HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Corynebacterium accolens (GCA_030175955.1)

Select a Genome:
BAKTA Annotations for GCA_030175955.1
Genome Selected: Corynebacterium accolens
ContigsBases CDSrRNA tmRNAtRNA
24 2458679 2255 3 1 49
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4627 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:7]    |    Number of Records Found: 4627 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3001 JASNUV010000007.1 GCA030175955_01951 CDS open 24294-24830 _na     178_aa DUF2017 domain-containing protein
3002 JASNUV010000007.1 GCA030175955_01952 CDS open 24830-25744 _na     304_aa P1 family peptidase
3003 JASNUV010000007.1 GCA030175955_01953 CDS open 25764-26390 _na     208_aa Rhomboid family intramembrane serine protease
3004 JASNUV010000007.1 GCA030175955_01954 CDS open 26390-27169 _na     259_aa murI glutamate racemase
3005 JASNUV010000007.1 GCA030175955_01955 CDS open 27230-27991 _na     253_aa Metallo-beta-lactamase domain-containing protein
3006 JASNUV010000007.1 GCA030175955_01956 CDS open 28007-28735 _na     242_aa rph ribonuclease PH
3007 JASNUV010000007.1 GCA030175955_01957 CDS open 28729-29331 _na     200_aa rdgB RdgB/HAM1 family non-canonical purine NTP pyrophosphatase
3008 JASNUV010000007.1 GCA030175955_01958 CDS open 29332-29682 _na     116_aa DUF3817 domain-containing protein
3009 JASNUV010000007.1 GCA030175955_01959 CDS open 29686-30204 _na     172_aa Glucitol operon activator protein
3010 JASNUV010000007.1 GCA030175955_01961 CDS open 30435-32342 _na     635_aa Oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase domain-containing protein
3011 JASNUV010000007.1 GCA030175955_01962 CDS open 32654-34741 _na     695_aa pflB formate C-acetyltransferase
3012 JASNUV010000007.1 GCA030175955_01963 CDS open 34765-35016 _na     83_aa grcA2 autonomous glycyl radical cofactor GrcA2
3013 JASNUV010000007.1 GCA030175955_01964 CDS open 35019-35888 _na     289_aa pflA pyruvate formate-lyase-activating protein
3014 JASNUV010000007.1 GCA030175955_01965 CDS open 35894-37138 _na     414_aa AB hydrolase-1 domain-containing protein
3015 JASNUV010000007.1 GCA030175955_01966 CDS open 37195-38100 _na     301_aa Band 7 domain-containing protein
3016 JASNUV010000007.1 GCA030175955_01967 CDS open 38105-39352 _na     415_aa Major facilitator superfamily (MFS) profile domain-containing protein
3017 JASNUV010000007.1 GCA030175955_01968 CDS open 39513-40805 _na     430_aa adenosylmethionine--8-amino-7-oxononanoate transaminase
3018 JASNUV010000007.1 GCA030175955_01969 CDS open 40802-41476 _na     224_aa bioD dethiobiotin synthase
3019 JASNUV010000007.1 GCA030175955_01970 CDS open 41498-42484 _na     328_aa HNH nuclease domain-containing protein
3020 JASNUV010000007.1 GCA030175955_01971 CDS open 42569-43186 _na     205_aa HTH tetR-type domain-containing protein
3021 JASNUV010000007.1 GCA030175955_01972 CDS open 43191-43667 _na     158_aa bcp thioredoxin-dependent thiol peroxidase
3022 JASNUV010000007.1 GCA030175955_01973 CDS open 43756-44034 _na     92_aa DUF3618 domain-containing protein
3023 JASNUV010000007.1 GCA030175955_01974 CDS open 44093-45370 _na     425_aa glutaminase
3024 JASNUV010000007.1 GCA030175955_01975 CDS open 45454-46632 _na     392_aa Fe/B12 periplasmic-binding domain-containing protein
3025 JASNUV010000007.1 GCA030175955_01976 CDS open 46632-47687 _na     351_aa Iron-siderophore ABC transporter permease
3026 JASNUV010000007.1 GCA030175955_01977 CDS open 47678-48445 _na     255_aa ABC transporter domain-containing protein
3027 JASNUV010000007.1 GCA030175955_01979 CDS open 48832-50037 _na     401_aa L%2CD-TPase catalytic domain-containing protein
3028 JASNUV010000007.1 GCA030175955_01980 CDS open 50058-51002 _na     314_aa Luciferase-like domain-containing protein
3029 JASNUV010000007.1 GCA030175955_01982 CDS open 51156-51788 _na     210_aa orn oligoribonuclease
3030 JASNUV010000007.1 GCA030175955_01983 CDS open 51959-53503 _na     514_aa Amino acid carrier protein
3031 JASNUV010000007.1 GCA030175955_01984 CDS open 53500-54300 _na     266_aa cmrA mycolate reductase
3032 JASNUV010000007.1 GCA030175955_01985 CDS open 54509-54895 _na     128_aa type II toxin-antitoxin system PemK/MazF family toxin
3033 JASNUV010000007.1 GCA030175955_01986 CDS open 54892-55491 _na     199_aa Panacea domain-containing protein
3034 JASNUV010000007.1 GCA030175955_01988 CDS open 56026-56961 _na     311_aa HTH lysR-type domain-containing protein
3035 JASNUV010000007.1 GCA030175955_01989 CDS open 57103-59067 _na     654_aa Copper resistance protein D domain-containing protein
3036 JASNUV010000007.1 GCA030175955_01990 CDS open 59260-59856 _na     198_aa Single-stranded DNA-binding protein
3037 JASNUV010000007.1 GCA030175955_01991 CDS open 59967-61637 _na     556_aa ettA energy-dependent translational throttle protein EttA
3038 JASNUV010000007.1 GCA030175955_01992 CDS open 61653-62063 _na     136_aa Thioesterase domain-containing protein
3039 JASNUV010000007.1 GCA030175955_01993 CDS open 62106-62744 _na     212_aa DUF1707 domain-containing protein
3040 JASNUV010000007.1 GCA030175955_01994 CDS open 63002-64093 _na     363_aa ald alanine dehydrogenase
3041 JASNUV010000007.1 GCA030175955_01995 CDS open 64225-64608 _na     127_aa Globin
3042 JASNUV010000007.1 GCA030175955_01996 CDS open 64609-65589 _na     326_aa mscS Mechanosensitive ion channel protein MscS
3043 JASNUV010000007.1 GCA030175955_01997 CDS open 65851-66927 _na     358_aa cystathionine gamma-synthase
3044 JASNUV010000007.1 GCA030175955_01998 CDS open 66949-68820 _na     623_aa FAD-dependent urate hydroxylase HpyO/Asp monooxygenase CreE-like FAD/NAD(P)-binding domain-containing protein
3045 JASNUV010000007.1 GCA030175955_01999 CDS open 68900-69589 _na     229_aa SDR family oxidoreductase
