HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Streptococcus oralis subsp. oralis (GCA_026782085.1)

Select a Genome:
BAKTA Annotations for GCA_026782085.1
Genome Selected: Streptococcus oralis subsp. oralis
ContigsBases CDSrRNA tmRNAtRNA
9 2059438 1969 3 1 48
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4103 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:8]    |    Number of Records Found: 4103 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3501 JAKUVW010000005.1 GCA026782085_01780 CDS open 71907-72896 _na     329_aa hypothetical protein
3502 JAKUVW010000005.1 GCA026782085_01781 CDS open 72941-73714 _na     257_aa Helix-turn-helix transcriptional regulator
3503 JAKUVW010000005.1 GCA026782085_01782 CDS open 73878-74075 _na     65_aa Helix-turn-helix transcriptional regulator
3504 JAKUVW010000005.1 GCA026782085_01783 CDS open 74090-74716 _na     208_aa Phage regulatory protein Rha (Phage_pRha)
3505 JAKUVW010000005.1 GCA026782085_01784 CDS open 74996-75196 _na     66_aa Glycerate kinase
3506 JAKUVW010000005.1 GCA026782085_01785 CDS open 75198-75413 _na     71_aa Holin
3507 JAKUVW010000005.1 GCA026782085_01786 CDS open 75410-75751 _na     113_aa Phage protein
3508 JAKUVW010000005.1 GCA026782085_01787 CDS open 75744-76019 _na     91_aa HTH merR-type domain-containing protein
3509 JAKUVW010000005.1 GCA026782085_01788 CDS open 76171-77400 _na     409_aa Replicative DNA helicase
3510 JAKUVW010000005.1 GCA026782085_01789 CDS open 77835-78311 _na     158_aa Phage protein
3511 JAKUVW010000005.1 GCA026782085_01790 CDS open 78335-78859 _na     174_aa Phage protein
3512 JAKUVW010000005.1 GCA026782085_01791 CDS open 78940-79458 _na     172_aa Phage protein
3513 JAKUVW010000005.1 GCA026782085_01792 CDS open 80173-80592 _na     139_aa rinA Phage transcriptional regulator%2C RinA family
3514 JAKUVW010000005.1 GCA026782085_01793 CDS open 80582-80920 _na     112_aa Conserved domain protein
3515 JAKUVW010000005.1 GCA026782085_01794 CDS open 81015-81176 _na     53_aa Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix domain protein
3516 JAKUVW010000005.1 GCA026782085_01795 CDS open 81179-81334 _na     51_aa hypothetical protein
3517 JAKUVW010000005.1 GCA026782085_01797 CDS open 82005-82523 _na     172_aa HXXEE domain-containing protein
3518 JAKUVW010000005.1 GCA026782085_01798 CDS open 82933-83586 _na     217_aa hypothetical protein
3519 JAKUVW010000005.1 GCA026782085_01799 CDS open 83589-84599 _na     336_aa hypothetical protein
3520 JAKUVW010000005.1 GCA026782085_01800 CDS open 84890-85150 _na     86_aa hypothetical protein
3521 JAKUVW010000005.1 GCA026782085_01801 CDS open 85452-88895 _na     1147_aa hepA ATP-dependent helicase HepA
3522 JAKUVW010000005.1 GCA026782085_01802 CDS open 88892-92347 _na     1151_aa site-specific DNA-methyltransferase (adenine-specific)
3523 JAKUVW010000005.1 GCA026782085_01803 CDS open 92857-93012 _na     51_aa Transposase
3524 JAKUVW010000005.1 GCA026782085_01804 CDS open 92988-93755 _na     255_aa Integrase catalytic domain-containing protein
3525 JAKUVW010000005.1 GCA026782085_01805 CDS open 93827-93976 _na     49_aa rpmG 50S ribosomal protein L33
3526 JAKUVW010000005.1 GCA026782085_01806 CDS open 93992-94174 _na     60_aa rpmF 50S ribosomal protein L32
3527 JAKUVW010000005.1 GCA026782085_01807 CDS open 94326-94526 _na     66_aa PTS ascorbate transporter subunit IIC
3528 JAKUVW010000005.1 GCA026782085_01808 CDS open 94529-95536 _na     335_aa hflC Band 7 domain-containing protein
3529 JAKUVW010000005.1 GCA026782085_01809 CDS open 95720-97423 _na     567_aa ilvD dihydroxy-acid dehydratase
3530 JAKUVW010000005.1 GCA026782085_01810 CDS open 97586-97927 _na     113_aa paaD MIP18 family-like domain-containing protein
3531 JAKUVW010000005.1 GCA026782085_01811 CDS open 98095-99375 _na     426_aa hisS histidine--tRNA ligase
3532 JAKUVW010000005.1 GCA026782085_01812 CDS open 99597-100238 _na     213_aa CAAX amino terminal protease family protein
3533 JAKUVW010000005.1 GCA026782085_01813 CDS open 100256-100474 _na     72_aa Excreted peptide
3534 JAKUVW010000005.1 GCA026782085_01814 CDS open 100626-102389 _na     587_aa aspS aspartate--tRNA ligase
3535 JAKUVW010000005.1 GCA026782085_01815 CDS open 102367-103308 _na     313_aa yitT DUF2179 domain-containing protein
3536 JAKUVW010000005.1 GCA026782085_01816 CDS open 103342-104328 _na     328_aa malR HTH-type transcriptional regulator MalR
3537 JAKUVW010000005.1 GCA026782085_01817 CDS open 104338-105144 _na     268_aa malA Maltodextrose utilization protein MalA
3538 JAKUVW010000005.1 GCA026782085_01818 CDS open 105318-106160 _na     280_aa malD Maltodextrin transport system permease protein MalD
3539 JAKUVW010000005.1 GCA026782085_01819 CDS open 106162-107454 _na     430_aa malC Maltodextrin transport system permease protein MalC
3540 JAKUVW010000005.1 GCA026782085_01820 CDS open 107579-108847 _na     422_aa Maltodextrin-binding protein
3541 JAKUVW010000005.1 GCA026782085_01821 CDS open 109321-110838 _na     505_aa malQ 4-alpha-glucanotransferase
3542 JAKUVW010000005.1 GCA026782085_01822 CDS open 110861-113119 _na     752_aa malP Maltodextrin phosphorylase
3543 JAKUVW010000005.1 GCA026782085_01823 CDS open 113653-114501 _na     282_aa Ribosomal RNA large subunit methyltransferase A
3544 JAKUVW010000005.1 GCA026782085_01824 CDS open 114653-114931 _na     92_aa Gram-positive signal peptide protein%2C YSIRK family
3545 JAKUVW010000005.1 GCA026782085_01825 CDS open 114933-116993 _na     686_aa zntA Cd(2+)-exporting ATPase
3546 JAKUVW010000005.1 GCA026782085_01826 CDS open 117071-118327 _na     418_aa tyrS tyrosine--tRNA ligase
3547 JAKUVW010000005.1 GCA026782085_01827 CDS open 118468-120975 _na     835_aa pbp1b penicillin-binding protein PBP1B
