HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Cutibacterium avidum (GCA_024104875.1)

Select a Genome:
BAKTA Annotations for GCA_024104875.1
Genome Selected: Cutibacterium avidum
ContigsBases CDSrRNA tmRNAtRNA
17 2512404 2298 5 1 46
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4722 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:2]    |    Number of Records Found: 4722 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
501 JAHDTS010000001.1 GCA024104875_00265 gene open 142133-142306
502 JAHDTS010000001.1 GCA024104875_00268 gene open 143194-144486
503 JAHDTS010000001.1 GCA024104875_00269 gene open 144597-145175
504 JAHDTS010000001.1 GCA024104875_00270 gene open 145286-146263
505 JAHDTS010000001.1 GCA024104875_00271 gene open 146411-147403 php
506 JAHDTS010000001.1 GCA024104875_00272 gene open 147400-148062
507 JAHDTS010000001.1 GCA024104875_00273 gene open 148059-148946 ulaE
508 JAHDTS010000001.1 GCA024104875_00274 gene open 149038-149706
509 JAHDTS010000001.1 GCA024104875_00275 gene open 149703-150653 rbsK
510 JAHDTS010000001.1 GCA024104875_00276 gene open 150688-152046 araJ
511 JAHDTS010000001.1 GCA024104875_00277 gene open 152051-153061
512 JAHDTS010000001.1 GCA024104875_00278 gene open 153616-154425 thiM
513 JAHDTS010000001.1 GCA024104875_00279 gene open 154412-154972
514 JAHDTS010000001.1 GCA024104875_00280 gene open 155071-156039 ldh
515 JAHDTS010000001.1 GCA024104875_00281 gene open 156082-157788 sfcA
516 JAHDTS010000001.1 GCA024104875_00282 gene open 157898-158455
517 JAHDTS010000001.1 GCA024104875_00283 gene open 158595-159599
518 JAHDTS010000001.1 GCA024104875_00284 gene open 159619-160446
519 JAHDTS010000001.1 GCA024104875_00285 gene open 160590-163070 leuS
520 JAHDTS010000001.1 GCA024104875_00286 gene open 163259-164077 comE
521 JAHDTS010000001.1 GCA024104875_00287 gene open 164064-166400 comE
522 JAHDTS010000001.1 GCA024104875_00288 gene open 166514-168262 sSL2
523 JAHDTS010000001.1 GCA024104875_00289 gene open 168328-169293 holA
524 JAHDTS010000001.1 GCA024104875_00290 gene open 169481-169747 rpsT
525 JAHDTS010000001.1 GCA024104875_00291 gene open 169893-171806
526 JAHDTS010000001.1 GCA024104875_00292 gene open 171947-173782 lepA
527 JAHDTS010000001.1 GCA024104875_00293 gene open 173779-174789
528 JAHDTS010000001.1 GCA024104875_00294 gene open 174786-176399 menD
529 JAHDTS010000001.1 GCA024104875_00295 gene open 176548-177723
530 JAHDTS010000001.1 GCA024104875_00296 gene open 177750-178955
531 JAHDTS010000001.1 GCA024104875_00297 gene open 179014-180180
532 JAHDTS010000001.1 GCA024104875_00298 gene open 180220-181209
533 JAHDTS010000001.1 GCA024104875_00299 gene open 181243-181764
534 JAHDTS010000001.1 GCA024104875_00300 gene open 181993-182130
535 JAHDTS010000001.1 GCA024104875_00301 gene open 182225-183880 acs
536 JAHDTS010000001.1 GCA024104875_00302 gene open 183975-184829
537 JAHDTS010000001.1 GCA024104875_00303 gene open 184822-185826
538 JAHDTS010000001.1 GCA024104875_00304 gene open 185823-187115
539 JAHDTS010000001.1 GCA024104875_00305 gene open 187267-188445 hemW
540 JAHDTS010000001.1 GCA024104875_00306 gene open 188509-189408
541 JAHDTS010000001.1 GCA024104875_00307 gene open 189405-190166
542 JAHDTS010000001.1 GCA024104875_00308 gene open 190193-190876
543 JAHDTS010000001.1 GCA024104875_00309 gene open 191020-192039 hrcA
544 JAHDTS010000001.1 GCA024104875_00310 gene open 192043-193218 dnaJ1
545 JAHDTS010000001.1 GCA024104875_00311 gene open 193215-193949
546 JAHDTS010000001.1 GCA024104875_00312 gene open 194065-194475 doxX
547 JAHDTS010000001.1 GCA024104875_00313 gene open 194642-196792 recQ
548 JAHDTS010000001.1 GCA024104875_00314 gene open 196876-198093
549 JAHDTS010000001.1 GCA024104875_00315 gene open 198136-198987
550 JAHDTS010000001.1 GCA024104875_00316 gene open 199090-200253
551 JAHDTS010000001.1 GCA024104875_00317 gene open 200326-201057
552 JAHDTS010000001.1 GCA024104875_00318 gene open 201198-202448 tgt
553 JAHDTS010000001.1 GCA024104875_00319 gene open 202635-203150
554 JAHDTS010000001.1 GCA024104875_00320 gene open 203209-203934 yhhQ
555 JAHDTS010000001.1 GCA024104875_00321 gene open 203999-205003 pip
556 JAHDTS010000001.1 GCA024104875_00322 gene open 205068-206144
557 JAHDTS010000001.1 GCA024104875_00323 gene open 206322-207275 phoH
558 JAHDTS010000001.1 GCA024104875_00324 gene open 207272-207739 ybeY
559 JAHDTS010000001.1 GCA024104875_00325 gene open 207736-209034 mpfA
560 JAHDTS010000001.1 GCA024104875_00326 gene open 209027-210049 era
561 JAHDTS010000001.1 GCA024104875_00327 gene open 210064-211560
562 JAHDTS010000001.1 GCA024104875_00328 gene open 211772-213496 leuA
563 JAHDTS010000001.1 GCA024104875_00329 gene open 213525-214331 uppS
564 JAHDTS010000001.1 GCA024104875_00330 gene open 214446-215111 lysE
565 JAHDTS010000001.1 GCA024104875_00331 gene open 215195-215995 recO
566 JAHDTS010000001.1 GCA024104875_00332 gene open 216168-216299
567 JAHDTS010000001.1 GCA024104875_00333 gene open 216389-217567
568 JAHDTS010000001.1 GCA024104875_00334 gene open 217616-217828
569 JAHDTS010000001.1 GCA024104875_00335 gene open 218028-218702 citB
570 JAHDTS010000001.1 GCA024104875_00336 gene open 218703-219113
571 JAHDTS010000001.1 GCA024104875_00337 gene open 219353-220744 glyQS
572 JAHDTS010000001.1 GCA024104875_00338 gene open 220874-221644
573 JAHDTS010000001.1 GCA024104875_00339 gene open 221641-223773 sdhA
574 JAHDTS010000001.1 GCA024104875_00340 gene open 223770-224528 sdhB
575 JAHDTS010000001.1 GCA024104875_00341 gene open 224612-225502 nadC
576 JAHDTS010000001.1 GCA024104875_00342 gene open 225499-227079 nadB
577 JAHDTS010000001.1 GCA024104875_00343 gene open 227072-228079 nadA
578 JAHDTS010000001.1 GCA024104875_00344 gene open 228179-228931
579 JAHDTS010000001.1 GCA024104875_00345 gene open 228992-230758 bluB
580 JAHDTS010000001.1 GCA024104875_00346 gene open 230947-232041 dusB