3046 JASNUV010000007.1 GCA030175955_02000 CDS open 69594-72110 _na     838_aa pepN aminopeptidase N
3047 JASNUV010000007.1 GCA030175955_02001 CDS open 72209-72832 _na     207_aa DSBA-like thioredoxin domain-containing protein
3048 JASNUV010000007.1 GCA030175955_02002 CDS open 72836-73234 _na     132_aa Major facilitator superfamily (MFS) profile domain-containing protein
3049 JASNUV010000007.1 GCA030175955_02003 CDS open 73352-73831 _na     159_aa ribose-5-phosphate isomerase
3050 JASNUV010000007.1 GCA030175955_02004 CDS open 73919-74752 _na     277_aa NADP-dependent oxidoreductase domain-containing protein
3051 JASNUV010000007.1 GCA030175955_02005 CDS open 74892-75119 _na     75_aa alpA Transcriptional regulator%2C AlpA family
3052 JASNUV010000007.1 GCA030175955_02006 CDS open 75109-75243 _na     44_aa Secreted protein
3053 JASNUV010000007.1 GCA030175955_02007 CDS open 75583-75804 _na     73_aa hypothetical protein
3054 JASNUV010000007.1 GCA030175955_02009 CDS open 76117-76974 _na     285_aa DUF1542 domain-containing protein
3055 JASNUV010000007.1 GCA030175955_02011 CDS open 77277-78632 _na     451_aa tig trigger factor
3056 JASNUV010000007.1 GCA030175955_02012 CDS open 78824-79435 _na     203_aa ATP-dependent Clp protease proteolytic subunit
3057 JASNUV010000007.1 GCA030175955_02013 CDS open 79456-80079 _na     207_aa ATP-dependent Clp protease proteolytic subunit
3058 JASNUV010000007.1 GCA030175955_02014 CDS open 80351-81853 _na     500_aa Major facilitator superfamily (MFS) profile domain-containing protein
3059 JASNUV010000007.1 GCA030175955_02015 CDS open 82177-83481 _na     434_aa Phosphate transporter
3060 JASNUV010000007.1 GCA030175955_02016 CDS open 83485-83775 _na     96_aa DUF4190 domain-containing protein
3061 JASNUV010000007.1 GCA030175955_02017 CDS open 83940-84194 _na     84_aa hypothetical protein
3062 JASNUV010000007.1 GCA030175955_02018 CDS open 84278-85042 _na     254_aa fabG 3-oxoacyl-ACP reductase FabG
3063 JASNUV010000007.1 GCA030175955_02019 CDS open 85273-86568 _na     431_aa clpX ATP-dependent Clp protease ATP-binding subunit ClpX
3064 JASNUV010000007.1 GCA030175955_02020 CDS open 86608-87366 _na     252_aa HTH tetR-type domain-containing protein
3065 JASNUV010000007.1 GCA030175955_02021 CDS open 87781-88737 _na     318_aa malate dehydrogenase
3066 JASNUV010000007.1 GCA030175955_02022 CDS open 88734-89555 _na     273_aa panC pantoate--beta-alanine ligase
3067 JASNUV010000007.1 GCA030175955_02023 CDS open 89567-90388 _na     273_aa panB 3-methyl-2-oxobutanoate hydroxymethyltransferase
3068 JASNUV010000007.1 GCA030175955_02024 CDS open 90413-93178 _na     921_aa valine--tRNA ligase
3069 JASNUV010000007.1 GCA030175955_02025 CDS open 93178-94749 _na     523_aa folC bifunctional tetrahydrofolate synthase/dihydrofolate synthase
3070 JASNUV010000007.1 GCA030175955_02026 CDS open 94746-95222 _na     158_aa DUF4233 domain-containing protein
3071 JASNUV010000007.1 GCA030175955_02027 CDS open 95228-95539 _na     103_aa Ribosomal protein L7/L12 C-terminal domain-containing protein
3072 JASNUV010000007.1 GCA030175955_02028 CDS open 95589-96026 _na     145_aa ndk nucleoside-diphosphate kinase
3073 JASNUV010000007.1 GCA030175955_02029 CDS open 96157-96489 _na     110_aa helix-turn-helix transcriptional regulator
3074 JASNUV010000007.1 GCA030175955_02030 CDS open 96619-97683 _na     354_aa arsB ACR3 family arsenite efflux transporter
3075 JASNUV010000007.1 GCA030175955_02031 CDS open 97680-98471 _na     263_aa HTH marR-type domain-containing protein
3076 JASNUV010000007.1 GCA030175955_02032 CDS open 98672-102523 _na     1283_aa translation initiation factor IF-2 N-terminal domain-containing protein
3077 JASNUV010000007.1 GCA030175955_02033 CDS open 102748-103053 _na     101_aa rplU 50S ribosomal protein L21
3078 JASNUV010000007.1 GCA030175955_02034 CDS open 103097-103375 _na     92_aa rpmA 50S ribosomal protein L27
3079 JASNUV010000007.1 GCA030175955_02035 CDS open 103567-104127 _na     186_aa Transposase for insertion sequence element
3080 JASNUV010000007.1 GCA030175955_02036 CDS open 104424-105068 _na     214_aa IS3 family transposase
3081 JASNUV010000007.1 GCA030175955_02037 CDS open 105265-105999 _na     244_aa IS3 family transposase
3082 JASNUV010000007.1 GCA030175955_02038 CDS open 106124-106306 _na     60_aa hypothetical protein
3083 JASNUV010000007.1 GCA030175955_02039 CDS open 106223-106492 _na     89_aa Transposase
3084 JASNUV010000007.1 GCA030175955_02040 CDS open 106592-106837 _na     81_aa hypothetical protein
3085 JASNUV010000007.1 GCA030175955_02041 CDS open 106911-107558 _na     215_aa luxR LuxR C-terminal-related transcriptional regulator
3086 JASNUV010000007.1 GCA030175955_02042 CDS open 107653-108177 _na     174_aa integrase core domain-containing protein
3087 JASNUV010000007.1 GCA030175955_02043 CDS open 108482-108763 _na     93_aa transposase
3088 JASNUV010000007.1 GCA030175955_02044 CDS open 109231-110781 _na     516_aa ATP-binding cassette domain-containing protein
3089 JASNUV010000007.1 GCA030175955_02045 CDS open 110778-113309 _na     843_aa protein kinase domain-containing protein
3090 JASNUV010000007.1 GCA030175955_02046 CDS open 113302-113940 _na     212_aa ABC transporter ATP-binding protein
3091 JASNUV010000007.1 GCA030175955_02047 CDS open 113937-115694 _na     585_aa ABC3 transporter permease C-terminal domain-containing protein
3092 JASNUV010000007.1 GCA030175955_02048 CDS open 115972-121914 _na     1980_aa DUF5979 domain-containing protein
3093 JASNUV010000007.1 GCA030175955_02049 CDS open 122177-123742 _na     521_aa SpaH/EbpB family LPXTG-anchored major pilin
3094 JASNUV010000007.1 GCA030175955_02050 CDS open 123887-125230 _na     447_aa LPXTG cell wall anchor domain-containing protein