3548 JAKUVW010000005.1 GCA026782085_01828 CDS open 121053-121964 _na     303_aa eamA EamA domain-containing protein
3549 JAKUVW010000005.1 GCA026782085_01829 CDS open 122049-122747 _na     232_aa dapD 2%2C3%2C4%2C5-tetrahydropyridine-2%2C6-dicarboxylate N-acetyltransferase
3550 JAKUVW010000005.1 GCA026782085_01830 CDS open 122817-123947 _na     376_aa abgB N-acetyldiaminopimelate deacetylase
3551 JAKUVW010000005.1 GCA026782085_01831 CDS open 123959-124498 _na     179_aa 5-formyltetrahydrofolate cyclo-ligase
3552 JAKUVW010000005.1 GCA026782085_01832 CDS open 124482-125162 _na     226_aa glpG GlpG protein (Membrane protein of glp regulon)
3553 JAKUVW010000005.1 GCA026782085_01833 CDS open 125284-126183 _na     299_aa galU UTP--glucose-1-phosphate uridylyltransferase GalU
3554 JAKUVW010000005.1 GCA026782085_01834 CDS open 126205-127221 _na     338_aa NAD(P)H-dependent glycerol-3-phosphate dehydrogenase
3555 JAKUVW010000005.1 GCA026782085_01835 CDS open 127392-129134 _na     580_aa mdlB ABC transporter ATP-binding protein/permease
3556 JAKUVW010000005.1 GCA026782085_01836 CDS open 129136-130902 _na     588_aa ABC transporter ATP-binding protein
3557 JAKUVW010000005.1 GCA026782085_01837 CDS open 131042-131731 _na     229_aa puuD Gamma-glutamyl hydrolase
3558 JAKUVW010000005.1 GCA026782085_01838 CDS open 131903-133252 _na     449_aa glucose-6-phosphate isomerase
3559 JAKUVW010000005.1 GCA026782085_01839 CDS open 133436-134236 _na     266_aa Short chain dehydrogenase/reductase family oxidoreductase
3560 JAKUVW010000005.1 GCA026782085_01840 CDS open 134260-135276 _na     338_aa Putative licABCH operon regulator
3561 JAKUVW010000005.1 GCA026782085_01841 CDS open 135278-136126 _na     282_aa transcription antiterminator
3562 JAKUVW010000005.1 GCA026782085_01842 CDS open 136126-136623 _na     165_aa Sorbitol operon activator
3563 JAKUVW010000005.1 GCA026782085_01843 CDS open 136620-137165 _na     181_aa PTS family glucitol/sorbitol porter%2C IIC component
3564 JAKUVW010000005.1 GCA026782085_01844 CDS open 137179-138159 _na     326_aa PTS family glucitol/sorbitol porter%2C IIB component
3565 JAKUVW010000005.1 GCA026782085_01845 CDS open 138258-138629 _na     123_aa PTS sorbitol transporter subunit IIA
3566 JAKUVW010000005.1 GCA026782085_01846 CDS open 138925-139302 _na     125_aa pgi glucose-6-phosphate isomerase
3567 JAKUVW010000005.1 GCA026782085_01847 CDS open 139430-140890 _na     486_aa gltX glutamate--tRNA ligase
3568 JAKUVW010000005.1 GCA026782085_01848 CDS open 140903-141337 _na     144_aa Cytidine/deoxycytidylate deaminase family protein
3569 JAKUVW010000005.1 GCA026782085_01704 gene open 317-553 comW
3570 JAKUVW010000005.1 GCA026782085_01705 gene open 747-2081
3571 JAKUVW010000005.1 GCA026782085_01707 gene open 2282-2749 tadA
3572 JAKUVW010000005.1 GCA026782085_01709 gene open 2935-3378 dut
3573 JAKUVW010000005.1 GCA026782085_01710 gene open 3388-3855
3574 JAKUVW010000005.1 GCA026782085_01711 gene open 3996-5213 radA
3575 JAKUVW010000005.1 GCA026782085_01712 gene open 5286-5780 cynT
3576 JAKUVW010000005.1 GCA026782085_01713 gene open 5994-6962 prs1
3577 JAKUVW010000005.1 GCA026782085_01714 gene open 7082-7519 yccU
3578 JAKUVW010000005.1 GCA026782085_01715 gene open 7549-8559 yeiH
3579 JAKUVW010000005.1 GCA026782085_01716 gene open 8711-9880 aspB
3580 JAKUVW010000005.1 GCA026782085_01717 gene open 9877-10647 recO
3581 JAKUVW010000005.1 GCA026782085_01718 gene open 10644-11636 plsX
3582 JAKUVW010000005.1 GCA026782085_01719 gene open 11642-11878
3583 JAKUVW010000005.1 GCA026782085_01720 gene open 12197-12340
3584 JAKUVW010000005.1 GCA026782085_01721 gene open 12357-12506
3585 JAKUVW010000005.1 GCA026782085_01722 gene open 12519-12695
3586 JAKUVW010000005.1 GCA026782085_01723 gene open 12845-13000
3587 JAKUVW010000005.1 GCA026782085_01724 gene open 13025-13246
3588 JAKUVW010000005.1 GCA026782085_01725 gene open 13284-13472
3589 JAKUVW010000005.1 GCA026782085_01726 gene open 13497-13706
3590 JAKUVW010000005.1 GCA026782085_01727 gene open 13917-16070 comA
3591 JAKUVW010000005.1 GCA026782085_01728 gene open 16083-17432
3592 JAKUVW010000005.1 GCA026782085_01729 gene open 17601-18308 purC
3593 JAKUVW010000005.1 GCA026782085_01730 gene open 18364-22089 purL2
3594 JAKUVW010000005.1 GCA026782085_01731 gene open 22102-23544 purF
3595 JAKUVW010000005.1 GCA026782085_01732 gene open 23585-24607 purM
3596 JAKUVW010000005.1 GCA026782085_01733 gene open 24604-25155
3597 JAKUVW010000005.1 GCA026782085_01734 gene open 25200-25664
3598 JAKUVW010000005.1 GCA026782085_01735 gene open 25666-27213 purH
3599 JAKUVW010000005.1 GCA026782085_01736 gene open 27334-28599 purD
3600 JAKUVW010000005.1 GCA026782085_01737 gene open 28799-29287 purE
3601 JAKUVW010000005.1 GCA026782085_01738 gene open 29274-30365 purK
3602 JAKUVW010000005.1 GCA026782085_01739 gene open 30372-31121
3603 JAKUVW010000005.1 GCA026782085_01740 gene open 31280-33007
3604 JAKUVW010000005.1 GCA026782085_01741 gene open 33223-34494 purB
3605 JAKUVW010000005.1 GCA026782085_01742 gene open 34552-38307
3606 JAKUVW010000005.1 GCA026782085_01743 gene open 38610-39326
3607 JAKUVW010000005.1 GCA026782085_01744 gene open 39648-41435 ganA
3608 JAKUVW010000005.1 GCA026782085_01745 gene open 41432-41908 agaB
3609 JAKUVW010000005.1 GCA026782085_01746 gene open 41935-42840 manY
3610 JAKUVW010000005.1 GCA026782085_01747 gene open 42827-43648 manZ
3611 JAKUVW010000005.1 GCA026782085_01748 gene open 43652-44056 manX
3612 JAKUVW010000005.1 GCA026782085_01749 gene open 44313-45479 agaS
3613 JAKUVW010000005.1 GCA026782085_01750 gene open 45490-46485 lacD
3614 JAKUVW010000005.1 GCA026782085_01751 gene open 46632-47669 galM
3615 JAKUVW010000005.1 GCA026782085_01752 gene open 47778-48632