581 JAHDTS010000001.1 GCA024104875_00347 gene open 232090-233208 dgt
582 JAHDTS010000001.1 GCA024104875_00348 gene open 233238-234032
583 JAHDTS010000001.1 GCA024104875_00349 gene open 234075-235919
584 JAHDTS010000001.1 GCA024104875_00350 gene open 236006-236818
585 JAHDTS010000001.1 GCA024104875_00351 gene open 236832-237338
586 JAHDTS010000001.1 GCA024104875_00353 gene open 237640-239043 otsA
587 JAHDTS010000001.1 GCA024104875_00354 gene open 239114-240061 otsB
588 JAHDTS010000001.1 GCA024104875_00355 gene open 240501-241571
589 JAHDTS010000001.1 GCA024104875_00356 gene open 241568-241795 sirA
590 JAHDTS010000001.1 GCA024104875_00357 gene open 241870-242805 cysK
591 JAHDTS010000001.1 GCA024104875_00358 gene open 242858-244318 pdxR
592 JAHDTS010000001.1 GCA024104875_00359 gene open 244339-245244 pdxS
593 JAHDTS010000001.1 GCA024104875_00360 gene open 245195-245887 pdxT
594 JAHDTS010000001.1 GCA024104875_00361 gene open 246004-247260 bioA
595 JAHDTS010000001.1 GCA024104875_00362 gene open 247257-247961 bioD
596 JAHDTS010000001.1 GCA024104875_00363 gene open 247958-249328
597 JAHDTS010000001.1 GCA024104875_00364 gene open 249314-250567
598 JAHDTS010000001.1 GCA024104875_00366 gene open 251163-252197
599 JAHDTS010000001.1 GCA024104875_00367 gene open 252333-253130
600 JAHDTS010000001.1 GCA024104875_00368 gene open 253130-254050
601 JAHDTS010000001.1 GCA024104875_00369 gene open 254202-255326 mMP0363
602 JAHDTS010000001.1 GCA024104875_00370 gene open 255336-256379 mMP0362
603 JAHDTS010000001.1 GCA024104875_00371 gene open 256376-257350
604 JAHDTS010000001.1 GCA024104875_00372 gene open 257341-258303
605 JAHDTS010000001.1 GCA024104875_00373 gene open 258358-259077
606 JAHDTS010000001.1 GCA024104875_00374 gene open 259151-259654
607 JAHDTS010000001.1 GCA024104875_00375 gene open 259707-260981 fabB
608 JAHDTS010000001.1 GCA024104875_00376 gene open 261054-261299 acpP
609 JAHDTS010000001.1 GCA024104875_00377 gene open 261381-262379
610 JAHDTS010000001.1 GCA024104875_00378 gene open 262376-263308 fabD
611 JAHDTS010000001.1 GCA024104875_00379 gene open 263436-263903
612 JAHDTS010000001.1 GCA024104875_00380 gene open 263996-264487
613 JAHDTS010000001.1 GCA024104875_00381 gene open 264349-264711
614 JAHDTS010000001.1 GCA024104875_00382 gene open 264869-266314
615 JAHDTS010000001.1 GCA024104875_00383 gene open 266334-267560 pucR
616 JAHDTS010000001.1 GCA024104875_00384 gene open 267802-270555 aceE
617 JAHDTS010000001.1 GCA024104875_00385 gene open 270672-271076
618 JAHDTS010000001.1 GCA024104875_00386 gene open 271178-273415
619 JAHDTS010000001.1 GCA024104875_00387 gene open 273412-273687
620 JAHDTS010000001.1 GCA024104875_00388 gene open 273769-274776
621 JAHDTS010000001.1 GCA024104875_00389 gene open 274931-275506 pyrR
622 JAHDTS010000001.1 GCA024104875_00390 gene open 275503-276447 pyrB
623 JAHDTS010000001.1 GCA024104875_00391 gene open 276444-277781 allB
624 JAHDTS010000001.1 GCA024104875_00392 gene open 277778-278866 carA
625 JAHDTS010000001.1 GCA024104875_00393 gene open 278866-282072 carB
626 JAHDTS010000001.1 GCA024104875_00394 gene open 282072-282866
627 JAHDTS010000001.1 GCA024104875_00395 gene open 282863-283786
628 JAHDTS010000001.1 GCA024104875_00396 gene open 283813-284523 pyrF
629 JAHDTS010000001.1 GCA024104875_00397 gene open 284552-285202 pyrE
630 JAHDTS010000001.1 GCA024104875_00398 gene open 285328-286134
631 JAHDTS010000001.1 GCA024104875_00399 gene open 286149-287330 rimO
632 JAHDTS010000001.1 GCA024104875_00400 gene open 287327-287593
633 JAHDTS010000001.1 GCA024104875_00401 gene open 287714-288334 pgsA
634 JAHDTS010000001.1 GCA024104875_00402 gene open 288331-288816 cinA
635 JAHDTS010000001.1 GCA024104875_00403 gene open 288917-289192
636 JAHDTS010000001.1 GCA024104875_00404 gene open 289313-290122 glpR
637 JAHDTS010000001.1 GCA024104875_00405 gene open 290221-290415
638 JAHDTS010000001.1 GCA024104875_00406 gene open 290724-291770 recA
639 JAHDTS010000001.1 GCA024104875_00407 gene open 291800-292315 recX
640 JAHDTS010000001.1 GCA024104875_00408 gene open 292413-294038 rny
641 JAHDTS010000001.1 GCA024104875_00409 gene open 294094-294993
642 JAHDTS010000001.1 GCA024104875_00410 gene open 295175-296716 yfcC
643 JAHDTS010000001.1 GCA024104875_00411 gene open 296766-298250 miaB
644 JAHDTS010000001.1 GCA024104875_00412 gene open 298403-298603
645 JAHDTS010000001.1 GCA024104875_00413 gene open 298739-299680 miaA
646 JAHDTS010000001.1 GCA024104875_00414 gene open 299685-300509 dapF
647 JAHDTS010000001.1 GCA024104875_00415 gene open 300632-302083 hflX
648 JAHDTS010000001.1 GCA024104875_00416 gene open 302073-304121
649 JAHDTS010000001.1 GCA024104875_00417 gene open 304131-304712 lexA
650 JAHDTS010000001.1 GCA024104875_00418 gene open 305098-305448
651 JAHDTS010000001.1 GCA024104875_00419 gene open 305674-306180 nrdR
652 JAHDTS010000001.1 GCA024104875_00420 gene open 306187-309111 nrdA
653 JAHDTS010000001.1 GCA024104875_00421 gene open 309307-310233
654 JAHDTS010000001.1 GCA024104875_00422 gene open 310323-311177 uspA
655 JAHDTS010000001.1 GCA024104875_00423 gene open 311131-311439
656 JAHDTS010000001.1 GCA024104875_00424 gene open 311508-315590 hrpA
657 JAHDTS010000001.1 GCA024104875_00425 gene open 315693-317867 gnpA
658 JAHDTS010000001.1 GCA024104875_00426 gene open 318036-318830 tesB
659 JAHDTS010000001.1 GCA024104875_00427 gene open 318980-319198
660 JAHDTS010000001.1 GCA024104875_00428 gene open 319195-319479
661 JAHDTS010000001.1 GCA024104875_00429 gene open 320287-320604
662 JAHDTS010000001.1 GCA024104875_00430 gene open 320747-321223
663 JAHDTS010000001.1 GCA024104875_00431 gene open 321731-322669 rpoD
664 JAHDTS010000001.1 GCA024104875_00432 gene open 323014-324552
665 JAHDTS010000001.1 GCA024104875_00433 gene open 324622-327183
666 JAHDTS010000001.1 GCA024104875_00434 gene open 327290-327901