3095 JASNUV010000007.1 GCA030175955_02051 CDS open 125227-126132 _na     301_aa class C sortase
3096 JASNUV010000007.1 GCA030175955_02052 CDS open 126208-127740 _na     510_aa obgE GTPase ObgE
3097 JASNUV010000007.1 GCA030175955_02053 CDS open 127878-129110 _na     410_aa Glutamate 5-kinase
3098 JASNUV010000007.1 GCA030175955_02054 CDS open 129134-130063 _na     309_aa D-isomer specific 2-hydroxyacid dehydrogenase NAD-binding domain-containing protein
3099 JASNUV010000007.1 GCA030175955_02055 CDS open 130220-130909 _na     229_aa Diphtheria toxin repressor
3100 JASNUV010000007.1 GCA030175955_02056 CDS open 130969-131766 _na     265_aa ABC transporter permease
3101 JASNUV010000007.1 GCA030175955_02057 CDS open 131754-132578 _na     274_aa ABC 3 transport family protein
3102 JASNUV010000007.1 GCA030175955_02058 CDS open 132575-133273 _na     232_aa ABC transporter domain-containing protein
3103 JASNUV010000007.1 GCA030175955_02059 CDS open 133270-134349 _na     359_aa Zinc ABC transporter substrate-binding protein
3104 JASNUV010000007.1 GCA030175955_02060 CDS open 134574-135842 _na     422_aa glutamate-5-semialdehyde dehydrogenase
3105 JASNUV010000007.1 GCA030175955_02061 CDS open 135847-136773 _na     308_aa PE-PPE domain-containing protein
3106 JASNUV010000007.1 GCA030175955_02062 CDS open 136792-137409 _na     205_aa nadD nicotinate-nucleotide adenylyltransferase
3107 JASNUV010000007.1 GCA030175955_02063 CDS open 137500-137970 _na     156_aa rsfS ribosome silencing factor
3108 JASNUV010000007.1 GCA030175955_02064 CDS open 137978-138676 _na     232_aa Phosphoglycerate mutase
3109 JASNUV010000007.1 GCA030175955_02065 CDS open 138676-139473 _na     265_aa degV DegV family EDD domain-containing protein
3110 JASNUV010000007.1 GCA030175955_02066 CDS open 139631-140284 _na     217_aa Helix-hairpin-helix DNA-binding motif class 1 domain-containing protein
3111 JASNUV010000007.1 GCA030175955_02067 CDS open 140305-141708 _na     467_aa ComEC/Rec2-related protein domain-containing protein
3112 JASNUV010000007.1 GCA030175955_02068 CDS open 141716-142684 _na     322_aa holA DNA polymerase III subunit delta
3113 JASNUV010000007.1 GCA030175955_02069 CDS open 142710-143084 _na     124_aa ankyrin repeat domain-containing protein
3114 JASNUV010000007.1 GCA030175955_02070 CDS open 143081-143728 _na     215_aa lysE Lysine transporter LysE
3115 JASNUV010000007.1 GCA030175955_02071 CDS open 143725-145086 _na     453_aa yqaJ YqaJ viral recombinase domain-containing protein
3116 JASNUV010000007.1 GCA030175955_02072 CDS open 145079-145921 _na     280_aa Site-specific DNA-methyltransferase (adenine-specific)
3117 JASNUV010000007.1 GCA030175955_02073 CDS open 146352-146930 _na     192_aa HTH tetR-type domain-containing protein
3118 JASNUV010000007.1 GCA030175955_01927 gene open 399-1685
3119 JASNUV010000007.1 GCA030175955_01928 gene open 1811-2539
3120 JASNUV010000007.1 GCA030175955_01929 gene open 2558-5080
3121 JASNUV010000007.1 GCA030175955_01930 gene open 5300-5659 fluC
3122 JASNUV010000007.1 GCA030175955_01931 gene open 5656-5958
3123 JASNUV010000007.1 GCA030175955_01932 gene open 5972-6490 mauE
3124 JASNUV010000007.1 GCA030175955_01933 gene open 6544-7269
3125 JASNUV010000007.1 GCA030175955_01935 gene open 7468-8265
3126 JASNUV010000007.1 GCA030175955_01936 gene open 8380-9117
3127 JASNUV010000007.1 GCA030175955_01937 gene open 9114-9935 nadE
3128 JASNUV010000007.1 GCA030175955_01938 gene open 9963-11312
3129 JASNUV010000007.1 GCA030175955_01939 gene open 11440-11562 ykgO
3130 JASNUV010000007.1 GCA030175955_01940 gene open 11933-12172 nrdH
3131 JASNUV010000007.1 GCA030175955_01941 gene open 12197-12628 nrdI
3132 JASNUV010000007.1 GCA030175955_01942 gene open 12683-14845 nrdE
3133 JASNUV010000007.1 GCA030175955_01943 gene open 14842-15528
3134 JASNUV010000007.1 GCA030175955_01944 gene open 15659-16648 nrdF
3135 JASNUV010000007.1 GCA030175955_01945 gene open 16971-18665
3136 JASNUV010000007.1 GCA030175955_01946 gene open 18747-19853 serB
3137 JASNUV010000007.1 GCA030175955_01947 gene open 19846-20568
3138 JASNUV010000007.1 GCA030175955_01948 gene open 20534-22498
3139 JASNUV010000007.1 GCA030175955_01949 gene open 22517-23845
3140 JASNUV010000007.1 GCA030175955_01950 gene open 23963-24289 clpS
3141 JASNUV010000007.1 GCA030175955_01951 gene open 24294-24830
3142 JASNUV010000007.1 GCA030175955_01952 gene open 24830-25744
3143 JASNUV010000007.1 GCA030175955_01953 gene open 25764-26390
3144 JASNUV010000007.1 GCA030175955_01954 gene open 26390-27169 murI
3145 JASNUV010000007.1 GCA030175955_01955 gene open 27230-27991
3146 JASNUV010000007.1 GCA030175955_01956 gene open 28007-28735 rph
3147 JASNUV010000007.1 GCA030175955_01957 gene open 28729-29331 rdgB
3148 JASNUV010000007.1 GCA030175955_01958 gene open 29332-29682
3149 JASNUV010000007.1 GCA030175955_01959 gene open 29686-30204
3150 JASNUV010000007.1 GCA030175955_01961 gene open 30435-32342
3151 JASNUV010000007.1 GCA030175955_01962 gene open 32654-34741 pflB
3152 JASNUV010000007.1 GCA030175955_01963 gene open 34765-35016 grcA2
3153 JASNUV010000007.1 GCA030175955_01964 gene open 35019-35888 pflA
3154 JASNUV010000007.1 GCA030175955_01965 gene open 35894-37138
3155 JASNUV010000007.1 GCA030175955_01966 gene open 37195-38100
3156 JASNUV010000007.1 GCA030175955_01967 gene open 38105-39352
3157 JASNUV010000007.1 GCA030175955_01968 gene open 39513-40805
3158 JASNUV010000007.1 GCA030175955_01969 gene open 40802-41476 bioD
3159 JASNUV010000007.1 GCA030175955_01970 gene open 41498-42484
3160 JASNUV010000007.1 GCA030175955_01971 gene open 42569-43186
3161 JASNUV010000007.1 GCA030175955_01972 gene open 43191-43667 bcp
3162 JASNUV010000007.1 GCA030175955_01973 gene open 43756-44034
3163 JASNUV010000007.1 GCA030175955_01974 gene open 44093-45370
3164 JASNUV010000007.1 GCA030175955_01975 gene open 45454-46632
