847-229226 _na     459_aa bglB 6-phospho-beta-glucosidase
278 JALDVW010000001.1 GCA023110385_00233 CDS open 229265-229678 _na     137_aa eamA EamA domain-containing protein
279 JALDVW010000001.1 GCA023110385_00234 CDS open 229894-231702 _na     602_aa glmS glutamine--fructose-6-phosphate transaminase (isomerizing)
280 JALDVW010000001.1 GCA023110385_00235 CDS open 231813-232865 _na     350_aa ssuD Luciferase-like domain-containing protein
281 JALDVW010000001.1 GCA023110385_00236 CDS open 233098-233955 _na     285_aa 5'-nucleotidase%2C lipoprotein e(P4) family
282 JALDVW010000001.1 GCA023110385_00237 CDS open 234322-235326 _na     334_aa Uroporphyrinogen decarboxylase (URO-D) domain-containing protein
283 JALDVW010000001.1 GCA023110385_00238 CDS open 235338-235541 _na     67_aa Enoyl-CoA hydratase
284 JALDVW010000001.1 GCA023110385_00239 CDS open 235544-236542 _na     332_aa Uroporphyrinogen decarboxylase (URO-D) domain-containing protein
285 JALDVW010000001.1 GCA023110385_00240 CDS open 236554-237432 _na     292_aa Solute-binding protein family 3/N-terminal domain-containing protein
286 JALDVW010000001.1 GCA023110385_00241 CDS open 237465-238157 _na     230_aa ABC transmembrane type-1 domain-containing protein
287 JALDVW010000001.1 GCA023110385_00242 CDS open 238161-238883 _na     240_aa ABC transmembrane type-1 domain-containing protein
288 JALDVW010000001.1 GCA023110385_00243 CDS open 238893-239657 _na     254_aa glnQ Glutamine ABC transporter%2C ATP-binding protein GlnQ
289 JALDVW010000001.1 GCA023110385_00244 CDS open 239859-243575 _na     1238_aa pullulanase
290 JALDVW010000001.1 GCA023110385_00245 CDS open 244018-247629 _na     1203_aa rpoB DNA-directed RNA polymerase subunit beta
291 JALDVW010000001.1 GCA023110385_00246 CDS open 247662-251327 _na     1221_aa rpoC DNA-directed RNA polymerase subunit beta'
292 JALDVW010000001.1 GCA023110385_00247 CDS open 251438-251857 _na     139_aa ndk nucleoside-diphosphate kinase
293 JALDVW010000001.1 GCA023110385_00248 CDS open 251992-252615 _na     207_aa comM Immunity factor ComM
294 JALDVW010000001.1 GCA023110385_00249 CDS open 252699-253142 _na     147_aa tsaE tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE
295 JALDVW010000001.1 GCA023110385_00250 CDS open 253132-253653 _na     173_aa Acetyltransferase%2C GNAT family
296 JALDVW010000001.1 GCA023110385_00251 CDS open 253658-254698 _na     346_aa brpA biofilm formation/cell division transcriptional regulator BrpA
297 JALDVW010000001.1 GCA023110385_00252 CDS open 254771-256027 _na     418_aa competence/damage-inducible protein A
298 JALDVW010000001.1 GCA023110385_00253 CDS open 256082-257233 _na     383_aa recA recombinase RecA
299 JALDVW010000001.1 GCA023110385_00254 CDS open 257363-257557 _na     64_aa pspC PspC domain protein
300 JALDVW010000001.1 GCA023110385_00255 CDS open 257689-258243 _na     184_aa N-acetyltransferase domain-containing protein
301 JALDVW010000001.1 GCA023110385_00256 CDS open 258353-259723 _na     456_aa norM Damage inducible DinF protein
302 JALDVW010000001.1 GCA023110385_00257 CDS open 259820-260536 _na     238_aa tACO1 YebC/PmpR family DNA-binding transcriptional regulator
303 JALDVW010000001.1 GCA023110385_00258 CDS open 260587-261270 _na     227_aa Immunity region