3616 JAKUVW010000005.1 GCA026782085_01753 gene open 48944-49516
3617 JAKUVW010000005.1 GCA026782085_01754 gene open 49518-50186
3618 JAKUVW010000005.1 GCA026782085_01755 gene open 50302-50973
3619 JAKUVW010000005.1 GCA026782085_01756 gene open 50976-51638
3620 JAKUVW010000005.1 GCA026782085_01757 gene open 51714-52271
3621 JAKUVW010000005.1 GCA026782085_01758 gene open 52471-52728 frmR
3622 JAKUVW010000005.1 GCA026782085_01759 gene open 52950-53246 glpE
3623 JAKUVW010000005.1 GCA026782085_01760 gene open 53576-53884
3624 JAKUVW010000005.1 GCA026782085_01761 gene open 54060-54149
3625 JAKUVW010000005.1 GCA026782085_01762 gene open 54183-54623
3626 JAKUVW010000005.1 GCA026782085_01763 gene open 54899-56134
3627 JAKUVW010000005.1 GCA026782085_01764 gene open 56554-57270
3628 JAKUVW010000005.1 GCA026782085_01765 gene open 57272-58354 drrB
3629 JAKUVW010000005.1 GCA026782085_01766 gene open 58394-59017
3630 JAKUVW010000005.1 GCA026782085_01767 gene open 59291-60055 udp
3631 JAKUVW010000005.1 GCA026782085_01768 gene open 60089-61468 trkH
3632 JAKUVW010000005.1 GCA026782085_01769 gene open 61482-62147
3633 JAKUVW010000005.1 GCA026782085_01770 gene open 62303-64837
3634 JAKUVW010000005.1 GCA026782085_01771 gene open 64918-65616 saeR
3635 JAKUVW010000005.1 GCA026782085_01772 gene open 65613-66647
3636 JAKUVW010000005.1 GCA026782085_01773 gene open 66743-66910
3637 JAKUVW010000005.1 GCA026782085_01774 gene open 66914-67405
3638 JAKUVW010000005.1 GCA026782085_01775 gene open 67566-68084 asbA
3639 JAKUVW010000005.1 GCA026782085_01776 gene open 68193-68939 lysR
3640 JAKUVW010000005.1 GCA026782085_01777 gene open 69039-69446
3641 JAKUVW010000005.1 GCA026782085_01778 gene open 69695-70306 rpsD
3642 JAKUVW010000005.1 GCA026782085_01779 gene open 70394-71560
3643 JAKUVW010000005.1 GCA026782085_01780 gene open 71907-72896
3644 JAKUVW010000005.1 GCA026782085_01781 gene open 72941-73714
3645 JAKUVW010000005.1 GCA026782085_01782 gene open 73878-74075
3646 JAKUVW010000005.1 GCA026782085_01783 gene open 74090-74716
3647 JAKUVW010000005.1 GCA026782085_01784 gene open 74996-75196
3648 JAKUVW010000005.1 GCA026782085_01785 gene open 75198-75413
3649 JAKUVW010000005.1 GCA026782085_01786 gene open 75410-75751
3650 JAKUVW010000005.1 GCA026782085_01787 gene open 75744-76019
3651 JAKUVW010000005.1 GCA026782085_01788 gene open 76171-77400
3652 JAKUVW010000005.1 GCA026782085_01789 gene open 77835-78311
3653 JAKUVW010000005.1 GCA026782085_01790 gene open 78335-78859
3654 JAKUVW010000005.1 GCA026782085_01791 gene open 78940-79458
3655 JAKUVW010000005.1 GCA026782085_01792 gene open 80173-80592 rinA
3656 JAKUVW010000005.1 GCA026782085_01793 gene open 80582-80920
3657 JAKUVW010000005.1 GCA026782085_01794 gene open 81015-81176
3658 JAKUVW010000005.1 GCA026782085_01795 gene open 81179-81334
3659 JAKUVW010000005.1 GCA026782085_01797 gene open 82005-82523
3660 JAKUVW010000005.1 GCA026782085_01798 gene open 82933-83586
3661 JAKUVW010000005.1 GCA026782085_01799 gene open 83589-84599
3662 JAKUVW010000005.1 GCA026782085_01800 gene open 84890-85150
3663 JAKUVW010000005.1 GCA026782085_01801 gene open 85452-88895 hepA
3664 JAKUVW010000005.1 GCA026782085_01802 gene open 88892-92347
3665 JAKUVW010000005.1 GCA026782085_01803 gene open 92857-93012
3666 JAKUVW010000005.1 GCA026782085_01804 gene open 92988-93755
3667 JAKUVW010000005.1 GCA026782085_01805 gene open 93827-93976 rpmG
3668 JAKUVW010000005.1 GCA026782085_01806 gene open 93992-94174 rpmF
3669 JAKUVW010000005.1 GCA026782085_01807 gene open 94326-94526
3670 JAKUVW010000005.1 GCA026782085_01808 gene open 94529-95536 hflC
3671 JAKUVW010000005.1 GCA026782085_01809 gene open 95720-97423 ilvD
3672 JAKUVW010000005.1 GCA026782085_01810 gene open 97586-97927 paaD
3673 JAKUVW010000005.1 GCA026782085_01811 gene open 98095-99375 hisS
3674 JAKUVW010000005.1 GCA026782085_01812 gene open 99597-100238
3675 JAKUVW010000005.1 GCA026782085_01813 gene open 100256-100474
3676 JAKUVW010000005.1 GCA026782085_01814 gene open 100626-102389 aspS
3677 JAKUVW010000005.1 GCA026782085_01815 gene open 102367-103308 yitT
3678 JAKUVW010000005.1 GCA026782085_01816 gene open 103342-104328 malR
3679 JAKUVW010000005.1 GCA026782085_01817 gene open 104338-105144 malA
3680 JAKUVW010000005.1 GCA026782085_01818 gene open 105318-106160 malD
3681 JAKUVW010000005.1 GCA026782085_01819 gene open 106162-107454 malC
3682 JAKUVW010000005.1 GCA026782085_01820 gene open 107579-108847
3683 JAKUVW010000005.1 GCA026782085_01821 gene open 109321-110838 malQ
3684 JAKUVW010000005.1 GCA026782085_01822 gene open 110861-113119 malP
3685 JAKUVW010000005.1 GCA026782085_01823 gene open 113653-114501
3686 JAKUVW010000005.1 GCA026782085_01824 gene open 114653-114931
3687 JAKUVW010000005.1 GCA026782085_01825 gene open 114933-116993 zntA
3688 JAKUVW010000005.1 GCA026782085_01826 gene open 117071-118327 tyrS
3689 JAKUVW010000005.1 GCA026782085_01827 gene open 118468-120975 pbp1b
3690 JAKUVW010000005.1 GCA026782085_01828 gene open 121053-121964 eamA
3691 JAKUVW010000005.1 GCA026782085_01829 gene open 122049-122747 dapD
3692 JAKUVW010000005.1 GCA026782085_01830 gene open 122817-123947 abgB
3693 JAKUVW010000005.1 GCA026782085_01831 gene open 123959-124498
3694 JAKUVW010000005.1 GCA026782085_01832 gene open 124482-125162 glpG
3695 JAKUVW010000005.1 GCA026782085_01833 gene open 125284-126183 galU
3696 JAKUVW010000005.1 GCA026782085_01834 gene open 126205-127221
3697 JAKUVW010000005.1 GCA026782085_01835 gene open 127392-129134 mdlB
3698 JAKUVW010000005.1 GCA026782085_01836 gene open 129136-130902
3699 JAKUVW010000005.1 GCA026782085_01837 gene open 131042-131731 puuD
3700 JAKUVW010000005.1 GCA026782085_01838 gene open 131903-133252
3701 JAKUVW010000005.1 GCA026782085_01839 gene open 133436-134236
