BAKTAGenome Explorer: Cutibacterium avidum (GCA_024105015.1)
Select a Genome:
|
BAKTA Annotations for GCA_024105015.1
|
Search & Sort all 4880 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 4001 | JAHDTZ010000009.1 | GCA024105015_02315 | gene | open | 14947-15528 | |||
| 4002 | JAHDTZ010000009.1 | GCA024105015_02316 | gene | open | 15582-16235 | |||
| 4003 | JAHDTZ010000009.1 | GCA024105015_02317 | gene | open | 16330-17301 | pdxI | ||
| 4004 | JAHDTZ010000009.1 | GCA024105015_02318 | gene | open | 17326-18624 | gltA | ||
| 4005 | JAHDTZ010000009.1 | GCA024105015_02319 | gene | open | 18627-19991 | |||
| 4006 | JAHDTZ010000009.1 | GCA024105015_02321 | gene | open | 20537-21667 | |||
| 4007 | JAHDTZ010000009.1 | GCA024105015_02322 | gene | open | 21942-22157 | csbD | ||
| 4008 | JAHDTZ010000009.1 | GCA024105015_02323 | gene | open | 22177-22728 | |||
| 4009 | JAHDTZ010000009.1 | GCA024105015_02324 | gene | open | 22703-23842 | dprA | ||
| 4010 | JAHDTZ010000009.1 | GCA024105015_02325 | gene | open | 23839-24489 | |||
| 4011 | JAHDTZ010000009.1 | GCA024105015_02326 | gene | open | 24657-27470 | |||
| 4012 | JAHDTZ010000009.1 | GCA024105015_02327 | gene | open | 27471-28640 | |||
| 4013 | JAHDTZ010000009.1 | GCA024105015_02328 | gene | open | 29304-30482 | abiH | ||
| 4014 | JAHDTZ010000009.1 | GCA024105015_02329 | gene | open | 31128-31340 | |||
| 4015 | JAHDTZ010000009.1 | GCA024105015_02330 | gene | open | 31528-32277 | |||
| 4016 | JAHDTZ010000009.1 | GCA024105015_02331 | gene | open | 32274-33446 | immA | ||
| 4017 | JAHDTZ010000009.1 | GCA024105015_02332 | gene | open | 33585-35039 | |||
| 4018 | JAHDTZ010000009.1 | GCA024105015_02333 | gene | open | 35218-36072 | |||
| 4019 | JAHDTZ010000009.1 | GCA024105015_02334 | gene | open | 36089-37156 | |||
| 4020 | JAHDTZ010000009.1 | GCA024105015_02335 | gene | open | 37651-40347 | |||
| 4021 | JAHDTZ010000009.1 | GCA024105015_02336 | gene | open | 40651-41001 | |||
| 4022 | JAHDTZ010000009.1 | GCA024105015_02337 | gene | open | 41070-42065 | dprA | ||
| 4023 | JAHDTZ010000009.1 | GCA024105015_02338 | gene | open | 42138-45680 | mobF | ||
| 4024 | JAHDTZ010000009.1 | GCA024105015_02339 | gene | open | 46019-47671 | ccmA | ||
| 4025 | JAHDTZ010000009.1 | GCA024105015_02340 | gene | open | 47668-48912 | |||
| 4026 | JAHDTZ010000009.1 | GCA024105015_02341 | gene | open | 48912-49556 | |||
| 4027 | JAHDTZ010000009.1 | GCA024105015_02342 | gene | open | 49792-50877 | |||
| 4028 | JAHDTZ010000009.1 | GCA024105015_02343 | gene | open | 50874-51794 | |||
| 4029 | JAHDTZ010000009.1 | GCA024105015_02344 | gene | open | 51791-52627 | |||
| 4030 | JAHDTZ010000009.1 | GCA024105015_02345 | gene | open | 52624-53169 | |||
| 4031 | JAHDTZ010000009.1 | GCA024105015_02346 | gene | open | 53269-54162 | |||
| 4032 | JAHDTZ010000009.1 | GCA024105015_02347 | gene | open | 54159-55205 | parB | ||
| 4033 | JAHDTZ010000009.1 | GCA024105015_02348 | gene | open | 55236-55949 | lpqN | ||
| 4034 | JAHDTZ010000009.1 | GCA024105015_02349 | gene | open | 55957-57573 | nlpD | ||
| 4035 | JAHDTZ010000009.1 | GCA024105015_02350 | gene | open | 57579-57845 | |||
| 4036 | JAHDTZ010000009.1 | GCA024105015_02351 | gene | open | 57846-58901 | |||
| 4037 | JAHDTZ010000009.1 | GCA024105015_02352 | gene | open | 59098-59421 | |||
| 4038 | JAHDTZ010000009.1 | GCA024105015_02353 | gene | open | 59467-61032 | trbL | ||
| 4039 | JAHDTZ010000009.1 | GCA024105015_02354 | gene | open | 61029-62516 | prgI | ||
| 4040 | JAHDTZ010000009.1 | GCA024105015_02355 | gene | open | 62499-63284 | |||
| 4041 | JAHDTZ010000009.1 | GCA024105015_02356 | gene | open | 63400-64188 | |||
| 4042 | JAHDTZ010000009.1 | GCA024105015_02357 | gene | open | 64131-65669 | virB4 | ||
| 4043 | JAHDTZ010000009.1 | GCA024105015_02358 | gene | open | 65669-66205 | |||
| 4044 | JAHDTZ010000009.1 | GCA024105015_02359 | gene | open | 66202-67983 | virD4 | ||
| 4045 | JAHDTZ010000009.1 | GCA024105015_02360 | gene | open | 68068-68517 | ssb | ||
| 4046 | JAHDTZ010000009.1 | GCA024105015_02361 | gene | open | 68533-69102 | |||
| 4047 | JAHDTZ010000009.1 | GCA024105015_02362 | gene | open | 69099-69356 | |||
| 4048 | JAHDTZ010000009.1 | GCA024105015_02363 | gene | open | 69270-70910 | |||
| 4049 | JAHDTZ010000009.1 | GCA024105015_02364 | gene | open | 70925-71866 | |||
| 4050 | JAHDTZ010000009.1 | GCA024105015_02365 | gene | open | 71863-72285 | yraN | ||
| 4051 | JAHDTZ010000009.1 | GCA024105015_02366 | gene | open | 72397-72708 | |||
| 4052 | JAHDTZ010000009.1 | GCA024105015_02367 | gene | open | 72705-73352 | |||
| 4053 | JAHDTZ010000009.1 | GCA024105015_02368 | gene | open | 73360-74190 | lepB | ||
| 4054 | JAHDTZ010000009.1 | GCA024105015_02369 | gene | open | 74366-74719 | rplS | ||
| 4055 | JAHDTZ010000009.1 | GCA024105015_02370 | gene | open | 74964-75737 | sdhB | ||
| 4056 | JAHDTZ010000009.1 | GCA024105015_02371 | gene | open | 75734-77761 | sdhA | ||
| 4057 | JAHDTZ010000009.1 | GCA024105015_02372 | gene | open | 77761-78411 | |||
| 4058 | JAHDTZ010000009.1 | GCA024105015_02373 | gene | open | 78644-79342 | trmD | ||
| 4059 | JAHDTZ010000009.1 | GCA024105015_02374 | gene | open | 79345-79884 | rimM | ||
| 4060 | JAHDTZ010000009.1 | GCA024105015_02375 | gene | open | 80024-80302 | ylqC | ||
| 4061 | JAHDTZ010000009.1 | GCA024105015_02376 | gene | open | 80305-80748 | rpsP | ||
| 4062 | JAHDTZ010000009.1 | GCA024105015_02377 | gene | open | 80940-82103 | |||
| 4063 | JAHDTZ010000009.1 | GCA024105015_02378 | gene | open | 82179-83765 | ffh | ||
| 4064 | JAHDTZ010000009.1 | GCA024105015_02379 | gene | open | 83841-85022 | |||
| 4065 | JAHDTZ010000009.1 | GCA024105015_02380 | gene | open | 85034-86221 | ftsY | ||
| 4066 | JAHDTZ010000009.1 | GCA024105015_02381 | gene | open | 86501-87175 | |||
| 4067 | JAHDTZ010000009.1 | GCA024105015_02382 | gene | open | 87809-88609 | |||
| 4068 | JAHDTZ010000009.1 | GCA024105015_02383 | gene | open | 88637-89452 | mutM | ||
| 4069 | JAHDTZ010000009.1 | GCA024105015_02384 | gene | open | 89472-90251 | rnc | ||
| 4070 | JAHDTZ010000009.1 | GCA024105015_02385 | gene | open | 90220-90444 | rpmF | ||
| 4071 | JAHDTZ010000009.1 | GCA024105015_02386 | gene | open | 90477-91037 | |||
| 4072 | JAHDTZ010000009.1 | GCA024105015_02387 | gene | open | 91252-92562 | |||
| 4073 | JAHDTZ010000009.1 | GCA024105015_02388 | gene | open | 92645-93601 | |||
| 4074 | JAHDTZ010000009.1 | GCA024105015_02389 | gene | open | 93598-94494 | ugpE | ||
