HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Corynebacterium propinquum (GCA_030176315.1)

Select a Genome:
BAKTA Annotations for GCA_030176315.1
Genome Selected: Corynebacterium propinquum
ContigsBases CDSrRNA tmRNAtRNA
45 2510206 2272 3 1 50
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4664 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:3]    |    Number of Records Found: 4664 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1001 JASNUH010000002.1 GCA030176315_01349 gene open 138035-138622
1002 JASNUH010000002.1 GCA030176315_01350 gene open 138639-139103 moaE
1003 JASNUH010000002.1 GCA030176315_01351 gene open 139159-140373 thiF
1004 JASNUH010000002.1 GCA030176315_01352 gene open 140370-141002
1005 JASNUH010000002.1 GCA030176315_01353 gene open 141031-141510 moaC
1006 JASNUH010000002.1 GCA030176315_01354 gene open 141535-142953
1007 JASNUH010000002.1 GCA030176315_01355 gene open 142969-144087 moaA
1008 JASNUH010000002.1 GCA030176315_01356 gene open 144163-145986
1009 JASNUH010000002.1 GCA030176315_01357 gene open 146491-148551 rho
1010 JASNUH010000002.1 GCA030176315_01358 gene open 148555-149628 prfA
1011 JASNUH010000002.1 GCA030176315_01359 gene open 149670-150515 prmC
1012 JASNUH010000002.1 GCA030176315_01360 gene open 150654-151316
1013 JASNUH010000002.1 GCA030176315_01361 gene open 151316-152491
1014 JASNUH010000002.1 GCA030176315_01362 gene open 152550-153017
1015 JASNUH010000002.1 GCA030176315_01363 gene open 153434-154237 atpB
1016 JASNUH010000002.1 GCA030176315_01364 gene open 154332-154568
1017 JASNUH010000002.1 GCA030176315_01365 gene open 154614-155183
1018 JASNUH010000002.1 GCA030176315_01366 gene open 155190-156017
1019 JASNUH010000002.1 GCA030176315_01367 gene open 156096-157736 atpA
1020 JASNUH010000002.1 GCA030176315_01368 gene open 157793-158767
1021 JASNUH010000002.1 GCA030176315_01369 gene open 158771-160222 atpD
1022 JASNUH010000002.1 GCA030176315_01370 gene open 160239-160610
1023 JASNUH010000002.1 GCA030176315_01371 gene open 160930-161388
1024 JASNUH010000002.1 GCA030176315_01372 gene open 161436-162128 nucS
1025 JASNUH010000002.1 GCA030176315_01373 gene open 162343-162537
1026 JASNUH010000002.1 GCA030176315_01374 gene open 162584-162880
1027 JASNUH010000002.1 GCA030176315_01375 gene open 162964-163968
1028 JASNUH010000002.1 GCA030176315_01376 gene open 164039-164977
1029 JASNUH010000002.1 GCA030176315_01377 gene open 164999-165880
1030 JASNUH010000002.1 GCA030176315_01378 gene open 166057-166860
1031 JASNUH010000002.1 GCA030176315_01379 gene open 166888-167853
1032 JASNUH010000002.1 GCA030176315_01380 gene open 167903-169024
1033 JASNUH010000002.1 GCA030176315_01381 gene open 169029-169868
1034 JASNUH010000002.1 GCA030176315_01382 gene open 169960-171033 mnmA
1035 JASNUH010000002.1 GCA030176315_01383 gene open 171048-172127 metE
1036 JASNUH010000002.1 GCA030176315_01384 gene open 172144-172458
1037 JASNUH010000002.1 GCA030176315_01385 gene open 172458-173504
1038 JASNUH010000002.1 GCA030176315_01386 gene open 173515-174186
1039 JASNUH010000002.1 GCA030176315_01387 gene open 174297-176375 ligA
1040 JASNUH010000002.1 GCA030176315_01388 gene open 176364-177026
1041 JASNUH010000002.1 GCA030176315_01389 gene open 177223-177513 gatC
1042 JASNUH010000002.1 GCA030176315_01390 gene open 177574-179061 gatA
1043 JASNUH010000002.1 GCA030176315_01391 gene open 179071-179394
1044 JASNUH010000002.1 GCA030176315_01392 gene open 179649-180983
1045 JASNUH010000002.1 GCA030176315_01393 gene open 181119-182150
1046 JASNUH010000002.1 GCA030176315_01394 gene open 182122-183750 gatB
1047 JASNUH010000002.1 GCA030176315_01395 gene open 183856-185274 ykvI
1048 JASNUH010000002.1 GCA030176315_01396 gene open 185431-186525
1049 JASNUH010000002.1 GCA030176315_01397 gene open 186692-187534
1050 JASNUH010000002.1 GCA030176315_01398 gene open 187604-188836 doxX
1051 JASNUH010000002.1 GCA030176315_01399 gene open 188871-190208
1052 JASNUH010000002.1 GCA030176315_01400 gene open 190156-191997 ilvD
1053 JASNUH010000002.1 GCA030176315_01401 gene open 192087-192671
1054 JASNUH010000002.1 GCA030176315_01402 gene open 192695-193933 mscS
1055 JASNUH010000002.1 GCA030176315_01403 gene open 194250-196121
1056 JASNUH010000002.1 GCA030176315_01404 gene open 196124-196639 ilvN
1057 JASNUH010000002.1 GCA030176315_01405 gene open 196750-197763 ilvC
1058 JASNUH010000002.1 GCA030176315_01406 gene open 197750-198709
1059 JASNUH010000002.1 GCA030176315_01407 gene open 198916-200496 serA
1060 JASNUH010000002.1 GCA030176315_01408 gene open 200499-201716
1061 JASNUH010000002.1 GCA030176315_01409 gene open 201713-202426
1062 JASNUH010000002.1 GCA030176315_01410 gene open 202547-203464
1063 JASNUH010000002.1 GCA030176315_01411 gene open 203512-204531
1064 JASNUH010000002.1 GCA030176315_01412 gene open 204542-206212
1065 JASNUH010000002.1 GCA030176315_01413 gene open 206263-208128
1066 JASNUH010000002.1 GCA030176315_01414 gene open 208157-208807
1067 JASNUH010000002.1 GCA030176315_01415 gene open 208827-209621
1068 JASNUH010000002.1 GCA030176315_01416 gene open 209626-210723
1069 JASNUH010000002.1 GCA030176315_01417 gene open 210749-212278 gltX
1070 JASNUH010000002.1 GCA030176315_01418 gene open 212225-212407
1071 JASNUH010000002.1 GCA030176315_01421 gene open 212680-212970
1072 JASNUH010000002.1 GCA030176315_01238 gene open 15118-15189 trnQ
1073 JASNUH010000002.1 GCA030176315_01252 gene open 31350-31426 trnL
1074 JASNUH010000002.1 GCA030176315_01337 gene open 123185-123258 trnR
1075 JASNUH010000002.1 GCA030176315_01419 gene open 212432-212503 trnQ
1076 JASNUH010000002.1 GCA030176315_01420 gene open 212537-212609 trnE
