HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Pyramidobacter piscolens (GCA_023455535.1)

Select a Genome:
BAKTA Annotations for GCA_023455535.1
Genome Selected: Pyramidobacter piscolens
ContigsBases CDSrRNA tmRNAtRNA
69 2438666 2200 4 1 52
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4537 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:5]    |    Number of Records Found: 4537 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2001 JAEYBZ010000029.1 GCA023455535_02090 gene open 26408-27235
2002 JAEYBZ010000029.1 GCA023455535_02091 gene open 27217-27819
2003 JAEYBZ010000029.1 GCA023455535_02092 gene open 27819-29423 pilY1
2004 JAEYBZ010000029.1 GCA023455535_02093 gene open 29437-30951 pilB
2005 JAEYBZ010000029.1 GCA023455535_02094 gene open 30957-32042 pilT
2006 JAEYBZ010000029.1 GCA023455535_02095 gene open 32039-33262 pilC
2007 JAEYBZ010000029.1 GCA023455535_02096 gene open 33274-33621 pilD
2008 JAEYBZ010000029.1 GCA023455535_02097 gene open 33651-34559 pilM
2009 JAEYBZ010000029.1 GCA023455535_02098 gene open 34549-35082
2010 JAEYBZ010000029.1 GCA023455535_02099 gene open 35079-35600 pilO
2011 JAEYBZ010000029.1 GCA023455535_02100 gene open 35597-36064 pilP
2012 JAEYBZ010000029.1 GCA023455535_02101 gene open 36074-37774 pilQ
2013 JAEYBZ010000029.1 GCA023455535_02102 gene open 38200-39492
2014 JAEYBZ010000030.1 GCA023455535_01863 CDS open 248-1243 _na     331_aa dctP TRAP transporter substrate-binding protein
2015 JAEYBZ010000030.1 GCA023455535_01864 CDS open 1385-1843 _na     152_aa TRAP transporter small permease
2016 JAEYBZ010000030.1 GCA023455535_01865 CDS open 1844-3124 _na     426_aa dctQ TRAP transporter large permease subunit
2017 JAEYBZ010000030.1 GCA023455535_01866 CDS open 3137-4363 _na     408_aa Zn-dependent hydrolase
2018 JAEYBZ010000030.1 GCA023455535_01867 CDS open 4418-5719 _na     433_aa allB Dihydroorotase
2019 JAEYBZ010000030.1 GCA023455535_01868 CDS open 5739-6614 _na     291_aa FAD-binding oxidoreductase
2020 JAEYBZ010000030.1 GCA023455535_01869 CDS open 6598-7527 _na     309_aa pyrD dihydroorotate dehydrogenase
2021 JAEYBZ010000030.1 GCA023455535_01870 CDS open 7581-8300 _na     239_aa pyrF orotidine-5'-phosphate decarboxylase
2022 JAEYBZ010000030.1 GCA023455535_01871 CDS open 8288-8890 _na     200_aa pyrE orotate phosphoribosyltransferase
2023 JAEYBZ010000030.1 GCA023455535_01872 CDS open 8928-9473 _na     181_aa pyrR bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR
2024 JAEYBZ010000030.1 GCA023455535_01873 CDS open 9476-10327 _na     283_aa hypothetical protein
2025 JAEYBZ010000030.1 GCA023455535_01874 CDS open 10526-11488 _na     320_aa selD selenide%2C water dikinase SelD
2026 JAEYBZ010000030.1 GCA023455535_01875 CDS open 11647-11865 _na     72_aa DUF2905 domain-containing protein
2027 JAEYBZ010000030.1 GCA023455535_01876 CDS open 12462-13220 _na     252_aa Peptide chain release factor 2
2028 JAEYBZ010000030.1 GCA023455535_01877 CDS open 13217-15115 _na     632_aa spoIVB Peptidase S55 domain-containing protein
2029 JAEYBZ010000030.1 GCA023455535_01878 CDS open 15339-16730 _na     463_aa comP histidine kinase
2030 JAEYBZ010000030.1 GCA023455535_01879 CDS open 16727-17374 _na     215_aa citB DNA-binding response regulator
2031 JAEYBZ010000030.1 GCA023455535_01880 CDS open 17676-17819 _na     47_aa hypothetical protein
2032 JAEYBZ010000030.1 GCA023455535_01881 CDS open 17880-18272 _na     130_aa Periplasmic heavy metal sensor
2033 JAEYBZ010000030.1 GCA023455535_01882 CDS open 18810-19259 _na     149_aa hypothetical protein
2034 JAEYBZ010000030.1 GCA023455535_01883 CDS open 19978-21000 _na     340_aa YeeE/YedE family protein
2035 JAEYBZ010000030.1 GCA023455535_01884 CDS open 21016-21234 _na     72_aa tusA Sulfurtransferase TusA family protein
2036 JAEYBZ010000030.1 GCA023455535_01885 CDS open 21726-22940 _na     404_aa DUF819 domain-containing protein
2037 JAEYBZ010000030.1 GCA023455535_01886 CDS open 23028-24203 _na     391_aa abgB Amidohydrolase
2038 JAEYBZ010000030.1 GCA023455535_01887 CDS open 24299-24448 _na     49_aa hypothetical protein
2039 JAEYBZ010000030.1 GCA023455535_01888 CDS open 24482-25681 _na     399_aa aspB Aminotransferase
2040 JAEYBZ010000030.1 GCA023455535_01889 CDS open 25995-27764 _na     589_aa Sigma-54 factor interaction domain-containing protein
2041 JAEYBZ010000030.1 GCA023455535_01890 CDS open 27966-29318 _na     450_aa Four-carbon acid sugar kinase family protein
2042 JAEYBZ010000030.1 GCA023455535_01891 CDS open 29440-30489 _na     349_aa pdxA 4-hydroxythreonine-4-phosphate dehydrogenase PdxA
2043 JAEYBZ010000030.1 GCA023455535_01892 CDS open 30696-31670 _na     324_aa 2-keto-3-deoxygluconate permease
2044 JAEYBZ010000030.1 GCA023455535_01893 CDS open 31745-32041 _na     98_aa Altronate hydrolase
2045 JAEYBZ010000030.1 GCA023455535_01894 CDS open 32038-33201 _na     387_aa Carbohydrate hydrolase
2046 JAEYBZ010000030.1 GCA023455535_01895 CDS open 33285-34220 _na     311_aa 2-dehydropantoate 2-reductase
2047 JAEYBZ010000030.1 GCA023455535_01896 CDS open 34391-40303 _na     1970_aa dNA2 DUF3320 domain-containing protein
2048 JAEYBZ010000030.1 GCA023455535_01897 CDS open 40641-41396 _na     251_aa nupO ABC transporter
2049 JAEYBZ010000030.1 GCA023455535_01898 CDS open 41393-42322 _na     309_aa araH ABC transporter permease
2050 JAEYBZ010000030.1 GCA023455535_01899 CDS open 42384-43388 _na     334_aa rbsB Monosaccharide-transporting ATPase
2051 JAEYBZ010000030.1 GCA023455535_01900 CDS open 43390-44244 _na     284_aa rbsB LacI family transcriptional regulator
2052 JAEYBZ010000030.1 GCA023455535_01901 CDS open 44470-45924 _na     484_aa gatA Amidase