304 JALDVW010000001.1 GCA023110385_00259 CDS open 261484-261945 _na     153_aa marR Transcriptional regulator%2C MarR family
305 JALDVW010000001.1 GCA023110385_00260 CDS open 261929-263698 _na     589_aa ABC transporter ATP-binding protein
306 JALDVW010000001.1 GCA023110385_00261 CDS open 263688-265448 _na     586_aa ABC transporter ATP-binding protein
307 JALDVW010000001.1 GCA023110385_00262 CDS open 265546-266049 _na     167_aa undecaprenyl-diphosphate phosphatase
308 JALDVW010000001.1 GCA023110385_00263 CDS open 266163-266609 _na     148_aa lytTR HTH LytTR-type domain-containing protein
309 JALDVW010000001.1 GCA023110385_00264 CDS open 266615-267289 _na     224_aa liaF LiaF transmembrane domain-containing protein
310 JALDVW010000001.1 GCA023110385_00265 CDS open 267394-267582 _na     62_aa rpmB 50S ribosomal protein L28
311 JALDVW010000001.1 GCA023110385_00266 CDS open 267735-268100 _na     121_aa yloU Asp23/Gls24 family envelope stress response protein
312 JALDVW010000001.1 GCA023110385_00267 CDS open 268103-269770 _na     555_aa fakA DhaL domain-containing protein
313 JALDVW010000001.1 GCA023110385_00268 CDS open 269910-270101 _na     63_aa Alanine aminotransferase
314 JALDVW010000001.1 GCA023110385_00269 CDS open 270098-270292 _na     64_aa Alanine aminotransferase
315 JALDVW010000001.1 GCA023110385_00270 CDS open 270279-271154 _na     291_aa yxlF Putative ABC transporter ATP-binding protein YxlF
316 JALDVW010000001.1 GCA023110385_00271 CDS open 271167-271901 _na     244_aa Multidrug ABC transporter permease
317 JALDVW010000001.1 GCA023110385_00272 CDS open 271906-273003 _na     365_aa histidine kinase
318 JALDVW010000001.1 GCA023110385_00273 CDS open 273005-273604 _na     199_aa citB Response regulator
319 JALDVW010000001.1 GCA023110385_00274 CDS open 273923-274336 _na     137_aa rpsL 30S ribosomal protein S12
320 JALDVW010000001.1 GCA023110385_00275 CDS open 274356-274826 _na     156_aa rpsG 30S ribosomal protein S7
321 JALDVW010000001.1 GCA023110385_00276 CDS open 275105-277186 _na     693_aa fusA elongation factor G
322 JALDVW010000001.1 GCA023110385_00277 CDS open 277510-279210 _na     566_aa ilvB acetolactate synthase large subunit
323 JALDVW010000001.1 GCA023110385_00278 CDS open 279203-279679 _na     158_aa ilvN acetolactate synthase small subunit
324 JALDVW010000001.1 GCA023110385_00279 CDS open 279769-280791 _na     340_aa ilvC ketol-acid reductoisomerase
325 JALDVW010000001.1 GCA023110385_00280 CDS open 280871-282121 _na     416_aa ilvA threonine ammonia-lyase IlvA
326 JALDVW010000001.1 GCA023110385_00281 CDS open 282204-283100 _na     298_aa hflK Modulator of FtsH protease HflK
327 JALDVW010000001.1 GCA023110385_00282 CDS open 283207-283422 _na     71_aa Spermidine synthase
328 JALDVW010000001.1 GCA023110385_00283 CDS open 283515-284255 _na     246_aa glnQ ABC transporter ATP-binding protein
329 JALDVW010000001.1 GCA023110385_00284 CDS open 284252-285817 _na     521_aa hisJ Glutamine ABC transporter substrate-binding protein
330 JALDVW010000001.1 GCA023110385_00285 CDS open 285947-287842 _na     631_aa Threonine dehydratase
331 JALDVW010000001.1 GCA023110385_00286 CDS open 287902-288747 _na     281_aa undecaprenyl-diphosphate phosphatase
332 JALDVW010000001.1 GCA023110385_00287 CDS open 288782-289843 _na     353_aa dinB DNA polymerase IV