3702 JAKUVW010000005.1 GCA026782085_01840 gene open 134260-135276
3703 JAKUVW010000005.1 GCA026782085_01841 gene open 135278-136126
3704 JAKUVW010000005.1 GCA026782085_01842 gene open 136126-136623
3705 JAKUVW010000005.1 GCA026782085_01843 gene open 136620-137165
3706 JAKUVW010000005.1 GCA026782085_01844 gene open 137179-138159
3707 JAKUVW010000005.1 GCA026782085_01845 gene open 138258-138629
3708 JAKUVW010000005.1 GCA026782085_01846 gene open 138925-139302 pgi
3709 JAKUVW010000005.1 GCA026782085_01847 gene open 139430-140890 gltX
3710 JAKUVW010000005.1 GCA026782085_01848 gene open 140903-141337
3711 JAKUVW010000005.1 GCA026782085_01703 gene open 35-108 trnN
3712 JAKUVW010000005.1 GCA026782085_01703 tRNA open 35-108 trnN tRNA-Asn(gtt)
3713 JAKUVW010000006.1 GCA026782085_01849 CDS open 22-594 _na     190_aa SHIRT domain-containing protein
3714 JAKUVW010000006.1 GCA026782085_01850 CDS open 752-1072 _na     106_aa padR Transcription regulator PadR N-terminal domain-containing protein
3715 JAKUVW010000006.1 GCA026782085_01851 CDS open 1072-1647 _na     191_aa DUF2812 domain-containing protein
3716 JAKUVW010000006.1 GCA026782085_01852 CDS open 1682-2194 _na     170_aa Phosphoglycerate kinase
3717 JAKUVW010000006.1 GCA026782085_01853 CDS open 2355-3389 _na     344_aa hrcA heat-inducible transcriptional repressor HrcA
3718 JAKUVW010000006.1 GCA026782085_01854 CDS open 3416-3931 _na     171_aa grpE nucleotide exchange factor GrpE
3719 JAKUVW010000006.1 GCA026782085_01855 CDS open 3942-4337 _na     131_aa NfeD-like C-terminal domain-containing protein
3720 JAKUVW010000006.1 GCA026782085_01856 CDS open 4575-6398 _na     607_aa dnaK molecular chaperone DnaK
3721 JAKUVW010000006.1 GCA026782085_01857 CDS open 6848-7984 _na     378_aa dnaJ molecular chaperone DnaJ
3722 JAKUVW010000006.1 GCA026782085_01858 CDS open 8062-8715 _na     217_aa DUF4825 domain-containing protein
3723 JAKUVW010000006.1 GCA026782085_01859 CDS open 8785-9063 _na     92_aa Methyl-accepting chemotaxis protein
3724 JAKUVW010000006.1 GCA026782085_01860 CDS open 9073-9483 _na     136_aa HIT domain-containing protein
3725 JAKUVW010000006.1 GCA026782085_01861 CDS open 9551-10282 _na     243_aa rbbA ABC transporter ATP-binding protein
3726 JAKUVW010000006.1 GCA026782085_01862 CDS open 10279-11328 _na     349_aa ecsB Bacterial ABC transporter protein EcsB
3727 JAKUVW010000006.1 GCA026782085_01863 CDS open 11376-12170 _na     264_aa ccrZ cell cycle regulator CcrZ
3728 JAKUVW010000006.1 GCA026782085_01864 CDS open 12167-12802 _na     211_aa trmB tRNA (guanosine(46)-N7)-methyltransferase TrmB
3729 JAKUVW010000006.1 GCA026782085_01865 CDS open 12881-13408 _na     175_aa rimP ribosome maturation factor RimP
3730 JAKUVW010000006.1 GCA026782085_01866 CDS open 13463-14587 _na     374_aa nusA Transcription termination/antitermination protein NusA
3731 JAKUVW010000006.1 GCA026782085_01867 CDS open 14609-14902 _na     97_aa rnpM RNase P modulator RnpM
3732 JAKUVW010000006.1 GCA026782085_01868 CDS open 14895-15194 _na     99_aa rpl7Ae YlxQ-related RNA-binding protein
3733 JAKUVW010000006.1 GCA026782085_01869 CDS open 15211-17997 _na     928_aa infB translation initiation factor IF-2
3734 JAKUVW010000006.1 GCA026782085_01870 CDS open 18163-18513 _na     116_aa rbfA 30S ribosome-binding factor RbfA
3735 JAKUVW010000006.1 GCA026782085_01871 CDS open 18771-19550 _na     259_aa Valyl-tRNA synthetase
3736 JAKUVW010000006.1 GCA026782085_01872 CDS open 19552-19734 _na     60_aa Phage protein
3737 JAKUVW010000006.1 GCA026782085_01873 CDS open 19995-20228 _na     77_aa DUF1858 domain-containing protein
3738 JAKUVW010000006.1 GCA026782085_01874 CDS open 20228-21562 _na     444_aa Hemerythrin HHE cation binding domain subfamily
3739 JAKUVW010000006.1 GCA026782085_01875 CDS open 21572-21826 _na     84_aa Aldose 1-epimerase
3740 JAKUVW010000006.1 GCA026782085_01876 CDS open 21869-22174 _na     101_aa DUF898 domain-containing protein
3741 JAKUVW010000006.1 GCA026782085_01877 CDS open 22393-22788 _na     131_aa Helicase
3742 JAKUVW010000006.1 GCA026782085_01878 CDS open 23066-23626 _na     186_aa [ribosomal protein uS5]-alanine N-acetyltransferase
3743 JAKUVW010000006.1 GCA026782085_01879 CDS open 23626-24204 _na     192_aa Shikimate kinase
3744 JAKUVW010000006.1 GCA026782085_01880 CDS open 24197-26848 _na     883_aa valine--tRNA ligase
3745 JAKUVW010000006.1 GCA026782085_01881 CDS open 26928-28745 _na     605_aa ParB/Sulfiredoxin domain-containing protein
3746 JAKUVW010000006.1 GCA026782085_01882 CDS open 28738-29589 _na     283_aa site-specific DNA-methyltransferase (adenine-specific)
3747 JAKUVW010000006.1 GCA026782085_01883 CDS open 30035-30640 _na     201_aa rpoE DNA-directed RNA polymerase subunit delta
3748 JAKUVW010000006.1 GCA026782085_01884 CDS open 30957-32564 _na     535_aa pyrG CTP synthase
3749 JAKUVW010000006.1 GCA026782085_01885 CDS open 32660-32959 _na     99_aa DUF4651 domain-containing protein
3750 JAKUVW010000006.1 GCA026782085_01886 CDS open 32956-33273 _na     105_aa Thiol-disulfide isomerase
3751 JAKUVW010000006.1 GCA026782085_01887 CDS open 33283-33909 _na     208_aa ytpR YtpR family tRNA-binding protein
3752 JAKUVW010000006.1 GCA026782085_01888 CDS open 33949-34710 _na     253_aa ydfG 3-oxoacyl-ACP reductase
3753 JAKUVW010000006.1 GCA026782085_01889 CDS open 34788-35183 _na     131_aa ssb single-stranded DNA-binding protein
3754 JAKUVW010000006.1 GCA026782085_01891 CDS open 35492-35776 _na     94_aa groES co-chaperone GroES
3755 JAKUVW010000006.1 GCA026782085_01892 CDS open 35792-37414 _na     540_aa groL chaperonin GroEL
3756 JAKUVW010000006.1 GCA026782085_01893 CDS open 37538-38305 _na     255_aa queH Epoxyqueuosine reductase QueH