2053 JAEYBZ010000030.1 GCA023455535_01902 CDS open 45940-47328 _na     462_aa atoE Short-chain fatty acid transporter
2054 JAEYBZ010000030.1 GCA023455535_01903 CDS open 47518-47964 _na     148_aa Hut operon positive regulatory protein
2055 JAEYBZ010000030.1 GCA023455535_01904 CDS open 48212-49654 _na     480_aa lpd FAD-dependent oxidoreductase
2056 JAEYBZ010000030.1 GCA023455535_01863 gene open 248-1243 dctP
2057 JAEYBZ010000030.1 GCA023455535_01864 gene open 1385-1843
2058 JAEYBZ010000030.1 GCA023455535_01865 gene open 1844-3124 dctQ
2059 JAEYBZ010000030.1 GCA023455535_01866 gene open 3137-4363
2060 JAEYBZ010000030.1 GCA023455535_01867 gene open 4418-5719 allB
2061 JAEYBZ010000030.1 GCA023455535_01868 gene open 5739-6614
2062 JAEYBZ010000030.1 GCA023455535_01869 gene open 6598-7527 pyrD
2063 JAEYBZ010000030.1 GCA023455535_01870 gene open 7581-8300 pyrF
2064 JAEYBZ010000030.1 GCA023455535_01871 gene open 8288-8890 pyrE
2065 JAEYBZ010000030.1 GCA023455535_01872 gene open 8928-9473 pyrR
2066 JAEYBZ010000030.1 GCA023455535_01873 gene open 9476-10327
2067 JAEYBZ010000030.1 GCA023455535_01874 gene open 10526-11488 selD
2068 JAEYBZ010000030.1 GCA023455535_01875 gene open 11647-11865
2069 JAEYBZ010000030.1 GCA023455535_01876 gene open 12462-13220
2070 JAEYBZ010000030.1 GCA023455535_01877 gene open 13217-15115 spoIVB
2071 JAEYBZ010000030.1 GCA023455535_01878 gene open 15339-16730 comP
2072 JAEYBZ010000030.1 GCA023455535_01879 gene open 16727-17374 citB
2073 JAEYBZ010000030.1 GCA023455535_01880 gene open 17676-17819
2074 JAEYBZ010000030.1 GCA023455535_01881 gene open 17880-18272
2075 JAEYBZ010000030.1 GCA023455535_01882 gene open 18810-19259
2076 JAEYBZ010000030.1 GCA023455535_01883 gene open 19978-21000
2077 JAEYBZ010000030.1 GCA023455535_01884 gene open 21016-21234 tusA
2078 JAEYBZ010000030.1 GCA023455535_01885 gene open 21726-22940
2079 JAEYBZ010000030.1 GCA023455535_01886 gene open 23028-24203 abgB
2080 JAEYBZ010000030.1 GCA023455535_01887 gene open 24299-24448
2081 JAEYBZ010000030.1 GCA023455535_01888 gene open 24482-25681 aspB
2082 JAEYBZ010000030.1 GCA023455535_01889 gene open 25995-27764
2083 JAEYBZ010000030.1 GCA023455535_01890 gene open 27966-29318
2084 JAEYBZ010000030.1 GCA023455535_01891 gene open 29440-30489 pdxA
2085 JAEYBZ010000030.1 GCA023455535_01892 gene open 30696-31670
2086 JAEYBZ010000030.1 GCA023455535_01893 gene open 31745-32041
2087 JAEYBZ010000030.1 GCA023455535_01894 gene open 32038-33201
2088 JAEYBZ010000030.1 GCA023455535_01895 gene open 33285-34220
2089 JAEYBZ010000030.1 GCA023455535_01896 gene open 34391-40303 dNA2
2090 JAEYBZ010000030.1 GCA023455535_01897 gene open 40641-41396 nupO
2091 JAEYBZ010000030.1 GCA023455535_01898 gene open 41393-42322 araH
2092 JAEYBZ010000030.1 GCA023455535_01899 gene open 42384-43388 rbsB
2093 JAEYBZ010000030.1 GCA023455535_01900 gene open 43390-44244 rbsB
2094 JAEYBZ010000030.1 GCA023455535_01901 gene open 44470-45924 gatA
2095 JAEYBZ010000030.1 GCA023455535_01902 gene open 45940-47328 atoE
2096 JAEYBZ010000030.1 GCA023455535_01903 gene open 47518-47964
2097 JAEYBZ010000030.1 GCA023455535_01904 gene open 48212-49654 lpd
2098 JAEYBZ010000031.1 GCA023455535_01204 CDS open 105-857 _na     250_aa hisJ Solute-binding protein family 3/N-terminal domain-containing protein
2099 JAEYBZ010000031.1 GCA023455535_01205 CDS open 1024-1758 _na     244_aa rraA Regulator of ribonuclease activity-like protein
2100 JAEYBZ010000031.1 GCA023455535_01206 CDS open 1773-2600 _na     275_aa nit1 Carbon-nitrogen hydrolase family protein
2101 JAEYBZ010000031.1 GCA023455535_01207 CDS open 2678-3670 _na     330_aa dctP TRAP transporter substrate-binding protein
2102 JAEYBZ010000031.1 GCA023455535_01208 CDS open 3765-4259 _na     164_aa dctM C4-dicarboxylate ABC transporter permease
2103 JAEYBZ010000031.1 GCA023455535_01209 CDS open 4260-5540 _na     426_aa dctQ TRAP C4-dicarboxylate transport system permease DctM subunit domain-containing protein
2104 JAEYBZ010000031.1 GCA023455535_01210 CDS open 5873-6040 _na     55_aa hypothetical protein
2105 JAEYBZ010000031.1 GCA023455535_01211 CDS open 6182-6535 _na     117_aa mazG Nucleotide pyrophosphohydrolase
2106 JAEYBZ010000031.1 GCA023455535_01212 CDS open 6602-6919 _na     105_aa SnoaL-like domain-containing protein
2107 JAEYBZ010000031.1 GCA023455535_01204 gene open 105-857 hisJ
2108 JAEYBZ010000031.1 GCA023455535_01205 gene open 1024-1758 rraA
2109 JAEYBZ010000031.1 GCA023455535_01206 gene open 1773-2600 nit1
2110 JAEYBZ010000031.1 GCA023455535_01207 gene open 2678-3670 dctP
2111 JAEYBZ010000031.1 GCA023455535_01208 gene open 3765-4259 dctM
2112 JAEYBZ010000031.1 GCA023455535_01209 gene open 4260-5540 dctQ
2113 JAEYBZ010000031.1 GCA023455535_01210 gene open 5873-6040
2114 JAEYBZ010000031.1 GCA023455535_01211 gene open 6182-6535 mazG
2115 JAEYBZ010000031.1 GCA023455535_01212 gene open 6602-6919
2116 JAEYBZ010000032.1 GCA023455535_00852 CDS open 156-542 _na     128_aa mutT (deoxy)nucleoside triphosphate pyrophosphohydrolase
2117 JAEYBZ010000032.1 GCA023455535_00853 CDS open 599-1885 _na     428_aa abgB Amidohydrolase
2118 JAEYBZ010000032.1 GCA023455535_00854 CDS open 1882-3099 _na     405_aa abgB Amidohydrolase
2119 JAEYBZ010000032.1 GCA023455535_00852 gene open 156-542 mutT
2120 JAEYBZ010000032.1 GCA023455535_00853 gene open 599-1885 abgB
2121 JAEYBZ010000032.1 GCA023455535_00854 gene open 1882-3099 abgB
2122 JAEYBZ010000033.1 GCA023455535_01321 CDS open 15-1382 _na     455_aa S-layer-like y domain-containing protein
2123 JAEYBZ010000033.1 GCA023455535_01322 CDS open 1662-3080 _na     472_aa SLH domain-containing protein