3165 JASNUV010000007.1 GCA030175955_01976 gene open 46632-47687
3166 JASNUV010000007.1 GCA030175955_01977 gene open 47678-48445
3167 JASNUV010000007.1 GCA030175955_01979 gene open 48832-50037
3168 JASNUV010000007.1 GCA030175955_01980 gene open 50058-51002
3169 JASNUV010000007.1 GCA030175955_01982 gene open 51156-51788 orn
3170 JASNUV010000007.1 GCA030175955_01983 gene open 51959-53503
3171 JASNUV010000007.1 GCA030175955_01984 gene open 53500-54300 cmrA
3172 JASNUV010000007.1 GCA030175955_01985 gene open 54509-54895
3173 JASNUV010000007.1 GCA030175955_01986 gene open 54892-55491
3174 JASNUV010000007.1 GCA030175955_01988 gene open 56026-56961
3175 JASNUV010000007.1 GCA030175955_01989 gene open 57103-59067
3176 JASNUV010000007.1 GCA030175955_01990 gene open 59260-59856
3177 JASNUV010000007.1 GCA030175955_01991 gene open 59967-61637 ettA
3178 JASNUV010000007.1 GCA030175955_01992 gene open 61653-62063
3179 JASNUV010000007.1 GCA030175955_01993 gene open 62106-62744
3180 JASNUV010000007.1 GCA030175955_01994 gene open 63002-64093 ald
3181 JASNUV010000007.1 GCA030175955_01995 gene open 64225-64608
3182 JASNUV010000007.1 GCA030175955_01996 gene open 64609-65589 mscS
3183 JASNUV010000007.1 GCA030175955_01997 gene open 65851-66927
3184 JASNUV010000007.1 GCA030175955_01998 gene open 66949-68820
3185 JASNUV010000007.1 GCA030175955_01999 gene open 68900-69589
3186 JASNUV010000007.1 GCA030175955_02000 gene open 69594-72110 pepN
3187 JASNUV010000007.1 GCA030175955_02001 gene open 72209-72832
3188 JASNUV010000007.1 GCA030175955_02002 gene open 72836-73234
3189 JASNUV010000007.1 GCA030175955_02003 gene open 73352-73831
3190 JASNUV010000007.1 GCA030175955_02004 gene open 73919-74752
3191 JASNUV010000007.1 GCA030175955_02005 gene open 74892-75119 alpA
3192 JASNUV010000007.1 GCA030175955_02006 gene open 75109-75243
3193 JASNUV010000007.1 GCA030175955_02007 gene open 75583-75804
3194 JASNUV010000007.1 GCA030175955_02009 gene open 76117-76974
3195 JASNUV010000007.1 GCA030175955_02011 gene open 77277-78632 tig
3196 JASNUV010000007.1 GCA030175955_02012 gene open 78824-79435
3197 JASNUV010000007.1 GCA030175955_02013 gene open 79456-80079
3198 JASNUV010000007.1 GCA030175955_02014 gene open 80351-81853
3199 JASNUV010000007.1 GCA030175955_02015 gene open 82177-83481
3200 JASNUV010000007.1 GCA030175955_02016 gene open 83485-83775
3201 JASNUV010000007.1 GCA030175955_02017 gene open 83940-84194
3202 JASNUV010000007.1 GCA030175955_02018 gene open 84278-85042 fabG
3203 JASNUV010000007.1 GCA030175955_02019 gene open 85273-86568 clpX
3204 JASNUV010000007.1 GCA030175955_02020 gene open 86608-87366
3205 JASNUV010000007.1 GCA030175955_02021 gene open 87781-88737
3206 JASNUV010000007.1 GCA030175955_02022 gene open 88734-89555 panC
3207 JASNUV010000007.1 GCA030175955_02023 gene open 89567-90388 panB
3208 JASNUV010000007.1 GCA030175955_02024 gene open 90413-93178
3209 JASNUV010000007.1 GCA030175955_02025 gene open 93178-94749 folC
3210 JASNUV010000007.1 GCA030175955_02026 gene open 94746-95222
3211 JASNUV010000007.1 GCA030175955_02027 gene open 95228-95539
3212 JASNUV010000007.1 GCA030175955_02028 gene open 95589-96026 ndk
3213 JASNUV010000007.1 GCA030175955_02029 gene open 96157-96489
3214 JASNUV010000007.1 GCA030175955_02030 gene open 96619-97683 arsB
3215 JASNUV010000007.1 GCA030175955_02031 gene open 97680-98471
3216 JASNUV010000007.1 GCA030175955_02032 gene open 98672-102523
3217 JASNUV010000007.1 GCA030175955_02033 gene open 102748-103053 rplU
3218 JASNUV010000007.1 GCA030175955_02034 gene open 103097-103375 rpmA
3219 JASNUV010000007.1 GCA030175955_02035 gene open 103567-104127
3220 JASNUV010000007.1 GCA030175955_02036 gene open 104424-105068
3221 JASNUV010000007.1 GCA030175955_02037 gene open 105265-105999
3222 JASNUV010000007.1 GCA030175955_02038 gene open 106124-106306
3223 JASNUV010000007.1 GCA030175955_02039 gene open 106223-106492
3224 JASNUV010000007.1 GCA030175955_02040 gene open 106592-106837
3225 JASNUV010000007.1 GCA030175955_02041 gene open 106911-107558 luxR
3226 JASNUV010000007.1 GCA030175955_02042 gene open 107653-108177
3227 JASNUV010000007.1 GCA030175955_02043 gene open 108482-108763
3228 JASNUV010000007.1 GCA030175955_02044 gene open 109231-110781
3229 JASNUV010000007.1 GCA030175955_02045 gene open 110778-113309
3230 JASNUV010000007.1 GCA030175955_02046 gene open 113302-113940
3231 JASNUV010000007.1 GCA030175955_02047 gene open 113937-115694
3232 JASNUV010000007.1 GCA030175955_02048 gene open 115972-121914
3233 JASNUV010000007.1 GCA030175955_02049 gene open 122177-123742
3234 JASNUV010000007.1 GCA030175955_02050 gene open 123887-125230
3235 JASNUV010000007.1 GCA030175955_02051 gene open 125227-126132
3236 JASNUV010000007.1 GCA030175955_02052 gene open 126208-127740 obgE
3237 JASNUV010000007.1 GCA030175955_02053 gene open 127878-129110
3238 JASNUV010000007.1 GCA030175955_02054 gene open 129134-130063
3239 JASNUV010000007.1 GCA030175955_02055 gene open 130220-130909
3240 JASNUV010000007.1 GCA030175955_02056 gene open 130969-131766
3241 JASNUV010000007.1 GCA030175955_02057 gene open 131754-132578
3242 JASNUV010000007.1 GCA030175955_02058 gene open 132575-133273
3243 JASNUV010000007.1 GCA030175955_02059 gene open 133270-134349
3244 JASNUV010000007.1 GCA030175955_02060 gene open 134574-135842
3245 JASNUV010000007.1 GCA030175955_02061 gene open 135847-136773
3246 JASNUV010000007.1 GCA030175955_02062 gene open 136792-137409 nadD
3247 JASNUV010000007.1 GCA030175955_02063 gene open 137500-137970 rsfS
3248 JASNUV010000007.1 GCA030175955_02064 gene open 137978-138676
3249 JASNUV010000007.1 GCA030175955_02065 gene open 138676-139473 degV
3250 JASNUV010000007.1 GCA030175955_02066 gene open 139631-140284
3251 JASNUV010000007.1 GCA030175955_02067 gene open 140305-141708
3252 JASNUV010000007.1 GCA030175955_02068 gene open 141716-142684 holA