1077 JASNUH010000002.1 GCA030176315_01238 tRNA open 15118-15189 trnQ tRNA-Gln(ttg)
1078 JASNUH010000002.1 GCA030176315_01252 tRNA open 31350-31426 trnL tRNA-Leu(taa)
1079 JASNUH010000002.1 GCA030176315_01337 tRNA open 123185-123258 trnR tRNA-Arg(ccg)
1080 JASNUH010000002.1 GCA030176315_01419 tRNA open 212432-212503 trnQ tRNA-Gln(ctg)
1081 JASNUH010000002.1 GCA030176315_01420 tRNA open 212537-212609 trnE tRNA-Glu(ctc)
1082 JASNUH010000003.1 GCA030176315_01570 gene open 82247-82536 5_ureB_sRNA
1083 JASNUH010000003.1 GCA030176315_01652 gene open 173082-173516 RNaseP_bact_a
1084 JASNUH010000003.1 GCA030176315_01570 ncRNA open 82247-82536 5' ureB small RNA
1085 JASNUH010000003.1 GCA030176315_01652 ncRNA open 173082-173516 Bacterial RNase P class A
1086 JASNUH010000003.1 regulatory_region open 122133-122238 mraW RNA
1087 JASNUH010000003.1 repeat_region open 68917-70542 CRISPR array with 27 repeats of length 29%2C consensus sequence CTCTTCTCCGCGCATGCGGAGGTAATTCC and spacer length 32
1088 JASNUH010000003.1 GCA030176315_01493 CDS open 1382-3505 _na     707_aa GA module-containing protein
1089 JASNUH010000003.1 GCA030176315_01494 CDS open 3798-5054 _na     418_aa Amidohydrolase
1090 JASNUH010000003.1 GCA030176315_01495 CDS open 5067-6413 _na     448_aa pyk pyruvate kinase
1091 JASNUH010000003.1 GCA030176315_01496 CDS open 6532-7440 _na     302_aa lgt prolipoprotein diacylglyceryl transferase
1092 JASNUH010000003.1 GCA030176315_01497 CDS open 7463-8350 _na     295_aa indole-3-glycerol-phosphate synthase
1093 JASNUH010000003.1 GCA030176315_01498 CDS open 8440-9174 _na     244_aa TIGR02234 family membrane protein
1094 JASNUH010000003.1 GCA030176315_01499 CDS open 9176-9535 _na     119_aa hisI phosphoribosyl-AMP cyclohydrolase
1095 JASNUH010000003.1 GCA030176315_01500 CDS open 9532-10353 _na     273_aa hisF Imidazole glycerol phosphate synthase subunit HisF
1096 JASNUH010000003.1 GCA030176315_01501 CDS open 10371-11192 _na     273_aa Inositol-phosphate phosphatase
1097 JASNUH010000003.1 GCA030176315_01502 CDS open 11205-11996 _na     263_aa priA bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA
1098 JASNUH010000003.1 GCA030176315_01503 CDS open 12026-12658 _na     210_aa hisH imidazole glycerol phosphate synthase subunit HisH
1099 JASNUH010000003.1 GCA030176315_01504 CDS open 12674-14071 _na     465_aa Major facilitator superfamily (MFS) profile domain-containing protein
1100 JASNUH010000003.1 GCA030176315_01505 CDS open 14175-14342 _na     55_aa Major facilitator superfamily (MFS) profile domain-containing protein
1101 JASNUH010000003.1 GCA030176315_01506 CDS open 14342-14947 _na     201_aa hisB imidazoleglycerol-phosphate dehydratase HisB
1102 JASNUH010000003.1 GCA030176315_01507 CDS open 14944-16038 _na     364_aa histidinol-phosphate transaminase
1103 JASNUH010000003.1 GCA030176315_01508 CDS open 16042-17460 _na     472_aa Histidinol dehydrogenase
1104 JASNUH010000003.1 GCA030176315_01509 CDS open 17473-18090 _na     205_aa DUF2567 domain-containing protein
1105 JASNUH010000003.1 GCA030176315_01510 CDS open 18094-18810 _na     238_aa ARC6/PARC6 family protein
1106 JASNUH010000003.1 GCA030176315_01511 CDS open 19025-19720 _na     231_aa tetR TetR family transcriptional regulator
1107 JASNUH010000003.1 GCA030176315_01512 CDS open 19724-21124 _na     466_aa DNA polymerase III subunit epsilon
1108 JASNUH010000003.1 GCA030176315_01513 CDS open 21246-23003 _na     585_aa BCCT family transporter
1109 JASNUH010000003.1 GCA030176315_01514 CDS open 23040-23729 _na     229_aa Peptidase S1 domain-containing protein
1110 JASNUH010000003.1 GCA030176315_01515 CDS open 23828-24682 _na     284_aa ABC transporter domain-containing protein
1111 JASNUH010000003.1 GCA030176315_01516 CDS open 24682-26778 _na     698_aa ABC transporter domain-containing protein
1112 JASNUH010000003.1 GCA030176315_01517 CDS open 26778-27743 _na     321_aa ABC transmembrane type-1 domain-containing protein
1113 JASNUH010000003.1 GCA030176315_01518 CDS open 27823-29460 _na     545_aa Solute-binding protein family 5 domain-containing protein
1114 JASNUH010000003.1 GCA030176315_01519 CDS open 29749-30450 _na     233_aa FadR/GntR family transcriptional regulator
1115 JASNUH010000003.1 GCA030176315_01520 CDS open 30478-31200 _na     240_aa N-acylglucosamine-6-phosphate 2-epimerase
1116 JASNUH010000003.1 GCA030176315_01521 CDS open 31272-32234 _na     320_aa ROK family protein
1117 JASNUH010000003.1 GCA030176315_01522 CDS open 32245-33186 _na     313_aa N-acetylneuraminate lyase
1118 JASNUH010000003.1 GCA030176315_01523 CDS open 33341-34525 _na     394_aa N-acetylglucosamine-6-phosphate deacetylase
1119 JASNUH010000003.1 GCA030176315_01524 CDS open 34605-35378 _na     257_aa Glucosamine-6-phosphate deaminase
1120 JASNUH010000003.1 GCA030176315_01525 CDS open 35386-38628 _na     1080_aa LPXTG cell wall anchor domain-containing protein
1121 JASNUH010000003.1 GCA030176315_01526 CDS open 38905-41826 _na     973_aa D-lactate dehydrogenase (cytochrome)
1122 JASNUH010000003.1 GCA030176315_01527 CDS open 41919-42608 _na     229_aa hypothetical protein
1123 JASNUH010000003.1 GCA030176315_01528 CDS open 42656-43054 _na     132_aa RNA-binding S4 domain-containing protein
1124 JASNUH010000003.1 GCA030176315_01529 CDS open 43091-43321 _na     76_aa Secreted protein
1125 JASNUH010000003.1 GCA030176315_01530 CDS open 43334-43990 _na     218_aa yigZ YigZ family protein
1126 JASNUH010000003.1 GCA030176315_01531 CDS open 43990-45291 _na     433_aa ilvA threonine ammonia-lyase IlvA
1127 JASNUH010000003.1 GCA030176315_01532 CDS open 45317-48895 _na     1192_aa dnaE DNA polymerase III subunit alpha