2124 JAEYBZ010000033.1 GCA023455535_01323 CDS open 3640-5115 _na     491_aa S-layer-like y domain-containing protein
2125 JAEYBZ010000033.1 GCA023455535_01324 CDS open 5272-5664 _na     130_aa doc Type II toxin-antitoxin system death-on-curing family toxin
2126 JAEYBZ010000033.1 GCA023455535_01325 CDS open 5645-5806 _na     53_aa hypothetical protein
2127 JAEYBZ010000033.1 GCA023455535_01326 CDS open 6123-7652 _na     509_aa murJ lipid II flippase MurJ
2128 JAEYBZ010000033.1 GCA023455535_01321 gene open 15-1382
2129 JAEYBZ010000033.1 GCA023455535_01322 gene open 1662-3080
2130 JAEYBZ010000033.1 GCA023455535_01323 gene open 3640-5115
2131 JAEYBZ010000033.1 GCA023455535_01324 gene open 5272-5664 doc
2132 JAEYBZ010000033.1 GCA023455535_01325 gene open 5645-5806
2133 JAEYBZ010000033.1 GCA023455535_01326 gene open 6123-7652 murJ
2134 JAEYBZ010000034.1 GCA023455535_00578 CDS open 56-1783 _na     575_aa mdcA malonate decarboxylase subunit alpha
2135 JAEYBZ010000034.1 GCA023455535_00579 CDS open 2055-2612 _na     185_aa DUF6305 domain-containing protein
2136 JAEYBZ010000034.1 GCA023455535_00580 CDS open 2665-4398 _na     577_aa ggt Gamma-glutamyltransferase
2137 JAEYBZ010000034.1 GCA023455535_00581 CDS open 5042-5212 _na     56_aa hypothetical protein
2138 JAEYBZ010000034.1 GCA023455535_00582 CDS open 5423-6451 _na     342_aa lldD Alpha-hydroxy-acid oxidizing protein
2139 JAEYBZ010000034.1 GCA023455535_00583 CDS open 6695-7240 _na     181_aa yfbR Phosphohydrolase
2140 JAEYBZ010000034.1 GCA023455535_00584 CDS open 7589-8458 _na     289_aa purR substrate-binding domain-containing protein
2141 JAEYBZ010000034.1 GCA023455535_00585 CDS open 8538-9512 _na     324_aa serA D-2-hydroxyacid dehydrogenase
2142 JAEYBZ010000034.1 GCA023455535_00586 CDS open 9705-10403 _na     232_aa fldA Flavodoxin
2143 JAEYBZ010000034.1 GCA023455535_00587 CDS open 10557-11189 _na     210_aa hypothetical protein
2144 JAEYBZ010000034.1 GCA023455535_00588 CDS open 11430-12689 _na     419_aa ATP-binding protein
2145 JAEYBZ010000034.1 GCA023455535_00589 CDS open 12788-13030 _na     80_aa hypothetical protein
2146 JAEYBZ010000034.1 GCA023455535_00590 CDS open 13092-16421 _na     1109_aa type I restriction endonuclease subunit R
2147 JAEYBZ010000034.1 GCA023455535_00591 CDS open 16460-17845 _na     461_aa AbiJ-NTD3 domain-containing protein
2148 JAEYBZ010000034.1 GCA023455535_00592 CDS open 17842-18798 _na     318_aa restriction endonuclease subunit S
2149 JAEYBZ010000034.1 GCA023455535_00593 CDS open 18953-19150 _na     65_aa N-6 DNA methylase
2150 JAEYBZ010000034.1 GCA023455535_00594 CDS open 19255-20568 _na     437_aa N-6 DNA methylase
2151 JAEYBZ010000034.1 GCA023455535_00595 CDS open 20639-20767 _na     42_aa helix-turn-helix domain-containing protein
2152 JAEYBZ010000034.1 GCA023455535_00596 CDS open 21283-22812 _na     509_aa guaA glutamine-hydrolyzing GMP synthase
2153 JAEYBZ010000034.1 GCA023455535_00597 CDS open 22942-24780 _na     612_aa dob10 DEAD/DEAH box helicase
2154 JAEYBZ010000034.1 GCA023455535_00598 CDS open 24806-25537 _na     243_aa hypothetical protein
2155 JAEYBZ010000034.1 GCA023455535_00599 CDS open 25566-27002 _na     478_aa proS proline--tRNA ligase
2156 JAEYBZ010000034.1 GCA023455535_00600 CDS open 27153-29270 _na     705_aa rssA PNPLA domain-containing protein
2157 JAEYBZ010000034.1 GCA023455535_00578 gene open 56-1783 mdcA
2158 JAEYBZ010000034.1 GCA023455535_00579 gene open 2055-2612
2159 JAEYBZ010000034.1 GCA023455535_00580 gene open 2665-4398 ggt
2160 JAEYBZ010000034.1 GCA023455535_00581 gene open 5042-5212
2161 JAEYBZ010000034.1 GCA023455535_00582 gene open 5423-6451 lldD
2162 JAEYBZ010000034.1 GCA023455535_00583 gene open 6695-7240 yfbR
2163 JAEYBZ010000034.1 GCA023455535_00584 gene open 7589-8458 purR
2164 JAEYBZ010000034.1 GCA023455535_00585 gene open 8538-9512 serA
2165 JAEYBZ010000034.1 GCA023455535_00586 gene open 9705-10403 fldA
2166 JAEYBZ010000034.1 GCA023455535_00587 gene open 10557-11189
2167 JAEYBZ010000034.1 GCA023455535_00588 gene open 11430-12689
2168 JAEYBZ010000034.1 GCA023455535_00589 gene open 12788-13030
2169 JAEYBZ010000034.1 GCA023455535_00590 gene open 13092-16421
2170 JAEYBZ010000034.1 GCA023455535_00591 gene open 16460-17845
2171 JAEYBZ010000034.1 GCA023455535_00592 gene open 17842-18798
2172 JAEYBZ010000034.1 GCA023455535_00593 gene open 18953-19150
2173 JAEYBZ010000034.1 GCA023455535_00594 gene open 19255-20568
2174 JAEYBZ010000034.1 GCA023455535_00595 gene open 20639-20767
2175 JAEYBZ010000034.1 GCA023455535_00596 gene open 21283-22812 guaA
2176 JAEYBZ010000034.1 GCA023455535_00597 gene open 22942-24780 dob10
2177 JAEYBZ010000034.1 GCA023455535_00598 gene open 24806-25537
2178 JAEYBZ010000034.1 GCA023455535_00599 gene open 25566-27002 proS
2179 JAEYBZ010000034.1 GCA023455535_00600 gene open 27153-29270 rssA
2180 JAEYBZ010000035.1 GCA023455535_01489 gene open 37939-38053 rrf
2181 JAEYBZ010000035.1 GCA023455535_01489 rRNA open 37939-38053 rrf 5S ribosomal RNA
2182 JAEYBZ010000035.1 GCA023455535_01451 CDS open 395-826 _na     143_aa rimI N-acetyltransferase
2183 JAEYBZ010000035.1 GCA023455535_01452 CDS open 951-2423 _na     490_aa menE Long-chain fatty acid--CoA ligase
2184 JAEYBZ010000035.1 GCA023455535_01453 CDS open 2502-3380 _na     292_aa spoIIQ2 M23 family metallopeptidase
2185 JAEYBZ010000035.1 GCA023455535_01454 CDS open 3428-3688 _na     86_aa grxC Thioredoxin
2186 JAEYBZ010000035.1 GCA023455535_01455 CDS open 3865-5271 _na     468_aa tolC TolC family protein
2187 JAEYBZ010000035.1 GCA023455535_01459 CDS open 5815-6498 _na     227_aa sYLF Ysc84 actin-binding domain-containing protein