667 JAHDTS010000001.1 GCA024104875_00435 gene open 327842-329086
668 JAHDTS010000001.1 GCA024104875_00436 gene open 329216-329797
669 JAHDTS010000001.1 GCA024104875_00437 gene open 329801-331216 dcuC
670 JAHDTS010000001.1 GCA024104875_00438 gene open 331301-332041
671 JAHDTS010000001.1 GCA024104875_00439 gene open 332034-332240
672 JAHDTS010000001.1 GCA024104875_00440 gene open 332389-334554 gyrB
673 JAHDTS010000001.1 GCA024104875_00441 gene open 334866-336185 dcuA
674 JAHDTS010000001.1 GCA024104875_00442 gene open 336254-337570
675 JAHDTS010000001.1 GCA024104875_00443 gene open 337640-338122
676 JAHDTS010000001.1 GCA024104875_00444 gene open 338139-340790
677 JAHDTS010000001.1 GCA024104875_00445 gene open 340856-341953
678 JAHDTS010000001.1 GCA024104875_00446 gene open 342000-342596
679 JAHDTS010000001.1 GCA024104875_00447 gene open 342593-343735
680 JAHDTS010000001.1 GCA024104875_00448 gene open 343738-344379 tdk
681 JAHDTS010000001.1 GCA024104875_00449 gene open 344455-345525 sepH
682 JAHDTS010000001.1 GCA024104875_00450 gene open 345735-346031
683 JAHDTS010000001.1 GCA024104875_00451 gene open 346100-346420
684 JAHDTS010000001.1 GCA024104875_00452 gene open 346444-346998
685 JAHDTS010000001.1 GCA024104875_00453 gene open 346991-347449 dut
686 JAHDTS010000001.1 GCA024104875_00454 gene open 347493-348227
687 JAHDTS010000001.1 GCA024104875_00455 gene open 348230-348622
688 JAHDTS010000001.1 GCA024104875_00456 gene open 349233-349892 trkA
689 JAHDTS010000001.1 GCA024104875_00457 gene open 349935-350654 trkA
690 JAHDTS010000001.1 GCA024104875_00458 gene open 350765-352789 potE
691 JAHDTS010000001.1 GCA024104875_00459 gene open 353034-354239 rlmD
692 JAHDTS010000001.1 GCA024104875_00460 gene open 354262-354501
693 JAHDTS010000001.1 GCA024104875_00461 gene open 354856-356148
694 JAHDTS010000001.1 GCA024104875_00462 gene open 356191-356412 copG
695 JAHDTS010000001.1 GCA024104875_00463 gene open 356432-357268
696 JAHDTS010000001.1 GCA024104875_00464 gene open 357356-359158
697 JAHDTS010000001.1 GCA024104875_00465 gene open 359178-359411
698 JAHDTS010000001.1 GCA024104875_00466 gene open 359765-362434 acnA
699 JAHDTS010000001.1 GCA024104875_00467 gene open 362645-363781
700 JAHDTS010000001.1 GCA024104875_00468 gene open 363918-365855 dxs
701 JAHDTS010000001.1 GCA024104875_00469 gene open 365892-367130
702 JAHDTS010000001.1 GCA024104875_00470 gene open 367127-367696
703 JAHDTS010000001.1 GCA024104875_00471 gene open 367819-368265
704 JAHDTS010000001.1 GCA024104875_00472 gene open 368400-369254
705 JAHDTS010000001.1 GCA024104875_00473 gene open 369311-370069 cbiX
706 JAHDTS010000001.1 GCA024104875_00477 gene open 370721-371005
707 JAHDTS010000001.1 GCA024104875_00479 gene open 371299-372363 adhP
708 JAHDTS010000001.1 GCA024104875_00480 gene open 372320-373108
709 JAHDTS010000001.1 GCA024104875_00481 gene open 373142-374203
710 JAHDTS010000001.1 GCA024104875_00482 gene open 374434-375654 nreB
711 JAHDTS010000001.1 GCA024104875_00483 gene open 375651-376283 luxR
712 JAHDTS010000001.1 GCA024104875_00484 gene open 376372-378426 thrS
713 JAHDTS010000001.1 GCA024104875_00485 gene open 378419-378979
714 JAHDTS010000001.1 GCA024104875_00486 gene open 378972-379595 pgsA
715 JAHDTS010000001.1 GCA024104875_00487 gene open 379641-380294
716 JAHDTS010000001.1 GCA024104875_00488 gene open 380291-381061
717 JAHDTS010000001.1 GCA024104875_00489 gene open 381104-381436 sbp
718 JAHDTS010000001.1 GCA024104875_00490 gene open 381429-382181
719 JAHDTS010000001.1 GCA024104875_00491 gene open 382258-382638
720 JAHDTS010000001.1 GCA024104875_00492 gene open 382647-383228 fHA
721 JAHDTS010000001.1 GCA024104875_00493 gene open 383228-383938 soxR
722 JAHDTS010000001.1 GCA024104875_00494 gene open 384018-384497
723 JAHDTS010000001.1 GCA024104875_00495 gene open 384681-385268 soxR
724 JAHDTS010000001.1 GCA024104875_00496 gene open 385378-386598
725 JAHDTS010000001.1 GCA024104875_00497 gene open 386809-387942
726 JAHDTS010000001.1 GCA024104875_00210 gene open 80999-81081 trnL
727 JAHDTS010000001.1 GCA024104875_00266 gene open 142757-142829 trnA
728 JAHDTS010000001.1 GCA024104875_00267 gene open 142899-142974 trnA
729 JAHDTS010000001.1 GCA024104875_00352 gene open 237435-237507 trnN
730 JAHDTS010000001.1 GCA024104875_00365 gene open 250739-250812 trnI
731 JAHDTS010000001.1 GCA024104875_00474 gene open 370314-370388 trnV
732 JAHDTS010000001.1 GCA024104875_00475 gene open 370390-370460 trnC
733 JAHDTS010000001.1 GCA024104875_00476 gene open 370489-370561 trnG
734 JAHDTS010000001.1 GCA024104875_00478 gene open 371059-371133 trnV
735 JAHDTS010000001.1 GCA024104875_00210 tRNA open 80999-81081 trnL tRNA-Leu(caa)
736 JAHDTS010000001.1 GCA024104875_00266 tRNA open 142757-142829 trnA tRNA-Ala(ggc)
737 JAHDTS010000001.1 GCA024104875_00267 tRNA open 142899-142974 trnA tRNA-Ala(ggc)
738 JAHDTS010000001.1 GCA024104875_00352 tRNA open 237435-237507 trnN tRNA-Asn(gtt)
739 JAHDTS010000001.1 GCA024104875_00365 tRNA open 250739-250812 trnI tRNA-Ile2(cat)
740 JAHDTS010000001.1 GCA024104875_00474 tRNA open 370314-370388 trnV tRNA-Val(gac)
741 JAHDTS010000001.1 GCA024104875_00475 tRNA open 370390-370460 trnC tRNA-Cys(gca)
742 JAHDTS010000001.1 GCA024104875_00476 tRNA open 370489-370561 trnG tRNA-Gly(gcc)
743 JAHDTS010000001.1 GCA024104875_00478 tRNA open 371059-371133 trnV tRNA-Val(cac)
744 JAHDTS010000002.1 GCA024104875_00551 gene open 63118-63214 Bacteria_small_SRP
745 JAHDTS010000002.1 GCA024104875_00551 ncRNA open 63118-63214 Bacterial small signal recognition particle RNA
746 JAHDTS010000002.1 regulatory_region open 203968-204132 Cobalamin riboswitch aptamer
747 JAHDTS010000002.1 regulatory_region open 246468-246526 msiK RNA
748 JAHDTS010000002.1 repeat_region open 141137-141799 CRISPR array with 9 repeats of length 36%2C consensus sequence GCCTCGGCTTAACTGCCGAGGCAACTTCGTTGAGGC and spacer length 37