333 JALDVW010000001.1 GCA023110385_00288 CDS open 290075-292390 _na     771_aa pflB formate C-acetyltransferase
334 JALDVW010000001.1 GCA023110385_00289 CDS open 292711-296784 _na     1357_aa Gram-positive cocci surface proteins LPxTG domain-containing protein
335 JALDVW010000001.1 GCA023110385_00290 CDS open 297237-299342 _na     701_aa clpL ATP-dependent Clp protease ATP-binding subunit ClpL
336 JALDVW010000001.1 GCA023110385_00291 CDS open 299510-299992 _na     160_aa luxS S-ribosylhomocysteine lyase
337 JALDVW010000001.1 GCA023110385_00292 CDS open 300087-301571 _na     494_aa UPF0371 protein SP70585_0405
338 JALDVW010000001.1 GCA023110385_00293 CDS open 301724-303334 _na     536_aa dexB Glucan 1%2C6-alpha-glucosidase
339 JALDVW010000001.1 GCA023110385_00294 CDS open 303395-303736 _na     113_aa Integrase core domain
340 JALDVW010000001.1 GCA023110385_00295 CDS open 304022-304165 _na     47_aa hypothetical protein
341 JALDVW010000001.1 GCA023110385_00296 CDS open 304528-306495 _na     655_aa amiA Oligopeptide-binding protein AmiA
342 JALDVW010000001.1 GCA023110385_00297 CDS open 306644-308605 _na     653_aa sarA Oligopeptide-binding protein SarA
343 JALDVW010000001.1 GCA023110385_00298 CDS open 308797-310242 _na     481_aa Cell envelope-related transcriptional attenuator domain-containing protein
344 JALDVW010000001.1 GCA023110385_00299 CDS open 310244-310975 _na     243_aa cps4B capsular polysaccharide biosynthesis protein Cps4B
345 JALDVW010000001.1 GCA023110385_00300 CDS open 310984-311676 _na     230_aa cpsC capsular polysaccharide biosynthesis protein CpsC
346 JALDVW010000001.1 GCA023110385_00301 CDS open 311686-312378 _na     230_aa cpsD Tyrosine-protein kinase CpsD
347 JALDVW010000001.1 GCA023110385_00302 CDS open 312401-313768 _na     455_aa epsL Putative sugar transferase EpsL
348 JALDVW010000001.1 GCA023110385_00303 CDS open 313799-314971 _na     390_aa cps2T beta 1-4 rhamnosyltransferase Cps2T
349 JALDVW010000001.1 GCA023110385_00304 CDS open 314975-316132 _na     385_aa Glycosyl transferase family protein
350 JALDVW010000001.1 GCA023110385_00305 CDS open 316135-317133 _na     332_aa wcwK Capsular polysaccharide phosphotransferase WcwK
351 JALDVW010000001.1 GCA023110385_00306 CDS open 317168-318133 _na     321_aa Glycosyl transferase family 2 protein
352 JALDVW010000001.1 GCA023110385_00307 CDS open 318172-319332 _na     386_aa Polysaccharide polymerase
353 JALDVW010000001.1 GCA023110385_00308 CDS open 319329-320741 _na     470_aa Putative O-antigen transporter
354 JALDVW010000001.1 GCA023110385_00309 CDS open 320751-321854 _na     367_aa glf UDP-galactopyranose mutase
355 JALDVW010000001.1 GCA023110385_00310 CDS open 321882-322934 _na     350_aa wbbI Beta-1%2C6-galactofuranosyltransferase WbbI
356 JALDVW010000001.1 GCA023110385_00311 CDS open 323006-323875 _na     289_aa rfbA glucose-1-phosphate thymidylyltransferase RfbA
357 JALDVW010000001.1 GCA023110385_00312 CDS open 323876-324469 _na     197_aa dTDP-4-dehydrorhamnose 3%2C5-epimerase
358 JALDVW010000001.1 GCA023110385_00313 CDS open 324488-325534 _na     348_aa rfbB dTDP-glucose 4%2C6-dehydratase
359 JALDVW010000001.1 GCA023110385_00314 CDS open 325595-326449 _na     284_aa rfbD dTDP-4-dehydrorhamnose reductase
360 JALDVW010000001.1 GCA023110385_00315 CDS open 326687-328669 _na     660_aa ABC transporter%2C substrate-binding protein%2C family 5