2188 JAEYBZ010000035.1 GCA023455535_01460 CDS open 6637-7722 _na     361_aa Deacylase
2189 JAEYBZ010000035.1 GCA023455535_01461 CDS open 7891-8514 _na     207_aa hypothetical protein
2190 JAEYBZ010000035.1 GCA023455535_01462 CDS open 8787-9542 _na     251_aa iclR IclR family transcriptional regulator
2191 JAEYBZ010000035.1 GCA023455535_01463 CDS open 9565-10815 _na     416_aa hutI imidazolonepropionase
2192 JAEYBZ010000035.1 GCA023455535_01464 CDS open 11019-13064 _na     681_aa hutU urocanate hydratase
2193 JAEYBZ010000035.1 GCA023455535_01465 CDS open 13155-14693 _na     512_aa hutH histidine ammonia-lyase
2194 JAEYBZ010000035.1 GCA023455535_01466 CDS open 15079-16068 _na     329_aa ansA Asparaginase
2195 JAEYBZ010000035.1 GCA023455535_01467 CDS open 16071-16775 _na     234_aa lactate utilization protein
2196 JAEYBZ010000035.1 GCA023455535_01468 CDS open 16924-17070 _na     48_aa hypothetical protein
2197 JAEYBZ010000035.1 GCA023455535_01469 CDS open 17067-17414 _na     115_aa ylxM UPF0122 protein B0D78_07250
2198 JAEYBZ010000035.1 GCA023455535_01470 CDS open 17407-18756 _na     449_aa ffh signal recognition particle protein
2199 JAEYBZ010000035.1 GCA023455535_01471 CDS open 18824-19090 _na     88_aa rpsP 30S ribosomal protein S16
2200 JAEYBZ010000035.1 GCA023455535_01472 CDS open 19090-19362 _na     90_aa ylqC KH domain-containing protein
2201 JAEYBZ010000035.1 GCA023455535_01473 CDS open 19365-19892 _na     175_aa rimM ribosome maturation factor RimM
2202 JAEYBZ010000035.1 GCA023455535_01474 CDS open 19889-21031 _na     380_aa trmD tRNA (guanosine(37)-N1)-methyltransferase TrmD
2203 JAEYBZ010000035.1 GCA023455535_01475 CDS open 21062-21415 _na     117_aa rplS 50S ribosomal protein L19
2204 JAEYBZ010000035.1 GCA023455535_01476 CDS open 21689-22888 _na     399_aa DUF3798 domain-containing protein
2205 JAEYBZ010000035.1 GCA023455535_01477 CDS open 23227-23445 _na     72_aa transposase
2206 JAEYBZ010000035.1 GCA023455535_01478 CDS open 23602-24138 _na     178_aa winged helix-turn-helix domain-containing protein
2207 JAEYBZ010000035.1 GCA023455535_01479 CDS open 24637-25638 _na     333_aa Peptidase C45 hydrolase domain-containing protein
2208 JAEYBZ010000035.1 GCA023455535_01480 CDS open 26028-27863 _na     611_aa oppA peptide ABC transporter substrate-binding protein
2209 JAEYBZ010000035.1 GCA023455535_01481 CDS open 28151-29059 _na     302_aa dppB ABC transporter permease
2210 JAEYBZ010000035.1 GCA023455535_01482 CDS open 29056-30036 _na     326_aa dppC ABC transporter permease
2211 JAEYBZ010000035.1 GCA023455535_01483 CDS open 30051-31106 _na     351_aa dppD ABC transporter ATP-binding protein
2212 JAEYBZ010000035.1 GCA023455535_01484 CDS open 31099-32046 _na     315_aa dppD ABC transporter ATP-binding protein
2213 JAEYBZ010000035.1 GCA023455535_01485 CDS open 32061-32465 _na     134_aa ycjU HAD family hydrolase
2214 JAEYBZ010000035.1 GCA023455535_01486 CDS open 32514-34148 _na     544_aa malK ATP-binding cassette domain-containing protein
2215 JAEYBZ010000035.1 GCA023455535_01487 CDS open 34154-35977 _na     607_aa fbpB Iron ABC transporter permease
2216 JAEYBZ010000035.1 GCA023455535_01488 CDS open 36086-37429 _na     447_aa Lipoprotein
2217 JAEYBZ010000035.1 GCA023455535_01451 gene open 395-826 rimI
2218 JAEYBZ010000035.1 GCA023455535_01452 gene open 951-2423 menE
2219 JAEYBZ010000035.1 GCA023455535_01453 gene open 2502-3380 spoIIQ2
2220 JAEYBZ010000035.1 GCA023455535_01454 gene open 3428-3688 grxC
2221 JAEYBZ010000035.1 GCA023455535_01455 gene open 3865-5271 tolC
2222 JAEYBZ010000035.1 GCA023455535_01459 gene open 5815-6498 sYLF
2223 JAEYBZ010000035.1 GCA023455535_01460 gene open 6637-7722
2224 JAEYBZ010000035.1 GCA023455535_01461 gene open 7891-8514
2225 JAEYBZ010000035.1 GCA023455535_01462 gene open 8787-9542 iclR
2226 JAEYBZ010000035.1 GCA023455535_01463 gene open 9565-10815 hutI
2227 JAEYBZ010000035.1 GCA023455535_01464 gene open 11019-13064 hutU
2228 JAEYBZ010000035.1 GCA023455535_01465 gene open 13155-14693 hutH
2229 JAEYBZ010000035.1 GCA023455535_01466 gene open 15079-16068 ansA
2230 JAEYBZ010000035.1 GCA023455535_01467 gene open 16071-16775
2231 JAEYBZ010000035.1 GCA023455535_01468 gene open 16924-17070
2232 JAEYBZ010000035.1 GCA023455535_01469 gene open 17067-17414 ylxM
2233 JAEYBZ010000035.1 GCA023455535_01470 gene open 17407-18756 ffh
2234 JAEYBZ010000035.1 GCA023455535_01471 gene open 18824-19090 rpsP
2235 JAEYBZ010000035.1 GCA023455535_01472 gene open 19090-19362 ylqC
2236 JAEYBZ010000035.1 GCA023455535_01473 gene open 19365-19892 rimM
2237 JAEYBZ010000035.1 GCA023455535_01474 gene open 19889-21031 trmD
2238 JAEYBZ010000035.1 GCA023455535_01475 gene open 21062-21415 rplS
2239 JAEYBZ010000035.1 GCA023455535_01476 gene open 21689-22888
2240 JAEYBZ010000035.1 GCA023455535_01477 gene open 23227-23445
2241 JAEYBZ010000035.1 GCA023455535_01478 gene open 23602-24138
2242 JAEYBZ010000035.1 GCA023455535_01479 gene open 24637-25638
2243 JAEYBZ010000035.1 GCA023455535_01480 gene open 26028-27863 oppA
2244 JAEYBZ010000035.1 GCA023455535_01481 gene open 28151-29059 dppB
2245 JAEYBZ010000035.1 GCA023455535_01482 gene open 29056-30036 dppC
2246 JAEYBZ010000035.1 GCA023455535_01483 gene open 30051-31106 dppD
2247 JAEYBZ010000035.1 GCA023455535_01484 gene open 31099-32046 dppD
2248 JAEYBZ010000035.1 GCA023455535_01485 gene open 32061-32465 ycjU
2249 JAEYBZ010000035.1 GCA023455535_01486 gene open 32514-34148 malK
2250 JAEYBZ010000035.1 GCA023455535_01487 gene open 34154-35977 fbpB
2251 JAEYBZ010000035.1 GCA023455535_01488 gene open 36086-37429