3757 JAKUVW010000006.1 GCA026782085_01894 CDS open 38376-38909 _na     177_aa ygaC Nucleoside triphosphate/diphosphate phosphatase
3758 JAKUVW010000006.1 GCA026782085_01895 CDS open 38998-39774 _na     258_aa recX recombination regulator RecX
3759 JAKUVW010000006.1 GCA026782085_01896 CDS open 40042-40560 _na     172_aa Aminoglycoside phosphotransferase domain-containing protein
3760 JAKUVW010000006.1 GCA026782085_01897 CDS open 40616-41977 _na     453_aa rlmD 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD
3761 JAKUVW010000006.1 GCA026782085_01849 gene open 22-594
3762 JAKUVW010000006.1 GCA026782085_01850 gene open 752-1072 padR
3763 JAKUVW010000006.1 GCA026782085_01851 gene open 1072-1647
3764 JAKUVW010000006.1 GCA026782085_01852 gene open 1682-2194
3765 JAKUVW010000006.1 GCA026782085_01853 gene open 2355-3389 hrcA
3766 JAKUVW010000006.1 GCA026782085_01854 gene open 3416-3931 grpE
3767 JAKUVW010000006.1 GCA026782085_01855 gene open 3942-4337
3768 JAKUVW010000006.1 GCA026782085_01856 gene open 4575-6398 dnaK
3769 JAKUVW010000006.1 GCA026782085_01857 gene open 6848-7984 dnaJ
3770 JAKUVW010000006.1 GCA026782085_01858 gene open 8062-8715
3771 JAKUVW010000006.1 GCA026782085_01859 gene open 8785-9063
3772 JAKUVW010000006.1 GCA026782085_01860 gene open 9073-9483
3773 JAKUVW010000006.1 GCA026782085_01861 gene open 9551-10282 rbbA
3774 JAKUVW010000006.1 GCA026782085_01862 gene open 10279-11328 ecsB
3775 JAKUVW010000006.1 GCA026782085_01863 gene open 11376-12170 ccrZ
3776 JAKUVW010000006.1 GCA026782085_01864 gene open 12167-12802 trmB
3777 JAKUVW010000006.1 GCA026782085_01865 gene open 12881-13408 rimP
3778 JAKUVW010000006.1 GCA026782085_01866 gene open 13463-14587 nusA
3779 JAKUVW010000006.1 GCA026782085_01867 gene open 14609-14902 rnpM
3780 JAKUVW010000006.1 GCA026782085_01868 gene open 14895-15194 rpl7Ae
3781 JAKUVW010000006.1 GCA026782085_01869 gene open 15211-17997 infB
3782 JAKUVW010000006.1 GCA026782085_01870 gene open 18163-18513 rbfA
3783 JAKUVW010000006.1 GCA026782085_01871 gene open 18771-19550
3784 JAKUVW010000006.1 GCA026782085_01872 gene open 19552-19734
3785 JAKUVW010000006.1 GCA026782085_01873 gene open 19995-20228
3786 JAKUVW010000006.1 GCA026782085_01874 gene open 20228-21562
3787 JAKUVW010000006.1 GCA026782085_01875 gene open 21572-21826
3788 JAKUVW010000006.1 GCA026782085_01876 gene open 21869-22174
3789 JAKUVW010000006.1 GCA026782085_01877 gene open 22393-22788
3790 JAKUVW010000006.1 GCA026782085_01878 gene open 23066-23626
3791 JAKUVW010000006.1 GCA026782085_01879 gene open 23626-24204
3792 JAKUVW010000006.1 GCA026782085_01880 gene open 24197-26848
3793 JAKUVW010000006.1 GCA026782085_01881 gene open 26928-28745
3794 JAKUVW010000006.1 GCA026782085_01882 gene open 28738-29589
3795 JAKUVW010000006.1 GCA026782085_01883 gene open 30035-30640 rpoE
3796 JAKUVW010000006.1 GCA026782085_01884 gene open 30957-32564 pyrG
3797 JAKUVW010000006.1 GCA026782085_01885 gene open 32660-32959
3798 JAKUVW010000006.1 GCA026782085_01886 gene open 32956-33273
3799 JAKUVW010000006.1 GCA026782085_01887 gene open 33283-33909 ytpR
3800 JAKUVW010000006.1 GCA026782085_01888 gene open 33949-34710 ydfG
3801 JAKUVW010000006.1 GCA026782085_01889 gene open 34788-35183 ssb
3802 JAKUVW010000006.1 GCA026782085_01891 gene open 35492-35776 groES
3803 JAKUVW010000006.1 GCA026782085_01892 gene open 35792-37414 groL
3804 JAKUVW010000006.1 GCA026782085_01893 gene open 37538-38305 queH
3805 JAKUVW010000006.1 GCA026782085_01894 gene open 38376-38909 ygaC
3806 JAKUVW010000006.1 GCA026782085_01895 gene open 38998-39774 recX
3807 JAKUVW010000006.1 GCA026782085_01896 gene open 40042-40560
3808 JAKUVW010000006.1 GCA026782085_01897 gene open 40616-41977 rlmD
3809 JAKUVW010000006.1 GCA026782085_01898 gene open 42044-42115 trnE
3810 JAKUVW010000006.1 GCA026782085_01898 tRNA open 42044-42115 trnE tRNA-Glu(ttc)
3811 JAKUVW010000007.1 GCA026782085_01967 gene open 83166-83210 SpR20_sRNA
3812 JAKUVW010000007.1 GCA026782085_01967 ncRNA open 83166-83210 Streptococcus sRNA SpR20
3813 JAKUVW010000007.1 repeat_region open 46013-46318 CRISPR array with 5 repeats of length 35%2C consensus sequence GTTTTATCGGTCACAATTTTGGAGACTACAAAAAC and spacer length 30
3814 JAKUVW010000007.1 GCA026782085_01899 CDS open 132-758 _na     208_aa DUF402 domain-containing protein
3815 JAKUVW010000007.1 GCA026782085_01900 CDS open 755-1384 _na     209_aa Phage protein
3816 JAKUVW010000007.1 GCA026782085_01901 CDS open 1436-1969 _na     177_aa Thiol-disulfide isomerase
3817 JAKUVW010000007.1 GCA026782085_01902 CDS open 2055-2582 _na     175_aa Thiol-disulfide isomerase
3818 JAKUVW010000007.1 GCA026782085_01903 CDS open 2668-3195 _na     175_aa Thiol-disulfide isomerase
3819 JAKUVW010000007.1 GCA026782085_01904 CDS open 3375-3662 _na     95_aa tipC TipC family immunity protein
3820 JAKUVW010000007.1 GCA026782085_01905 CDS open 3678-3824 _na     48_aa hypothetical protein
3821 JAKUVW010000007.1 GCA026782085_01906 CDS open 4373-5005 _na     210_aa ABC-2 family transporter protein
3822 JAKUVW010000007.1 GCA026782085_01907 CDS open 5303-6346 _na     347_aa ddl D-alanine--D-alanine ligase
3823 JAKUVW010000007.1 GCA026782085_01908 CDS open 6431-7804 _na     457_aa murF UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase
3824 JAKUVW010000007.1 GCA026782085_01909 CDS open 7791-8411 _na     206_aa yjhB Nudix hydrolase domain-containing protein
3825 JAKUVW010000007.1 GCA026782085_01910 CDS open 8600-9304 _na     234_aa Integral membrane protein
3826 JAKUVW010000007.1 GCA026782085_01911 CDS open 9541-10911 _na     456_aa ftsA cell division protein FtsA
3827 JAKUVW010000007.1 GCA026782085_01912 CDS open 10928-12184 _na     418_aa ftsZ cell division protein FtsZ
3828 JAKUVW010000007.1 GCA026782085_01913 CDS open 12188-12859 _na     223_aa Pyridoxal phosphate homeostasis protein