1128 JASNUH010000003.1 GCA030176315_01533 CDS open 48919-49116 _na     65_aa Lipoprotein
1129 JASNUH010000003.1 GCA030176315_01534 CDS open 49122-49718 _na     198_aa Secreted protein
1130 JASNUH010000003.1 GCA030176315_01535 CDS open 49747-50682 _na     311_aa Pseudouridine synthase
1131 JASNUH010000003.1 GCA030176315_01536 CDS open 50672-51157 _na     161_aa lspA signal peptidase II
1132 JASNUH010000003.1 GCA030176315_01537 CDS open 51276-52409 _na     377_aa Secreted protein
1133 JASNUH010000003.1 GCA030176315_01538 CDS open 52438-54087 _na     549_aa HNH endonuclease signature motif containing protein
1134 JASNUH010000003.1 GCA030176315_01539 CDS open 54812-56485 _na     557_aa L-lactate permease
1135 JASNUH010000003.1 GCA030176315_01540 CDS open 56735-57361 _na     208_aa Secreted protein
1136 JASNUH010000003.1 GCA030176315_01541 CDS open 57501-58526 _na     341_aa Asparaginase
1137 JASNUH010000003.1 GCA030176315_01542 CDS open 58506-59942 _na     478_aa DNA polymerase IV
1138 JASNUH010000003.1 GCA030176315_01543 CDS open 59963-60676 _na     237_aa cas5e type I-E CRISPR-associated protein Cas5/CasD
1139 JASNUH010000003.1 GCA030176315_01544 CDS open 60669-61754 _na     361_aa cas7e type I-E CRISPR-associated protein Cas7/Cse4/CasC
1140 JASNUH010000003.1 GCA030176315_01545 CDS open 61775-62419 _na     214_aa Type I-E CRISPR-associated protein Cse2/CasB
1141 JASNUH010000003.1 GCA030176315_01546 CDS open 62416-64032 _na     538_aa Type I-E CRISPR-associated protein Cse1/CasA
1142 JASNUH010000003.1 GCA030176315_01547 CDS open 64288-64974 _na     228_aa Type I-E CRISPR-associated protein Cas6/Cse3/CasE
1143 JASNUH010000003.1 GCA030176315_01548 CDS open 64971-67646 _na     891_aa HD Cas3-type domain-containing protein
1144 JASNUH010000003.1 GCA030176315_01549 CDS open 67648-68583 _na     311_aa cas1e type I-E CRISPR-associated endonuclease Cas1e
1145 JASNUH010000003.1 GCA030176315_01550 CDS open 68584-68895 _na     103_aa cas2e type I-E CRISPR-associated endoribonuclease Cas2e
1146 JASNUH010000003.1 GCA030176315_01551 CDS open 70618-70872 _na     84_aa hypothetical protein
1147 JASNUH010000003.1 GCA030176315_01552 CDS open 70878-71096 _na     72_aa Resolvase HTH domain-containing protein
1148 JASNUH010000003.1 GCA030176315_01553 CDS open 71089-71217 _na     42_aa hypothetical protein
1149 JASNUH010000003.1 GCA030176315_01554 CDS open 71296-71415 _na     39_aa hypothetical protein
1150 JASNUH010000003.1 GCA030176315_01555 CDS open 71507-71716 _na     69_aa Tyrosine-type recombinase/integrase
1151 JASNUH010000003.1 GCA030176315_01556 CDS open 72314-72634 _na     106_aa cdiI CdiI immunity protein domain-containing protein
1152 JASNUH010000003.1 GCA030176315_01557 CDS open 72787-72951 _na     54_aa hypothetical protein
1153 JASNUH010000003.1 GCA030176315_01558 CDS open 73019-73165 _na     48_aa hypothetical protein
1154 JASNUH010000003.1 GCA030176315_01559 CDS open 73314-73574 _na     86_aa hypothetical protein
1155 JASNUH010000003.1 GCA030176315_01560 CDS open 73873-74910 _na     345_aa htaA HtaA protein
1156 JASNUH010000003.1 GCA030176315_01561 CDS open 74918-75862 _na     314_aa ABC transporter substrate-binding protein
1157 JASNUH010000003.1 GCA030176315_01562 CDS open 75859-76575 _na     238_aa ABC transporter domain-containing protein
1158 JASNUH010000003.1 GCA030176315_01563 CDS open 76572-77711 _na     379_aa ABC transporter permease
1159 JASNUH010000003.1 GCA030176315_01564 CDS open 77808-78113 _na     101_aa Metalloregulator ArsR/SmtB family transcription factor
1160 JASNUH010000003.1 GCA030176315_01565 CDS open 78151-79026 _na     291_aa ureD Urease accessory protein UreD
1161 JASNUH010000003.1 GCA030176315_01566 CDS open 79028-79642 _na     204_aa ureG urease accessory protein UreG
1162 JASNUH010000003.1 GCA030176315_01567 CDS open 79724-80473 _na     249_aa ureF Urease accessory protein UreF
1163 JASNUH010000003.1 GCA030176315_01568 CDS open 80454-80927 _na     157_aa ureE urease accessory protein UreE
1164 JASNUH010000003.1 GCA030176315_01569 CDS open 80979-82691 _na     570_aa ureC urease subunit alpha
1165 JASNUH010000003.1 GCA030176315_01571 CDS open 82745-83071 _na     108_aa urease subunit beta
1166 JASNUH010000003.1 GCA030176315_01572 CDS open 83106-83408 _na     100_aa urease subunit gamma
1167 JASNUH010000003.1 GCA030176315_01573 CDS open 83822-84343 _na     173_aa hypothetical protein
1168 JASNUH010000003.1 GCA030176315_01574 CDS open 84364-84492 _na     42_aa hypothetical protein
1169 JASNUH010000003.1 GCA030176315_01575 CDS open 84563-85168 _na     201_aa hypothetical protein
1170 JASNUH010000003.1 GCA030176315_01576 CDS open 85658-86629 _na     323_aa DUF5666 domain-containing protein
1171 JASNUH010000003.1 GCA030176315_01577 CDS open 87418-87993 _na     191_aa hypothetical protein
1172 JASNUH010000003.1 GCA030176315_01578 CDS open 88029-89015 _na     328_aa hypothetical protein
1173 JASNUH010000003.1 GCA030176315_01579 CDS open 89352-90281 _na     309_aa Secreted protein
1174 JASNUH010000003.1 GCA030176315_01580 CDS open 90591-91703 _na     370_aa alkene reductase
1175 JASNUH010000003.1 GCA030176315_01581 CDS open 91756-92883 _na     375_aa Alanine racemase
1176 JASNUH010000003.1 GCA030176315_01582 CDS open 93052-96303 _na     1083_aa ileS isoleucine--tRNA ligase
1177 JASNUH010000003.1 GCA030176315_01583 CDS open 96528-96680 _na     50_aa Zinc-binding dehydrogenase
1178 JASNUH010000003.1 GCA030176315_01584 CDS open 96929-97732 _na     267_aa Cysteine-rich domain-containing protein