2252 JAEYBZ010000035.1 GCA023455535_01456 gene open 5464-5539 trnT
2253 JAEYBZ010000035.1 GCA023455535_01457 gene open 5563-5648 trnY
2254 JAEYBZ010000035.1 GCA023455535_01458 gene open 5656-5731 trnT
2255 JAEYBZ010000035.1 GCA023455535_01456 tRNA open 5464-5539 trnT tRNA-Thr(tgt)
2256 JAEYBZ010000035.1 GCA023455535_01457 tRNA open 5563-5648 trnY tRNA-Tyr(gta)
2257 JAEYBZ010000035.1 GCA023455535_01458 tRNA open 5656-5731 trnT tRNA-Thr(ggt)
2258 JAEYBZ010000036.1 regulatory_region open 13159-13273 FMN riboswitch aptamer (RFN element)
2259 JAEYBZ010000036.1 GCA023455535_00874 CDS open 55-816 _na     253_aa RING-type E3 ubiquitin transferase
2260 JAEYBZ010000036.1 GCA023455535_00875 CDS open 1080-2897 _na     605_aa SH3b domain-containing protein
2261 JAEYBZ010000036.1 GCA023455535_00876 CDS open 3049-4128 _na     359_aa hypothetical protein
2262 JAEYBZ010000036.1 GCA023455535_00877 CDS open 4191-5168 _na     325_aa DUF1461 domain-containing protein
2263 JAEYBZ010000036.1 GCA023455535_00878 CDS open 5385-5852 _na     155_aa DUF4878 domain-containing protein
2264 JAEYBZ010000036.1 GCA023455535_00879 CDS open 5910-8051 _na     713_aa ldcC Lysine decarboxylase LdcC
2265 JAEYBZ010000036.1 GCA023455535_00880 CDS open 8303-9097 _na     264_aa ADP-ribosylglycohydrolase
2266 JAEYBZ010000036.1 GCA023455535_00881 CDS open 9213-10427 _na     404_aa sbcD Nuclease SbcCD subunit D
2267 JAEYBZ010000036.1 GCA023455535_00882 CDS open 10424-13108 _na     894_aa sbcC AAA family ATPase
2268 JAEYBZ010000036.1 GCA023455535_00883 CDS open 13379-14578 _na     399_aa ribA bifunctional 3%2C4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II
2269 JAEYBZ010000036.1 GCA023455535_00884 CDS open 14688-16169 _na     493_aa hypothetical protein
2270 JAEYBZ010000036.1 GCA023455535_00885 CDS open 16390-17571 _na     393_aa thrC Threonine synthase
2271 JAEYBZ010000036.1 GCA023455535_00886 CDS open 17712-19250 _na     512_aa Glycosyltransferase RgtA/B/C/D-like domain-containing protein
2272 JAEYBZ010000036.1 GCA023455535_00887 CDS open 19282-20286 _na     334_aa wcaA Glycosyltransferase family 2 protein
2273 JAEYBZ010000036.1 GCA023455535_00888 CDS open 20279-20689 _na     136_aa gtrA GtrA family protein
2274 JAEYBZ010000036.1 GCA023455535_00889 CDS open 21033-22856 _na     607_aa ftsH ATP-dependent zinc metalloprotease FtsH
2275 JAEYBZ010000036.1 GCA023455535_00890 CDS open 23231-23671 _na     146_aa ibpA Hsp20/alpha crystallin family protein
2276 JAEYBZ010000036.1 GCA023455535_00891 CDS open 23861-25225 _na     454_aa uraA Xanthine permease
2277 JAEYBZ010000036.1 GCA023455535_00892 CDS open 25383-25973 _na     196_aa dnaQ 3'-5' exonuclease
2278 JAEYBZ010000036.1 GCA023455535_00874 gene open 55-816
2279 JAEYBZ010000036.1 GCA023455535_00875 gene open 1080-2897
2280 JAEYBZ010000036.1 GCA023455535_00876 gene open 3049-4128
2281 JAEYBZ010000036.1 GCA023455535_00877 gene open 4191-5168
2282 JAEYBZ010000036.1 GCA023455535_00878 gene open 5385-5852
2283 JAEYBZ010000036.1 GCA023455535_00879 gene open 5910-8051 ldcC
2284 JAEYBZ010000036.1 GCA023455535_00880 gene open 8303-9097
2285 JAEYBZ010000036.1 GCA023455535_00881 gene open 9213-10427 sbcD
2286 JAEYBZ010000036.1 GCA023455535_00882 gene open 10424-13108 sbcC
2287 JAEYBZ010000036.1 GCA023455535_00883 gene open 13379-14578 ribA
2288 JAEYBZ010000036.1 GCA023455535_00884 gene open 14688-16169
2289 JAEYBZ010000036.1 GCA023455535_00885 gene open 16390-17571 thrC
2290 JAEYBZ010000036.1 GCA023455535_00886 gene open 17712-19250
2291 JAEYBZ010000036.1 GCA023455535_00887 gene open 19282-20286 wcaA
2292 JAEYBZ010000036.1 GCA023455535_00888 gene open 20279-20689 gtrA
2293 JAEYBZ010000036.1 GCA023455535_00889 gene open 21033-22856 ftsH
2294 JAEYBZ010000036.1 GCA023455535_00890 gene open 23231-23671 ibpA
2295 JAEYBZ010000036.1 GCA023455535_00891 gene open 23861-25225 uraA
2296 JAEYBZ010000036.1 GCA023455535_00892 gene open 25383-25973 dnaQ
2297 JAEYBZ010000037.1 repeat_region open 19757-19996 CRISPR array with 4 repeats of length 33%2C consensus sequence GTCGCGCCCTCACGGGCGCGCGAATTGAAAGCG and spacer length 32
2298 JAEYBZ010000037.1 GCA023455535_00855 CDS open 281-1147 _na     288_aa OB-fold protein
2299 JAEYBZ010000037.1 GCA023455535_00856 CDS open 1252-2379 _na     375_aa hypothetical protein
2300 JAEYBZ010000037.1 GCA023455535_00857 CDS open 2759-3127 _na     122_aa mntR Metal-dependent transcriptional regulator
2301 JAEYBZ010000037.1 GCA023455535_00858 CDS open 3335-3829 _na     164_aa fldA flavodoxin
2302 JAEYBZ010000037.1 GCA023455535_00859 CDS open 4140-4484 _na     114_aa DUF2023 domain-containing protein
2303 JAEYBZ010000037.1 GCA023455535_00860 CDS open 4620-5174 _na     184_aa GDYXXLXY domain-containing protein
2304 JAEYBZ010000037.1 GCA023455535_00861 CDS open 5161-6330 _na     389_aa DUF2157 domain-containing protein
2305 JAEYBZ010000037.1 GCA023455535_00862 CDS open 6683-7480 _na     265_aa Metallo-beta-lactamase domain-containing protein
2306 JAEYBZ010000037.1 GCA023455535_00863 CDS open 7831-8898 _na     355_aa afuA ABC transporter substrate-binding protein
2307 JAEYBZ010000037.1 GCA023455535_00864 CDS open 8974-9498 _na     174_aa Phosphohydrolase
2308 JAEYBZ010000037.1 GCA023455535_00865 CDS open 9584-10609 _na     341_aa tyrosine-protein phosphatase
2309 JAEYBZ010000037.1 GCA023455535_00866 CDS open 10633-11202 _na     189_aa ywlG TIGR01440 family protein
2310 JAEYBZ010000037.1 GCA023455535_00867 CDS open 11353-13824 _na     823_aa cas3 HD Cas3-type domain-containing protein
2311 JAEYBZ010000037.1 GCA023455535_00868 CDS open 13855-14589 _na     244_aa cas5c type I-C CRISPR-associated protein Cas5c