3829 JAKUVW010000007.1 GCA026782085_01914 CDS open 12869-13399 _na     176_aa sepF Cell division protein SepF
3830 JAKUVW010000007.1 GCA026782085_01915 CDS open 13399-13659 _na     86_aa YGGT family protein
3831 JAKUVW010000007.1 GCA026782085_01916 CDS open 13656-14447 _na     263_aa RNA-binding protein
3832 JAKUVW010000007.1 GCA026782085_01917 CDS open 14456-14710 _na     84_aa Putative septum site-determining protein divIVA
3833 JAKUVW010000007.1 GCA026782085_01918 CDS open 14727-15521 _na     264_aa DivIVA domain protein
3834 JAKUVW010000007.1 GCA026782085_01919 CDS open 15774-18566 _na     930_aa ileS isoleucine--tRNA ligase
3835 JAKUVW010000007.1 GCA026782085_01920 CDS open 18862-26076 _na     2404_aa SIALI-17 repeat-containing surface protein
3836 JAKUVW010000007.1 GCA026782085_01921 CDS open 26326-32751 _na     2141_aa Immunoglobulin A1 protease
3837 JAKUVW010000007.1 GCA026782085_01922 CDS open 32999-33379 _na     126_aa Prophage Lp1 protein 6
3838 JAKUVW010000007.1 GCA026782085_01923 CDS open 33614-39103 _na     1829_aa zmpA zinc metalloprotease A
3839 JAKUVW010000007.1 GCA026782085_01924 CDS open 39255-39635 _na     126_aa Prophage Lp1 protein 6
3840 JAKUVW010000007.1 GCA026782085_01925 CDS open 39771-40301 _na     176_aa Phage protein
3841 JAKUVW010000007.1 GCA026782085_01926 CDS open 40416-41108 _na     230_aa gpmA phosphoglycerate mutase
3842 JAKUVW010000007.1 GCA026782085_01927 CDS open 41233-41805 _na     190_aa TetR/AcrR family transcriptional regulator
3843 JAKUVW010000007.1 GCA026782085_01928 CDS open 41946-42647 _na     233_aa ABC transporter ATP-binding protein
3844 JAKUVW010000007.1 GCA026782085_01929 CDS open 42649-45348 _na     899_aa Efflux ABC transporter%2C permease protein
3845 JAKUVW010000007.1 GCA026782085_01930 CDS open 45493-45762 _na     89_aa rpsO 30S ribosomal protein S15
3846 JAKUVW010000007.1 GCA026782085_01931 CDS open 46606-47217 _na     203_aa cadD Cadmium resistance transporter
3847 JAKUVW010000007.1 GCA026782085_01932 CDS open 47449-48495 _na     348_aa ABC-transporter Fe3+-siderophore%2C permease
3848 JAKUVW010000007.1 GCA026782085_01933 CDS open 48497-49252 _na     251_aa ABC-transporter%2C Fe3+-siderophore%2C ATP-binding protein
3849 JAKUVW010000007.1 GCA026782085_01934 CDS open 49272-50282 _na     336_aa Periplasmic binding protein
3850 JAKUVW010000007.1 GCA026782085_01935 CDS open 50263-50955 _na     230_aa Putative esterase
3851 JAKUVW010000007.1 GCA026782085_01936 CDS open 50998-51747 _na     249_aa plsC 1-acyl-sn-glycerol-3-phosphate acyltransferase
3852 JAKUVW010000007.1 GCA026782085_01937 CDS open 51880-54216 _na     778_aa exp7 putative cation-transporting ATPase exp7
3853 JAKUVW010000007.1 GCA026782085_01938 CDS open 54318-54989 _na     223_aa trmK Bcl-2 family protein
3854 JAKUVW010000007.1 GCA026782085_01939 CDS open 54983-55780 _na     265_aa nIF3 Nif3-like dinuclear metal center hexameric protein
3855 JAKUVW010000007.1 GCA026782085_01940 CDS open 55797-56900 _na     367_aa dadA Oxidoreductase%2C DadA family protein
3856 JAKUVW010000007.1 GCA026782085_01941 CDS open 57108-58127 _na     339_aa galE UDP-glucose 4-epimerase GalE
3857 JAKUVW010000007.1 GCA026782085_01942 CDS open 58111-59079 _na     322_aa Bactoprenol glucosyl transferase-like protein
3858 JAKUVW010000007.1 GCA026782085_01943 CDS open 59419-59925 _na     168_aa SAG1386/EF1546 family surface-associated protein
3859 JAKUVW010000007.1 GCA026782085_01944 CDS open 59935-60609 _na     224_aa cmk (d)CMP kinase
3860 JAKUVW010000007.1 GCA026782085_01945 CDS open 60728-61234 _na     168_aa Dihydrofolate reductase
3861 JAKUVW010000007.1 GCA026782085_01946 CDS open 61234-61404 _na     56_aa Membrane associated protein
3862 JAKUVW010000007.1 GCA026782085_01947 CDS open 61460-62668 _na     402_aa clpX ATP-dependent Clp protease ATP-binding subunit ClpX
3863 JAKUVW010000007.1 GCA026782085_01948 CDS open 62677-63264 _na     195_aa yihA ribosome biogenesis GTP-binding protein YihA/YsxC
3864 JAKUVW010000007.1 GCA026782085_01949 CDS open 63274-63654 _na     126_aa ridA Enamine/imine deaminase
3865 JAKUVW010000007.1 GCA026782085_01950 CDS open 63706-64596 _na     296_aa rapZ RNase adapter RapZ
3866 JAKUVW010000007.1 GCA026782085_01951 CDS open 64593-65570 _na     325_aa cofD Putative gluconeogenesis factor
3867 JAKUVW010000007.1 GCA026782085_01952 CDS open 65567-66478 _na     303_aa whiA DNA-binding protein WhiA
3868 JAKUVW010000007.1 GCA026782085_01953 CDS open 66511-67479 _na     322_aa trxB Ferredoxin--NADP reductase
3869 JAKUVW010000007.1 GCA026782085_01954 CDS open 67616-68473 _na     285_aa cdaA diadenylate cyclase CdaA
3870 JAKUVW010000007.1 GCA026782085_01955 CDS open 68460-69242 _na     260_aa YbbR-like protein
3871 JAKUVW010000007.1 GCA026782085_01956 CDS open 69271-70623 _na     450_aa glmM phosphoglucosamine mutase
3872 JAKUVW010000007.1 GCA026782085_01957 CDS open 70697-71071 _na     124_aa Transposase
3873 JAKUVW010000007.1 GCA026782085_01958 CDS open 71074-71922 _na     282_aa degV EDD domain protein%2C DegV family
3874 JAKUVW010000007.1 GCA026782085_01959 CDS open 72188-72955 _na     255_aa dapB 4-hydroxy-tetrahydrodipicolinate reductase
3875 JAKUVW010000007.1 GCA026782085_01960 CDS open 72967-74151 _na     394_aa cca CCA tRNA nucleotidyltransferase
3876 JAKUVW010000007.1 GCA026782085_01961 CDS open 74148-76016 _na     622_aa abc-f ribosomal protection-like ABC-F family protein
3877 JAKUVW010000007.1 GCA026782085_01962 CDS open 76013-76624 _na     203_aa Gram-positive signal peptide protein%2C YSIRK family
3878 JAKUVW010000007.1 GCA026782085_01963 CDS open 76678-77871 _na     397_aa fieF Cation-efflux pump
3879 JAKUVW010000007.1 GCA026782085_01964 CDS open 78179-80875 _na     898_aa mgtA Calcium-transporting ATPase