1179 JASNUH010000003.1 GCA030176315_01585 CDS open 97732-99207 _na     491_aa LutB/LldF family L-lactate oxidation iron-sulfur protein
1180 JASNUH010000003.1 GCA030176315_01586 CDS open 99207-99839 _na     210_aa LUD domain-containing protein
1181 JASNUH010000003.1 GCA030176315_01587 CDS open 100179-101666 _na     495_aa Sodium/glutamate symporter
1182 JASNUH010000003.1 GCA030176315_01588 CDS open 101837-102910 _na     357_aa Cell wall synthesis protein Wag31
1183 JASNUH010000003.1 GCA030176315_01589 CDS open 103102-103395 _na     97_aa yggT YggT family protein
1184 JASNUH010000003.1 GCA030176315_01590 CDS open 103514-104092 _na     192_aa sepF Cell division protein SepF
1185 JASNUH010000003.1 GCA030176315_01591 CDS open 104173-104913 _na     246_aa Pyridoxal phosphate homeostasis protein
1186 JASNUH010000003.1 GCA030176315_01592 CDS open 104916-105689 _na     257_aa pgeF peptidoglycan editing factor PgeF
1187 JASNUH010000003.1 GCA030176315_01593 CDS open 105705-106949 _na     414_aa ftsZ cell division protein FtsZ
1188 JASNUH010000003.1 GCA030176315_01594 CDS open 107183-107839 _na     218_aa FtsQ-type POTRA domain-containing protein
1189 JASNUH010000003.1 GCA030176315_01595 CDS open 107842-109374 _na     510_aa murC UDP-N-acetylmuramate--L-alanine ligase
1190 JASNUH010000003.1 GCA030176315_01596 CDS open 109443-110606 _na     387_aa UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase
1191 JASNUH010000003.1 GCA030176315_01597 CDS open 110579-112033 _na     484_aa ftsW putative peptidoglycan glycosyltransferase FtsW
1192 JASNUH010000003.1 GCA030176315_01598 CDS open 112093-113550 _na     485_aa murD UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase
1193 JASNUH010000003.1 GCA030176315_01599 CDS open 113614-114711 _na     365_aa mraY phospho-N-acetylmuramoyl-pentapeptide-transferase
1194 JASNUH010000003.1 GCA030176315_01600 CDS open 114785-116326 _na     513_aa UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase
1195 JASNUH010000003.1 GCA030176315_01601 CDS open 116326-117894 _na     522_aa UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2%2C6-diaminopimelate ligase
1196 JASNUH010000003.1 GCA030176315_01602 CDS open 117997-119949 _na     650_aa Penicillin-binding protein transpeptidase domain-containing protein
1197 JASNUH010000003.1 GCA030176315_01603 CDS open 120059-120961 _na     300_aa ftsL Cell division protein FtsL
1198 JASNUH010000003.1 GCA030176315_01604 CDS open 120964-122100 _na     378_aa rsmH 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH
1199 JASNUH010000003.1 GCA030176315_01605 CDS open 122245-122679 _na     144_aa mraZ division/cell wall cluster transcriptional repressor MraZ
1200 JASNUH010000003.1 GCA030176315_01606 CDS open 123293-123808 _na     171_aa DUF3040 domain-containing protein
1201 JASNUH010000003.1 GCA030176315_01607 CDS open 123934-124458 _na     174_aa SAV-6107 family HEPN domain-containing protein
1202 JASNUH010000003.1 GCA030176315_01608 CDS open 124604-125173 _na     189_aa GNAT family N-acetyltransferase
1203 JASNUH010000003.1 GCA030176315_01609 CDS open 125277-126404 _na     375_aa Polyprenyl synthetase family protein
1204 JASNUH010000003.1 GCA030176315_01610 CDS open 126404-127960 _na     518_aa alpha-(1->6)-mannopyranosyltransferase A
1205 JASNUH010000003.1 GCA030176315_01611 CDS open 127929-128312 _na     127_aa Rv2175c family DNA-binding protein
1206 JASNUH010000003.1 GCA030176315_01612 CDS open 128359-129894 _na     511_aa non-specific serine/threonine protein kinase
1207 JASNUH010000003.1 GCA030176315_01613 CDS open 129975-131453 _na     492_aa class II 3-deoxy-7-phosphoheptulonate synthase
1208 JASNUH010000003.1 GCA030176315_01614 CDS open 131396-131911 _na     171_aa polyadenylate-specific 3'-exoribonuclease AS
1209 JASNUH010000003.1 GCA030176315_01615 CDS open 132074-132229 _na     51_aa hypothetical protein
1210 JASNUH010000003.1 GCA030176315_01616 CDS open 132294-133391 _na     365_aa Acyltransferase family protein
1211 JASNUH010000003.1 GCA030176315_01617 CDS open 133410-134150 _na     246_aa Lysophospholipid acyltransferase family protein
1212 JASNUH010000003.1 GCA030176315_01618 CDS open 134193-135161 _na     322_aa ROK family protein
1213 JASNUH010000003.1 GCA030176315_01619 CDS open 135310-136347 _na     345_aa NlpC/P60 family protein
1214 JASNUH010000003.1 GCA030176315_01620 CDS open 136434-137030 _na     198_aa NlpC/P60 family protein
1215 JASNUH010000003.1 GCA030176315_01621 CDS open 137144-137641 _na     165_aa hypothetical protein
1216 JASNUH010000003.1 GCA030176315_01622 CDS open 137738-139366 _na     542_aa Cytochrome bc1 complex cytochrome b subunit
1217 JASNUH010000003.1 GCA030176315_01623 CDS open 139366-140586 _na     406_aa Cytochrome bc1 complex Rieske iron-sulfur subunit
1218 JASNUH010000003.1 GCA030176315_01624 CDS open 140586-141476 _na     296_aa Cytochrome bc1 complex cytochrome c subunit
1219 JASNUH010000003.1 GCA030176315_01625 CDS open 141544-142164 _na     206_aa cytochrome-c oxidase
1220 JASNUH010000003.1 GCA030176315_01626 CDS open 142688-143119 _na     143_aa Cytochrome c oxidase polypeptide 4
1221 JASNUH010000003.1 GCA030176315_01627 CDS open 143140-144231 _na     363_aa cytochrome-c oxidase
1222 JASNUH010000003.1 GCA030176315_01628 CDS open 144653-146575 _na     640_aa asnB asparagine synthase (glutamine-hydrolyzing)
1223 JASNUH010000003.1 GCA030176315_01629 CDS open 146793-147137 _na     114_aa iscA FeS cluster biogenesis domain-containing protein
1224 JASNUH010000003.1 GCA030176315_01630 CDS open 147269-148039 _na     256_aa DUF3043 domain-containing protein
1225 JASNUH010000003.1 GCA030176315_01631 CDS open 148092-149021 _na     309_aa Nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase
1226 JASNUH010000003.1 GCA030176315_01632 CDS open 149018-150166 _na     382_aa branched-chain amino acid aminotransferase
1227 JASNUH010000003.1 GCA030176315_01633 CDS open 150244-151779 _na     511_aa leucyl aminopeptidase
1228 JASNUH010000003.1 GCA030176315_01634 CDS open 151818-152210 _na     130_aa Oxidoreductase
1229 JASNUH010000003.1 GCA030176315_01635 CDS open 152337-154481 _na     714_aa sucB 2-oxoglutarate dehydrogenase%2C E2 component%2C dihydrolipoamide succinyltransferase
1230 JASNUH010000003.1 GCA030176315_01636 CDS open 154710-155897 _na     395_aa MFS transporter
1231 JASNUH010000003.1 GCA030176315_01637 CDS open 155983-156753 _na     256_aa lipB lipoyl(octanoyl) transferase LipB
1232 JASNUH010000003.1 GCA030176315_01638 CDS open 156833-157876 _na     347_aa lipA lipoyl synthase
1233 JASNUH010000003.1 GCA030176315_01639 CDS open 157997-158776 _na     259_aa DUF4191 domain-containing protein
1234 JASNUH010000003.1 GCA030176315_01640 CDS open 158783-159271 _na     162_aa RDD domain-containing protein
1235 JASNUH010000003.1 GCA030176315_01641 CDS open 159326-160375 _na     349_aa SGNH/GDSL hydrolase family protein
1236 JASNUH010000003.1 GCA030176315_01642 CDS open 160368-160907 _na     179_aa Nudix hydrolase domain-containing protein
1237 JASNUH010000003.1 GCA030176315_01643 CDS open 160998-162083 _na     361_aa Trypsin-like serine protease
1238 JASNUH010000003.1 GCA030176315_01644 CDS open 162115-163581 _na     488_aa thrC threonine synthase
1239 JASNUH010000003.1 GCA030176315_01645 CDS open 163599-165104 _na     501_aa Lysosomal dipeptide transporter MFSD1
1240 JASNUH010000003.1 GCA030176315_01646 CDS open 165101-165634 _na     177_aa hypothetical protein
1241 JASNUH010000003.1 GCA030176315_01647 CDS open 165769-166233 _na     154_aa hypothetical protein
1242 JASNUH010000003.1 GCA030176315_01648 CDS open 166315-169554 _na     1079_aa bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase
1243 JASNUH010000003.1 GCA030176315_01649 CDS open 169670-171007 _na     445_aa glnA type I glutamate--ammonia ligase
1244 JASNUH010000003.1 GCA030176315_01650 CDS open 171054-171266 _na     70_aa SPOR domain-containing protein
1245 JASNUH010000003.1 GCA030176315_01651 CDS open 171531-173051 _na     506_aa Galactokinase family protein
1246 JASNUH010000003.1 GCA030176315_01653 CDS open 173585-174649 _na     354_aa adhP alcohol dehydrogenase AdhP
1247 JASNUH010000003.1 GCA030176315_01654 CDS open 174982-176148 _na     388_aa bifunctional RNase H/acid phosphatase
1248 JASNUH010000003.1 GCA030176315_01655 CDS open 176162-176962 _na     266_aa C4-type zinc ribbon domain-containing protein
1249 JASNUH010000003.1 GCA030176315_01656 CDS open 177083-178231 _na     382_aa Nif3-like dinuclear metal center hexameric protein
1250 JASNUH010000003.1 GCA030176315_01657 CDS open 178311-178826 _na     171_aa protein-tyrosine-phosphatase
1251 JASNUH010000003.1 GCA030176315_01658 CDS open 178859-179944 _na     361_aa SURF1-like protein
1252 JASNUH010000003.1 GCA030176315_01659 CDS open 179889-180113 _na     74_aa hypothetical protein
1253 JASNUH010000003.1 GCA030176315_01660 CDS open 180074-182653 _na     859_aa YhgE/Pip domain-containing protein
1254 JASNUH010000003.1 GCA030176315_01661 CDS open 182650-184839 _na     729_aa YhgE/Pip domain-containing protein
1255 JASNUH010000003.1 GCA030176315_01662 CDS open 184993-185502 _na     169_aa Phosphoesterase HXTX domain-containing protein
1256 JASNUH010000003.1 GCA030176315_01663 CDS open 185505-185939 _na     144_aa hepT type VII toxin-antitoxin system HepT family RNase toxin
1257 JASNUH010000003.1 GCA030176315_01664 CDS open 185936-186367 _na     143_aa Nucleotidyltransferase domain-containing protein
1258 JASNUH010000003.1 GCA030176315_01665 CDS open 186579-187670 _na     363_aa Enoyl reductase (ER) domain-containing protein
1259 JASNUH010000003.1 GCA030176315_01666 CDS open 187762-188115 _na     117_aa SMODS and SLOG-associating 2TM effector domain-containing protein
1260 JASNUH010000003.1 GCA030176315_01667 CDS open 188072-188314 _na     80_aa hypothetical protein
1261 JASNUH010000003.1 GCA030176315_01668 CDS open 188316-189584 _na     422_aa Phosphatase PAP2 family protein
1262 JASNUH010000003.1 GCA030176315_01669 CDS open 189759-189959 _na     66_aa hypothetical protein
1263 JASNUH010000003.1 GCA030176315_01670 CDS open 189983-190789 _na     268_aa GTP pyrophosphokinase
1264 JASNUH010000003.1 GCA030176315_01671 CDS open 190909-191847 _na     312_aa S1 family peptidase
1265 JASNUH010000003.1 GCA030176315_01672 CDS open 191898-192596 _na     232_aa alkB Alpha-ketoglutarate-dependent dioxygenase AlkB
1266 JASNUH010000003.1 GCA030176315_01673 CDS open 192731-195127 _na     798_aa Htaa domain-containing protein
1267 JASNUH010000003.1 GCA030176315_01674 CDS open 195413-196636 _na     407_aa Peptidase M20 dimerisation domain-containing protein
1268 JASNUH010000003.1 GCA030176315_01675 CDS open 196647-197954 _na     435_aa DUF3100 domain-containing protein
1269 JASNUH010000003.1 GCA030176315_01676 CDS open 198351-198929 _na     192_aa Abi-like protein
1270 JASNUH010000003.1 GCA030176315_01677 CDS open 199524-200876 _na     450_aa Nucleoside transporter/FeoB GTPase Gate domain-containing protein
1271 JASNUH010000003.1 GCA030176315_01678 CDS open 200869-202053 _na     394_aa CaiB/BaiF CoA-transferase family protein
1272 JASNUH010000003.1 GCA030176315_01679 CDS open 202092-203258 _na     388_aa Acyl-CoA dehydrogenase
1273 JASNUH010000003.1 GCA030176315_01680 CDS open 203974-204417 _na     147_aa hypothetical protein