361 JALDVW010000001.1 GCA023110385_00316 CDS open 328993-335361 _na     2122_aa SpGH101 family endo-alpha-N-acetylgalactosaminidase
362 JALDVW010000001.1 GCA023110385_00317 CDS open 335502-343751 _na     2749_aa SIALI-17 repeat-containing surface protein
363 JALDVW010000001.1 GCA023110385_00318 CDS open 343919-346087 _na     722_aa pbp1a penicillin-binding protein PBP1A
364 JALDVW010000001.1 GCA023110385_00319 CDS open 346084-346680 _na     198_aa recU Holliday junction resolvase RecU
365 JALDVW010000001.1 GCA023110385_00320 CDS open 346747-347274 _na     175_aa DUF1273 domain-containing protein
366 JALDVW010000001.1 GCA023110385_00321 CDS open 347344-347673 _na     109_aa gpsB cell division regulator GpsB
367 JALDVW010000001.1 GCA023110385_00323 CDS open 348159-349316 _na     385_aa rlmL THUMP domain-containing protein
368 JALDVW010000001.1 GCA023110385_00324 CDS open 349329-350777 _na     482_aa mapZ cell division site-positioning protein MapZ family protein
369 JALDVW010000001.1 GCA023110385_00325 CDS open 350853-352277 _na     474_aa gndA NADP-dependent phosphogluconate dehydrogenase
370 JALDVW010000001.1 GCA023110385_00326 CDS open 352289-352978 _na     229_aa arlR Response regulator ArlR
371 JALDVW010000001.1 GCA023110385_00327 CDS open 353078-354115 _na     345_aa cbpF choline-binding protein CbpF
372 JALDVW010000001.1 GCA023110385_00328 CDS open 354237-355115 _na     292_aa mvk mevalonate kinase
373 JALDVW010000001.1 GCA023110385_00329 CDS open 355097-356050 _na     317_aa mvaD diphosphomevalonate decarboxylase
374 JALDVW010000001.1 GCA023110385_00330 CDS open 356037-357044 _na     335_aa phosphomevalonate kinase
375 JALDVW010000001.1 GCA023110385_00331 CDS open 357028-358029 _na     333_aa fni type 2 isopentenyl-diphosphate Delta-isomerase
376 JALDVW010000001.1 GCA023110385_00332 CDS open 358196-358894 _na     232_aa Cell wall-active antibiotics response LiaF-like C-terminal domain-containing protein
377 JALDVW010000001.1 GCA023110385_00333 CDS open 358891-359889 _na     332_aa Sensor histidine kinase
378 JALDVW010000001.1 GCA023110385_00334 CDS open 359900-360532 _na     210_aa citB Response regulator
379 JALDVW010000001.1 GCA023110385_00335 CDS open 360533-361189 _na     218_aa DNA alkylation repair enzyme
380 JALDVW010000001.1 GCA023110385_00336 CDS open 361282-362565 _na     427_aa tig trigger factor
381 JALDVW010000001.1 GCA023110385_00337 CDS open 362613-364982 _na     789_aa recD ATP-dependent RecD2 DNA helicase
382 JALDVW010000001.1 GCA023110385_00338 CDS open 365111-365611 _na     166_aa lepB signal peptidase I
383 JALDVW010000001.1 GCA023110385_00339 CDS open 365729-366610 _na     293_aa rnhC ribonuclease HIII
384 JALDVW010000001.1 GCA023110385_00340 CDS open 366697-366999 _na     100_aa zapA Cell division protein ZapA
385 JALDVW010000001.1 GCA023110385_00341 CDS open 366996-367544 _na     182_aa cvpA CvpA family protein
386 JALDVW010000001.1 GCA023110385_00342 CDS open 367645-369981 _na     778_aa mutS2 endonuclease MutS2
387 JALDVW010000001.1 GCA023110385_00343 CDS open 370325-371647 _na     440_aa alsT Amino acid carrier family protein
388 JALDVW010000001.1 GCA023110385_00344 CDS open 371779-372327 _na     182_aa yciW Carboxymuconolactone decarboxylase-like domain-containing protein