| 4075 | JAHDTZ010000009.1 | GCA024105015_02390 | gene | open | 94589-95596 | |||
| 4076 | JAHDTZ010000009.1 | GCA024105015_02391 | gene | open | 95806-98133 | |||
| 4077 | JAHDTZ010000009.1 | GCA024105015_02392 | gene | open | 98213-101296 | |||
| 4078 | JAHDTZ010000009.1 | GCA024105015_02393 | gene | open | 101293-102519 | |||
| 4079 | JAHDTZ010000009.1 | GCA024105015_02394 | gene | open | 102585-103061 | coaD | ||
| 4080 | JAHDTZ010000009.1 | GCA024105015_02395 | gene | open | 103058-103651 | rsmD | ||
| 4081 | JAHDTZ010000009.1 | GCA024105015_02396 | gene | open | 103827-104249 | nimA | ||
| 4082 | JAHDTZ010000009.1 | GCA024105015_02397 | gene | open | 104313-106574 | recG | ||
| 4083 | JAHDTZ010000009.1 | GCA024105015_02398 | gene | open | 106625-106810 | rpmB | ||
| 4084 | JAHDTZ010000009.1 | GCA024105015_02399 | gene | open | 107005-109470 | |||
| 4085 | JAHDTZ010000009.1 | GCA024105015_02400 | gene | open | 109442-110617 | metK | ||
| 4086 | JAHDTZ010000009.1 | GCA024105015_02401 | gene | open | 110702-111274 | |||
| 4087 | JAHDTZ010000009.1 | GCA024105015_02402 | gene | open | 111382-111867 | |||
| 4088 | JAHDTZ010000009.1 | GCA024105015_02403 | gene | open | 111851-112327 | |||
| 4089 | JAHDTZ010000009.1 | GCA024105015_02404 | gene | open | 112320-113891 | |||
| 4090 | JAHDTZ010000009.1 | GCA024105015_02405 | gene | open | 113899-114297 | |||
| 4091 | JAHDTZ010000009.1 | GCA024105015_02406 | gene | open | 114704-115081 | yajD | ||
| 4092 | JAHDTZ010000009.1 | GCA024105015_02407 | gene | open | 115239-115700 | |||
| 4093 | JAHDTZ010000009.1 | GCA024105015_02408 | gene | open | 115691-117067 | hepA | ||
| 4094 | JAHDTZ010000009.1 | GCA024105015_02409 | gene | open | 117048-117326 | |||
| 4095 | JAHDTZ010000009.1 | GCA024105015_02410 | gene | open | 117460-119718 | |||
| 4096 | JAHDTZ010000009.1 | GCA024105015_02411 | gene | open | 119715-120152 | |||
| 4097 | JAHDTZ010000009.1 | GCA024105015_02412 | gene | open | 120149-120913 | |||
| 4098 | JAHDTZ010000009.1 | GCA024105015_02413 | gene | open | 121305-122279 | |||
| 4099 | JAHDTZ010000009.1 | GCA024105015_02414 | gene | open | 122293-123411 | |||
| 4100 | JAHDTZ010000009.1 | GCA024105015_02415 | gene | open | 123363-124262 | |||
| 4101 | JAHDTZ010000009.1 | GCA024105015_02416 | gene | open | 124335-124523 | |||
| 4102 | JAHDTZ010000009.1 | GCA024105015_02417 | gene | open | 124537-125091 | |||
| 4103 | JAHDTZ010000009.1 | GCA024105015_02418 | gene | open | 125113-126252 | |||
| 4104 | JAHDTZ010000009.1 | GCA024105015_02419 | gene | open | 126245-126652 | |||
| 4105 | JAHDTZ010000009.1 | GCA024105015_02420 | gene | open | 126649-126894 | |||
| 4106 | JAHDTZ010000009.1 | GCA024105015_02421 | gene | open | 126961-127632 | |||
| 4107 | JAHDTZ010000009.1 | GCA024105015_02422 | gene | open | 127796-127933 | |||
| 4108 | JAHDTZ010000009.1 | GCA024105015_02423 | gene | open | 128129-129259 | |||
| 4109 | JAHDTZ010000009.1 | GCA024105015_02424 | gene | open | 129256-129483 | |||
| 4110 | JAHDTZ010000009.1 | GCA024105015_02425 | gene | open | 129473-131194 | |||
| 4111 | JAHDTZ010000009.1 | GCA024105015_02426 | gene | open | 131191-131427 | |||
| 4112 | JAHDTZ010000009.1 | GCA024105015_02427 | gene | open | 131468-133426 | |||
| 4113 | JAHDTZ010000009.1 | GCA024105015_02428 | gene | open | 133442-136408 | |||
| 4114 | JAHDTZ010000009.1 | GCA024105015_02429 | gene | open | 136420-139272 | hepA | ||
| 4115 | JAHDTZ010000009.1 | GCA024105015_02430 | gene | open | 139303-140316 | |||
| 4116 | JAHDTZ010000009.1 | GCA024105015_02431 | gene | open | 140515-143520 | |||
| 4117 | JAHDTZ010000009.1 | GCA024105015_02320 | gene | open | 20131-20216 | trnL | ||
| 4118 | JAHDTZ010000009.1 | GCA024105015_02320 | tRNA | open | 20131-20216 | trnL | tRNA-Leu(gag) | |
| 4119 | JAHDTZ010000010.1 | repeat_region | open | 73822-76359 | CRISPR array with 42 repeats of length 28%2C consensus sequence GGCTCACCCCCGCGTAGGCGGGGAAGAC and spacer length 32 | |||
| 4120 | JAHDTZ010000010.1 | GCA024105015_00001 | CDS | open | 846-2339 | _na 497_aa | PTS system fructose-specific IIBC component | |
| 4121 | JAHDTZ010000010.1 | GCA024105015_00002 | CDS | open | 2376-2837 | _na 153_aa | PTS system fructose/mannitol specific IIA subunit | |
| 4122 | JAHDTZ010000010.1 | GCA024105015_00003 | CDS | open | 3026-3409 | _na 127_aa | Rhodanese domain-containing protein | |
| 4123 | JAHDTZ010000010.1 | GCA024105015_00004 | CDS | open | 3551-8845 | _na 1764_aa | Peptidase S8 and S53 subtilisin kexin sedolisin | |
| 4124 | JAHDTZ010000010.1 | GCA024105015_00005 | CDS | open | 9444-9734 | _na 96_aa | rpsF | 30S ribosomal protein S6 |
| 4125 | JAHDTZ010000010.1 | GCA024105015_00006 | CDS | open | 9849-10439 | _na 196_aa | ssb | Single-stranded DNA-binding protein |
| 4126 | JAHDTZ010000010.1 | GCA024105015_00007 | CDS | open | 10585-10824 | _na 79_aa | rpsR | 30S ribosomal protein S18 |
| 4127 | JAHDTZ010000010.1 | GCA024105015_00008 | CDS | open | 10839-11288 | _na 149_aa | rplI | 50S ribosomal protein L9 |
| 4128 | JAHDTZ010000010.1 | GCA024105015_00009 | CDS | open | 11424-12791 | _na 455_aa | Dicarboxylate MFS family major facilitator transporter | |
| 4129 | JAHDTZ010000010.1 | GCA024105015_00010 | CDS | open | 12922-13596 | _na 224_aa | 2'-5' RNA ligase | |
| 4130 | JAHDTZ010000010.1 | GCA024105015_00011 | CDS | open | 13867-14385 | _na 172_aa | ftnA | Ferritin |
| 4131 | JAHDTZ010000010.1 | GCA024105015_00012 | CDS | open | 14660-15514 | _na 284_aa | uppP | undecaprenyl-diphosphate phosphatase |
| 4132 | JAHDTZ010000010.1 | GCA024105015_00013 | CDS | open | 15604-16380 | _na 258_aa | Siderophore-interacting protein | |
| 4133 | JAHDTZ010000010.1 | GCA024105015_00014 | CDS | open | 16871-17821 | _na 316_aa | Manganese/zinc/iron ABC superfamily ATP binding cassette transporter%2C membrane protein | |
| 4134 | JAHDTZ010000010.1 | GCA024105015_00015 | CDS | open | 17823-18764 | _na 313_aa | Mn2+%2C Zn2+ ABC superfamily ATP binding cassette transporter%2C membrane protein | |
| 4135 | JAHDTZ010000010.1 | GCA024105015_00016 | CDS | open | 18761-19510 | _na 249_aa | Iron ABC superfamily ATP binding cassette transporter%2C ABC protein | |
| 4136 | JAHDTZ010000010.1 | GCA024105015_00017 | CDS | open | 19567-20517 | _na 316_aa | Zn2+ ABC superfamily ATP binding cassette transporter%2C binding protein | |