2312 JAEYBZ010000037.1 GCA023455535_00869 CDS open 14586-16661 _na     691_aa cas8c type I-C CRISPR-associated protein Cas8c/Csd1
2313 JAEYBZ010000037.1 GCA023455535_00870 CDS open 16682-17548 _na     288_aa cas7c type I-C CRISPR-associated protein Cas7/Csd2
2314 JAEYBZ010000037.1 GCA023455535_00871 CDS open 17550-18203 _na     217_aa cas4 CRISPR-associated protein Cas4
2315 JAEYBZ010000037.1 GCA023455535_00872 CDS open 18200-19231 _na     343_aa cas1c type I-C CRISPR-associated endonuclease Cas1c
2316 JAEYBZ010000037.1 GCA023455535_00873 CDS open 19241-19531 _na     96_aa cas2 CRISPR-associated endonuclease Cas2
2317 JAEYBZ010000037.1 GCA023455535_00855 gene open 281-1147
2318 JAEYBZ010000037.1 GCA023455535_00856 gene open 1252-2379
2319 JAEYBZ010000037.1 GCA023455535_00857 gene open 2759-3127 mntR
2320 JAEYBZ010000037.1 GCA023455535_00858 gene open 3335-3829 fldA
2321 JAEYBZ010000037.1 GCA023455535_00859 gene open 4140-4484
2322 JAEYBZ010000037.1 GCA023455535_00860 gene open 4620-5174
2323 JAEYBZ010000037.1 GCA023455535_00861 gene open 5161-6330
2324 JAEYBZ010000037.1 GCA023455535_00862 gene open 6683-7480
2325 JAEYBZ010000037.1 GCA023455535_00863 gene open 7831-8898 afuA
2326 JAEYBZ010000037.1 GCA023455535_00864 gene open 8974-9498
2327 JAEYBZ010000037.1 GCA023455535_00865 gene open 9584-10609
2328 JAEYBZ010000037.1 GCA023455535_00866 gene open 10633-11202 ywlG
2329 JAEYBZ010000037.1 GCA023455535_00867 gene open 11353-13824 cas3
2330 JAEYBZ010000037.1 GCA023455535_00868 gene open 13855-14589 cas5c
2331 JAEYBZ010000037.1 GCA023455535_00869 gene open 14586-16661 cas8c
2332 JAEYBZ010000037.1 GCA023455535_00870 gene open 16682-17548 cas7c
2333 JAEYBZ010000037.1 GCA023455535_00871 gene open 17550-18203 cas4
2334 JAEYBZ010000037.1 GCA023455535_00872 gene open 18200-19231 cas1c
2335 JAEYBZ010000037.1 GCA023455535_00873 gene open 19241-19531 cas2
2336 JAEYBZ010000038.1 GCA023455535_01490 CDS open 196-1590 _na     464_aa norM Multidrug export protein MepA
2337 JAEYBZ010000038.1 GCA023455535_01491 CDS open 2372-5425 _na     1017_aa Restriction endonuclease subunit R
2338 JAEYBZ010000038.1 GCA023455535_01492 CDS open 5422-6540 _na     372_aa DUF1016 domain-containing protein
2339 JAEYBZ010000038.1 GCA023455535_01493 CDS open 6552-8573 _na     673_aa site-specific DNA-methyltransferase
2340 JAEYBZ010000038.1 GCA023455535_01494 CDS open 8602-9660 _na     352_aa ATP-binding protein
2341 JAEYBZ010000038.1 GCA023455535_01495 CDS open 9661-10317 _na     218_aa DUF4391 domain-containing protein
2342 JAEYBZ010000038.1 GCA023455535_01496 CDS open 10442-13681 _na     1079_aa ATP-dependent helicase
2343 JAEYBZ010000038.1 GCA023455535_01497 CDS open 13742-14221 _na     159_aa ASCH domain-containing protein
2344 JAEYBZ010000038.1 GCA023455535_01498 CDS open 14275-15765 _na     496_aa cobQ cobyric acid synthase
2345 JAEYBZ010000038.1 GCA023455535_01499 CDS open 15938-16432 _na     164_aa rutF Flavin reductase like domain-containing protein
2346 JAEYBZ010000038.1 GCA023455535_01500 CDS open 16562-16744 _na     60_aa serine hydroxymethyltransferase (serine methylase)(shmt)
2347 JAEYBZ010000038.1 GCA023455535_01501 CDS open 17069-17887 _na     272_aa focA Formate/nitrite transporter family protein
2348 JAEYBZ010000038.1 GCA023455535_01502 CDS open 18273-20171 _na     632_aa gyrB DNA topoisomerase (ATP-hydrolyzing) subunit B
2349 JAEYBZ010000038.1 GCA023455535_01503 CDS open 20168-20380 _na     70_aa hypothetical protein
2350 JAEYBZ010000038.1 GCA023455535_01504 CDS open 20872-22251 _na     459_aa norM MATE family efflux transporter
2351 JAEYBZ010000038.1 GCA023455535_01505 CDS open 22330-22659 _na     109_aa relE Type II toxin-antitoxin system RelE/ParE family toxin
2352 JAEYBZ010000038.1 GCA023455535_01506 CDS open 22656-22979 _na     107_aa Antitoxin
2353 JAEYBZ010000038.1 GCA023455535_01507 CDS open 23211-23630 _na     139_aa fur Fur family transcriptional regulator
2354 JAEYBZ010000038.1 GCA023455535_01508 CDS open 23650-24090 _na     146_aa dps DNA starvation/stationary phase protection protein
2355 JAEYBZ010000038.1 GCA023455535_01509 CDS open 24253-24507 _na     84_aa hypothetical protein
2356 JAEYBZ010000038.1 GCA023455535_01510 CDS open 24396-25070 _na     224_aa ycjU HAD family phosphatase
2357 JAEYBZ010000038.1 GCA023455535_01511 CDS open 25063-25563 _na     166_aa yjhB 8-oxo-dGTP diphosphatase
2358 JAEYBZ010000038.1 GCA023455535_01512 CDS open 25662-26039 _na     125_aa yeaO DUF488 domain-containing protein
2359 JAEYBZ010000038.1 GCA023455535_01513 CDS open 26175-27170 _na     331_aa autotransporter outer membrane beta-barrel domain-containing protein
2360 JAEYBZ010000038.1 GCA023455535_01514 CDS open 27280-28422 _na     380_aa hgdB double-cubane-cluster-containing anaerobic reductase
2361 JAEYBZ010000038.1 GCA023455535_01515 CDS open 28419-29189 _na     256_aa yjiL 2-hydroxyglutaryl-CoA dehydratase
2362 JAEYBZ010000038.1 GCA023455535_01516 CDS open 29715-30938 _na     407_aa caiB CoA transferase
2363 JAEYBZ010000038.1 GCA023455535_01517 CDS open 30952-31854 _na     300_aa leuA Hydroxymethylglutaryl-CoA lyase
2364 JAEYBZ010000038.1 GCA023455535_01518 CDS open 31871-33148 _na     425_aa Citrate transporter-like domain-containing protein
2365 JAEYBZ010000038.1 GCA023455535_01519 CDS open 33218-34117 _na     299_aa lysR LysR family transcriptional regulator
2366 JAEYBZ010000038.1 GCA023455535_01520 CDS open 34164-35939 _na     591_aa iorA indolepyruvate ferredoxin oxidoreductase subunit alpha
2367 JAEYBZ010000038.1 GCA023455535_01521 CDS open 35936-36529 _na     197_aa porG indolepyruvate oxidoreductase subunit beta