389 JALDVW010000001.1 GCA023110385_00345 CDS open 372438-373337 _na     299_aa tehA Exfoliative toxin A
390 JALDVW010000001.1 GCA023110385_00346 CDS open 373363-374637 _na     424_aa serS serine--tRNA ligase
391 JALDVW010000001.1 GCA023110385_00347 CDS open 374852-375223 _na     123_aa manO PTS mannose transporter accessory protein ManO
392 JALDVW010000001.1 GCA023110385_00348 CDS open 375226-376590 _na     454_aa metL1 aspartate kinase
393 JALDVW010000001.1 GCA023110385_00349 CDS open 376874-377659 _na     261_aa enoyl-CoA hydratase
394 JALDVW010000001.1 GCA023110385_00350 CDS open 377749-378183 _na     144_aa HTH marR-type domain-containing protein
395 JALDVW010000001.1 GCA023110385_00351 CDS open 378183-379157 _na     324_aa Beta-ketoacyl-[acyl-carrier-protein] synthase III
396 JALDVW010000001.1 GCA023110385_00352 CDS open 379215-379439 _na     74_aa acpP Acyl carrier protein
397 JALDVW010000001.1 GCA023110385_00353 CDS open 379557-380531 _na     324_aa fabK enoyl-[acyl-carrier-protein] reductase FabK
398 JALDVW010000001.1 GCA023110385_00354 CDS open 380524-381444 _na     306_aa fabD ACP S-malonyltransferase
399 JALDVW010000001.1 GCA023110385_00355 CDS open 381490-382221 _na     243_aa fabG 3-oxoacyl-[acyl-carrier-protein] reductase
400 JALDVW010000001.1 GCA023110385_00356 CDS open 382250-383485 _na     411_aa fabF beta-ketoacyl-ACP synthase II
401 JALDVW010000001.1 GCA023110385_00357 CDS open 383488-383976 _na     162_aa accB acetyl-CoA carboxylase biotin carboxyl carrier protein
402 JALDVW010000001.1 GCA023110385_00358 CDS open 383973-384395 _na     140_aa fabZ 3-hydroxyacyl-ACP dehydratase FabZ
403 JALDVW010000001.1 GCA023110385_00359 CDS open 384407-385774 _na     455_aa accC acetyl-CoA carboxylase biotin carboxylase subunit
404 JALDVW010000001.1 GCA023110385_00360 CDS open 385810-386676 _na     288_aa accD acetyl-CoA carboxylase%2C carboxyltransferase subunit beta
405 JALDVW010000001.1 GCA023110385_00361 CDS open 386673-387440 _na     255_aa accA acetyl-CoA carboxylase carboxyl transferase subunit alpha
406 JALDVW010000001.1 GCA023110385_00362 CDS open 387588-388289 _na     233_aa CPBP family intramembrane metalloprotease
407 JALDVW010000001.1 GCA023110385_00363 CDS open 388338-388760 _na     140_aa nusB transcription antitermination factor NusB
408 JALDVW010000001.1 GCA023110385_00364 CDS open 388753-389142 _na     129_aa yloU General stress protein%2C Gls24 family
409 JALDVW010000001.1 GCA023110385_00365 CDS open 389164-389724 _na     186_aa efp elongation factor P
410 JALDVW010000001.1 GCA023110385_00366 CDS open 389806-390933 _na     375_aa SPFH domain-containing protein
411 JALDVW010000001.1 GCA023110385_00367 CDS open 390942-391886 _na     314_aa Tim44-like domain-containing protein
412 JALDVW010000001.1 GCA023110385_00368 CDS open 391949-393394 _na     481_aa gatB Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB
413 JALDVW010000001.1 GCA023110385_00369 CDS open 393394-394860 _na     488_aa gatA Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA
414 JALDVW010000001.1 GCA023110385_00370 CDS open 394860-395162 _na     100_aa gatC Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC
415 JALDVW010000001.1 GCA023110385_00371 CDS open 395328-396020 _na     230_aa Integral membrane protein