749 JAHDTS010000002.1 GCA024104875_00498 CDS open 44-241 _na     65_aa DUF2530 domain-containing protein
750 JAHDTS010000002.1 GCA024104875_00499 CDS open 261-1409 _na     382_aa hypothetical protein
751 JAHDTS010000002.1 GCA024104875_00500 CDS open 1606-3210 _na     534_aa cydC thiol reductant ABC exporter subunit CydC
752 JAHDTS010000002.1 GCA024104875_00501 CDS open 3207-4853 _na     548_aa cydD thiol reductant ABC exporter subunit CydD
753 JAHDTS010000002.1 GCA024104875_00502 CDS open 4857-5930 _na     357_aa cydB cytochrome d ubiquinol oxidase subunit II
754 JAHDTS010000002.1 GCA024104875_00503 CDS open 5944-7464 _na     506_aa Cytochrome d ubiquinol oxidase subunit I
755 JAHDTS010000002.1 GCA024104875_00504 CDS open 7597-8160 _na     187_aa DUF218 domain-containing protein
756 JAHDTS010000002.1 GCA024104875_00505 CDS open 8263-10323 _na     686_aa Multidrug resistance ABC superfamily ATP binding cassette transporter%2C membrane protein
757 JAHDTS010000002.1 GCA024104875_00506 CDS open 10320-12056 _na     578_aa ABC superfamily ATP binding cassette transporter%2C ABC/membrane protein
758 JAHDTS010000002.1 GCA024104875_00507 CDS open 12234-13523 _na     429_aa Sugar ABC transporter substrate-binding protein
759 JAHDTS010000002.1 GCA024104875_00508 CDS open 13616-15148 _na     510_aa lysS lysine--tRNA ligase
760 JAHDTS010000002.1 GCA024104875_00509 CDS open 15241-15522 _na     93_aa crgA Cell division protein CrgA
761 JAHDTS010000002.1 GCA024104875_00510 CDS open 15646-16524 _na     292_aa DUF881 domain-containing protein
762 JAHDTS010000002.1 GCA024104875_00511 CDS open 16871-17221 _na     116_aa Anthranilate synthase component II
763 JAHDTS010000002.1 GCA024104875_00512 CDS open 17223-19091 _na     622_aa pknB Stk1 family PASTA domain-containing Ser/Thr kinase
764 JAHDTS010000002.1 GCA024104875_00513 CDS open 19149-20576 _na     475_aa Penicillin binding protein
765 JAHDTS010000002.1 GCA024104875_00514 CDS open 20573-21979 _na     468_aa ftsW Cell division protein FtsW
766 JAHDTS010000002.1 GCA024104875_00515 CDS open 21979-23433 _na     484_aa Serine/threonine protein phosphatase 1
767 JAHDTS010000002.1 GCA024104875_00516 CDS open 23437-23925 _na     162_aa FHA domain-containing protein
768 JAHDTS010000002.1 GCA024104875_00517 CDS open 23928-24617 _na     229_aa fHA FHA domain-containing protein
769 JAHDTS010000002.1 GCA024104875_00518 CDS open 24788-25858 _na     356_aa Glycosyltransferase
770 JAHDTS010000002.1 GCA024104875_00519 CDS open 25855-26433 _na     192_aa Protein-tyrosine phosphatase
771 JAHDTS010000002.1 GCA024104875_00520 CDS open 26439-26708 _na     89_aa Pyrrolo-quinoline quinone
772 JAHDTS010000002.1 GCA024104875_00521 CDS open 26705-27640 _na     311_aa 2-nitropropane dioxygenase
773 JAHDTS010000002.1 GCA024104875_00522 CDS open 27669-27926 _na     85_aa Nitrate ABC superfamily ATP binding cassette transporter%2C ABC protein
774 JAHDTS010000002.1 GCA024104875_00523 CDS open 27920-28636 _na     238_aa Serine kinase
775 JAHDTS010000002.1 GCA024104875_00524 CDS open 28636-30024 _na     462_aa dTDP-4-dehydrorhamnose reductase
776 JAHDTS010000002.1 GCA024104875_00525 CDS open 30024-31022 _na     332_aa rfbB dTDP-glucose 4%2C6-dehydratase
777 JAHDTS010000002.1 GCA024104875_00526 CDS open 31323-32654 _na     443_aa PE-PGRS family protein
778 JAHDTS010000002.1 GCA024104875_00527 CDS open 32905-33792 _na     295_aa rfbA glucose-1-phosphate thymidylyltransferase RfbA
779 JAHDTS010000002.1 GCA024104875_00528 CDS open 33890-35191 _na     433_aa Brp/Blh family beta-carotene 15%2C15'-monooxygenase
780 JAHDTS010000002.1 GCA024104875_00529 CDS open 35403-36980 _na     525_aa Capsular exopolysaccharide family protein
781 JAHDTS010000002.1 GCA024104875_00530 CDS open 36977-38221 _na     414_aa Brp/Blh family beta-carotene 15%2C15'-monooxygenase
782 JAHDTS010000002.1 GCA024104875_00531 CDS open 38310-39311 _na     333_aa Spore protein YkvP/CgeB glycosyl transferase-like domain-containing protein
783 JAHDTS010000002.1 GCA024104875_00532 CDS open 39308-40357 _na     349_aa Prephenate dehydrogenase
784 JAHDTS010000002.1 GCA024104875_00533 CDS open 40437-41804 _na     455_aa Group 1 glycosyl transferase
785 JAHDTS010000002.1 GCA024104875_00534 CDS open 41843-42733 _na     296_aa glycosyltransferase family A protein
786 JAHDTS010000002.1 GCA024104875_00535 CDS open 42826-44715 _na     629_aa ABC superfamily ATP binding cassette transporter%2C ABC/membrane protein
787 JAHDTS010000002.1 GCA024104875_00536 CDS open 44719-45651 _na     310_aa Glucosyltransferase
788 JAHDTS010000002.1 GCA024104875_00537 CDS open 45963-46901 _na     312_aa exoV ExoV domain protein
789 JAHDTS010000002.1 GCA024104875_00538 CDS open 47113-49284 _na     723_aa glycosyltransferase
790 JAHDTS010000002.1 GCA024104875_00539 CDS open 49281-50324 _na     347_aa Glycosyltransferase
791 JAHDTS010000002.1 GCA024104875_00540 CDS open 50324-52588 _na     754_aa N-acylneuraminate-9-phosphate synthase
792 JAHDTS010000002.1 GCA024104875_00541 CDS open 52630-53313 _na     227_aa N-acylneuraminate cytidylyltransferase
793 JAHDTS010000002.1 GCA024104875_00542 CDS open 53310-53432 _na     40_aa Cell division inhibitor
794 JAHDTS010000002.1 GCA024104875_00543 CDS open 53429-53926 _na     165_aa VanZ-like domain-containing protein
795 JAHDTS010000002.1 GCA024104875_00544 CDS open 53926-55416 _na     496_aa Bacterial sugar transferase
796 JAHDTS010000002.1 GCA024104875_00545 CDS open 55899-56645 _na     248_aa Tat pathway signal sequence domain protein
797 JAHDTS010000002.1 GCA024104875_00546 CDS open 56855-58606 _na     583_aa treZ malto-oligosyltrehalose trehalohydrolase
798 JAHDTS010000002.1 GCA024104875_00547 CDS open 58603-61140 _na     845_aa treY malto-oligosyltrehalose synthase
799 JAHDTS010000002.1 GCA024104875_00548 CDS open 61213-62175 _na     320_aa Phosphotransferase