| 4137 | JAHDTZ010000010.1 | GCA024105015_00018 | CDS | open | 20709-21440 | _na 243_aa | aat | leucyl/phenylalanyl-tRNA--protein transferase |
| 4138 | JAHDTZ010000010.1 | GCA024105015_00019 | CDS | open | 21485-22414 | _na 309_aa | pheA | prephenate dehydratase |
| 4139 | JAHDTZ010000010.1 | GCA024105015_00020 | CDS | open | 22609-23532 | _na 307_aa | DUF2382 domain-containing protein | |
| 4140 | JAHDTZ010000010.1 | GCA024105015_00021 | CDS | open | 23664-24938 | _na 424_aa | serS | serine--tRNA ligase |
| 4141 | JAHDTZ010000010.1 | GCA024105015_00022 | CDS | open | 24935-26260 | _na 441_aa | UTP-hexose-1-phosphate uridylyltransferase | |
| 4142 | JAHDTZ010000010.1 | GCA024105015_00023 | CDS | open | 26313-27086 | _na 257_aa | HAD family hydrolase | |
| 4143 | JAHDTZ010000010.1 | GCA024105015_00024 | CDS | open | 27143-27709 | _na 188_aa | whiB | Transcription regulator WhiB superfamily protein |
| 4144 | JAHDTZ010000010.1 | GCA024105015_00025 | CDS | open | 28075-30228 | _na 717_aa | Na+/H+ antiporter | |
| 4145 | JAHDTZ010000010.1 | GCA024105015_00026 | CDS | open | 30305-31519 | _na 404_aa | Membrane protein%2C putative permease | |
| 4146 | JAHDTZ010000010.1 | GCA024105015_00027 | CDS | open | 31620-32084 | _na 154_aa | DUF4282 domain-containing protein | |
| 4147 | JAHDTZ010000010.1 | GCA024105015_00028 | CDS | open | 32211-33629 | _na 472_aa | argG | argininosuccinate synthase |
| 4148 | JAHDTZ010000010.1 | GCA024105015_00029 | CDS | open | 33897-34898 | _na 333_aa | qor | NADPH:quinone reductase |
| 4149 | JAHDTZ010000010.1 | GCA024105015_00030 | CDS | open | 35040-35693 | _na 217_aa | hypothetical protein | |
| 4150 | JAHDTZ010000010.1 | GCA024105015_00031 | CDS | open | 35681-36592 | _na 303_aa | ATP/GTP-binding protein | |
| 4151 | JAHDTZ010000010.1 | GCA024105015_00033 | CDS | open | 36919-37404 | _na 161_aa | PH domain-containing protein | |
| 4152 | JAHDTZ010000010.1 | GCA024105015_00034 | CDS | open | 37663-37935 | _na 90_aa | DUF3188 domain-containing protein | |
| 4153 | JAHDTZ010000010.1 | GCA024105015_00035 | CDS | open | 37946-39655 | _na 569_aa | putP | Transporter%2C SSS family |
| 4154 | JAHDTZ010000010.1 | GCA024105015_00036 | CDS | open | 39885-41120 | _na 411_aa | galK | galactokinase |
| 4155 | JAHDTZ010000010.1 | GCA024105015_00037 | CDS | open | 41218-42234 | _na 338_aa | lacI | LacI family transcriptional regulator |
| 4156 | JAHDTZ010000010.1 | GCA024105015_00038 | CDS | open | 42330-44177 | _na 615_aa | Cell envelope-related transcriptional attenuator domain-containing protein | |
| 4157 | JAHDTZ010000010.1 | GCA024105015_00041 | CDS | open | 44897-45100 | _na 67_aa | Cardiolipin synthase N-terminal domain-containing protein | |
| 4158 | JAHDTZ010000010.1 | GCA024105015_00042 | CDS | open | 45163-45888 | _na 241_aa | Glycerophosphodiester phosphodiesterase | |
| 4159 | JAHDTZ010000010.1 | GCA024105015_00043 | CDS | open | 46001-46714 | _na 237_aa | Glutamine amidotransferase/GMP synthase | |
| 4160 | JAHDTZ010000010.1 | GCA024105015_00044 | CDS | open | 46769-48697 | _na 642_aa | putative potassium transport system protein Kup | |
| 4161 | JAHDTZ010000010.1 | GCA024105015_00045 | CDS | open | 48868-50763 | _na 631_aa | 1%2C4-alpha-glucan branching enzyme | |
| 4162 | JAHDTZ010000010.1 | GCA024105015_00046 | CDS | open | 50862-51383 | _na 173_aa | YbaK/aminoacyl-tRNA synthetase-associated domain-containing protein | |
| 4163 | JAHDTZ010000010.1 | GCA024105015_00047 | CDS | open | 51440-52183 | _na 247_aa | MaoC/PaaZ C-terminal domain-containing protein | |
| 4164 | JAHDTZ010000010.1 | GCA024105015_00048 | CDS | open | 52180-53034 | _na 284_aa | Uracil phosphoribosyltransferase | |
| 4165 | JAHDTZ010000010.1 | GCA024105015_00049 | CDS | open | 53145-53759 | _na 204_aa | tRNA adenosine deaminase-associated protein | |
| 4166 | JAHDTZ010000010.1 | GCA024105015_00050 | CDS | open | 53775-54245 | _na 156_aa | tRNA-specific adenosine deaminase | |
| 4167 | JAHDTZ010000010.1 | GCA024105015_00051 | CDS | open | 54329-55669 | _na 446_aa | rfbX | RfbX family protein involved in the export of O-antigen and teichoic acid |
| 4168 | JAHDTZ010000010.1 | GCA024105015_00053 | CDS | open | 56066-57568 | _na 500_aa | potassium/proton antiporter | |
| 4169 | JAHDTZ010000010.1 | GCA024105015_00054 | CDS | open | 57701-58255 | _na 184_aa | LytR/CpsA/Psr regulator C-terminal domain-containing protein | |
| 4170 | JAHDTZ010000010.1 | GCA024105015_00055 | CDS | open | 58265-58558 | _na 97_aa | vapB6 | Type II toxin-antitoxin system VapB family antitoxin |
| 4171 | JAHDTZ010000010.1 | GCA024105015_00056 | CDS | open | 58731-59900 | _na 389_aa | cysteine-S-conjugate beta-lyase | |
| 4172 | JAHDTZ010000010.1 | GCA024105015_00057 | CDS | open | 60101-60979 | _na 292_aa | PRC-barrel domain-containing protein | |
| 4173 | JAHDTZ010000010.1 | GCA024105015_00058 | CDS | open | 61090-62133 | _na 347_aa | rlpA | putative endolytic peptidoglycan transglycosylase RlpA |
| 4174 | JAHDTZ010000010.1 | GCA024105015_00059 | CDS | open | 62427-63674 | _na 415_aa | Prolyl aminopeptidase | |
| 4175 | JAHDTZ010000010.1 | GCA024105015_00060 | CDS | open | 63986-64615 | _na 209_aa | Maltose O-acetyltransferase | |
| 4176 | JAHDTZ010000010.1 | GCA024105015_00061 | CDS | open | 64612-65337 | _na 241_aa | hypothetical protein | |
| 4177 | JAHDTZ010000010.1 | GCA024105015_00062 | CDS | open | 65389-67989 | _na 866_aa | ABC transporter | |
| 4178 | JAHDTZ010000010.1 | GCA024105015_00063 | CDS | open | 67996-68784 | _na 262_aa | ABC superfamily ATP binding cassette transporter%2C ABC protein | |
| 4179 | JAHDTZ010000010.1 | GCA024105015_00064 | CDS | open | 68824-68973 | _na 49_aa | hypothetical protein | |
| 4180 | JAHDTZ010000010.1 | GCA024105015_00065 | CDS | open | 68958-69578 | _na 206_aa | Lipoprotein | |
| 4181 | JAHDTZ010000010.1 | GCA024105015_00066 | CDS | open | 69859-70578 | _na 239_aa | hypothetical protein | |
| 4182 | JAHDTZ010000010.1 | GCA024105015_00067 | CDS | open | 70722-71288 | _na 188_aa | hypothetical protein | |
| 4183 | JAHDTZ010000010.1 | GCA024105015_00068 | CDS | open | 71386-72033 | _na 215_aa | hypothetical protein | |
| 4184 | JAHDTZ010000010.1 | GCA024105015_00069 | CDS | open | 72214-72438 | _na 74_aa | hypothetical protein | |
| 4185 | JAHDTZ010000010.1 | GCA024105015_00070 | CDS | open | 72664-72966 | _na 100_aa | hypothetical protein | |
| 4186 | JAHDTZ010000010.1 | GCA024105015_00071 | CDS | open | 73009-73323 | _na 104_aa | hypothetical protein | |