416 JALDVW010000001.1 GCA023110385_00372 CDS open 396164-397708 _na     514_aa prfC peptide chain release factor 3
417 JALDVW010000001.1 GCA023110385_00373 CDS open 402647-402859 _na     70_aa hypothetical protein
418 JALDVW010000001.1 GCA023110385_00374 CDS open 403215-405566 _na     783_aa hypothetical protein
419 JALDVW010000001.1 GCA023110385_00375 CDS open 405786-407012 _na     408_aa Glycosyl transferase family protein
420 JALDVW010000001.1 GCA023110385_00376 CDS open 407028-408257 _na     409_aa Glycosyl hydrolase family 8
421 JALDVW010000001.1 GCA023110385_00377 CDS open 408346-409563 _na     405_aa secY2 accessory Sec system protein translocase subunit SecY2
422 JALDVW010000001.1 GCA023110385_00378 CDS open 409573-411153 _na     526_aa asp1 accessory Sec system protein Asp1
423 JALDVW010000001.1 GCA023110385_00379 CDS open 411137-412666 _na     509_aa asp2 accessory Sec system protein Asp2
424 JALDVW010000001.1 GCA023110385_00380 CDS open 412663-413103 _na     146_aa asp3 accessory Sec system protein Asp3
425 JALDVW010000001.1 GCA023110385_00381 CDS open 413096-415468 _na     790_aa secA2 accessory Sec system translocase SecA2
426 JALDVW010000001.1 GCA023110385_00382 CDS open 415481-417001 _na     506_aa gtfA accessory Sec system glycosyltransferase GtfA
427 JALDVW010000001.1 GCA023110385_00383 CDS open 416985-418331 _na     448_aa gtfB accessory Sec system glycosylation chaperone GtfB
428 JALDVW010000001.1 GCA023110385_00384 CDS open 418324-418503 _na     59_aa Accessory secretory protein Asp4
429 JALDVW010000001.1 GCA023110385_00385 CDS open 418508-418729 _na     73_aa Accessory secretory protein Asp5
430 JALDVW010000001.1 GCA023110385_00386 CDS open 418800-419285 _na     161_aa yezG Antitoxin YezG
431 JALDVW010000001.1 GCA023110385_00387 CDS open 419402-419974 _na     190_aa Suppressor of fused-like domain-containing protein
432 JALDVW010000001.1 GCA023110385_00388 CDS open 420267-420791 _na     174_aa Transposase
433 JALDVW010000001.1 GCA023110385_00389 CDS open 420775-421380 _na     201_aa hypothetical protein
434 JALDVW010000001.1 GCA023110385_00390 CDS open 421487-422029 _na     180_aa GAD-like domain-containing protein
435 JALDVW010000001.1 GCA023110385_00391 CDS open 422132-423085 _na     317_aa Putative aromatic acid exporter C-terminal domain-containing protein
436 JALDVW010000001.1 GCA023110385_00392 CDS open 423135-424346 _na     403_aa sstT serine/threonine transporter SstT
437 JALDVW010000001.1 GCA023110385_00393 CDS open 424496-425056 _na     186_aa Small conductance mechanosensitive ion channel protein
438 JALDVW010000001.1 GCA023110385_00394 CDS open 425114-426022 _na     302_aa corA Magnesium and cobalt transporter CorA
439 JALDVW010000001.1 GCA023110385_00395 CDS open 426040-426567 _na     175_aa UMP phosphatase
440 JALDVW010000001.1 GCA023110385_00396 CDS open 426570-427676 _na     368_aa yqeH ribosome biogenesis GTPase YqeH
441 JALDVW010000001.1 GCA023110385_00397 CDS open 427890-428201 _na     103_aa yhbY ribosome assembly RNA-binding protein YhbY
442 JALDVW010000001.1 GCA023110385_00398 CDS open 428252-428881 _na     209_aa nicotinate-nucleotide adenylyltransferase
443 JALDVW010000001.1 GCA023110385_00399 CDS open 428881-429474 _na     197_aa yqeK bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK
444 JALDVW010000001.1 GCA023110385_00400 CDS open 429475-429828 _na     117_aa rsfS ribosome silencing factor
445 JALDVW010000001.1 GCA023110385_00401 CDS open 430143-430889 _na     248_aa ubiE Methyltransferase domain-containing protein
446 JALDVW010000001.1 GCA023110385_00402 CDS open 430899-431996 _na     365_aa tmcAL nucleotidyltransferase
447 JALDVW010000001.1 GCA023110385_00403 CDS open 432201-433814 _na     537_aa rny ribonuclease Y
448 JALDVW010000001.1 GCA023110385_00404 CDS open 433949-434575 _na     208_aa gmk guanylate kinase
449 JALDVW010000001.1 GCA023110385_00405 CDS open 434600-434914 _na     104_aa rpoZ DNA-directed RNA polymerase subunit omega
450 JALDVW010000001.1 GCA023110385_00406 CDS open 434980-437376 _na     798_aa priA primosomal protein N'
451 JALDVW010000001.1 GCA023110385_00407 CDS open 437389-438324 _na     311_aa fmt methionyl-tRNA formyltransferase
452 JALDVW010000001.1 GCA023110385_00408 CDS open 438317-439630 _na     437_aa rsmB 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB
453 JALDVW010000001.1 GCA023110385_00409 CDS open 439646-440386 _na     246_aa phpP Stp1/IreP family PP2C-type Ser/Thr phosphatase
454 JALDVW010000001.1 GCA023110385_00410 CDS open 440383-442284 _na     633_aa pknB Stk1 family PASTA domain-containing Ser/Thr kinase
455 JALDVW010000001.1 GCA023110385_00411 CDS open 442372-443130 _na     252_aa Threonine/serine exporter-like N-terminal domain-containing protein
456 JALDVW010000001.1 GCA023110385_00412 CDS open 443132-443587 _na     151_aa thrE Threonine/Serine exporter ThrE domain-containing protein
457 JALDVW010000001.1 GCA023110385_00413 CDS open 443706-444878 _na     390_aa hydroxymethylglutaryl-CoA synthase
458 JALDVW010000001.1 GCA023110385_00414 CDS open 444878-446152 _na     424_aa hMG1 hydroxymethylglutaryl-CoA reductase%2C degradative
459 JALDVW010000001.1 GCA023110385_00415 CDS open 446187-447152 _na     321_aa purR HTH lacI-type domain-containing protein
460 JALDVW010000001.1 GCA023110385_00416 CDS open 447133-448587 _na     484_aa sacC Sucrose-6-phosphate hydrolase
461 JALDVW010000001.1 GCA023110385_00417 CDS open 448966-450861 _na     631_aa PTS system sucrose-specific IIBC component
462 JALDVW010000001.1 GCA023110385_00418 CDS open 451020-451907 _na     295_aa scrK fructokinase ScrK
463 JALDVW010000001.1 GCA023110385_00419 CDS open 451954-452571 _na     205_aa tVP38 TVP38/TMEM64 family membrane protein
464 JALDVW010000001.1 GCA023110385_00420 CDS open 452704-455337 _na     877_aa Helicase ATP-binding domain-containing protein
465 JALDVW010000001.1 GCA023110385_00421 CDS open 455581-457449 _na     622_aa NTPase
466 JALDVW010000001.1 GCA023110385_00422 CDS open 457662-458066 _na     134_aa DUF1722 domain-containing protein
467 JALDVW010000001.1 GCA023110385_00423 CDS open 458050-458415 _na     121_aa Pyrimidine dimer DNA glycosylase
468 JALDVW010000001.1 GCA023110385_00424 CDS open 458604-458897 _na     97_aa aF2118 HTH cro/C1-type domain-containing protein
469 JALDVW010000001.1 GCA023110385_00425 CDS open 459250-461499 _na     749_aa metE 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase
470 JALDVW010000001.1 GCA023110385_00426 CDS open 461594-462460 _na     288_aa metF methylenetetrahydrofolate reductase [NAD(P)H]