800 JAHDTS010000002.1 GCA024104875_00550 CDS open 62549-62914 _na     121_aa hslR Heat shock protein HslR
801 JAHDTS010000002.1 GCA024104875_00552 CDS open 63274-63630 _na     118_aa Fumarate reductase subunit D
802 JAHDTS010000002.1 GCA024104875_00553 CDS open 63698-66592 _na     964_aa DNA polymerase III subunit gamma and tau
803 JAHDTS010000002.1 GCA024104875_00554 CDS open 66708-67031 _na     107_aa YbaB/EbfC family nucleoid-associated protein
804 JAHDTS010000002.1 GCA024104875_00555 CDS open 67062-67667 _na     201_aa recR recombination mediator RecR
805 JAHDTS010000002.1 GCA024104875_00556 CDS open 67773-68339 _na     188_aa padR PadR family transcriptional regulator
806 JAHDTS010000002.1 GCA024104875_00557 CDS open 68345-69127 _na     260_aa lolD Macrolide export ABC superfamily ATP binding cassette transporter%2C ABC protein
807 JAHDTS010000002.1 GCA024104875_00558 CDS open 69127-71805 _na     892_aa Efflux ABC superfamily ATP binding cassette transporter%2C permease protein
808 JAHDTS010000002.1 GCA024104875_00559 CDS open 71828-73648 _na     606_aa Brp/Blh family beta-carotene 15%2C15'-monooxygenase
809 JAHDTS010000002.1 GCA024104875_00560 CDS open 73768-74568 _na     266_aa Hydrolase
810 JAHDTS010000002.1 GCA024104875_00561 CDS open 74578-75429 _na     283_aa Hydrolase
811 JAHDTS010000002.1 GCA024104875_00562 CDS open 76540-76758 _na     72_aa hypothetical protein
812 JAHDTS010000002.1 GCA024104875_00563 CDS open 76923-78128 _na     401_aa ABC transporter permease
813 JAHDTS010000002.1 GCA024104875_00564 CDS open 78122-78721 _na     199_aa Integral membrane protein
814 JAHDTS010000002.1 GCA024104875_00565 CDS open 79166-82477 _na     1103_aa ileS isoleucine--tRNA ligase
815 JAHDTS010000002.1 GCA024104875_00566 CDS open 82557-83579 _na     340_aa Trans-1%2C2-dihydrobenzene-1%2C2-diol dehydrogenase
816 JAHDTS010000002.1 GCA024104875_00567 CDS open 83650-83991 _na     113_aa whiB Transcriptional regulator WhiB
817 JAHDTS010000002.1 GCA024104875_00568 CDS open 83988-84161 _na     57_aa DUF4177 domain-containing protein
818 JAHDTS010000002.1 GCA024104875_00569 CDS open 84158-84613 _na     151_aa ridA Endoribonuclease L-PSP
819 JAHDTS010000002.1 GCA024104875_00570 CDS open 84715-85416 _na     233_aa Crp/Fnr family transcriptional regulator
820 JAHDTS010000002.1 GCA024104875_00571 CDS open 85554-86267 _na     237_aa nth endonuclease III
821 JAHDTS010000002.1 GCA024104875_00572 CDS open 86264-86851 _na     195_aa Redoxin superfamily protein
822 JAHDTS010000002.1 GCA024104875_00573 CDS open 86848-87504 _na     218_aa NUDIX hydrolase
823 JAHDTS010000002.1 GCA024104875_00574 CDS open 87593-88129 _na     178_aa Integral membrane protein
824 JAHDTS010000002.1 GCA024104875_00575 CDS open 88225-89493 _na     422_aa nhaA Na+/H+ antiporter NhaA
825 JAHDTS010000002.1 GCA024104875_00576 CDS open 89661-90419 _na     252_aa Methyltransferase
826 JAHDTS010000002.1 GCA024104875_00577 CDS open 90547-91605 _na     352_aa ssd septum site-determining protein Ssd
827 JAHDTS010000002.1 GCA024104875_00578 CDS open 91602-92768 _na     388_aa cpaF Helicase/secretion neighborhood ATPase
828 JAHDTS010000002.1 GCA024104875_00579 CDS open 92765-93535 _na     256_aa gspF Type II secretion system protein GspF domain-containing protein
829 JAHDTS010000002.1 GCA024104875_00580 CDS open 93532-94281 _na     249_aa Type II secretion system protein F domain protein
830 JAHDTS010000002.1 GCA024104875_00581 CDS open 94278-94430 _na     50_aa Variable large protein
831 JAHDTS010000002.1 GCA024104875_00582 CDS open 94498-94785 _na     95_aa DUF4244 domain-containing protein
832 JAHDTS010000002.1 GCA024104875_00583 CDS open 94782-95192 _na     136_aa TadE-like protein
833 JAHDTS010000002.1 GCA024104875_00584 CDS open 95258-95593 _na     111_aa tadE Pilus assembly protein TadE
834 JAHDTS010000002.1 GCA024104875_00585 CDS open 95646-95768 _na     40_aa hypothetical protein
835 JAHDTS010000002.1 GCA024104875_00586 CDS open 95907-98192 _na     761_aa ATP-dependent helicase
836 JAHDTS010000002.1 GCA024104875_00587 CDS open 98204-99721 _na     505_aa Methyltransferase
837 JAHDTS010000002.1 GCA024104875_00588 CDS open 99823-100113 _na     96_aa DUF2249 domain-containing protein
838 JAHDTS010000002.1 GCA024104875_00589 CDS open 100238-103138 _na     966_aa topA type I DNA topoisomerase
839 JAHDTS010000002.1 GCA024104875_00590 CDS open 103140-104627 _na     495_aa Transcriptional regulator
840 JAHDTS010000002.1 GCA024104875_00591 CDS open 104620-105267 _na     215_aa tmk dTMP kinase
841 JAHDTS010000002.1 GCA024104875_00592 CDS open 105301-106557 _na     418_aa dnaX DNA polymerase III subunit delta'
842 JAHDTS010000002.1 GCA024104875_00593 CDS open 106662-107468 _na     268_aa doxX DoxX family protein
843 JAHDTS010000002.1 GCA024104875_00594 CDS open 107477-108235 _na     252_aa PSP1 C-terminal domain-containing protein
844 JAHDTS010000002.1 GCA024104875_00595 CDS open 108232-109929 _na     565_aa Peptidase
845 JAHDTS010000002.1 GCA024104875_00596 CDS open 110064-110396 _na     110_aa Secreted protein
846 JAHDTS010000002.1 GCA024104875_00597 CDS open 110459-112138 _na     559_aa DUF885 domain-containing protein
847 JAHDTS010000002.1 GCA024104875_00599 CDS open 112833-113117 _na     94_aa hypothetical protein
848 JAHDTS010000002.1 GCA024104875_00600 CDS open 113258-113695 _na     145_aa hypothetical protein
849 JAHDTS010000002.1 GCA024104875_00601 CDS open 113766-114290 _na     174_aa Yip1 domain-containing protein
850 JAHDTS010000002.1 GCA024104875_00602 CDS open 114308-114679 _na     123_aa hypothetical protein
851 JAHDTS010000002.1 GCA024104875_00603 CDS open 114676-116160 _na     494_aa Brp/Blh family beta-carotene 15%2C15'-monooxygenase
852 JAHDTS010000002.1 GCA024104875_00604 CDS open 116109-116774 _na     221_aa Bacitracin ABC transporter%2C ABC protein