3253 JASNUV010000007.1 GCA030175955_02069 gene open 142710-143084
3254 JASNUV010000007.1 GCA030175955_02070 gene open 143081-143728 lysE
3255 JASNUV010000007.1 GCA030175955_02071 gene open 143725-145086 yqaJ
3256 JASNUV010000007.1 GCA030175955_02072 gene open 145079-145921
3257 JASNUV010000007.1 GCA030175955_02073 gene open 146352-146930
3258 JASNUV010000007.1 GCA030175955_01934 gene open 7346-7418 trnA
3259 JASNUV010000007.1 GCA030175955_01960 gene open 30301-30382 trnL
3260 JASNUV010000007.1 GCA030175955_01978 gene open 48550-48622 trnK
3261 JASNUV010000007.1 GCA030175955_01981 gene open 51031-51106 trnH
3262 JASNUV010000007.1 GCA030175955_01987 gene open 55912-55985 trnR
3263 JASNUV010000007.1 GCA030175955_02008 gene open 75921-75995 trnG
3264 JASNUV010000007.1 GCA030175955_02010 gene open 77109-77182 trnP
3265 JASNUV010000007.1 GCA030175955_01934 tRNA open 7346-7418 trnA tRNA-Ala(ggc)
3266 JASNUV010000007.1 GCA030175955_01960 tRNA open 30301-30382 trnL tRNA-Leu(tag)
3267 JASNUV010000007.1 GCA030175955_01978 tRNA open 48550-48622 trnK tRNA-Lys(ctt)
3268 JASNUV010000007.1 GCA030175955_01981 tRNA open 51031-51106 trnH tRNA-His(gtg)
3269 JASNUV010000007.1 GCA030175955_01987 tRNA open 55912-55985 trnR tRNA-Arg(tct)
3270 JASNUV010000007.1 GCA030175955_02008 tRNA open 75921-75995 trnG tRNA-Gly(tcc)
3271 JASNUV010000007.1 GCA030175955_02010 tRNA open 77109-77182 trnP tRNA-Pro(tgg)
3272 JASNUV010000008.1 GCA030175955_02179 gene open 117836-118291 RNaseP_bact_a
3273 JASNUV010000008.1 GCA030175955_02179 ncRNA open 117836-118291 Bacterial RNase P class A
3274 JASNUV010000008.1 repeat_region open 95918-99190 CRISPR array with 54 repeats of length 28%2C consensus sequence GTGCTCCCCGCGTGAGCGGGGATGAGCC and spacer length 33
3275 JASNUV010000008.1 GCA030175955_02074 CDS open 10-273 _na     87_aa rpsT 30S ribosomal protein S20
3276 JASNUV010000008.1 GCA030175955_02075 CDS open 499-1035 _na     178_aa PemK-like protein
3277 JASNUV010000008.1 GCA030175955_02076 CDS open 1054-2904 _na     616_aa lepA translation elongation factor 4
3278 JASNUV010000008.1 GCA030175955_02077 CDS open 3151-5052 _na     633_aa Phospholipase C
3279 JASNUV010000008.1 GCA030175955_02078 CDS open 5056-6177 _na     373_aa Imelysin-like domain-containing protein
3280 JASNUV010000008.1 GCA030175955_02079 CDS open 6177-7403 _na     408_aa efeB iron uptake transporter deferrochelatase/peroxidase subunit
3281 JASNUV010000008.1 GCA030175955_02080 CDS open 7782-8771 _na     329_aa HNH nuclease domain-containing protein
3282 JASNUV010000008.1 GCA030175955_02081 CDS open 8929-10305 _na     458_aa Peptidase M20 dimerisation domain-containing protein
3283 JASNUV010000008.1 GCA030175955_02082 CDS open 10308-10688 _na     126_aa Oxidoreductase
3284 JASNUV010000008.1 GCA030175955_02083 CDS open 10688-12571 _na     627_aa Choline transporter
3285 JASNUV010000008.1 GCA030175955_02084 CDS open 12636-14327 _na     563_aa Integral membrane bound transporter domain-containing protein
3286 JASNUV010000008.1 GCA030175955_02085 CDS open 14389-15837 _na     482_aa nikD nickel import ATP-binding protein NikD
3287 JASNUV010000008.1 GCA030175955_02086 CDS open 15834-16655 _na     273_aa ABC transmembrane type-1 domain-containing protein
3288 JASNUV010000008.1 GCA030175955_02087 CDS open 16652-17617 _na     321_aa ABC transmembrane type-1 domain-containing protein
3289 JASNUV010000008.1 GCA030175955_02088 CDS open 17614-19134 _na     506_aa Solute-binding protein family 5 domain-containing protein
3290 JASNUV010000008.1 GCA030175955_02089 CDS open 19323-20342 _na     339_aa Luciferase-like domain-containing protein
3291 JASNUV010000008.1 GCA030175955_02090 CDS open 20509-21936 _na     475_aa brnQ branched-chain amino acid transport system II carrier protein
3292 JASNUV010000008.1 GCA030175955_02091 CDS open 22148-23278 _na     376_aa cysteine-S-conjugate beta-lyase
3293 JASNUV010000008.1 GCA030175955_02092 CDS open 23321-25207 _na     628_aa Iron ABC transporter ATP-binding protein
3294 JASNUV010000008.1 GCA030175955_02093 CDS open 25375-25923 _na     182_aa Secreted protein
3295 JASNUV010000008.1 GCA030175955_02094 CDS open 25920-26471 _na     183_aa idi isopentenyl-diphosphate Delta-isomerase
3296 JASNUV010000008.1 GCA030175955_02095 CDS open 26475-27737 _na     420_aa Carboxylic ester hydrolase
3297 JASNUV010000008.1 GCA030175955_02096 CDS open 27776-27979 _na     67_aa hypothetical protein
3298 JASNUV010000008.1 GCA030175955_02097 CDS open 27972-28247 _na     91_aa hypothetical protein
3299 JASNUV010000008.1 GCA030175955_02098 CDS open 28399-30231 _na     610_aa Acyl-CoA synthetase
3300 JASNUV010000008.1 GCA030175955_02099 CDS open 30456-31136 _na     226_aa DUF222 domain-containing protein
3301 JASNUV010000008.1 GCA030175955_02100 CDS open 31291-32226 _na     311_aa DUF559 domain-containing protein
3302 JASNUV010000008.1 GCA030175955_02101 CDS open 32391-33545 _na     384_aa Orc1-like AAA ATPase domain-containing protein
3303 JASNUV010000008.1 GCA030175955_02102 CDS open 33653-34711 _na     352_aa CNNM transmembrane domain-containing protein
3304 JASNUV010000008.1 GCA030175955_02103 CDS open 34711-36099 _na     462_aa hemolysin family protein
3305 JASNUV010000008.1 GCA030175955_02104 CDS open 36249-37388 _na     379_aa hemW radical SAM family heme chaperone HemW
3306 JASNUV010000008.1 GCA030175955_02105 CDS open 37552-38592 _na     346_aa hrcA heat-inducible transcriptional repressor HrcA
3307 JASNUV010000008.1 GCA030175955_02106 CDS open 38674-39834 _na     386_aa dnaJ molecular chaperone DnaJ
3308 JASNUV010000008.1 GCA030175955_02107 CDS open 39834-40577 _na     247_aa 16S rRNA (uracil(1498)-N(3))-methyltransferase
3309 JASNUV010000008.1 GCA030175955_02108 CDS open 40588-41565 _na     325_aa PhoH-like protein