471 JALDVW010000001.1 GCA023110385_00427 CDS open 463001-465214 _na     737_aa pnp polyribonucleotide nucleotidyltransferase
472 JALDVW010000001.1 GCA023110385_00428 CDS open 465229-465846 _na     205_aa cysE serine O-acetyltransferase
473 JALDVW010000001.1 GCA023110385_00429 CDS open 465858-466724 _na     288_aa N-acetyltransferase domain-containing protein
474 JALDVW010000001.1 GCA023110385_00430 CDS open 466729-467493 _na     254_aa Uridine phosphorylase
475 JALDVW010000001.1 GCA023110385_00431 CDS open 467502-468023 _na     173_aa Diacylglycerol kinase
476 JALDVW010000001.1 GCA023110385_00432 CDS open 468041-469384 _na     447_aa cysS cysteine--tRNA ligase
477 JALDVW010000001.1 GCA023110385_00433 CDS open 469377-469763 _na     128_aa mrnC Mini-ribonuclease 3
478 JALDVW010000001.1 GCA023110385_00434 CDS open 469767-470636 _na     289_aa pucR PucR C-terminal helix-turn-helix domain-containing protein
479 JALDVW010000001.1 GCA023110385_00435 CDS open 470750-471880 _na     376_aa malK ABC transporter family protein
480 JALDVW010000001.1 GCA023110385_00436 CDS open 472020-474236 _na     738_aa spoT GTP diphosphokinase
481 JALDVW010000001.1 GCA023110385_00437 CDS open 474266-474709 _na     147_aa dtd D-aminoacyl-tRNA deacylase
482 JALDVW010000001.1 GCA023110385_00438 CDS open 474741-475154 _na     137_aa Histidine kinase
483 JALDVW010000001.1 GCA023110385_00439 CDS open 475262-475912 _na     216_aa mntR Transcriptional regulator MntR
484 JALDVW010000001.1 GCA023110385_00440 CDS open 475996-476490 _na     164_aa tpx thiol peroxidase
485 JALDVW010000001.1 GCA023110385_00441 CDS open 476611-477540 _na     309_aa psaA Manganese ABC transporter substrate-binding lipoprotein PsaA
486 JALDVW010000001.1 GCA023110385_00442 CDS open 477567-478415 _na     282_aa znuB Manganese ABC transporter permease
487 JALDVW010000001.1 GCA023110385_00443 CDS open 478412-479143 _na     243_aa znuC High-affinity zinc uptake system ATP-binding protein ZnuC
488 JALDVW010000001.1 GCA023110385_00444 CDS open 479322-481214 _na     630_aa pepO Neutral endopeptidase
489 JALDVW010000001.1 GCA023110385_00445 CDS open 481303-482067 _na     254_aa Lipoprotein
490 JALDVW010000001.1 GCA023110385_00446 CDS open 482172-482801 _na     209_aa gloB Hydroxyacylglutathione hydrolase
491 JALDVW010000001.1 GCA023110385_00447 CDS open 482903-484096 _na     397_aa Methane monooxygenase component C
492 JALDVW010000001.1 GCA023110385_00448 CDS open 491507-492583 _na     358_aa Triacylglycerol lipase
493 JALDVW010000001.1 GCA023110385_00449 CDS open 492695-493471 _na     258_aa Ferredoxin reductase
494 JALDVW010000001.1 GCA023110385_00450 CDS open 493557-494120 _na     187_aa Fatty acid metabolism regulator protein
495 JALDVW010000001.1 GCA023110385_00451 CDS open 494449-495126 _na     225_aa ompR Response regulator protein GraR
496 JALDVW010000001.1 GCA023110385_00452 CDS open 495119-496093 _na     324_aa histidine kinase
497 JALDVW010000001.1 GCA023110385_00453 CDS open 496254-496379 _na     41_aa hypothetical protein
498 JALDVW010000001.1 GCA023110385_00454 CDS open 496833-497882 _na     349_aa DUF389 domain-containing protein
499 JALDVW010000001.1 GCA023110385_00455 CDS open 498096-500039 _na     647_aa thrS threonine--tRNA ligase
500 JALDVW010000001.1 GCA023110385_00456 CDS open 500050-500673 _na     207_aa AAA family ATPase