853 JAHDTS010000002.1 GCA024104875_00605 CDS open 116837-117208 _na     123_aa Antitoxin
854 JAHDTS010000002.1 GCA024104875_00606 CDS open 117316-117732 _na     138_aa YdhG-like domain-containing protein
855 JAHDTS010000002.1 GCA024104875_00607 CDS open 118238-119584 _na     448_aa Flavin-containing amine oxidase
856 JAHDTS010000002.1 GCA024104875_00608 CDS open 119589-119786 _na     65_aa Nitrogen regulatory protein P-II
857 JAHDTS010000002.1 GCA024104875_00609 CDS open 119783-121183 _na     466_aa Ammonium transporter
858 JAHDTS010000002.1 GCA024104875_00610 CDS open 121341-122366 _na     341_aa Zinc-ribbon domain-containing protein
859 JAHDTS010000002.1 GCA024104875_00611 CDS open 122387-122872 _na     161_aa Phosphoglycerate mutase family protein
860 JAHDTS010000002.1 GCA024104875_00612 CDS open 122920-123909 _na     329_aa Cephalosporin-C deacetylase
861 JAHDTS010000002.1 GCA024104875_00613 CDS open 123918-124931 _na     337_aa SAM-dependent methyltransferase
862 JAHDTS010000002.1 GCA024104875_00614 CDS open 125072-125632 _na     186_aa ppa Inorganic pyrophosphatase
863 JAHDTS010000002.1 GCA024104875_00615 CDS open 125703-127133 _na     476_aa dacB D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase
864 JAHDTS010000002.1 GCA024104875_00616 CDS open 127133-128086 _na     317_aa tRNA(Ile)-lysidine synthase
865 JAHDTS010000002.1 GCA024104875_00617 CDS open 128096-128650 _na     184_aa hpt hypoxanthine phosphoribosyltransferase
866 JAHDTS010000002.1 GCA024104875_00618 CDS open 128789-130948 _na     719_aa ftsH ATP-dependent zinc metalloprotease FtsH
867 JAHDTS010000002.1 GCA024104875_00619 CDS open 131047-131772 _na     241_aa DUF6498 domain-containing protein
868 JAHDTS010000002.1 GCA024104875_00620 CDS open 131818-132393 _na     191_aa folE GTP cyclohydrolase I FolE
869 JAHDTS010000002.1 GCA024104875_00621 CDS open 132659-133867 _na     402_aa CRISPR-associated protein
870 JAHDTS010000002.1 GCA024104875_00622 CDS open 133870-135405 _na     511_aa csb2 type I-U CRISPR-associated protein Csb2
871 JAHDTS010000002.1 GCA024104875_00623 CDS open 135405-138044 _na     879_aa cas3u type I-U CRISPR-associated helicase/endonuclease Cas3
872 JAHDTS010000002.1 GCA024104875_00624 CDS open 138041-139075 _na     344_aa hypothetical protein
873 JAHDTS010000002.1 GCA024104875_00625 CDS open 139130-140659 _na     509_aa cas1 CRISPR-associated endonuclease Cas1
874 JAHDTS010000002.1 GCA024104875_00626 CDS open 140656-140958 _na     100_aa cas2 CRISPR-associated endonuclease Cas2
875 JAHDTS010000002.1 GCA024104875_00627 CDS open 141925-142764 _na     279_aa folP dihydropteroate synthase
876 JAHDTS010000002.1 GCA024104875_00628 CDS open 142851-143213 _na     120_aa folB dihydroneopterin aldolase
877 JAHDTS010000002.1 GCA024104875_00629 CDS open 143210-143767 _na     185_aa folK 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase
878 JAHDTS010000002.1 GCA024104875_00630 CDS open 143764-144303 _na     179_aa Secreted protein
879 JAHDTS010000002.1 GCA024104875_00631 CDS open 144370-145065 _na     231_aa minE Cell division topological specificity factor MinE
880 JAHDTS010000002.1 GCA024104875_00632 CDS open 145160-146275 _na     371_aa NADH dehydrogenase (Quinone)
881 JAHDTS010000002.1 GCA024104875_00633 CDS open 146478-146795 _na     105_aa Lsr2 family protein
882 JAHDTS010000002.1 GCA024104875_00634 CDS open 147056-149587 _na     843_aa clpC ATP-dependent Clp protease ATP-binding subunit ClpC
883 JAHDTS010000002.1 GCA024104875_00635 CDS open 149649-150677 _na     342_aa DUF2891 domain-containing protein
884 JAHDTS010000002.1 GCA024104875_00636 CDS open 150674-151660 _na     328_aa DUF979 domain-containing protein
885 JAHDTS010000002.1 GCA024104875_00637 CDS open 151657-152421 _na     254_aa DUF969 domain-containing protein
886 JAHDTS010000002.1 GCA024104875_00638 CDS open 152550-153320 _na     256_aa 5-oxoprolinase subunit A
887 JAHDTS010000002.1 GCA024104875_00639 CDS open 153317-153937 _na     206_aa Allophanate hydrolase subunit 1
888 JAHDTS010000002.1 GCA024104875_00640 CDS open 153934-154806 _na     290_aa Allophanate hydrolase subunit 2
889 JAHDTS010000002.1 GCA024104875_00641 CDS open 154878-156365 _na     495_aa Drug transporter
890 JAHDTS010000002.1 GCA024104875_00642 CDS open 156433-157332 _na     299_aa TIGR01777 family protein
891 JAHDTS010000002.1 GCA024104875_00643 CDS open 157329-158231 _na     300_aa Membrane spanning protein
892 JAHDTS010000002.1 GCA024104875_00644 CDS open 158274-159122 _na     282_aa hypothetical protein
893 JAHDTS010000002.1 GCA024104875_00645 CDS open 159134-160672 _na     512_aa ptsG2 PTS system sugar-specific EII component
894 JAHDTS010000002.1 GCA024104875_00646 CDS open 160674-161390 _na     238_aa Putative N-acetylmannosamine-6-phosphate 2-epimerase
895 JAHDTS010000002.1 GCA024104875_00647 CDS open 161539-162075 _na     178_aa (d)CMP kinase
896 JAHDTS010000002.1 GCA024104875_00648 CDS open 162072-162947 _na     291_aa Adenine DNA glycosylase
897 JAHDTS010000002.1 GCA024104875_00649 CDS open 162961-164268 _na     435_aa hemL glutamate-1-semialdehyde 2%2C1-aminomutase
898 JAHDTS010000002.1 GCA024104875_00650 CDS open 164316-165362 _na     348_aa hemB porphobilinogen synthase
899 JAHDTS010000002.1 GCA024104875_00651 CDS open 165393-166118 _na     241_aa Uroporphyrinogen-III synthase
900 JAHDTS010000002.1 GCA024104875_00652 CDS open 166115-167128 _na     337_aa hemC hydroxymethylbilane synthase
901 JAHDTS010000002.1 GCA024104875_00653 CDS open 167164-168594 _na     476_aa hemY Putative protoporphyrinogen oxidase%2C HemY
902 JAHDTS010000002.1 GCA024104875_00654 CDS open 168618-169682 _na     354_aa hemE uroporphyrinogen decarboxylase
903 JAHDTS010000002.1 GCA024104875_00655 CDS open 169794-171143 _na     449_aa Glutamyl-tRNA reductase
904 JAHDTS010000002.1 GCA024104875_00656 CDS open 171140-173245 _na     701_aa hemQ hydrogen peroxide-dependent heme synthase