| 4187 | JAHDTZ010000010.1 | GCA024105015_00072 | CDS | open | 76404-76760 | _na 118_aa | cas2e | type I-E CRISPR-associated endoribonuclease Cas2e |
| 4188 | JAHDTZ010000010.1 | GCA024105015_00073 | CDS | open | 76751-77689 | _na 312_aa | cas1e | type I-E CRISPR-associated endonuclease Cas1e |
| 4189 | JAHDTZ010000010.1 | GCA024105015_00074 | CDS | open | 77693-78358 | _na 221_aa | cas6e | type I-E CRISPR-associated protein Cas6/Cse3/CasE |
| 4190 | JAHDTZ010000010.1 | GCA024105015_00075 | CDS | open | 78358-79065 | _na 235_aa | cas5e | type I-E CRISPR-associated protein Cas5/CasD |
| 4191 | JAHDTZ010000010.1 | GCA024105015_00076 | CDS | open | 79062-80186 | _na 374_aa | cas7e | type I-E CRISPR-associated protein Cas7/Cse4/CasC |
| 4192 | JAHDTZ010000010.1 | GCA024105015_00077 | CDS | open | 80183-80812 | _na 209_aa | casB | type I-E CRISPR-associated protein Cse2/CasB |
| 4193 | JAHDTZ010000010.1 | GCA024105015_00078 | CDS | open | 80812-82470 | _na 552_aa | casA | type I-E CRISPR-associated protein Cse1/CasA |
| 4194 | JAHDTZ010000010.1 | GCA024105015_00079 | CDS | open | 82467-85259 | _na 930_aa | CRISPR-associated helicase cas3 | |
| 4195 | JAHDTZ010000010.1 | GCA024105015_00080 | CDS | open | 85483-87018 | _na 511_aa | hutH | histidine ammonia-lyase |
| 4196 | JAHDTZ010000010.1 | GCA024105015_00081 | CDS | open | 87153-88343 | _na 396_aa | hutI | imidazolonepropionase |
| 4197 | JAHDTZ010000010.1 | GCA024105015_00082 | CDS | open | 88340-89680 | _na 446_aa | formimidoylglutamate deiminase | |
| 4198 | JAHDTZ010000010.1 | GCA024105015_00083 | CDS | open | 89677-90879 | _na 400_aa | allantoate amidohydrolase | |
| 4199 | JAHDTZ010000010.1 | GCA024105015_00084 | CDS | open | 90879-92885 | _na 668_aa | urocanate hydratase | |
| 4200 | JAHDTZ010000010.1 | GCA024105015_00085 | CDS | open | 93073-93687 | _na 204_aa | nucleoside/nucleotide kinase family protein | |
| 4201 | JAHDTZ010000010.1 | GCA024105015_00086 | CDS | open | 93715-94080 | _na 121_aa | fkpA | Peptidyl-prolyl cis-trans isomerase |
| 4202 | JAHDTZ010000010.1 | GCA024105015_00087 | CDS | open | 94163-94333 | _na 56_aa | rpmF | 50S ribosomal protein L32 |
| 4203 | JAHDTZ010000010.1 | GCA024105015_00088 | CDS | open | 94338-94643 | _na 101_aa | rpsN | 30S ribosomal protein S14 |
| 4204 | JAHDTZ010000010.1 | GCA024105015_00089 | CDS | open | 94643-94879 | _na 78_aa | rpmB | 50S ribosomal protein L28 |
| 4205 | JAHDTZ010000010.1 | GCA024105015_00090 | CDS | open | 94989-95234 | _na 81_aa | rpmE2 | type B 50S ribosomal protein L31 |
| 4206 | JAHDTZ010000010.1 | GCA024105015_00091 | CDS | open | 95501-96265 | _na 254_aa | UPF0246 protein HMPREF9153_0829 | |
| 4207 | JAHDTZ010000010.1 | GCA024105015_00092 | CDS | open | 96601-97680 | _na 359_aa | Oligopeptide ABC superfamily ATP binding cassette transporter%2C ABC protein | |
| 4208 | JAHDTZ010000010.1 | GCA024105015_00093 | CDS | open | 97670-98707 | _na 345_aa | dppD | Oligopeptide ABC superfamily ATP binding cassette transporter%2C ABC protein |
| 4209 | JAHDTZ010000010.1 | GCA024105015_00094 | CDS | open | 98717-99700 | _na 327_aa | dppC | ABC transporter permease |
| 4210 | JAHDTZ010000010.1 | GCA024105015_00095 | CDS | open | 99693-100616 | _na 307_aa | dppB | Dipeptide ABC superfamily ATP binding cassette transporter%2C permease protein |
| 4211 | JAHDTZ010000010.1 | GCA024105015_00096 | CDS | open | 100688-102355 | _na 555_aa | Oligopeptide ABC superfamily ATP binding cassette transporter%2C binding protein | |
| 4212 | JAHDTZ010000010.1 | GCA024105015_00097 | CDS | open | 102653-103192 | _na 179_aa | pfpI | PfpI family intracellular protease |
| 4213 | JAHDTZ010000010.1 | GCA024105015_00099 | CDS | open | 103675-104577 | _na 300_aa | Ser/Thr protein phosphatase | |
| 4214 | JAHDTZ010000010.1 | GCA024105015_00100 | CDS | open | 104579-107059 | _na 826_aa | peptidoglycan glycosyltransferase | |
| 4215 | JAHDTZ010000010.1 | GCA024105015_00101 | CDS | open | 107385-108659 | _na 424_aa | metL1 | aspartate kinase |
| 4216 | JAHDTZ010000010.1 | GCA024105015_00102 | CDS | open | 108667-110487 | _na 606_aa | murJ | murein biosynthesis integral membrane protein MurJ |
| 4217 | JAHDTZ010000010.1 | GCA024105015_00103 | CDS | open | 110573-112132 | _na 519_aa | Polysaccharide deacetylase domain protein | |
| 4218 | JAHDTZ010000010.1 | GCA024105015_00104 | CDS | open | 112288-113220 | _na 310_aa | Permease | |
| 4219 | JAHDTZ010000010.1 | GCA024105015_00105 | CDS | open | 113217-114083 | _na 288_aa | TIGR03943 family putative permease subunit | |
| 4220 | JAHDTZ010000010.1 | GCA024105015_00106 | CDS | open | 114080-115573 | _na 497_aa | NodB-like y domain-containing protein | |
| 4221 | JAHDTZ010000010.1 | GCA024105015_00107 | CDS | open | 115763-116887 | _na 374_aa | Lysophospholipase | |
| 4222 | JAHDTZ010000010.1 | GCA024105015_00108 | CDS | open | 117215-117511 | _na 98_aa | hypothetical protein | |
| 4223 | JAHDTZ010000010.1 | GCA024105015_00001 | gene | open | 846-2339 | |||
| 4224 | JAHDTZ010000010.1 | GCA024105015_00002 | gene | open | 2376-2837 | |||
| 4225 | JAHDTZ010000010.1 | GCA024105015_00003 | gene | open | 3026-3409 | |||
| 4226 | JAHDTZ010000010.1 | GCA024105015_00004 | gene | open | 3551-8845 | |||
| 4227 | JAHDTZ010000010.1 | GCA024105015_00005 | gene | open | 9444-9734 | rpsF | ||
| 4228 | JAHDTZ010000010.1 | GCA024105015_00006 | gene | open | 9849-10439 | ssb | ||
| 4229 | JAHDTZ010000010.1 | GCA024105015_00007 | gene | open | 10585-10824 | rpsR | ||
| 4230 | JAHDTZ010000010.1 | GCA024105015_00008 | gene | open | 10839-11288 | rplI | ||
| 4231 | JAHDTZ010000010.1 | GCA024105015_00009 | gene | open | 11424-12791 | |||
| 4232 | JAHDTZ010000010.1 | GCA024105015_00010 | gene | open | 12922-13596 | |||
| 4233 | JAHDTZ010000010.1 | GCA024105015_00011 | gene | open | 13867-14385 | ftnA | ||
| 4234 | JAHDTZ010000010.1 | GCA024105015_00012 | gene | open | 14660-15514 | uppP | ||
| 4235 | JAHDTZ010000010.1 | GCA024105015_00013 | gene | open | 15604-16380 | |||
| 4236 | JAHDTZ010000010.1 | GCA024105015_00014 | gene | open | 16871-17821 | |||
| 4237 | JAHDTZ010000010.1 | GCA024105015_00015 | gene | open | 17823-18764 | |||
| 4238 | JAHDTZ010000010.1 | GCA024105015_00016 | gene | open | 18761-19510 | |||
| 4239 | JAHDTZ010000010.1 | GCA024105015_00017 | gene | open | 19567-20517 | |||
| 4240 | JAHDTZ010000010.1 | GCA024105015_00018 | gene | open | 20709-21440 | aat | ||