2368 JAEYBZ010000038.1 GCA023455535_01522 CDS open 36744-37511 _na     255_aa pxpA 5-oxoprolinase subunit A
2369 JAEYBZ010000038.1 GCA023455535_01523 CDS open 37531-38592 _na     353_aa pxpC Biotin-dependent carboxyltransferase family protein
2370 JAEYBZ010000038.1 GCA023455535_01524 CDS open 38589-39320 _na     243_aa pxpB 5-oxoprolinase subunit PxpB
2371 JAEYBZ010000038.1 GCA023455535_01525 CDS open 39391-40596 _na     401_aa mntH Divalent metal cation transporter
2372 JAEYBZ010000038.1 GCA023455535_01526 CDS open 40767-41609 _na     280_aa nfo putative endonuclease 4
2373 JAEYBZ010000038.1 GCA023455535_01527 CDS open 41705-42211 _na     168_aa DVU_1555 family C-GCAxxG-C-C protein
2374 JAEYBZ010000038.1 GCA023455535_01528 CDS open 42236-42598 _na     120_aa qdoI cupin domain-containing protein
2375 JAEYBZ010000038.1 GCA023455535_01529 CDS open 42826-43317 _na     163_aa queF preQ(1) synthase
2376 JAEYBZ010000038.1 GCA023455535_01530 CDS open 43322-43816 _na     164_aa queT QueT transporter
2377 JAEYBZ010000038.1 GCA023455535_01531 CDS open 44397-45332 _na     311_aa lysR LysR family transcriptional regulator
2378 JAEYBZ010000038.1 GCA023455535_01532 CDS open 45787-47103 _na     438_aa lysP APC family permease
2379 JAEYBZ010000038.1 GCA023455535_01533 CDS open 47164-48354 _na     396_aa rspA Mandelate racemase/muconate lactonizing enzyme family protein
2380 JAEYBZ010000038.1 GCA023455535_01534 CDS open 48701-49492 _na     263_aa tauB ABC transporter ATP-binding protein
2381 JAEYBZ010000038.1 GCA023455535_01535 CDS open 49489-50331 _na     280_aa tauC ABC transporter permease
2382 JAEYBZ010000038.1 GCA023455535_01536 CDS open 50401-51498 _na     365_aa tauA ABC transporter substrate-binding protein
2383 JAEYBZ010000038.1 GCA023455535_01537 CDS open 51709-52803 _na     364_aa tauA ABC transporter substrate-binding protein
2384 JAEYBZ010000038.1 GCA023455535_01538 CDS open 52992-53987 _na     331_aa dppD ABC transporter ATP-binding protein
2385 JAEYBZ010000038.1 GCA023455535_01539 CDS open 53996-54925 _na     309_aa dppC ABC transporter permease
2386 JAEYBZ010000038.1 GCA023455535_01540 CDS open 54926-55900 _na     324_aa dppB ABC transporter permease
2387 JAEYBZ010000038.1 GCA023455535_01541 CDS open 56084-57607 _na     507_aa ddpA ABC transporter substrate-binding protein
2388 JAEYBZ010000038.1 GCA023455535_01542 CDS open 57906-58700 _na     264_aa fepC ABC transporter ATP-binding protein
2389 JAEYBZ010000038.1 GCA023455535_01543 CDS open 58697-59704 _na     335_aa fepD Iron ABC transporter permease
2390 JAEYBZ010000038.1 GCA023455535_01544 CDS open 59704-60786 _na     360_aa fepB ABC transporter substrate-binding protein
2391 JAEYBZ010000038.1 GCA023455535_01545 CDS open 60827-61918 _na     363_aa fepB ABC transporter substrate-binding protein
2392 JAEYBZ010000038.1 GCA023455535_01546 CDS open 61925-63094 _na     389_aa cfbD Nitrogenase/oxidoreductase component 1 domain-containing protein
2393 JAEYBZ010000038.1 GCA023455535_01547 CDS open 63091-64377 _na     428_aa cfbD Nitrogenase/oxidoreductase component 1 domain-containing protein
2394 JAEYBZ010000038.1 GCA023455535_01548 CDS open 64374-65129 _na     251_aa cfbC Nitrogenase iron protein
2395 JAEYBZ010000038.1 GCA023455535_01549 CDS open 65453-65887 _na     144_aa aroQ type II 3-dehydroquinate dehydratase
2396 JAEYBZ010000038.1 GCA023455535_01550 CDS open 65884-67101 _na     405_aa aroK Shikimate kinase
2397 JAEYBZ010000038.1 GCA023455535_01551 CDS open 67102-68241 _na     379_aa pheA Bifunctional chorismate mutase/prephenate dehydratase
2398 JAEYBZ010000038.1 GCA023455535_01552 CDS open 68245-69348 _na     367_aa aroC chorismate synthase
2399 JAEYBZ010000038.1 GCA023455535_01553 CDS open 69351-70616 _na     421_aa aroA 3-phosphoshikimate 1-carboxyvinyltransferase
2400 JAEYBZ010000038.1 GCA023455535_01554 CDS open 70613-71710 _na     365_aa aroB 3-dehydroquinate synthase
2401 JAEYBZ010000038.1 GCA023455535_01555 CDS open 71711-72550 _na     279_aa tyrA Prephenate dehydrogenase
2402 JAEYBZ010000038.1 GCA023455535_01556 CDS open 72547-73548 _na     333_aa aroGA bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase
2403 JAEYBZ010000038.1 GCA023455535_01557 CDS open 73980-74936 _na     318_aa csa3 DDE-type integrase/transposase/recombinase
2404 JAEYBZ010000038.1 GCA023455535_01490 gene open 196-1590 norM
2405 JAEYBZ010000038.1 GCA023455535_01491 gene open 2372-5425
2406 JAEYBZ010000038.1 GCA023455535_01492 gene open 5422-6540
2407 JAEYBZ010000038.1 GCA023455535_01493 gene open 6552-8573
2408 JAEYBZ010000038.1 GCA023455535_01494 gene open 8602-9660
2409 JAEYBZ010000038.1 GCA023455535_01495 gene open 9661-10317
2410 JAEYBZ010000038.1 GCA023455535_01496 gene open 10442-13681
2411 JAEYBZ010000038.1 GCA023455535_01497 gene open 13742-14221
2412 JAEYBZ010000038.1 GCA023455535_01498 gene open 14275-15765 cobQ
2413 JAEYBZ010000038.1 GCA023455535_01499 gene open 15938-16432 rutF
2414 JAEYBZ010000038.1 GCA023455535_01500 gene open 16562-16744
2415 JAEYBZ010000038.1 GCA023455535_01501 gene open 17069-17887 focA
2416 JAEYBZ010000038.1 GCA023455535_01502 gene open 18273-20171 gyrB
2417 JAEYBZ010000038.1 GCA023455535_01503 gene open 20168-20380
2418 JAEYBZ010000038.1 GCA023455535_01504 gene open 20872-22251 norM
2419 JAEYBZ010000038.1 GCA023455535_01505 gene open 22330-22659 relE
2420 JAEYBZ010000038.1 GCA023455535_01506 gene open 22656-22979
2421 JAEYBZ010000038.1 GCA023455535_01507 gene open 23211-23630 fur
2422 JAEYBZ010000038.1 GCA023455535_01508 gene open 23650-24090 dps
2423 JAEYBZ010000038.1 GCA023455535_01509 gene open 24253-24507