905 JAHDTS010000002.1 GCA024104875_00657 CDS open 173245-173961 _na     238_aa DUF11 domain-containing protein
906 JAHDTS010000002.1 GCA024104875_00658 CDS open 174039-175142 _na     367_aa disA DNA integrity scanning diadenylate cyclase DisA
907 JAHDTS010000002.1 GCA024104875_00659 CDS open 175192-176592 _na     466_aa radA DNA repair protein RadA
908 JAHDTS010000002.1 GCA024104875_00660 CDS open 176646-178292 _na     548_aa Malate oxidoreductase
909 JAHDTS010000002.1 GCA024104875_00661 CDS open 178356-178994 _na     212_aa Glyoxalase-like domain-containing protein
910 JAHDTS010000002.1 GCA024104875_00662 CDS open 179186-180040 _na     284_aa Xylose isomerase domain protein
911 JAHDTS010000002.1 GCA024104875_00663 CDS open 180037-180996 _na     319_aa Proline dehydrogenase
912 JAHDTS010000002.1 GCA024104875_00664 CDS open 180999-181832 _na     277_aa Abortive infection protein
913 JAHDTS010000002.1 GCA024104875_00665 CDS open 181877-182908 _na     343_aa aspartate-semialdehyde dehydrogenase
914 JAHDTS010000002.1 GCA024104875_00666 CDS open 182905-183696 _na     263_aa proC pyrroline-5-carboxylate reductase
915 JAHDTS010000002.1 GCA024104875_00667 CDS open 183832-183933 _na     33_aa 30S ribosomal protein bS22
916 JAHDTS010000002.1 GCA024104875_00668 CDS open 183952-184296 _na     114_aa Glutaredoxin family protein
917 JAHDTS010000002.1 GCA024104875_00669 CDS open 184420-186135 _na     571_aa hemD uroporphyrinogen-III C-methyltransferase
918 JAHDTS010000002.1 GCA024104875_00670 CDS open 186213-186881 _na     222_aa phoE Phosphoglycerate mutase
919 JAHDTS010000002.1 GCA024104875_00671 CDS open 186878-187447 _na     189_aa Thioredoxin family thiol:disulfide interchange protein
920 JAHDTS010000002.1 GCA024104875_00672 CDS open 187444-188205 _na     253_aa Cytochrome c biogenesis membrane protein
921 JAHDTS010000002.1 GCA024104875_00673 CDS open 188205-189806 _na     533_aa Cytochrome c biogenesis membrane protein
922 JAHDTS010000002.1 GCA024104875_00674 CDS open 189803-190696 _na     297_aa ccsB c-type cytochrome biogenesis protein CcsB
923 JAHDTS010000002.1 GCA024104875_00675 CDS open 190698-192146 _na     482_aa Sigma factor
924 JAHDTS010000002.1 GCA024104875_00676 CDS open 192150-192944 _na     264_aa Short-chain dehydrogenase/reductase SDR
925 JAHDTS010000002.1 GCA024104875_00677 CDS open 192968-194491 _na     507_aa ilvA threonine ammonia-lyase%2C biosynthetic
926 JAHDTS010000002.1 GCA024104875_00678 CDS open 194503-196380 _na     625_aa ilvD dihydroxy-acid dehydratase
927 JAHDTS010000002.1 GCA024104875_00679 CDS open 196572-197318 _na     248_aa DUF5134 domain-containing protein
928 JAHDTS010000002.1 GCA024104875_00680 CDS open 197594-198994 _na     466_aa mycothione reductase
929 JAHDTS010000002.1 GCA024104875_00681 CDS open 199107-200060 _na     317_aa restriction endonuclease
930 JAHDTS010000002.1 GCA024104875_00682 CDS open 200351-201121 _na     256_aa Methyltransferase domain-containing protein
931 JAHDTS010000002.1 GCA024104875_00683 CDS open 201118-201987 _na     289_aa ABC superfamily ATP binding cassette transporter%2C binding protein
932 JAHDTS010000002.1 GCA024104875_00684 CDS open 202149-202907 _na     252_aa Ferrichrome ABC superfamily ATP binding cassette transporter%2C ABC protein
933 JAHDTS010000002.1 GCA024104875_00685 CDS open 202904-203929 _na     341_aa Heme ABC superfamily ATP binding cassette transporter%2C membrane protein
934 JAHDTS010000002.1 GCA024104875_00686 CDS open 204378-205154 _na     258_aa pstB phosphate ABC transporter ATP-binding protein PstB
935 JAHDTS010000002.1 GCA024104875_00687 CDS open 205173-206105 _na     310_aa pstA phosphate ABC transporter permease PstA
936 JAHDTS010000002.1 GCA024104875_00688 CDS open 206102-207106 _na     334_aa pstC phosphate ABC transporter permease subunit PstC
937 JAHDTS010000002.1 GCA024104875_00689 CDS open 207214-208365 _na     383_aa pstS phosphate ABC transporter substrate-binding protein PstS
938 JAHDTS010000002.1 GCA024104875_00690 CDS open 208543-209484 _na     313_aa Nudix hydrolase domain-containing protein
939 JAHDTS010000002.1 GCA024104875_00691 CDS open 209491-211596 _na     701_aa ppk RNA degradosome polyphosphate kinase
940 JAHDTS010000002.1 GCA024104875_00692 CDS open 211739-212383 _na     214_aa ompR Transcriptional regulatory protein%2C C-terminal domain protein
941 JAHDTS010000002.1 GCA024104875_00693 CDS open 212494-213378 _na     294_aa F5/8 type C domain-containing protein
942 JAHDTS010000002.1 GCA024104875_00694 CDS open 213388-213825 _na     145_aa dtd D-aminoacyl-tRNA deacylase
943 JAHDTS010000002.1 GCA024104875_00695 CDS open 214019-214519 _na     166_aa Ferric nitrobindin-like protein
944 JAHDTS010000002.1 GCA024104875_00696 CDS open 214521-215465 _na     314_aa ygfZ Folate-binding protein YgfZ
945 JAHDTS010000002.1 GCA024104875_00697 CDS open 215506-216891 _na     461_aa wcaJ Exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase
946 JAHDTS010000002.1 GCA024104875_00698 CDS open 216923-217690 _na     255_aa ydfG Short-chain dehydrogenase/reductase family oxidoreductase
947 JAHDTS010000002.1 GCA024104875_00699 CDS open 217801-219474 _na     557_aa ptsA Phosphoenolpyruvate-protein phosphotransferase
948 JAHDTS010000002.1 GCA024104875_00700 CDS open 219480-219746 _na     88_aa ptsH HPr family phosphocarrier protein
949 JAHDTS010000002.1 GCA024104875_00701 CDS open 219843-220646 _na     267_aa 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase
950 JAHDTS010000002.1 GCA024104875_00702 CDS open 220643-221128 _na     161_aa 2-C-methyl-D-erythritol 2%2C4-cyclodiphosphate synthase
951 JAHDTS010000002.1 GCA024104875_00703 CDS open 221106-221501 _na     131_aa Protein-N(Pi)-phosphohistidine--sugar phosphotransferase
952 JAHDTS010000002.1 GCA024104875_00704 CDS open 221701-221997 _na     98_aa PTS family galactitol (Gat) porter component IIB