| 4241 | JAHDTZ010000010.1 | GCA024105015_00019 | gene | open | 21485-22414 | pheA | ||
| 4242 | JAHDTZ010000010.1 | GCA024105015_00020 | gene | open | 22609-23532 | |||
| 4243 | JAHDTZ010000010.1 | GCA024105015_00021 | gene | open | 23664-24938 | serS | ||
| 4244 | JAHDTZ010000010.1 | GCA024105015_00022 | gene | open | 24935-26260 | |||
| 4245 | JAHDTZ010000010.1 | GCA024105015_00023 | gene | open | 26313-27086 | |||
| 4246 | JAHDTZ010000010.1 | GCA024105015_00024 | gene | open | 27143-27709 | whiB | ||
| 4247 | JAHDTZ010000010.1 | GCA024105015_00025 | gene | open | 28075-30228 | |||
| 4248 | JAHDTZ010000010.1 | GCA024105015_00026 | gene | open | 30305-31519 | |||
| 4249 | JAHDTZ010000010.1 | GCA024105015_00027 | gene | open | 31620-32084 | |||
| 4250 | JAHDTZ010000010.1 | GCA024105015_00028 | gene | open | 32211-33629 | argG | ||
| 4251 | JAHDTZ010000010.1 | GCA024105015_00029 | gene | open | 33897-34898 | qor | ||
| 4252 | JAHDTZ010000010.1 | GCA024105015_00030 | gene | open | 35040-35693 | |||
| 4253 | JAHDTZ010000010.1 | GCA024105015_00031 | gene | open | 35681-36592 | |||
| 4254 | JAHDTZ010000010.1 | GCA024105015_00033 | gene | open | 36919-37404 | |||
| 4255 | JAHDTZ010000010.1 | GCA024105015_00034 | gene | open | 37663-37935 | |||
| 4256 | JAHDTZ010000010.1 | GCA024105015_00035 | gene | open | 37946-39655 | putP | ||
| 4257 | JAHDTZ010000010.1 | GCA024105015_00036 | gene | open | 39885-41120 | galK | ||
| 4258 | JAHDTZ010000010.1 | GCA024105015_00037 | gene | open | 41218-42234 | lacI | ||
| 4259 | JAHDTZ010000010.1 | GCA024105015_00038 | gene | open | 42330-44177 | |||
| 4260 | JAHDTZ010000010.1 | GCA024105015_00041 | gene | open | 44897-45100 | |||
| 4261 | JAHDTZ010000010.1 | GCA024105015_00042 | gene | open | 45163-45888 | |||
| 4262 | JAHDTZ010000010.1 | GCA024105015_00043 | gene | open | 46001-46714 | |||
| 4263 | JAHDTZ010000010.1 | GCA024105015_00044 | gene | open | 46769-48697 | |||
| 4264 | JAHDTZ010000010.1 | GCA024105015_00045 | gene | open | 48868-50763 | |||
| 4265 | JAHDTZ010000010.1 | GCA024105015_00046 | gene | open | 50862-51383 | |||
| 4266 | JAHDTZ010000010.1 | GCA024105015_00047 | gene | open | 51440-52183 | |||
| 4267 | JAHDTZ010000010.1 | GCA024105015_00048 | gene | open | 52180-53034 | |||
| 4268 | JAHDTZ010000010.1 | GCA024105015_00049 | gene | open | 53145-53759 | |||
| 4269 | JAHDTZ010000010.1 | GCA024105015_00050 | gene | open | 53775-54245 | |||
| 4270 | JAHDTZ010000010.1 | GCA024105015_00051 | gene | open | 54329-55669 | rfbX | ||
| 4271 | JAHDTZ010000010.1 | GCA024105015_00053 | gene | open | 56066-57568 | |||
| 4272 | JAHDTZ010000010.1 | GCA024105015_00054 | gene | open | 57701-58255 | |||
| 4273 | JAHDTZ010000010.1 | GCA024105015_00055 | gene | open | 58265-58558 | vapB6 | ||
| 4274 | JAHDTZ010000010.1 | GCA024105015_00056 | gene | open | 58731-59900 | |||
| 4275 | JAHDTZ010000010.1 | GCA024105015_00057 | gene | open | 60101-60979 | |||
| 4276 | JAHDTZ010000010.1 | GCA024105015_00058 | gene | open | 61090-62133 | rlpA | ||
| 4277 | JAHDTZ010000010.1 | GCA024105015_00059 | gene | open | 62427-63674 | |||
| 4278 | JAHDTZ010000010.1 | GCA024105015_00060 | gene | open | 63986-64615 | |||
| 4279 | JAHDTZ010000010.1 | GCA024105015_00061 | gene | open | 64612-65337 | |||
| 4280 | JAHDTZ010000010.1 | GCA024105015_00062 | gene | open | 65389-67989 | |||
| 4281 | JAHDTZ010000010.1 | GCA024105015_00063 | gene | open | 67996-68784 | |||
| 4282 | JAHDTZ010000010.1 | GCA024105015_00064 | gene | open | 68824-68973 | |||
| 4283 | JAHDTZ010000010.1 | GCA024105015_00065 | gene | open | 68958-69578 | |||
| 4284 | JAHDTZ010000010.1 | GCA024105015_00066 | gene | open | 69859-70578 | |||
| 4285 | JAHDTZ010000010.1 | GCA024105015_00067 | gene | open | 70722-71288 | |||
| 4286 | JAHDTZ010000010.1 | GCA024105015_00068 | gene | open | 71386-72033 | |||
| 4287 | JAHDTZ010000010.1 | GCA024105015_00069 | gene | open | 72214-72438 | |||
| 4288 | JAHDTZ010000010.1 | GCA024105015_00070 | gene | open | 72664-72966 | |||
| 4289 | JAHDTZ010000010.1 | GCA024105015_00071 | gene | open | 73009-73323 | |||
| 4290 | JAHDTZ010000010.1 | GCA024105015_00072 | gene | open | 76404-76760 | cas2e | ||
| 4291 | JAHDTZ010000010.1 | GCA024105015_00073 | gene | open | 76751-77689 | cas1e | ||
| 4292 | JAHDTZ010000010.1 | GCA024105015_00074 | gene | open | 77693-78358 | cas6e | ||
| 4293 | JAHDTZ010000010.1 | GCA024105015_00075 | gene | open | 78358-79065 | cas5e | ||
| 4294 | JAHDTZ010000010.1 | GCA024105015_00076 | gene | open | 79062-80186 | cas7e | ||
| 4295 | JAHDTZ010000010.1 | GCA024105015_00077 | gene | open | 80183-80812 | casB | ||
| 4296 | JAHDTZ010000010.1 | GCA024105015_00078 | gene | open | 80812-82470 | casA | ||
| 4297 | JAHDTZ010000010.1 | GCA024105015_00079 | gene | open | 82467-85259 | |||
| 4298 | JAHDTZ010000010.1 | GCA024105015_00080 | gene | open | 85483-87018 | hutH | ||
| 4299 | JAHDTZ010000010.1 | GCA024105015_00081 | gene | open | 87153-88343 | hutI | ||
| 4300 | JAHDTZ010000010.1 | GCA024105015_00082 | gene | open | 88340-89680 | |||
| 4301 | JAHDTZ010000010.1 | GCA024105015_00083 | gene | open | 89677-90879 | |||
| 4302 | JAHDTZ010000010.1 | GCA024105015_00084 | gene | open | 90879-92885 | |||
| 4303 | JAHDTZ010000010.1 | GCA024105015_00085 | gene | open | 93073-93687 | |||
| 4304 | JAHDTZ010000010.1 | GCA024105015_00086 | gene | open | 93715-94080 | fkpA | ||
| 4305 | JAHDTZ010000010.1 | GCA024105015_00087 | gene | open | 94163-94333 | rpmF | ||
| 4306 | JAHDTZ010000010.1 | GCA024105015_00088 | gene | open | 94338-94643 | rpsN | ||
| 4307 | JAHDTZ010000010.1 | GCA024105015_00089 | gene | open | 94643-94879 | rpmB | ||
| 4308 | JAHDTZ010000010.1 | GCA024105015_00090 | gene | open | 94989-95234 | rpmE2 | ||
| 4309 | JAHDTZ010000010.1 | GCA024105015_00091 | gene | open | 95501-96265 | |||
| 4310 | JAHDTZ010000010.1 | GCA024105015_00092 | gene | open | 96601-97680 | |||
| 4311 | JAHDTZ010000010.1 | GCA024105015_00093 | gene | open | 97670-98707 | dppD | ||
| 4312 | JAHDTZ010000010.1 | GCA024105015_00094 | gene | open | 98717-99700 | dppC | ||
| 4313 | JAHDTZ010000010.1 | GCA024105015_00095 | gene | open | 99693-100616 | dppB | ||
| 4314 | JAHDTZ010000010.1 | GCA024105015_00096 | gene | open | 100688-102355 | |||
| 4315 | JAHDTZ010000010.1 | GCA024105015_00097 | gene | open | 102653-103192 | pfpI | ||
| 4316 | JAHDTZ010000010.1 | GCA024105015_00099 | gene | open | 103675-104577 | |||