3310 JASNUV010000008.1 GCA030175955_02109 CDS open 41566-42186 _na     206_aa ybeY rRNA maturation RNase YbeY
3311 JASNUV010000008.1 GCA030175955_02110 CDS open 42238-43086 _na     282_aa pdxY pyridoxal kinase PdxY
3312 JASNUV010000008.1 GCA030175955_02111 CDS open 43213-44232 _na     339_aa formamidase
3313 JASNUV010000008.1 GCA030175955_02112 CDS open 44458-45015 _na     185_aa Secreted protein
3314 JASNUV010000008.1 GCA030175955_02113 CDS open 45145-46182 _na     345_aa era GTPase Era
3315 JASNUV010000008.1 GCA030175955_02114 CDS open 46189-46905 _na     238_aa recO DNA repair protein RecO
3316 JASNUV010000008.1 GCA030175955_02115 CDS open 46916-47668 _na     250_aa isoprenyl transferase
3317 JASNUV010000008.1 GCA030175955_02116 CDS open 47700-48128 _na     142_aa Ferric uptake regulation protein
3318 JASNUV010000008.1 GCA030175955_02117 CDS open 48188-48478 _na     96_aa HTH arsR-type domain-containing protein
3319 JASNUV010000008.1 GCA030175955_02118 CDS open 48667-50046 _na     459_aa glycine--tRNA ligase
3320 JASNUV010000008.1 GCA030175955_02119 CDS open 50051-50560 _na     169_aa DUF4178 domain-containing protein
3321 JASNUV010000008.1 GCA030175955_02120 CDS open 50560-51087 _na     175_aa Htaa domain-containing protein
3322 JASNUV010000008.1 GCA030175955_02121 CDS open 51119-53167 _na     682_aa TPM domain-containing protein
3323 JASNUV010000008.1 GCA030175955_02122 CDS open 53209-53796 _na     195_aa DUF218 domain-containing protein
3324 JASNUV010000008.1 GCA030175955_02123 CDS open 53808-55100 _na     430_aa deoxyguanosinetriphosphate triphosphohydrolase
3325 JASNUV010000008.1 GCA030175955_02124 CDS open 55307-55540 _na     77_aa Barstar family protein
3326 JASNUV010000008.1 GCA030175955_02125 CDS open 55543-55965 _na     140_aa Ribonuclease
3327 JASNUV010000008.1 GCA030175955_02126 CDS open 56191-58110 _na     639_aa DNA primase
3328 JASNUV010000008.1 GCA030175955_02127 CDS open 58179-58460 _na     93_aa ytxH YtxH domain-containing protein
3329 JASNUV010000008.1 GCA030175955_02128 CDS open 58651-58779 _na     42_aa hypothetical protein
3330 JASNUV010000008.1 GCA030175955_02129 CDS open 58792-60009 _na     405_aa putative acetyl-CoA acetyltransferase
3331 JASNUV010000008.1 GCA030175955_02130 CDS open 60019-60792 _na     257_aa Pca regulon regulatory protein
3332 JASNUV010000008.1 GCA030175955_02131 CDS open 60909-61652 _na     247_aa 3-oxoacid CoA-transferase%2C A subunit
3333 JASNUV010000008.1 GCA030175955_02132 CDS open 61652-62293 _na     213_aa Succinyl-CoA:3-ketoacid-coenzyme A transferase subunit B
3334 JASNUV010000008.1 GCA030175955_02133 CDS open 62368-63714 _na     448_aa Major facilitator superfamily (MFS) profile domain-containing protein
3335 JASNUV010000008.1 GCA030175955_02134 CDS open 64139-65695 _na     518_aa Pyruvate carboxyltransferase domain-containing protein
3336 JASNUV010000008.1 GCA030175955_02135 CDS open 65698-66237 _na     179_aa accB acetyl-CoA carboxylase biotin carboxyl carrier protein
3337 JASNUV010000008.1 GCA030175955_02136 CDS open 66255-67631 _na     458_aa accC acetyl-CoA carboxylase biotin carboxylase subunit
3338 JASNUV010000008.1 GCA030175955_02137 CDS open 67776-68699 _na     307_aa eamA EamA domain-containing protein
3339 JASNUV010000008.1 GCA030175955_02138 CDS open 68776-69828 _na     350_aa Vanillate O-demethylase oxidoreductase
3340 JASNUV010000008.1 GCA030175955_02139 CDS open 70278-71591 _na     437_aa ER-bound oxygenase mpaB/mpaB'/Rubber oxygenase catalytic domain-containing protein
3341 JASNUV010000008.1 GCA030175955_02140 CDS open 71649-73025 _na     458_aa ER-bound oxygenase mpaB/mpaB'/Rubber oxygenase catalytic domain-containing protein
3342 JASNUV010000008.1 GCA030175955_02141 CDS open 73061-74266 _na     401_aa ER-bound oxygenase mpaB/mpaB'/Rubber oxygenase catalytic domain-containing protein
3343 JASNUV010000008.1 GCA030175955_02142 CDS open 74398-75771 _na     457_aa Aldehyde dehydrogenase domain-containing protein
3344 JASNUV010000008.1 GCA030175955_02144 CDS open 76302-77018 _na     238_aa 6-carboxyhexanoate--CoA ligase
3345 JASNUV010000008.1 GCA030175955_02145 CDS open 77015-78184 _na     389_aa 8-amino-7-oxononanoate synthase
3346 JASNUV010000008.1 GCA030175955_02146 CDS open 78246-78629 _na     127_aa hypothetical protein
3347 JASNUV010000008.1 GCA030175955_02147 CDS open 78969-80102 _na     377_aa jetD Wadjet protein JetD C-terminal domain-containing protein
3348 JASNUV010000008.1 GCA030175955_02148 CDS open 80089-83460 _na     1123_aa ATP-binding protein
3349 JASNUV010000008.1 GCA030175955_02149 CDS open 83453-84103 _na     216_aa DUF4194 domain-containing protein
3350 JASNUV010000008.1 GCA030175955_02150 CDS open 84103-85572 _na     489_aa DUF3375 domain-containing protein
3351 JASNUV010000008.1 GCA030175955_02151 CDS open 85708-86127 _na     139_aa Organic hydroperoxide resistance protein
3352 JASNUV010000008.1 GCA030175955_02152 CDS open 86867-86977 _na     36_aa hypothetical protein
3353 JASNUV010000008.1 GCA030175955_02153 CDS open 87221-89425 _na     734_aa CRISPR-associated helicase Cas3'
3354 JASNUV010000008.1 GCA030175955_02154 CDS open 89525-91270 _na     581_aa casA type I-E CRISPR-associated protein Cse1/CasA
3355 JASNUV010000008.1 GCA030175955_02155 CDS open 91263-91934 _na     223_aa casB type I-E CRISPR-associated protein Cse2/CasB
3356 JASNUV010000008.1 GCA030175955_02156 CDS open 91970-93112 _na     380_aa cas7e type I-E CRISPR-associated protein Cas7/Cse4/CasC
3357 JASNUV010000008.1 GCA030175955_02157 CDS open 93240-93842 _na     200_aa cas5e type I-E CRISPR-associated protein Cas5/CasD
3358 JASNUV010000008.1 GCA030175955_02158 CDS open 93839-94537 _na     232_aa cas6e type I-E CRISPR-associated protein Cas6/Cse3/CasE
3359 JASNUV010000008.1 GCA030175955_02159 CDS open 94537-95475 _na     312_aa cas1e type I-E CRISPR-associated endonuclease Cas1e