3880 JAKUVW010000007.1 GCA026782085_01965 CDS open 80980-81390 _na     136_aa peptide deformylase
3881 JAKUVW010000007.1 GCA026782085_01966 CDS open 81402-82997 _na     531_aa Cell shape-determining protein
3882 JAKUVW010000007.1 GCA026782085_01968 CDS open 83294-84022 _na     242_aa yaaA peroxide stress protein YaaA
3883 JAKUVW010000007.1 GCA026782085_01969 CDS open 84054-84602 _na     182_aa ssuE NADPH-dependent FMN reductase-like domain-containing protein
3884 JAKUVW010000007.1 GCA026782085_01970 CDS open 84694-85140 _na     148_aa mhqR HTH-type transcriptional regulator MhqR
3885 JAKUVW010000007.1 GCA026782085_01971 CDS open 85259-85735 _na     158_aa DUF5590 domain-containing protein
3886 JAKUVW010000007.1 GCA026782085_01972 CDS open 85745-86923 _na     392_aa Aminotransferase
3887 JAKUVW010000007.1 GCA026782085_01973 CDS open 87076-88419 _na     447_aa asnS asparagine--tRNA ligase
3888 JAKUVW010000007.1 GCA026782085_01974 CDS open 88568-88858 _na     96_aa rpsF 30S ribosomal protein S6
3889 JAKUVW010000007.1 GCA026782085_01975 CDS open 88870-89340 _na     156_aa ssbA single-stranded DNA-binding protein SsbA
3890 JAKUVW010000007.1 GCA026782085_01976 CDS open 89372-89611 _na     79_aa rpsR 30S ribosomal protein S18
3891 JAKUVW010000007.1 GCA026782085_01977 CDS open 89873-90382 _na     169_aa Acetyltransferase%2C GNAT family
3892 JAKUVW010000007.1 GCA026782085_01978 CDS open 90820-91977 _na     385_aa wecB non-hydrolyzing UDP-N-acetylglucosamine 2-epimerase
3893 JAKUVW010000007.1 GCA026782085_01979 CDS open 91974-92753 _na     259_aa GGDEF domain-containing protein
3894 JAKUVW010000007.1 GCA026782085_01980 CDS open 92763-92903 _na     46_aa DUF3149 domain-containing protein
3895 JAKUVW010000007.1 GCA026782085_01981 CDS open 92896-94206 _na     436_aa Beta-monoglucosyldiacylglycerol synthase
3896 JAKUVW010000007.1 GCA026782085_01982 CDS open 94215-95318 _na     367_aa Glucanase
3897 JAKUVW010000007.1 GCA026782085_01983 CDS open 95441-96841 _na     466_aa ppiB Peptidyl-prolyl cis-trans isomerase
3898 JAKUVW010000007.1 GCA026782085_01984 CDS open 96843-97202 _na     119_aa S1 RNA-binding domain-containing protein
3899 JAKUVW010000007.1 GCA026782085_01985 CDS open 97256-98005 _na     249_aa trmN6 Methyltransferase small domain-containing protein
3900 JAKUVW010000007.1 GCA026782085_01986 CDS open 97995-98279 _na     94_aa GIY-YIG catalytic domain protein
3901 JAKUVW010000007.1 GCA026782085_01987 CDS open 98364-99299 _na     311_aa ppaC manganese-dependent inorganic pyrophosphatase
3902 JAKUVW010000007.1 GCA026782085_01988 CDS open 99385-99897 _na     170_aa UDP-N-acetylmuramoylalanyl-D-glutamate--2%2C 6-diaminopimelate ligase
3903 JAKUVW010000007.1 GCA026782085_01989 CDS open 99881-100531 _na     216_aa DUF1803 domain-containing protein
3904 JAKUVW010000007.1 GCA026782085_01990 CDS open 100633-100833 _na     66_aa CsbD-like protein
3905 JAKUVW010000007.1 GCA026782085_01991 CDS open 100865-102310 _na     481_aa murE UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L-lysine ligase
3906 JAKUVW010000007.1 GCA026782085_01992 CDS open 102416-104038 _na     540_aa spoVB Putative cell division protein YtgP
3907 JAKUVW010000007.1 GCA026782085_01993 CDS open 104241-106199 _na     652_aa Peptide ABC transporter ATP-binding protein
3908 JAKUVW010000007.1 GCA026782085_01994 CDS open 106345-107439 _na     364_aa metC cystathionine gamma-synthase
3909 JAKUVW010000007.1 GCA026782085_01995 CDS open 107447-108613 _na     388_aa cysteine-S-conjugate beta-lyase
3910 JAKUVW010000007.1 GCA026782085_01996 CDS open 108706-111801 _na     1031_aa SNF2 family N-terminal domain protein
3911 JAKUVW010000007.1 GCA026782085_01997 CDS open 111849-112460 _na     203_aa Cystathionine gamma-synthase
3912 JAKUVW010000007.1 GCA026782085_01998 CDS open 112472-113806 _na     444_aa murC UDP-N-acetylmuramate--L-alanine ligase
3913 JAKUVW010000007.1 GCA026782085_01999 CDS open 113816-114283 _na     155_aa GNAT family N-acetyltransferase
3914 JAKUVW010000007.1 GCA026782085_02000 CDS open 114280-114783 _na     167_aa GNAT family N-acetyltransferase
3915 JAKUVW010000007.1 GCA026782085_02001 CDS open 114858-116609 _na     583_aa Endolytic murein transglycosylase
3916 JAKUVW010000007.1 GCA026782085_02002 CDS open 116672-117154 _na     160_aa greA transcription elongation factor GreA
3917 JAKUVW010000007.1 GCA026782085_02003 CDS open 117231-118595 _na     454_aa Amino acid permease
3918 JAKUVW010000007.1 GCA026782085_02004 CDS open 118696-119106 _na     136_aa Acetyltransferase%2C GNAT family
3919 JAKUVW010000007.1 GCA026782085_02005 CDS open 119164-119760 _na     198_aa HAD superfamily hydrolase
3920 JAKUVW010000007.1 GCA026782085_02006 CDS open 119907-120116 _na     69_aa xRE HTH cro/C1-type domain-containing protein
3921 JAKUVW010000007.1 GCA026782085_02007 CDS open 120106-120594 _na     162_aa Bifunctional GMP synthase/glutamine amidotransferase protein
3922 JAKUVW010000007.1 GCA026782085_02008 CDS open 120624-122171 _na     515_aa pncB nicotinate phosphoribosyltransferase
3923 JAKUVW010000007.1 GCA026782085_02009 CDS open 122168-122992 _na     274_aa nadE ammonia-dependent NAD(+) synthetase
3924 JAKUVW010000007.1 GCA026782085_02010 CDS open 123150-123701 _na     183_aa ydaF Putative ribosomal N-acetyltransferase YdaF
3925 JAKUVW010000007.1 GCA026782085_02011 CDS open 123865-124575 _na     236_aa ccdA2 thiol-disulfide oxidoreductase-associated membrane protein CcdA2
3926 JAKUVW010000007.1 GCA026782085_02012 CDS open 124589-125152 _na     187_aa Thioredoxin domain-containing protein
3927 JAKUVW010000007.1 GCA026782085_02013 CDS open 125162-126274 _na     370_aa msrAB2 bifunctional methionine sulfoxide reductase B/A protein