| 4317 | JAHDTZ010000010.1 | GCA024105015_00100 | gene | open | 104579-107059 | |||
| 4318 | JAHDTZ010000010.1 | GCA024105015_00101 | gene | open | 107385-108659 | metL1 | ||
| 4319 | JAHDTZ010000010.1 | GCA024105015_00102 | gene | open | 108667-110487 | murJ | ||
| 4320 | JAHDTZ010000010.1 | GCA024105015_00103 | gene | open | 110573-112132 | |||
| 4321 | JAHDTZ010000010.1 | GCA024105015_00104 | gene | open | 112288-113220 | |||
| 4322 | JAHDTZ010000010.1 | GCA024105015_00105 | gene | open | 113217-114083 | |||
| 4323 | JAHDTZ010000010.1 | GCA024105015_00106 | gene | open | 114080-115573 | |||
| 4324 | JAHDTZ010000010.1 | GCA024105015_00107 | gene | open | 115763-116887 | |||
| 4325 | JAHDTZ010000010.1 | GCA024105015_00108 | gene | open | 117215-117511 | |||
| 4326 | JAHDTZ010000010.1 | GCA024105015_00032 | gene | open | 36757-36842 | trnS | ||
| 4327 | JAHDTZ010000010.1 | GCA024105015_00039 | gene | open | 44398-44487 | trnS | ||
| 4328 | JAHDTZ010000010.1 | GCA024105015_00040 | gene | open | 44697-44769 | trnR | ||
| 4329 | JAHDTZ010000010.1 | GCA024105015_00052 | gene | open | 55748-55832 | trnS | ||
| 4330 | JAHDTZ010000010.1 | GCA024105015_00098 | gene | open | 103518-103594 | trnP | ||
| 4331 | JAHDTZ010000010.1 | GCA024105015_00032 | tRNA | open | 36757-36842 | trnS | tRNA-Ser(tga) | |
| 4332 | JAHDTZ010000010.1 | GCA024105015_00039 | tRNA | open | 44398-44487 | trnS | tRNA-Ser(gct) | |
| 4333 | JAHDTZ010000010.1 | GCA024105015_00040 | tRNA | open | 44697-44769 | trnR | tRNA-Arg(acg) | |
| 4334 | JAHDTZ010000010.1 | GCA024105015_00052 | tRNA | open | 55748-55832 | trnS | tRNA-Ser(cga) | |
| 4335 | JAHDTZ010000010.1 | GCA024105015_00098 | tRNA | open | 103518-103594 | trnP | tRNA-Pro(cgg) | |
| 4336 | JAHDTZ010000011.1 | GCA024105015_00109 | CDS | open | 18-716 | _na 232_aa | rlpA | septal ring lytic transglycosylase RlpA family protein |
| 4337 | JAHDTZ010000011.1 | GCA024105015_00110 | CDS | open | 1021-2307 | _na 428_aa | gltA | citrate synthase |
| 4338 | JAHDTZ010000011.1 | GCA024105015_00111 | CDS | open | 2515-3621 | _na 368_aa | adenosine deaminase | |
| 4339 | JAHDTZ010000011.1 | GCA024105015_00112 | CDS | open | 3688-4800 | _na 370_aa | ald | alanine dehydrogenase |
| 4340 | JAHDTZ010000011.1 | GCA024105015_00113 | CDS | open | 4973-5167 | _na 64_aa | hypothetical protein | |
| 4341 | JAHDTZ010000011.1 | GCA024105015_00114 | CDS | open | 5140-5490 | _na 116_aa | asnC | AsnC family transcriptional regulator |
| 4342 | JAHDTZ010000011.1 | GCA024105015_00115 | CDS | open | 6178-6582 | _na 134_aa | hypothetical protein | |
| 4343 | JAHDTZ010000011.1 | GCA024105015_00116 | CDS | open | 6648-7235 | _na 195_aa | 2%2C4-diaminopentanoate dehydrogenase C-terminal domain-containing protein | |
| 4344 | JAHDTZ010000011.1 | GCA024105015_00117 | CDS | open | 7384-7593 | _na 69_aa | ortA | 2-amino-4-oxopentanoate thiolase subunit OrtA |
| 4345 | JAHDTZ010000011.1 | GCA024105015_00118 | CDS | open | 7590-9005 | _na 471_aa | ortB | 2-amino-4-oxopentanoate thiolase subunit OrtB |
| 4346 | JAHDTZ010000011.1 | GCA024105015_00119 | CDS | open | 9005-9424 | _na 139_aa | Ornithine aminomutase | |
| 4347 | JAHDTZ010000011.1 | GCA024105015_00120 | CDS | open | 9479-10261 | _na 260_aa | APC family D-serine/D-alanine/glycine transporter | |
| 4348 | JAHDTZ010000011.1 | GCA024105015_00121 | CDS | open | 10728-12107 | _na 459_aa | APC family D-serine/D-alanine/glycine transporter | |
| 4349 | JAHDTZ010000011.1 | GCA024105015_00122 | CDS | open | 12368-13495 | _na 375_aa | alr | alanine racemase |
| 4350 | JAHDTZ010000011.1 | GCA024105015_00123 | CDS | open | 13720-15144 | _na 474_aa | manB | Phosphoglucomutase |
| 4351 | JAHDTZ010000011.1 | GCA024105015_00124 | CDS | open | 15258-16448 | _na 396_aa | Galactokinase | |
| 4352 | JAHDTZ010000011.1 | GCA024105015_00125 | CDS | open | 16445-17281 | _na 278_aa | Glucose-1-phosphate thymidylyltransferase | |
| 4353 | JAHDTZ010000011.1 | GCA024105015_00126 | CDS | open | 17406-18275 | _na 289_aa | hypothetical protein | |
| 4354 | JAHDTZ010000011.1 | GCA024105015_00127 | CDS | open | 18239-18373 | _na 44_aa | hypothetical protein | |
| 4355 | JAHDTZ010000011.1 | GCA024105015_00128 | CDS | open | 18447-19328 | _na 293_aa | DUF559 domain-containing protein | |
| 4356 | JAHDTZ010000011.1 | GCA024105015_00129 | CDS | open | 19679-21085 | _na 468_aa | fumC | class II fumarate hydratase |
| 4357 | JAHDTZ010000011.1 | GCA024105015_00130 | CDS | open | 21064-21258 | _na 64_aa | hypothetical protein | |
| 4358 | JAHDTZ010000011.1 | GCA024105015_00131 | CDS | open | 21291-22202 | _na 303_aa | ugpE | ABC transporter%2C permease protein |
| 4359 | JAHDTZ010000011.1 | GCA024105015_00132 | CDS | open | 22204-23112 | _na 302_aa | ugpA | Binding-protein-dependent transport system |
| 4360 | JAHDTZ010000011.1 | GCA024105015_00133 | CDS | open | 23350-24690 | _na 446_aa | ugpB | Solute-binding lipoprotein |
| 4361 | JAHDTZ010000011.1 | GCA024105015_00134 | CDS | open | 24892-25899 | _na 335_aa | celR | HTH-type transcriptional regulator CelR |
| 4362 | JAHDTZ010000011.1 | GCA024105015_00135 | CDS | open | 25904-26596 | _na 230_aa | Suppressor of fused-like domain-containing protein | |
| 4363 | JAHDTZ010000011.1 | GCA024105015_00136 | CDS | open | 26722-27579 | _na 285_aa | mscS | Transporter%2C small conductance mechanosensitive ion channel MscS family protein |
| 4364 | JAHDTZ010000011.1 | GCA024105015_00137 | CDS | open | 27758-28393 | _na 211_aa | ParB/Sulfiredoxin domain-containing protein | |
| 4365 | JAHDTZ010000011.1 | GCA024105015_00138 | CDS | open | 28493-29398 | _na 301_aa | ABC transporter ATP-binding protein | |
| 4366 | JAHDTZ010000011.1 | GCA024105015_00139 | CDS | open | 29400-30194 | _na 264_aa | ABC transporter permease | |
| 4367 | JAHDTZ010000011.1 | GCA024105015_00140 | CDS | open | 30228-31163 | _na 311_aa | ACP S-malonyltransferase | |
| 4368 | JAHDTZ010000011.1 | GCA024105015_00141 | CDS | open | 31163-32626 | _na 487_aa | AMP-binding protein | |
| 4369 | JAHDTZ010000011.1 | GCA024105015_00142 | CDS | open | 32665-32898 | _na 77_aa | Acyl carrier protein | |
| 4370 | JAHDTZ010000011.1 | GCA024105015_00143 | CDS | open | 32903-34090 | _na 395_aa | PLP-dependent aminotransferase family protein | |
| 4371 | JAHDTZ010000011.1 | GCA024105015_00144 | CDS | open | 34087-36393 | _na 768_aa | Lantibiotic dehydratase | |