1274 JASNUH010000003.1 GCA030176315_01681 CDS open 204471-204656 _na     61_aa hypothetical protein
1275 JASNUH010000003.1 GCA030176315_01682 CDS open 205464-206405 _na     313_aa DUF2891 domain-containing protein
1276 JASNUH010000003.1 GCA030176315_01683 CDS open 206601-207443 _na     280_aa MurR/RpiR family transcriptional regulator
1277 JASNUH010000003.1 GCA030176315_01684 CDS open 207522-208970 _na     482_aa sodium:solute symporter
1278 JASNUH010000003.1 GCA030176315_01493 gene open 1382-3505
1279 JASNUH010000003.1 GCA030176315_01494 gene open 3798-5054
1280 JASNUH010000003.1 GCA030176315_01495 gene open 5067-6413 pyk
1281 JASNUH010000003.1 GCA030176315_01496 gene open 6532-7440 lgt
1282 JASNUH010000003.1 GCA030176315_01497 gene open 7463-8350
1283 JASNUH010000003.1 GCA030176315_01498 gene open 8440-9174
1284 JASNUH010000003.1 GCA030176315_01499 gene open 9176-9535 hisI
1285 JASNUH010000003.1 GCA030176315_01500 gene open 9532-10353 hisF
1286 JASNUH010000003.1 GCA030176315_01501 gene open 10371-11192
1287 JASNUH010000003.1 GCA030176315_01502 gene open 11205-11996 priA
1288 JASNUH010000003.1 GCA030176315_01503 gene open 12026-12658 hisH
1289 JASNUH010000003.1 GCA030176315_01504 gene open 12674-14071
1290 JASNUH010000003.1 GCA030176315_01505 gene open 14175-14342
1291 JASNUH010000003.1 GCA030176315_01506 gene open 14342-14947 hisB
1292 JASNUH010000003.1 GCA030176315_01507 gene open 14944-16038
1293 JASNUH010000003.1 GCA030176315_01508 gene open 16042-17460
1294 JASNUH010000003.1 GCA030176315_01509 gene open 17473-18090
1295 JASNUH010000003.1 GCA030176315_01510 gene open 18094-18810
1296 JASNUH010000003.1 GCA030176315_01511 gene open 19025-19720 tetR
1297 JASNUH010000003.1 GCA030176315_01512 gene open 19724-21124
1298 JASNUH010000003.1 GCA030176315_01513 gene open 21246-23003
1299 JASNUH010000003.1 GCA030176315_01514 gene open 23040-23729
1300 JASNUH010000003.1 GCA030176315_01515 gene open 23828-24682
1301 JASNUH010000003.1 GCA030176315_01516 gene open 24682-26778
1302 JASNUH010000003.1 GCA030176315_01517 gene open 26778-27743
1303 JASNUH010000003.1 GCA030176315_01518 gene open 27823-29460
1304 JASNUH010000003.1 GCA030176315_01519 gene open 29749-30450
1305 JASNUH010000003.1 GCA030176315_01520 gene open 30478-31200
1306 JASNUH010000003.1 GCA030176315_01521 gene open 31272-32234
1307 JASNUH010000003.1 GCA030176315_01522 gene open 32245-33186
1308 JASNUH010000003.1 GCA030176315_01523 gene open 33341-34525
1309 JASNUH010000003.1 GCA030176315_01524 gene open 34605-35378
1310 JASNUH010000003.1 GCA030176315_01525 gene open 35386-38628
1311 JASNUH010000003.1 GCA030176315_01526 gene open 38905-41826
1312 JASNUH010000003.1 GCA030176315_01527 gene open 41919-42608
1313 JASNUH010000003.1 GCA030176315_01528 gene open 42656-43054
1314 JASNUH010000003.1 GCA030176315_01529 gene open 43091-43321
1315 JASNUH010000003.1 GCA030176315_01530 gene open 43334-43990 yigZ
1316 JASNUH010000003.1 GCA030176315_01531 gene open 43990-45291 ilvA
1317 JASNUH010000003.1 GCA030176315_01532 gene open 45317-48895 dnaE
1318 JASNUH010000003.1 GCA030176315_01533 gene open 48919-49116
1319 JASNUH010000003.1 GCA030176315_01534 gene open 49122-49718
1320 JASNUH010000003.1 GCA030176315_01535 gene open 49747-50682
1321 JASNUH010000003.1 GCA030176315_01536 gene open 50672-51157 lspA
1322 JASNUH010000003.1 GCA030176315_01537 gene open 51276-52409
1323 JASNUH010000003.1 GCA030176315_01538 gene open 52438-54087
1324 JASNUH010000003.1 GCA030176315_01539 gene open 54812-56485
1325 JASNUH010000003.1 GCA030176315_01540 gene open 56735-57361
1326 JASNUH010000003.1 GCA030176315_01541 gene open 57501-58526
1327 JASNUH010000003.1 GCA030176315_01542 gene open 58506-59942
1328 JASNUH010000003.1 GCA030176315_01543 gene open 59963-60676 cas5e
1329 JASNUH010000003.1 GCA030176315_01544 gene open 60669-61754 cas7e
1330 JASNUH010000003.1 GCA030176315_01545 gene open 61775-62419
1331 JASNUH010000003.1 GCA030176315_01546 gene open 62416-64032
1332 JASNUH010000003.1 GCA030176315_01547 gene open 64288-64974
1333 JASNUH010000003.1 GCA030176315_01548 gene open 64971-67646
1334 JASNUH010000003.1 GCA030176315_01549 gene open 67648-68583 cas1e
1335 JASNUH010000003.1 GCA030176315_01550 gene open 68584-68895 cas2e
1336 JASNUH010000003.1 GCA030176315_01551 gene open 70618-70872
1337 JASNUH010000003.1 GCA030176315_01552 gene open 70878-71096
1338 JASNUH010000003.1 GCA030176315_01553 gene open 71089-71217
1339 JASNUH010000003.1 GCA030176315_01554 gene open 71296-71415
1340 JASNUH010000003.1 GCA030176315_01555 gene open 71507-71716
1341 JASNUH010000003.1 GCA030176315_01556 gene open 72314-72634 cdiI
1342 JASNUH010000003.1 GCA030176315_01557 gene open 72787-72951
1343 JASNUH010000003.1 GCA030176315_01558 gene open 73019-73165
1344 JASNUH010000003.1 GCA030176315_01559 gene open 73314-73574
1345 JASNUH010000003.1 GCA030176315_01560 gene open 73873-74910 htaA
1346 JASNUH010000003.1 GCA030176315_01561 gene open 74918-75862
1347 JASNUH010000003.1 GCA030176315_01562 gene open 75859-76575
1348 JASNUH010000003.1 GCA030176315_01563 gene open 76572-77711
1349 JASNUH010000003.1 GCA030176315_01564 gene open 77808-78113
1350 JASNUH010000003.1 GCA030176315_01565 gene open 78151-79026 ureD
1351 JASNUH010000003.1 GCA030176315_01566 gene open 79028-79642 ureG
1352 JASNUH010000003.1 GCA030176315_01567 gene open 79724-80473 ureF
1353 JASNUH010000003.1 GCA030176315_01568 gene open 80454-80927 ureE
1354 JASNUH010000003.1 GCA030176315_01569 gene open 80979-82691 ureC
1355 JASNUH010000003.1 GCA030176315_01571 gene open 82745-83071
1356 JASNUH010000003.1 GCA030176315_01572 gene open 83106-83408
1357 JASNUH010000003.1 GCA030176315_01573 gene open 83822-84343