3360 JASNUV010000008.1 GCA030175955_02161 CDS open 99788-100318 _na     176_aa DUF3558 domain-containing protein
3361 JASNUV010000008.1 GCA030175955_02162 CDS open 100398-101504 _na     368_aa Glycine transporter domain-containing protein
3362 JASNUV010000008.1 GCA030175955_02163 CDS open 101612-103210 _na     532_aa mscS Mechanosensitive ion channel MscS domain-containing protein
3363 JASNUV010000008.1 GCA030175955_02164 CDS open 103393-104484 _na     363_aa NADH:flavin oxidoreductase/NADH oxidase N-terminal domain-containing protein
3364 JASNUV010000008.1 GCA030175955_02165 CDS open 104698-105492 _na     264_aa Beta-lactamase-related domain-containing protein
3365 JASNUV010000008.1 GCA030175955_02166 CDS open 105575-105691 _na     38_aa hypothetical protein
3366 JASNUV010000008.1 GCA030175955_02167 CDS open 106303-106719 _na     138_aa hypothetical protein
3367 JASNUV010000008.1 GCA030175955_02168 CDS open 106796-107584 _na     262_aa TIGR01457 family HAD hydrolase
3368 JASNUV010000008.1 GCA030175955_02169 CDS open 107581-107880 _na     99_aa Acyl carrier protein
3369 JASNUV010000008.1 GCA030175955_02170 CDS open 108033-110777 _na     914_aa aceE pyruvate dehydrogenase (acetyl-transferring)%2C homodimeric type
3370 JASNUV010000008.1 GCA030175955_02171 CDS open 111136-111534 _na     132_aa DUF3052 domain-containing protein
3371 JASNUV010000008.1 GCA030175955_02173 CDS open 111784-112719 _na     311_aa SURF1-like protein
3372 JASNUV010000008.1 GCA030175955_02174 CDS open 112730-113221 _na     163_aa protein-tyrosine-phosphatase
3373 JASNUV010000008.1 GCA030175955_02175 CDS open 113315-114457 _na     380_aa Nif3-like dinuclear metal center hexameric protein
3374 JASNUV010000008.1 GCA030175955_02176 CDS open 114458-115177 _na     239_aa C4-type zinc ribbon domain-containing protein
3375 JASNUV010000008.1 GCA030175955_02177 CDS open 115174-116370 _na     398_aa bifunctional RNase H/acid phosphatase
3376 JASNUV010000008.1 GCA030175955_02178 CDS open 116703-117767 _na     354_aa adhP alcohol dehydrogenase AdhP
3377 JASNUV010000008.1 GCA030175955_02180 CDS open 118295-119569 _na     424_aa Galactokinase N-terminal domain-containing protein
3378 JASNUV010000008.1 GCA030175955_02181 CDS open 119822-120016 _na     64_aa SPOR domain-containing protein
3379 JASNUV010000008.1 GCA030175955_02182 CDS open 120086-121843 _na     585_aa CHAD domain-containing protein
3380 JASNUV010000008.1 GCA030175955_02183 CDS open 122019-123059 _na     346_aa DUF2786 domain-containing protein
3381 JASNUV010000008.1 GCA030175955_02184 CDS open 123255-124592 _na     445_aa glnA type I glutamate--ammonia ligase
3382 JASNUV010000008.1 GCA030175955_02185 CDS open 124600-127659 _na     1019_aa bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase
3383 JASNUV010000008.1 GCA030175955_02186 CDS open 127757-128119 _na     120_aa Amphi-Trp domain-containing protein
3384 JASNUV010000008.1 GCA030175955_02187 CDS open 128121-128588 _na     155_aa LytR/CpsA/Psr regulator C-terminal domain-containing protein
3385 JASNUV010000008.1 GCA030175955_02188 CDS open 128686-128796 _na     36_aa hypothetical protein
3386 JASNUV010000008.1 GCA030175955_02189 CDS open 128992-129768 _na     258_aa AAA+ ATPase domain-containing protein
3387 JASNUV010000008.1 GCA030175955_02190 CDS open 129773-131035 _na     420_aa Major facilitator superfamily (MFS) profile domain-containing protein
3388 JASNUV010000008.1 GCA030175955_02191 CDS open 131119-132561 _na     480_aa thrC threonine synthase
3389 JASNUV010000008.1 GCA030175955_02192 CDS open 132569-132715 _na     48_aa Cell division protein
3390 JASNUV010000008.1 GCA030175955_02193 CDS open 132741-133535 _na     264_aa Peptidase S1 domain-containing protein
3391 JASNUV010000008.1 GCA030175955_02194 CDS open 133566-134111 _na     181_aa Nudix hydrolase domain-containing protein
3392 JASNUV010000008.1 GCA030175955_02195 CDS open 134108-134482 _na     124_aa hypothetical protein
3393 JASNUV010000008.1 GCA030175955_02196 CDS open 134513-135400 _na     295_aa Voltage-dependent anion channel
3394 JASNUV010000008.1 GCA030175955_02197 CDS open 135690-137123 _na     477_aa glnA type I glutamate--ammonia ligase
3395 JASNUV010000008.1 GCA030175955_02198 CDS open 137242-137715 _na     157_aa RDD domain-containing protein
3396 JASNUV010000008.1 GCA030175955_02199 CDS open 137869-138654 _na     261_aa DUF4191 domain-containing protein
3397 JASNUV010000008.1 GCA030175955_02200 CDS open 138737-139801 _na     354_aa lipA lipoyl synthase
3398 JASNUV010000008.1 GCA030175955_02201 CDS open 139938-140741 _na     267_aa lipB lipoyl(octanoyl) transferase LipB
3399 JASNUV010000008.1 GCA030175955_02202 CDS open 140860-141252 _na     130_aa gcvH glycine cleavage system protein GcvH
3400 JASNUV010000008.1 GCA030175955_02203 CDS open 141298-142410 _na     370_aa gcvT glycine cleavage system aminomethyltransferase GcvT
3401 JASNUV010000008.1 GCA030175955_02204 CDS open 142413-145256 _na     947_aa gcvP aminomethyl-transferring glycine dehydrogenase
3402 JASNUV010000008.1 GCA030175955_02205 CDS open 145554-146474 _na     306_aa hypothetical protein
3403 JASNUV010000008.1 GCA030175955_02074 gene open 10-273 rpsT
3404 JASNUV010000008.1 GCA030175955_02075 gene open 499-1035
3405 JASNUV010000008.1 GCA030175955_02076 gene open 1054-2904 lepA
3406 JASNUV010000008.1 GCA030175955_02077 gene open 3151-5052
3407 JASNUV010000008.1 GCA030175955_02078 gene open 5056-6177
3408 JASNUV010000008.1 GCA030175955_02079 gene open 6177-7403 efeB
3409 JASNUV010000008.1 GCA030175955_02080 gene open 7782-8771
3410 JASNUV010000008.1 GCA030175955_02081 gene open 8929-10305
3411 JASNUV010000008.1 GCA030175955_02082 gene open 10308-10688
3412 JASNUV010000008.1 GCA030175955_02083 gene open 10688-12571