2424 JAEYBZ010000038.1 GCA023455535_01510 gene open 24396-25070 ycjU
2425 JAEYBZ010000038.1 GCA023455535_01511 gene open 25063-25563 yjhB
2426 JAEYBZ010000038.1 GCA023455535_01512 gene open 25662-26039 yeaO
2427 JAEYBZ010000038.1 GCA023455535_01513 gene open 26175-27170
2428 JAEYBZ010000038.1 GCA023455535_01514 gene open 27280-28422 hgdB
2429 JAEYBZ010000038.1 GCA023455535_01515 gene open 28419-29189 yjiL
2430 JAEYBZ010000038.1 GCA023455535_01516 gene open 29715-30938 caiB
2431 JAEYBZ010000038.1 GCA023455535_01517 gene open 30952-31854 leuA
2432 JAEYBZ010000038.1 GCA023455535_01518 gene open 31871-33148
2433 JAEYBZ010000038.1 GCA023455535_01519 gene open 33218-34117 lysR
2434 JAEYBZ010000038.1 GCA023455535_01520 gene open 34164-35939 iorA
2435 JAEYBZ010000038.1 GCA023455535_01521 gene open 35936-36529 porG
2436 JAEYBZ010000038.1 GCA023455535_01522 gene open 36744-37511 pxpA
2437 JAEYBZ010000038.1 GCA023455535_01523 gene open 37531-38592 pxpC
2438 JAEYBZ010000038.1 GCA023455535_01524 gene open 38589-39320 pxpB
2439 JAEYBZ010000038.1 GCA023455535_01525 gene open 39391-40596 mntH
2440 JAEYBZ010000038.1 GCA023455535_01526 gene open 40767-41609 nfo
2441 JAEYBZ010000038.1 GCA023455535_01527 gene open 41705-42211
2442 JAEYBZ010000038.1 GCA023455535_01528 gene open 42236-42598 qdoI
2443 JAEYBZ010000038.1 GCA023455535_01529 gene open 42826-43317 queF
2444 JAEYBZ010000038.1 GCA023455535_01530 gene open 43322-43816 queT
2445 JAEYBZ010000038.1 GCA023455535_01531 gene open 44397-45332 lysR
2446 JAEYBZ010000038.1 GCA023455535_01532 gene open 45787-47103 lysP
2447 JAEYBZ010000038.1 GCA023455535_01533 gene open 47164-48354 rspA
2448 JAEYBZ010000038.1 GCA023455535_01534 gene open 48701-49492 tauB
2449 JAEYBZ010000038.1 GCA023455535_01535 gene open 49489-50331 tauC
2450 JAEYBZ010000038.1 GCA023455535_01536 gene open 50401-51498 tauA
2451 JAEYBZ010000038.1 GCA023455535_01537 gene open 51709-52803 tauA
2452 JAEYBZ010000038.1 GCA023455535_01538 gene open 52992-53987 dppD
2453 JAEYBZ010000038.1 GCA023455535_01539 gene open 53996-54925 dppC
2454 JAEYBZ010000038.1 GCA023455535_01540 gene open 54926-55900 dppB
2455 JAEYBZ010000038.1 GCA023455535_01541 gene open 56084-57607 ddpA
2456 JAEYBZ010000038.1 GCA023455535_01542 gene open 57906-58700 fepC
2457 JAEYBZ010000038.1 GCA023455535_01543 gene open 58697-59704 fepD
2458 JAEYBZ010000038.1 GCA023455535_01544 gene open 59704-60786 fepB
2459 JAEYBZ010000038.1 GCA023455535_01545 gene open 60827-61918 fepB
2460 JAEYBZ010000038.1 GCA023455535_01546 gene open 61925-63094 cfbD
2461 JAEYBZ010000038.1 GCA023455535_01547 gene open 63091-64377 cfbD
2462 JAEYBZ010000038.1 GCA023455535_01548 gene open 64374-65129 cfbC
2463 JAEYBZ010000038.1 GCA023455535_01549 gene open 65453-65887 aroQ
2464 JAEYBZ010000038.1 GCA023455535_01550 gene open 65884-67101 aroK
2465 JAEYBZ010000038.1 GCA023455535_01551 gene open 67102-68241 pheA
2466 JAEYBZ010000038.1 GCA023455535_01552 gene open 68245-69348 aroC
2467 JAEYBZ010000038.1 GCA023455535_01553 gene open 69351-70616 aroA
2468 JAEYBZ010000038.1 GCA023455535_01554 gene open 70613-71710 aroB
2469 JAEYBZ010000038.1 GCA023455535_01555 gene open 71711-72550 tyrA
2470 JAEYBZ010000038.1 GCA023455535_01556 gene open 72547-73548 aroGA
2471 JAEYBZ010000038.1 GCA023455535_01557 gene open 73980-74936 csa3
2472 JAEYBZ010000039.1 GCA023455535_01327 CDS open 106-396 _na     96_aa yafQ type II toxin-antitoxin system YafQ family toxin
2473 JAEYBZ010000039.1 GCA023455535_01328 CDS open 431-679 _na     82_aa hypothetical protein
2474 JAEYBZ010000039.1 GCA023455535_01329 CDS open 730-1200 _na     156_aa hypothetical protein
2475 JAEYBZ010000039.1 GCA023455535_01330 CDS open 1217-1633 _na     138_aa hypothetical protein
2476 JAEYBZ010000039.1 GCA023455535_01331 CDS open 1683-2030 _na     115_aa hypothetical protein
2477 JAEYBZ010000039.1 GCA023455535_01332 CDS open 2353-4809 _na     818_aa AAA family ATPase
2478 JAEYBZ010000039.1 GCA023455535_01333 CDS open 4802-5056 _na     84_aa Winged helix-turn-helix domain-containing protein
2479 JAEYBZ010000039.1 GCA023455535_01334 CDS open 5053-5790 _na     245_aa hypothetical protein
2480 JAEYBZ010000039.1 GCA023455535_01335 CDS open 5787-6005 _na     72_aa XRE family transcriptional regulator
2481 JAEYBZ010000039.1 GCA023455535_01342 CDS open 6974-8623 _na     549_aa rqcH NFACT RNA-binding domain-containing protein
2482 JAEYBZ010000039.1 GCA023455535_01327 gene open 106-396 yafQ
2483 JAEYBZ010000039.1 GCA023455535_01328 gene open 431-679
2484 JAEYBZ010000039.1 GCA023455535_01329 gene open 730-1200
2485 JAEYBZ010000039.1 GCA023455535_01330 gene open 1217-1633
2486 JAEYBZ010000039.1 GCA023455535_01331 gene open 1683-2030
2487 JAEYBZ010000039.1 GCA023455535_01332 gene open 2353-4809
2488 JAEYBZ010000039.1 GCA023455535_01333 gene open 4802-5056
2489 JAEYBZ010000039.1 GCA023455535_01334 gene open 5053-5790
2490 JAEYBZ010000039.1 GCA023455535_01335 gene open 5787-6005
2491 JAEYBZ010000039.1 GCA023455535_01342 gene open 6974-8623 rqcH
2492 JAEYBZ010000039.1 GCA023455535_01336 gene open 6326-6401 trnK
2493 JAEYBZ010000039.1 GCA023455535_01337 gene open 6411-6487 trnH
2494 JAEYBZ010000039.1 GCA023455535_01338 gene open 6519-6595 trnR
2495 JAEYBZ010000039.1 GCA023455535_01339 gene open 6604-6679 trnG
2496 JAEYBZ010000039.1 GCA023455535_01340 gene open 6695-6772 trnP
2497 JAEYBZ010000039.1 GCA023455535_01341 gene open 6786-6861 trnA
2498 JAEYBZ010000039.1 GCA023455535_01336 tRNA open 6326-6401 trnK tRNA-Lys(ctt)
2499 JAEYBZ010000039.1 GCA023455535_01337 tRNA open 6411-6487 trnH tRNA-His(gtg)
2500 JAEYBZ010000039.1 GCA023455535_01338 tRNA open 6519-6595 trnR tRNA-Arg(tct)