1358 JASNUH010000003.1 GCA030176315_01574 gene open 84364-84492
1359 JASNUH010000003.1 GCA030176315_01575 gene open 84563-85168
1360 JASNUH010000003.1 GCA030176315_01576 gene open 85658-86629
1361 JASNUH010000003.1 GCA030176315_01577 gene open 87418-87993
1362 JASNUH010000003.1 GCA030176315_01578 gene open 88029-89015
1363 JASNUH010000003.1 GCA030176315_01579 gene open 89352-90281
1364 JASNUH010000003.1 GCA030176315_01580 gene open 90591-91703
1365 JASNUH010000003.1 GCA030176315_01581 gene open 91756-92883
1366 JASNUH010000003.1 GCA030176315_01582 gene open 93052-96303 ileS
1367 JASNUH010000003.1 GCA030176315_01583 gene open 96528-96680
1368 JASNUH010000003.1 GCA030176315_01584 gene open 96929-97732
1369 JASNUH010000003.1 GCA030176315_01585 gene open 97732-99207
1370 JASNUH010000003.1 GCA030176315_01586 gene open 99207-99839
1371 JASNUH010000003.1 GCA030176315_01587 gene open 100179-101666
1372 JASNUH010000003.1 GCA030176315_01588 gene open 101837-102910
1373 JASNUH010000003.1 GCA030176315_01589 gene open 103102-103395 yggT
1374 JASNUH010000003.1 GCA030176315_01590 gene open 103514-104092 sepF
1375 JASNUH010000003.1 GCA030176315_01591 gene open 104173-104913
1376 JASNUH010000003.1 GCA030176315_01592 gene open 104916-105689 pgeF
1377 JASNUH010000003.1 GCA030176315_01593 gene open 105705-106949 ftsZ
1378 JASNUH010000003.1 GCA030176315_01594 gene open 107183-107839
1379 JASNUH010000003.1 GCA030176315_01595 gene open 107842-109374 murC
1380 JASNUH010000003.1 GCA030176315_01596 gene open 109443-110606
1381 JASNUH010000003.1 GCA030176315_01597 gene open 110579-112033 ftsW
1382 JASNUH010000003.1 GCA030176315_01598 gene open 112093-113550 murD
1383 JASNUH010000003.1 GCA030176315_01599 gene open 113614-114711 mraY
1384 JASNUH010000003.1 GCA030176315_01600 gene open 114785-116326
1385 JASNUH010000003.1 GCA030176315_01601 gene open 116326-117894
1386 JASNUH010000003.1 GCA030176315_01602 gene open 117997-119949
1387 JASNUH010000003.1 GCA030176315_01603 gene open 120059-120961 ftsL
1388 JASNUH010000003.1 GCA030176315_01604 gene open 120964-122100 rsmH
1389 JASNUH010000003.1 GCA030176315_01605 gene open 122245-122679 mraZ
1390 JASNUH010000003.1 GCA030176315_01606 gene open 123293-123808
1391 JASNUH010000003.1 GCA030176315_01607 gene open 123934-124458
1392 JASNUH010000003.1 GCA030176315_01608 gene open 124604-125173
1393 JASNUH010000003.1 GCA030176315_01609 gene open 125277-126404
1394 JASNUH010000003.1 GCA030176315_01610 gene open 126404-127960
1395 JASNUH010000003.1 GCA030176315_01611 gene open 127929-128312
1396 JASNUH010000003.1 GCA030176315_01612 gene open 128359-129894
1397 JASNUH010000003.1 GCA030176315_01613 gene open 129975-131453
1398 JASNUH010000003.1 GCA030176315_01614 gene open 131396-131911
1399 JASNUH010000003.1 GCA030176315_01615 gene open 132074-132229
1400 JASNUH010000003.1 GCA030176315_01616 gene open 132294-133391
1401 JASNUH010000003.1 GCA030176315_01617 gene open 133410-134150
1402 JASNUH010000003.1 GCA030176315_01618 gene open 134193-135161
1403 JASNUH010000003.1 GCA030176315_01619 gene open 135310-136347
1404 JASNUH010000003.1 GCA030176315_01620 gene open 136434-137030
1405 JASNUH010000003.1 GCA030176315_01621 gene open 137144-137641
1406 JASNUH010000003.1 GCA030176315_01622 gene open 137738-139366
1407 JASNUH010000003.1 GCA030176315_01623 gene open 139366-140586
1408 JASNUH010000003.1 GCA030176315_01624 gene open 140586-141476
1409 JASNUH010000003.1 GCA030176315_01625 gene open 141544-142164
1410 JASNUH010000003.1 GCA030176315_01626 gene open 142688-143119
1411 JASNUH010000003.1 GCA030176315_01627 gene open 143140-144231
1412 JASNUH010000003.1 GCA030176315_01628 gene open 144653-146575 asnB
1413 JASNUH010000003.1 GCA030176315_01629 gene open 146793-147137 iscA
1414 JASNUH010000003.1 GCA030176315_01630 gene open 147269-148039
1415 JASNUH010000003.1 GCA030176315_01631 gene open 148092-149021
1416 JASNUH010000003.1 GCA030176315_01632 gene open 149018-150166
1417 JASNUH010000003.1 GCA030176315_01633 gene open 150244-151779
1418 JASNUH010000003.1 GCA030176315_01634 gene open 151818-152210
1419 JASNUH010000003.1 GCA030176315_01635 gene open 152337-154481 sucB
1420 JASNUH010000003.1 GCA030176315_01636 gene open 154710-155897
1421 JASNUH010000003.1 GCA030176315_01637 gene open 155983-156753 lipB
1422 JASNUH010000003.1 GCA030176315_01638 gene open 156833-157876 lipA
1423 JASNUH010000003.1 GCA030176315_01639 gene open 157997-158776
1424 JASNUH010000003.1 GCA030176315_01640 gene open 158783-159271
1425 JASNUH010000003.1 GCA030176315_01641 gene open 159326-160375
1426 JASNUH010000003.1 GCA030176315_01642 gene open 160368-160907
1427 JASNUH010000003.1 GCA030176315_01643 gene open 160998-162083
1428 JASNUH010000003.1 GCA030176315_01644 gene open 162115-163581 thrC
1429 JASNUH010000003.1 GCA030176315_01645 gene open 163599-165104
1430 JASNUH010000003.1 GCA030176315_01646 gene open 165101-165634
1431 JASNUH010000003.1 GCA030176315_01647 gene open 165769-166233
1432 JASNUH010000003.1 GCA030176315_01648 gene open 166315-169554
1433 JASNUH010000003.1 GCA030176315_01649 gene open 169670-171007 glnA
1434 JASNUH010000003.1 GCA030176315_01650 gene open 171054-171266
1435 JASNUH010000003.1 GCA030176315_01651 gene open 171531-173051
1436 JASNUH010000003.1 GCA030176315_01653 gene open 173585-174649 adhP
1437 JASNUH010000003.1 GCA030176315_01654 gene open 174982-176148
1438 JASNUH010000003.1 GCA030176315_01655 gene open 176162-176962
1439 JASNUH010000003.1 GCA030176315_01656 gene open 177083-178231
1440 JASNUH010000003.1 GCA030176315_01657 gene open 178311-178826