3413 JASNUV010000008.1 GCA030175955_02084 gene open 12636-14327
3414 JASNUV010000008.1 GCA030175955_02085 gene open 14389-15837 nikD
3415 JASNUV010000008.1 GCA030175955_02086 gene open 15834-16655
3416 JASNUV010000008.1 GCA030175955_02087 gene open 16652-17617
3417 JASNUV010000008.1 GCA030175955_02088 gene open 17614-19134
3418 JASNUV010000008.1 GCA030175955_02089 gene open 19323-20342
3419 JASNUV010000008.1 GCA030175955_02090 gene open 20509-21936 brnQ
3420 JASNUV010000008.1 GCA030175955_02091 gene open 22148-23278
3421 JASNUV010000008.1 GCA030175955_02092 gene open 23321-25207
3422 JASNUV010000008.1 GCA030175955_02093 gene open 25375-25923
3423 JASNUV010000008.1 GCA030175955_02094 gene open 25920-26471 idi
3424 JASNUV010000008.1 GCA030175955_02095 gene open 26475-27737
3425 JASNUV010000008.1 GCA030175955_02096 gene open 27776-27979
3426 JASNUV010000008.1 GCA030175955_02097 gene open 27972-28247
3427 JASNUV010000008.1 GCA030175955_02098 gene open 28399-30231
3428 JASNUV010000008.1 GCA030175955_02099 gene open 30456-31136
3429 JASNUV010000008.1 GCA030175955_02100 gene open 31291-32226
3430 JASNUV010000008.1 GCA030175955_02101 gene open 32391-33545
3431 JASNUV010000008.1 GCA030175955_02102 gene open 33653-34711
3432 JASNUV010000008.1 GCA030175955_02103 gene open 34711-36099
3433 JASNUV010000008.1 GCA030175955_02104 gene open 36249-37388 hemW
3434 JASNUV010000008.1 GCA030175955_02105 gene open 37552-38592 hrcA
3435 JASNUV010000008.1 GCA030175955_02106 gene open 38674-39834 dnaJ
3436 JASNUV010000008.1 GCA030175955_02107 gene open 39834-40577
3437 JASNUV010000008.1 GCA030175955_02108 gene open 40588-41565
3438 JASNUV010000008.1 GCA030175955_02109 gene open 41566-42186 ybeY
3439 JASNUV010000008.1 GCA030175955_02110 gene open 42238-43086 pdxY
3440 JASNUV010000008.1 GCA030175955_02111 gene open 43213-44232
3441 JASNUV010000008.1 GCA030175955_02112 gene open 44458-45015
3442 JASNUV010000008.1 GCA030175955_02113 gene open 45145-46182 era
3443 JASNUV010000008.1 GCA030175955_02114 gene open 46189-46905 recO
3444 JASNUV010000008.1 GCA030175955_02115 gene open 46916-47668
3445 JASNUV010000008.1 GCA030175955_02116 gene open 47700-48128
3446 JASNUV010000008.1 GCA030175955_02117 gene open 48188-48478
3447 JASNUV010000008.1 GCA030175955_02118 gene open 48667-50046
3448 JASNUV010000008.1 GCA030175955_02119 gene open 50051-50560
3449 JASNUV010000008.1 GCA030175955_02120 gene open 50560-51087
3450 JASNUV010000008.1 GCA030175955_02121 gene open 51119-53167
3451 JASNUV010000008.1 GCA030175955_02122 gene open 53209-53796
3452 JASNUV010000008.1 GCA030175955_02123 gene open 53808-55100
3453 JASNUV010000008.1 GCA030175955_02124 gene open 55307-55540
3454 JASNUV010000008.1 GCA030175955_02125 gene open 55543-55965
3455 JASNUV010000008.1 GCA030175955_02126 gene open 56191-58110
3456 JASNUV010000008.1 GCA030175955_02127 gene open 58179-58460 ytxH
3457 JASNUV010000008.1 GCA030175955_02128 gene open 58651-58779
3458 JASNUV010000008.1 GCA030175955_02129 gene open 58792-60009
3459 JASNUV010000008.1 GCA030175955_02130 gene open 60019-60792
3460 JASNUV010000008.1 GCA030175955_02131 gene open 60909-61652
3461 JASNUV010000008.1 GCA030175955_02132 gene open 61652-62293
3462 JASNUV010000008.1 GCA030175955_02133 gene open 62368-63714
3463 JASNUV010000008.1 GCA030175955_02134 gene open 64139-65695
3464 JASNUV010000008.1 GCA030175955_02135 gene open 65698-66237 accB
3465 JASNUV010000008.1 GCA030175955_02136 gene open 66255-67631 accC
3466 JASNUV010000008.1 GCA030175955_02137 gene open 67776-68699 eamA
3467 JASNUV010000008.1 GCA030175955_02138 gene open 68776-69828
3468 JASNUV010000008.1 GCA030175955_02139 gene open 70278-71591
3469 JASNUV010000008.1 GCA030175955_02140 gene open 71649-73025
3470 JASNUV010000008.1 GCA030175955_02141 gene open 73061-74266
3471 JASNUV010000008.1 GCA030175955_02142 gene open 74398-75771
3472 JASNUV010000008.1 GCA030175955_02144 gene open 76302-77018
3473 JASNUV010000008.1 GCA030175955_02145 gene open 77015-78184
3474 JASNUV010000008.1 GCA030175955_02146 gene open 78246-78629
3475 JASNUV010000008.1 GCA030175955_02147 gene open 78969-80102 jetD
3476 JASNUV010000008.1 GCA030175955_02148 gene open 80089-83460
3477 JASNUV010000008.1 GCA030175955_02149 gene open 83453-84103
3478 JASNUV010000008.1 GCA030175955_02150 gene open 84103-85572
3479 JASNUV010000008.1 GCA030175955_02151 gene open 85708-86127
3480 JASNUV010000008.1 GCA030175955_02152 gene open 86867-86977
3481 JASNUV010000008.1 GCA030175955_02153 gene open 87221-89425
3482 JASNUV010000008.1 GCA030175955_02154 gene open 89525-91270 casA
3483 JASNUV010000008.1 GCA030175955_02155 gene open 91263-91934 casB
3484 JASNUV010000008.1 GCA030175955_02156 gene open 91970-93112 cas7e
3485 JASNUV010000008.1 GCA030175955_02157 gene open 93240-93842 cas5e
3486 JASNUV010000008.1 GCA030175955_02158 gene open 93839-94537 cas6e
3487 JASNUV010000008.1 GCA030175955_02159 gene open 94537-95475 cas1e
3488 JASNUV010000008.1 GCA030175955_02161 gene open 99788-100318
3489 JASNUV010000008.1 GCA030175955_02162 gene open 100398-101504
3490 JASNUV010000008.1 GCA030175955_02163 gene open 101612-103210 mscS
3491 JASNUV010000008.1 GCA030175955_02164 gene open 103393-104484
3492 JASNUV010000008.1 GCA030175955_02165 gene open 104698-105492
3493 JASNUV010000008.1 GCA030175955_02166 gene open 105575-105691
3494 JASNUV010000008.1 GCA030175955_02167 gene open 106303-106719
3495 JASNUV010000008.1 GCA030175955_02168 gene open 106796-107584
3496 JASNUV010000008.1 GCA030175955_02169 gene open 107581-107880
3497 JASNUV010000008.1 GCA030175955_02170 gene open 108033-110777 aceE
3498 JASNUV010000008.1 GCA030175955_02171 gene open 111136-111534
3499 JASNUV010000008.1 GCA030175955_02173 gene open 111784-112719
3500 JASNUV010000008.1 GCA030175955_02174 gene open 112730-113221