| 4372 | JAHDTZ010000011.1 | GCA024105015_00145 | CDS | open | 36377-37441 | _na 354_aa | sbnA | 2%2C3-diaminopropionate biosynthesis protein SbnA |
| 4373 | JAHDTZ010000011.1 | GCA024105015_00146 | CDS | open | 37438-38463 | _na 341_aa | sbnB | 2%2C3-diaminopropionate biosynthesis protein SbnB |
| 4374 | JAHDTZ010000011.1 | GCA024105015_00147 | CDS | open | 38460-39248 | _na 262_aa | 3-oxoacyl-(Acyl-carrier-protein) reductase | |
| 4375 | JAHDTZ010000011.1 | GCA024105015_00148 | CDS | open | 39291-39587 | _na 98_aa | Phosphopantetheine-binding protein | |
| 4376 | JAHDTZ010000011.1 | GCA024105015_00149 | CDS | open | 39584-40087 | _na 167_aa | fabZ | 3-hydroxyacyl-ACP dehydratase FabZ |
| 4377 | JAHDTZ010000011.1 | GCA024105015_00150 | CDS | open | 40117-42159 | _na 680_aa | GNAT family N-acetyltransferase | |
| 4378 | JAHDTZ010000011.1 | GCA024105015_00151 | CDS | open | 42206-43210 | _na 334_aa | Aminomethyl transferase family protein | |
| 4379 | JAHDTZ010000011.1 | GCA024105015_00152 | CDS | open | 43216-45555 | _na 779_aa | Beta-ketoacyl-[acyl-carrier-protein] synthase family protein | |
| 4380 | JAHDTZ010000011.1 | GCA024105015_00153 | CDS | open | 45552-46223 | _na 223_aa | 4'-phosphopantetheinyl transferase superfamily protein | |
| 4381 | JAHDTZ010000011.1 | GCA024105015_00154 | CDS | open | 46220-47353 | _na 377_aa | Peptide synthetase | |
| 4382 | JAHDTZ010000011.1 | GCA024105015_00155 | CDS | open | 47379-48824 | _na 481_aa | DHA2 family efflux MFS transporter permease subunit | |
| 4383 | JAHDTZ010000011.1 | GCA024105015_00156 | CDS | open | 48890-49039 | _na 49_aa | hypothetical protein | |
| 4384 | JAHDTZ010000011.1 | GCA024105015_00157 | CDS | open | 49101-51323 | _na 740_aa | serine/threonine protein kinase | |
| 4385 | JAHDTZ010000011.1 | GCA024105015_00158 | CDS | open | 51437-51568 | _na 43_aa | hypothetical protein | |
| 4386 | JAHDTZ010000011.1 | GCA024105015_00159 | CDS | open | 51601-52770 | _na 389_aa | Histidine kinase | |
| 4387 | JAHDTZ010000011.1 | GCA024105015_00160 | CDS | open | 52767-53375 | _na 202_aa | Response regulator transcription factor | |
| 4388 | JAHDTZ010000011.1 | GCA024105015_00161 | CDS | open | 53403-53753 | _na 116_aa | hypothetical protein | |
| 4389 | JAHDTZ010000011.1 | GCA024105015_00162 | CDS | open | 53893-54159 | _na 88_aa | DUF4229 domain-containing protein | |
| 4390 | JAHDTZ010000011.1 | GCA024105015_00163 | CDS | open | 54156-55634 | _na 492_aa | CCA tRNA nucleotidyltransferase | |
| 4391 | JAHDTZ010000011.1 | GCA024105015_00164 | CDS | open | 55679-57829 | _na 716_aa | Secreted protein | |
| 4392 | JAHDTZ010000011.1 | GCA024105015_00165 | CDS | open | 57903-59705 | _na 600_aa | Serine-threonine protein kinase | |
| 4393 | JAHDTZ010000011.1 | GCA024105015_00166 | CDS | open | 60135-61658 | _na 507_aa | glpK | glycerol kinase GlpK |
| 4394 | JAHDTZ010000011.1 | GCA024105015_00167 | CDS | open | 61746-62498 | _na 250_aa | glpF | MIP family glycerol uptake facilitator protein GlpF |
| 4395 | JAHDTZ010000011.1 | GCA024105015_00168 | CDS | open | 62514-63632 | _na 372_aa | deoR | Sugar-binding family transcriptional regulator |
| 4396 | JAHDTZ010000011.1 | GCA024105015_00169 | CDS | open | 63712-65115 | _na 467_aa | Serine protease | |
| 4397 | JAHDTZ010000011.1 | GCA024105015_00170 | CDS | open | 65323-65622 | _na 99_aa | hypothetical protein | |
| 4398 | JAHDTZ010000011.1 | GCA024105015_00171 | CDS | open | 65834-66886 | _na 350_aa | trxB | thioredoxin-disulfide reductase |
| 4399 | JAHDTZ010000011.1 | GCA024105015_00172 | CDS | open | 67050-67925 | _na 291_aa | RNA pseudouridylate synthase | |
| 4400 | JAHDTZ010000011.1 | GCA024105015_00173 | CDS | open | 68448-69272 | _na 274_aa | MFS transporter | |
| 4401 | JAHDTZ010000011.1 | GCA024105015_00174 | CDS | open | 69294-69545 | _na 83_aa | hypothetical protein | |
| 4402 | JAHDTZ010000011.1 | GCA024105015_00175 | CDS | open | 69547-70479 | _na 310_aa | Lipase/esterase | |
| 4403 | JAHDTZ010000011.1 | GCA024105015_00176 | CDS | open | 70570-71007 | _na 145_aa | yhfA | OsmC-like protein |
| 4404 | JAHDTZ010000011.1 | GCA024105015_00177 | CDS | open | 71017-71343 | _na 108_aa | trxA | thioredoxin |
| 4405 | JAHDTZ010000011.1 | GCA024105015_00178 | CDS | open | 71692-72750 | _na 352_aa | Glycerol-3-phosphate dehydrogenase | |
| 4406 | JAHDTZ010000011.1 | GCA024105015_00179 | CDS | open | 72898-73869 | _na 323_aa | Sugar-binding family transcriptional regulator | |
| 4407 | JAHDTZ010000011.1 | GCA024105015_00180 | CDS | open | 73889-75946 | _na 685_aa | tkt | transketolase |
| 4408 | JAHDTZ010000011.1 | GCA024105015_00181 | CDS | open | 76114-77796 | _na 560_aa | ribulokinase | |
| 4409 | JAHDTZ010000011.1 | GCA024105015_00182 | CDS | open | 77891-79255 | _na 454_aa | L-arabinose utilization protein | |
| 4410 | JAHDTZ010000011.1 | GCA024105015_00183 | CDS | open | 79282-80844 | _na 520_aa | araB | Carbohydrate kinase%2C FGGY family protein |
| 4411 | JAHDTZ010000011.1 | GCA024105015_00184 | CDS | open | 80909-81763 | _na 284_aa | nagD | HAD hydrolase%2C family IIA |
| 4412 | JAHDTZ010000011.1 | GCA024105015_00185 | CDS | open | 81787-82866 | _na 359_aa | Permease | |
| 4413 | JAHDTZ010000011.1 | GCA024105015_00186 | CDS | open | 83040-83531 | _na 163_aa | Ribose 5-phosphate isomerase | |
| 4414 | JAHDTZ010000011.1 | GCA024105015_00187 | CDS | open | 83851-84666 | _na 271_aa | deoR | DeoR family transcriptional regulator |
| 4415 | JAHDTZ010000011.1 | GCA024105015_00109 | gene | open | 18-716 | rlpA | ||
| 4416 | JAHDTZ010000011.1 | GCA024105015_00110 | gene | open | 1021-2307 | gltA | ||
| 4417 | JAHDTZ010000011.1 | GCA024105015_00111 | gene | open | 2515-3621 | |||
| 4418 | JAHDTZ010000011.1 | GCA024105015_00112 | gene | open | 3688-4800 | ald | ||
| 4419 | JAHDTZ010000011.1 | GCA024105015_00113 | gene | open | 4973-5167 | |||
| 4420 | JAHDTZ010000011.1 | GCA024105015_00114 | gene | open | 5140-5490 | asnC | ||
| 4421 | JAHDTZ010000011.1 | GCA024105015_00115 | gene | open | 6178-6582 | |||
| 4422 | JAHDTZ010000011.1 | GCA024105015_00116 | gene | open | 6648-7235 | |||
| 4423 | JAHDTZ010000011.1 | GCA024105015_00117 | gene | open | 7384-7593 | ortA | ||
| 4424 | JAHDTZ010000011.1 | GCA024105015_00118 | gene | open | 7590-9005 | ortB | ||
| 4425 | JAHDTZ010000011.1 | GCA024105015_00119 | gene | open | 9005-9424 | |||
| 4426 | JAHDTZ010000011.1 | GCA024105015_00120 | gene | open | 9479-10261 | |||