1441 JASNUH010000003.1 GCA030176315_01658 gene open 178859-179944
1442 JASNUH010000003.1 GCA030176315_01659 gene open 179889-180113
1443 JASNUH010000003.1 GCA030176315_01660 gene open 180074-182653
1444 JASNUH010000003.1 GCA030176315_01661 gene open 182650-184839
1445 JASNUH010000003.1 GCA030176315_01662 gene open 184993-185502
1446 JASNUH010000003.1 GCA030176315_01663 gene open 185505-185939 hepT
1447 JASNUH010000003.1 GCA030176315_01664 gene open 185936-186367
1448 JASNUH010000003.1 GCA030176315_01665 gene open 186579-187670
1449 JASNUH010000003.1 GCA030176315_01666 gene open 187762-188115
1450 JASNUH010000003.1 GCA030176315_01667 gene open 188072-188314
1451 JASNUH010000003.1 GCA030176315_01668 gene open 188316-189584
1452 JASNUH010000003.1 GCA030176315_01669 gene open 189759-189959
1453 JASNUH010000003.1 GCA030176315_01670 gene open 189983-190789
1454 JASNUH010000003.1 GCA030176315_01671 gene open 190909-191847
1455 JASNUH010000003.1 GCA030176315_01672 gene open 191898-192596 alkB
1456 JASNUH010000003.1 GCA030176315_01673 gene open 192731-195127
1457 JASNUH010000003.1 GCA030176315_01674 gene open 195413-196636
1458 JASNUH010000003.1 GCA030176315_01675 gene open 196647-197954
1459 JASNUH010000003.1 GCA030176315_01676 gene open 198351-198929
1460 JASNUH010000003.1 GCA030176315_01677 gene open 199524-200876
1461 JASNUH010000003.1 GCA030176315_01678 gene open 200869-202053
1462 JASNUH010000003.1 GCA030176315_01679 gene open 202092-203258
1463 JASNUH010000003.1 GCA030176315_01680 gene open 203974-204417
1464 JASNUH010000003.1 GCA030176315_01681 gene open 204471-204656
1465 JASNUH010000003.1 GCA030176315_01682 gene open 205464-206405
1466 JASNUH010000003.1 GCA030176315_01683 gene open 206601-207443
1467 JASNUH010000003.1 GCA030176315_01684 gene open 207522-208970
1468 JASNUH010000004.1 regulatory_region open 51706-51818 TPP riboswitch aptamer (THI element)
1469 JASNUH010000004.1 GCA030176315_01689 CDS open 298-432 _na     44_aa Major facilitator superfamily (MFS) profile domain-containing protein
1470 JASNUH010000004.1 GCA030176315_01690 CDS open 679-810 _na     43_aa hypothetical protein
1471 JASNUH010000004.1 GCA030176315_01691 CDS open 1314-1964 _na     216_aa lysE LysE family translocator
1472 JASNUH010000004.1 GCA030176315_01692 CDS open 1961-2437 _na     158_aa Ankyrin repeat domain-containing protein
1473 JASNUH010000004.1 GCA030176315_01693 CDS open 2450-3400 _na     316_aa holA DNA polymerase III subunit delta
1474 JASNUH010000004.1 GCA030176315_01694 CDS open 3425-5164 _na     579_aa ComEC/Rec2 family competence protein
1475 JASNUH010000004.1 GCA030176315_01695 CDS open 5174-5995 _na     273_aa ComEA family DNA-binding protein
1476 JASNUH010000004.1 GCA030176315_01696 CDS open 6135-6944 _na     269_aa degV DegV family EDD domain-containing protein
1477 JASNUH010000004.1 GCA030176315_01697 CDS open 6945-7622 _na     225_aa Histidine phosphatase family protein
1478 JASNUH010000004.1 GCA030176315_01698 CDS open 7619-8077 _na     152_aa rsfS ribosome silencing factor
1479 JASNUH010000004.1 GCA030176315_01699 CDS open 8176-8832 _na     218_aa nadD nicotinate-nucleotide adenylyltransferase
1480 JASNUH010000004.1 GCA030176315_01700 CDS open 8919-9428 _na     169_aa SCP domain-containing protein
1481 JASNUH010000004.1 GCA030176315_01701 CDS open 9471-10772 _na     433_aa glutamate-5-semialdehyde dehydrogenase
1482 JASNUH010000004.1 GCA030176315_01702 CDS open 10791-11687 _na     298_aa D-isomer specific 2-hydroxyacid dehydrogenase family protein
1483 JASNUH010000004.1 GCA030176315_01703 CDS open 11799-13037 _na     412_aa Glutamate 5-kinase
1484 JASNUH010000004.1 GCA030176315_01704 CDS open 13126-14655 _na     509_aa obgE GTPase ObgE
1485 JASNUH010000004.1 GCA030176315_01705 CDS open 14780-15058 _na     92_aa rpmA 50S ribosomal protein L27
1486 JASNUH010000004.1 GCA030176315_01706 CDS open 15079-15384 _na     101_aa rplU 50S ribosomal protein L21
1487 JASNUH010000004.1 GCA030176315_01707 CDS open 15689-19240 _na     1183_aa Translation initiation factor IF-2 N-terminal domain-containing protein
1488 JASNUH010000004.1 GCA030176315_01708 CDS open 19243-19386 _na     47_aa hypothetical protein
1489 JASNUH010000004.1 GCA030176315_01709 CDS open 19601-20326 _na     241_aa marR MarR family transcriptional regulator
1490 JASNUH010000004.1 GCA030176315_01710 CDS open 20651-21070 _na     139_aa ndk nucleoside-diphosphate kinase
1491 JASNUH010000004.1 GCA030176315_01711 CDS open 21131-21631 _na     166_aa DUF4233 domain-containing protein
1492 JASNUH010000004.1 GCA030176315_01712 CDS open 21628-23190 _na     520_aa folC bifunctional tetrahydrofolate synthase/dihydrofolate synthase
1493 JASNUH010000004.1 GCA030176315_01713 CDS open 23190-25982 _na     930_aa valine--tRNA ligase
1494 JASNUH010000004.1 GCA030176315_01714 CDS open 26075-26905 _na     276_aa panB 3-methyl-2-oxobutanoate hydroxymethyltransferase
1495 JASNUH010000004.1 GCA030176315_01715 CDS open 26917-27807 _na     296_aa panC pantoate--beta-alanine ligase
1496 JASNUH010000004.1 GCA030176315_01716 CDS open 27800-28504 _na     234_aa TetR/AcrR family transcriptional regulator
1497 JASNUH010000004.1 GCA030176315_01717 CDS open 28549-29883 _na     444_aa clpX ATP-dependent Clp protease ATP-binding subunit ClpX
1498 JASNUH010000004.1 GCA030176315_01718 CDS open 30061-32418 _na     785_aa Histidine kinase/HSP90-like ATPase domain-containing protein
1499 JASNUH010000004.1 GCA030176315_01719 CDS open 32469-33140 _na     223_aa Response regulator transcription factor
1500 JASNUH010000004.1 GCA030176315_01720 CDS open 33598-34227 _na     209_aa ATP-dependent Clp protease proteolytic subunit