953 JAHDTS010000002.1 GCA024104875_00705 CDS open 222083-222568 _na     161_aa cdnL RNA polymerase-binding transcription factor CarD
954 JAHDTS010000002.1 GCA024104875_00706 CDS open 223124-223624 _na     166_aa Lipoprotein
955 JAHDTS010000002.1 GCA024104875_00707 CDS open 223697-224377 _na     226_aa ompR Sensory transduction protein RegX3
956 JAHDTS010000002.1 GCA024104875_00708 CDS open 224374-225555 _na     393_aa senX3 Sensor-like histidine kinase SenX3
957 JAHDTS010000002.1 GCA024104875_00709 CDS open 225716-226384 _na     222_aa phoU phosphate signaling complex protein PhoU
958 JAHDTS010000002.1 GCA024104875_00710 CDS open 226543-227607 _na     354_aa Polysaccharide deacetylase
959 JAHDTS010000002.1 GCA024104875_00711 CDS open 227698-228447 _na     249_aa gpmA phosphoglyceromutase
960 JAHDTS010000002.1 GCA024104875_00712 CDS open 228481-228945 _na     154_aa PTS family fructose/mannitol porter component IIA
961 JAHDTS010000002.1 GCA024104875_00713 CDS open 228938-229243 _na     101_aa PTS family galactitol (Gat) porter component IIB
962 JAHDTS010000002.1 GCA024104875_00714 CDS open 229447-230439 _na     330_aa ansA L-asparaginase I
963 JAHDTS010000002.1 GCA024104875_00715 CDS open 230443-231882 _na     479_aa L-asparagine permease
964 JAHDTS010000002.1 GCA024104875_00716 CDS open 232145-232270 _na     41_aa hypothetical protein
965 JAHDTS010000002.1 GCA024104875_00717 CDS open 232421-233896 _na     491_aa glyA glycine hydroxymethyltransferase
966 JAHDTS010000002.1 GCA024104875_00718 CDS open 234023-235123 _na     366_aa pfkB PfkB family carbohydrate kinase
967 JAHDTS010000002.1 GCA024104875_00719 CDS open 235458-235772 _na     104_aa hypothetical protein
968 JAHDTS010000002.1 GCA024104875_00720 CDS open 235868-236830 _na     320_aa rlmB 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
969 JAHDTS010000002.1 GCA024104875_00721 CDS open 236844-238274 _na     476_aa cysS cysteine--tRNA ligase
970 JAHDTS010000002.1 GCA024104875_00722 CDS open 238322-238570 _na     82_aa hypothetical protein
971 JAHDTS010000002.1 GCA024104875_00723 CDS open 238581-239978 _na     465_aa DUF4032 domain-containing protein
972 JAHDTS010000002.1 GCA024104875_00724 CDS open 240055-241224 _na     389_aa Cystathionine beta-lyase
973 JAHDTS010000002.1 GCA024104875_00725 CDS open 241374-241889 _na     171_aa Alkaline shock protein 23
974 JAHDTS010000002.1 GCA024104875_00726 CDS open 241901-242086 _na     61_aa DUF2273 domain-containing protein
975 JAHDTS010000002.1 GCA024104875_00727 CDS open 242086-242499 _na     137_aa yloU Asp23/Gls24 family envelope stress response protein
976 JAHDTS010000002.1 GCA024104875_00728 CDS open 242501-243055 _na     184_aa DUF6286 domain-containing protein
977 JAHDTS010000002.1 GCA024104875_00729 CDS open 243052-243768 _na     238_aa amaP alkaline shock response membrane anchor protein AmaP
978 JAHDTS010000002.1 GCA024104875_00730 CDS open 243829-244404 _na     191_aa RNA polymerase sigma factor
979 JAHDTS010000002.1 GCA024104875_00731 CDS open 244395-244919 _na     174_aa Asp23/Gls24 family envelope stress response protein
980 JAHDTS010000002.1 GCA024104875_00732 CDS open 244912-245268 _na     118_aa Asp23/Gls24 family envelope stress response protein
981 JAHDTS010000002.1 GCA024104875_00733 CDS open 245363-246463 _na     366_aa malK Sugar ABC superfamily ATP binding cassette transporter%2C ABC protein
982 JAHDTS010000002.1 GCA024104875_00734 CDS open 246734-246859 _na     41_aa hypothetical protein
983 JAHDTS010000002.1 GCA024104875_00735 CDS open 246844-246996 _na     50_aa hypothetical protein
984 JAHDTS010000002.1 GCA024104875_00736 CDS open 246993-247211 _na     72_aa hypothetical protein
985 JAHDTS010000002.1 GCA024104875_00737 CDS open 247408-248838 _na     476_aa sdaA L-serine ammonia-lyase
986 JAHDTS010000002.1 GCA024104875_00738 CDS open 249052-251397 _na     781_aa Oxidoreductase
987 JAHDTS010000002.1 GCA024104875_00739 CDS open 251423-252718 _na     431_aa Sugar ABC superfamily ATP binding cassette transporter%2C binding protein
988 JAHDTS010000002.1 GCA024104875_00740 CDS open 252718-253677 _na     319_aa ABC superfamily ATP binding cassette transporter%2C membrane protein
989 JAHDTS010000002.1 GCA024104875_00741 CDS open 253670-254563 _na     297_aa Sugar ABC superfamily ATP binding cassette transporter%2C membrane protein
990 JAHDTS010000002.1 GCA024104875_00742 CDS open 254670-255707 _na     345_aa tdh L-threonine 3-dehydrogenase
991 JAHDTS010000002.1 GCA024104875_00743 CDS open 255731-256933 _na     400_aa glycine C-acetyltransferase
992 JAHDTS010000002.1 GCA024104875_00744 CDS open 256957-257871 _na     304_aa Glycine betaine/L-proline ABC superfamily ATP binding cassette transporter%2C substrate-binding protein
993 JAHDTS010000002.1 GCA024104875_00745 CDS open 257894-258589 _na     231_aa Glycine betaine/L-proline ABC superfamily ATP binding cassette transporter%2C permease protein
994 JAHDTS010000002.1 GCA024104875_00746 CDS open 258586-259239 _na     217_aa Glycine betaine/L-proline ABC superfamily ATP binding cassette transporter%2C permease protein
995 JAHDTS010000002.1 GCA024104875_00747 CDS open 259236-260060 _na     274_aa Glycine betaine/L-proline ABC superfamily ATP binding cassette transporter%2C ABC protein
996 JAHDTS010000002.1 GCA024104875_00748 CDS open 260228-261019 _na     263_aa VTT domain-containing protein
997 JAHDTS010000002.1 GCA024104875_00749 CDS open 261035-261406 _na     123_aa DUF488 domain-containing protein
998 JAHDTS010000002.1 GCA024104875_00750 CDS open 261416-261946 _na     176_aa O-acetyl-ADP-ribose deacetylase
999 JAHDTS010000002.1 GCA024104875_00751 CDS open 262041-263057 _na     338_aa Alcohol dehydrogenase
1000 JAHDTS010000002.1 GCA024104875_00752 CDS open 263077-263664 _na     195_aa Phosphoglycerate mutase