3928 JAKUVW010000007.1 GCA026782085_02014 CDS open 126345-127082 _na     245_aa yesN Response regulator
3929 JAKUVW010000007.1 GCA026782085_02015 CDS open 127079-128770 _na     563_aa yesM Sensor histidine kinase
3930 JAKUVW010000007.1 GCA026782085_02016 CDS open 128880-129443 _na     187_aa UPF0340 protein HMPREF8571_1353
3931 JAKUVW010000007.1 GCA026782085_02017 CDS open 129704-131419 _na     571_aa pabB aminodeoxychorismate synthase component I
3932 JAKUVW010000007.1 GCA026782085_02018 CDS open 131539-133833 _na     764_aa Putative endo-beta-N-acetylglucosaminidase
3933 JAKUVW010000007.1 GCA026782085_02019 CDS open 133959-134918 _na     319_aa nagC Glucokinase
3934 JAKUVW010000007.1 GCA026782085_02020 CDS open 135018-135857 _na     279_aa thyA thymidylate synthase
3935 JAKUVW010000007.1 GCA026782085_02021 CDS open 136008-136178 _na     56_aa DUF3042 domain-containing protein
3936 JAKUVW010000007.1 GCA026782085_02022 CDS open 136299-137183 _na     294_aa miaA tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA
3937 JAKUVW010000007.1 GCA026782085_02023 CDS open 137176-138414 _na     412_aa hflX GTPase HflX
3938 JAKUVW010000007.1 GCA026782085_02024 CDS open 138407-139030 _na     207_aa Galactose-1-phosphate uridyl transferase N-terminal domain-containing protein
3939 JAKUVW010000007.1 GCA026782085_02025 CDS open 139045-139974 _na     309_aa rnz ribonuclease Z
3940 JAKUVW010000007.1 GCA026782085_02026 CDS open 140003-140494 _na     163_aa DUF3843 domain-containing protein
3941 JAKUVW010000007.1 GCA026782085_02027 CDS open 140523-141278 _na     251_aa yqjQ NADP-dependent 3-hydroxy acid dehydrogenase YdfG
3942 JAKUVW010000007.1 GCA026782085_02028 CDS open 141676-142005 _na     109_aa DUF202 domain-containing protein
3943 JAKUVW010000007.1 GCA026782085_02029 CDS open 142450-142743 _na     97_aa Glycoside hydrolase family 13 N-terminal Ig-like domain-containing protein
3944 JAKUVW010000007.1 GCA026782085_02030 CDS open 143355-150332 _na     2325_aa Gram-positive signal peptide protein%2C YSIRK family
3945 JAKUVW010000007.1 GCA026782085_01899 gene open 132-758
3946 JAKUVW010000007.1 GCA026782085_01900 gene open 755-1384
3947 JAKUVW010000007.1 GCA026782085_01901 gene open 1436-1969
3948 JAKUVW010000007.1 GCA026782085_01902 gene open 2055-2582
3949 JAKUVW010000007.1 GCA026782085_01903 gene open 2668-3195
3950 JAKUVW010000007.1 GCA026782085_01904 gene open 3375-3662 tipC
3951 JAKUVW010000007.1 GCA026782085_01905 gene open 3678-3824
3952 JAKUVW010000007.1 GCA026782085_01906 gene open 4373-5005
3953 JAKUVW010000007.1 GCA026782085_01907 gene open 5303-6346 ddl
3954 JAKUVW010000007.1 GCA026782085_01908 gene open 6431-7804 murF
3955 JAKUVW010000007.1 GCA026782085_01909 gene open 7791-8411 yjhB
3956 JAKUVW010000007.1 GCA026782085_01910 gene open 8600-9304
3957 JAKUVW010000007.1 GCA026782085_01911 gene open 9541-10911 ftsA
3958 JAKUVW010000007.1 GCA026782085_01912 gene open 10928-12184 ftsZ
3959 JAKUVW010000007.1 GCA026782085_01913 gene open 12188-12859
3960 JAKUVW010000007.1 GCA026782085_01914 gene open 12869-13399 sepF
3961 JAKUVW010000007.1 GCA026782085_01915 gene open 13399-13659
3962 JAKUVW010000007.1 GCA026782085_01916 gene open 13656-14447
3963 JAKUVW010000007.1 GCA026782085_01917 gene open 14456-14710
3964 JAKUVW010000007.1 GCA026782085_01918 gene open 14727-15521
3965 JAKUVW010000007.1 GCA026782085_01919 gene open 15774-18566 ileS
3966 JAKUVW010000007.1 GCA026782085_01920 gene open 18862-26076
3967 JAKUVW010000007.1 GCA026782085_01921 gene open 26326-32751
3968 JAKUVW010000007.1 GCA026782085_01922 gene open 32999-33379
3969 JAKUVW010000007.1 GCA026782085_01923 gene open 33614-39103 zmpA
3970 JAKUVW010000007.1 GCA026782085_01924 gene open 39255-39635
3971 JAKUVW010000007.1 GCA026782085_01925 gene open 39771-40301
3972 JAKUVW010000007.1 GCA026782085_01926 gene open 40416-41108 gpmA
3973 JAKUVW010000007.1 GCA026782085_01927 gene open 41233-41805
3974 JAKUVW010000007.1 GCA026782085_01928 gene open 41946-42647
3975 JAKUVW010000007.1 GCA026782085_01929 gene open 42649-45348
3976 JAKUVW010000007.1 GCA026782085_01930 gene open 45493-45762 rpsO
3977 JAKUVW010000007.1 GCA026782085_01931 gene open 46606-47217 cadD
3978 JAKUVW010000007.1 GCA026782085_01932 gene open 47449-48495
3979 JAKUVW010000007.1 GCA026782085_01933 gene open 48497-49252
3980 JAKUVW010000007.1 GCA026782085_01934 gene open 49272-50282
3981 JAKUVW010000007.1 GCA026782085_01935 gene open 50263-50955
3982 JAKUVW010000007.1 GCA026782085_01936 gene open 50998-51747 plsC
3983 JAKUVW010000007.1 GCA026782085_01937 gene open 51880-54216 exp7
3984 JAKUVW010000007.1 GCA026782085_01938 gene open 54318-54989 trmK
3985 JAKUVW010000007.1 GCA026782085_01939 gene open 54983-55780 nIF3
3986 JAKUVW010000007.1 GCA026782085_01940 gene open 55797-56900 dadA
3987 JAKUVW010000007.1 GCA026782085_01941 gene open 57108-58127 galE
3988 JAKUVW010000007.1 GCA026782085_01942 gene open 58111-59079
3989 JAKUVW010000007.1 GCA026782085_01943 gene open 59419-59925
3990 JAKUVW010000007.1 GCA026782085_01944 gene open 59935-60609 cmk
3991 JAKUVW010000007.1 GCA026782085_01945 gene open 60728-61234
3992 JAKUVW010000007.1 GCA026782085_01946 gene open 61234-61404
3993 JAKUVW010000007.1 GCA026782085_01947 gene open 61460-62668 clpX
3994 JAKUVW010000007.1 GCA026782085_01948 gene open 62677-63264 yihA
3995 JAKUVW010000007.1 GCA026782085_01949 gene open 63274-63654 ridA
3996 JAKUVW010000007.1 GCA026782085_01950 gene open 63706-64596 rapZ
3997 JAKUVW010000007.1 GCA026782085_01951 gene open 64593-65570 cofD
3998 JAKUVW010000007.1 GCA026782085_01952 gene open 65567-66478 whiA
3999 JAKUVW010000007.1 GCA026782085_01953 gene open 66511-67479 trxB
4000 JAKUVW010000007.1 GCA026782085_01954 gene open 67616-68473 cdaA