| 4427 | JAHDTZ010000011.1 | GCA024105015_00121 | gene | open | 10728-12107 | |||
| 4428 | JAHDTZ010000011.1 | GCA024105015_00122 | gene | open | 12368-13495 | alr | ||
| 4429 | JAHDTZ010000011.1 | GCA024105015_00123 | gene | open | 13720-15144 | manB | ||
| 4430 | JAHDTZ010000011.1 | GCA024105015_00124 | gene | open | 15258-16448 | |||
| 4431 | JAHDTZ010000011.1 | GCA024105015_00125 | gene | open | 16445-17281 | |||
| 4432 | JAHDTZ010000011.1 | GCA024105015_00126 | gene | open | 17406-18275 | |||
| 4433 | JAHDTZ010000011.1 | GCA024105015_00127 | gene | open | 18239-18373 | |||
| 4434 | JAHDTZ010000011.1 | GCA024105015_00128 | gene | open | 18447-19328 | |||
| 4435 | JAHDTZ010000011.1 | GCA024105015_00129 | gene | open | 19679-21085 | fumC | ||
| 4436 | JAHDTZ010000011.1 | GCA024105015_00130 | gene | open | 21064-21258 | |||
| 4437 | JAHDTZ010000011.1 | GCA024105015_00131 | gene | open | 21291-22202 | ugpE | ||
| 4438 | JAHDTZ010000011.1 | GCA024105015_00132 | gene | open | 22204-23112 | ugpA | ||
| 4439 | JAHDTZ010000011.1 | GCA024105015_00133 | gene | open | 23350-24690 | ugpB | ||
| 4440 | JAHDTZ010000011.1 | GCA024105015_00134 | gene | open | 24892-25899 | celR | ||
| 4441 | JAHDTZ010000011.1 | GCA024105015_00135 | gene | open | 25904-26596 | |||
| 4442 | JAHDTZ010000011.1 | GCA024105015_00136 | gene | open | 26722-27579 | mscS | ||
| 4443 | JAHDTZ010000011.1 | GCA024105015_00137 | gene | open | 27758-28393 | |||
| 4444 | JAHDTZ010000011.1 | GCA024105015_00138 | gene | open | 28493-29398 | |||
| 4445 | JAHDTZ010000011.1 | GCA024105015_00139 | gene | open | 29400-30194 | |||
| 4446 | JAHDTZ010000011.1 | GCA024105015_00140 | gene | open | 30228-31163 | |||
| 4447 | JAHDTZ010000011.1 | GCA024105015_00141 | gene | open | 31163-32626 | |||
| 4448 | JAHDTZ010000011.1 | GCA024105015_00142 | gene | open | 32665-32898 | |||
| 4449 | JAHDTZ010000011.1 | GCA024105015_00143 | gene | open | 32903-34090 | |||
| 4450 | JAHDTZ010000011.1 | GCA024105015_00144 | gene | open | 34087-36393 | |||
| 4451 | JAHDTZ010000011.1 | GCA024105015_00145 | gene | open | 36377-37441 | sbnA | ||
| 4452 | JAHDTZ010000011.1 | GCA024105015_00146 | gene | open | 37438-38463 | sbnB | ||
| 4453 | JAHDTZ010000011.1 | GCA024105015_00147 | gene | open | 38460-39248 | |||
| 4454 | JAHDTZ010000011.1 | GCA024105015_00148 | gene | open | 39291-39587 | |||
| 4455 | JAHDTZ010000011.1 | GCA024105015_00149 | gene | open | 39584-40087 | fabZ | ||
| 4456 | JAHDTZ010000011.1 | GCA024105015_00150 | gene | open | 40117-42159 | |||
| 4457 | JAHDTZ010000011.1 | GCA024105015_00151 | gene | open | 42206-43210 | |||
| 4458 | JAHDTZ010000011.1 | GCA024105015_00152 | gene | open | 43216-45555 | |||
| 4459 | JAHDTZ010000011.1 | GCA024105015_00153 | gene | open | 45552-46223 | |||
| 4460 | JAHDTZ010000011.1 | GCA024105015_00154 | gene | open | 46220-47353 | |||
| 4461 | JAHDTZ010000011.1 | GCA024105015_00155 | gene | open | 47379-48824 | |||
| 4462 | JAHDTZ010000011.1 | GCA024105015_00156 | gene | open | 48890-49039 | |||
| 4463 | JAHDTZ010000011.1 | GCA024105015_00157 | gene | open | 49101-51323 | |||
| 4464 | JAHDTZ010000011.1 | GCA024105015_00158 | gene | open | 51437-51568 | |||
| 4465 | JAHDTZ010000011.1 | GCA024105015_00159 | gene | open | 51601-52770 | |||
| 4466 | JAHDTZ010000011.1 | GCA024105015_00160 | gene | open | 52767-53375 | |||
| 4467 | JAHDTZ010000011.1 | GCA024105015_00161 | gene | open | 53403-53753 | |||
| 4468 | JAHDTZ010000011.1 | GCA024105015_00162 | gene | open | 53893-54159 | |||
| 4469 | JAHDTZ010000011.1 | GCA024105015_00163 | gene | open | 54156-55634 | |||
| 4470 | JAHDTZ010000011.1 | GCA024105015_00164 | gene | open | 55679-57829 | |||
| 4471 | JAHDTZ010000011.1 | GCA024105015_00165 | gene | open | 57903-59705 | |||
| 4472 | JAHDTZ010000011.1 | GCA024105015_00166 | gene | open | 60135-61658 | glpK | ||
| 4473 | JAHDTZ010000011.1 | GCA024105015_00167 | gene | open | 61746-62498 | glpF | ||
| 4474 | JAHDTZ010000011.1 | GCA024105015_00168 | gene | open | 62514-63632 | deoR | ||
| 4475 | JAHDTZ010000011.1 | GCA024105015_00169 | gene | open | 63712-65115 | |||
| 4476 | JAHDTZ010000011.1 | GCA024105015_00170 | gene | open | 65323-65622 | |||
| 4477 | JAHDTZ010000011.1 | GCA024105015_00171 | gene | open | 65834-66886 | trxB | ||
| 4478 | JAHDTZ010000011.1 | GCA024105015_00172 | gene | open | 67050-67925 | |||
| 4479 | JAHDTZ010000011.1 | GCA024105015_00173 | gene | open | 68448-69272 | |||
| 4480 | JAHDTZ010000011.1 | GCA024105015_00174 | gene | open | 69294-69545 | |||
| 4481 | JAHDTZ010000011.1 | GCA024105015_00175 | gene | open | 69547-70479 | |||
| 4482 | JAHDTZ010000011.1 | GCA024105015_00176 | gene | open | 70570-71007 | yhfA | ||
| 4483 | JAHDTZ010000011.1 | GCA024105015_00177 | gene | open | 71017-71343 | trxA | ||
| 4484 | JAHDTZ010000011.1 | GCA024105015_00178 | gene | open | 71692-72750 | |||
| 4485 | JAHDTZ010000011.1 | GCA024105015_00179 | gene | open | 72898-73869 | |||
| 4486 | JAHDTZ010000011.1 | GCA024105015_00180 | gene | open | 73889-75946 | tkt | ||
| 4487 | JAHDTZ010000011.1 | GCA024105015_00181 | gene | open | 76114-77796 | |||
| 4488 | JAHDTZ010000011.1 | GCA024105015_00182 | gene | open | 77891-79255 | |||
| 4489 | JAHDTZ010000011.1 | GCA024105015_00183 | gene | open | 79282-80844 | araB | ||
| 4490 | JAHDTZ010000011.1 | GCA024105015_00184 | gene | open | 80909-81763 | nagD | ||
| 4491 | JAHDTZ010000011.1 | GCA024105015_00185 | gene | open | 81787-82866 | |||
| 4492 | JAHDTZ010000011.1 | GCA024105015_00186 | gene | open | 83040-83531 | |||
| 4493 | JAHDTZ010000011.1 | GCA024105015_00187 | gene | open | 83851-84666 | deoR | ||
| 4494 | JAHDTZ010000012.1 | regulatory_region | open | 39856-40066 | Cobalamin riboswitch aptamer | |||
| 4495 | JAHDTZ010000012.1 | GCA024105015_00188 | CDS | open | 113-406 | _na 97_aa | dUTP diphosphatase | |
| 4496 | JAHDTZ010000012.1 | GCA024105015_00189 | CDS | open | 610-984 | _na 124_aa | hypothetical protein | |
| 4497 | JAHDTZ010000012.1 | GCA024105015_00190 | CDS | open | 1067-1807 | _na 246_aa | Pentapeptide repeat-containing protein | |
| 4498 | JAHDTZ010000012.1 | GCA024105015_00191 | CDS | open | 1817-2389 | _na 190_aa | hypothetical protein | |
| 4499 | JAHDTZ010000012.1 | GCA024105015_00192 | CDS | open | 3123-3938 | _na 271_aa | hypothetical protein | |
| 4500 | JAHDTZ010000012.1 | GCA024105015_00193 | CDS | open | 4515-5168 | _na 217_aa | hypothetical protein |

