HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Corynebacterium accolens (GCA_030176375.1)

Select a Genome:
BAKTA Annotations for GCA_030176375.1
Genome Selected: Corynebacterium accolens
ContigsBases CDSrRNA tmRNAtRNA
33 2437262 2272 3 1 49
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4660 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:8]    |    Number of Records Found: 4660 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3501 JASNUJ010000011.1 GCA030176375_00108 CDS open 5835-6410 _na     191_aa Secreted protein
3502 JASNUJ010000011.1 GCA030176375_00109 CDS open 6482-7963 _na     493_aa sufI Multicopper oxidase
3503 JASNUJ010000011.1 GCA030176375_00110 CDS open 9027-9326 _na     99_aa Integrase catalytic domain-containing protein
3504 JASNUJ010000011.1 GCA030176375_00111 CDS open 9616-9756 _na     46_aa hypothetical protein
3505 JASNUJ010000011.1 GCA030176375_00112 CDS open 9796-10086 _na     96_aa Scramblase
3506 JASNUJ010000011.1 GCA030176375_00113 CDS open 10225-11358 _na     377_aa HNH nuclease domain-containing protein
3507 JASNUJ010000011.1 GCA030176375_00114 CDS open 11587-11928 _na     113_aa hypothetical protein
3508 JASNUJ010000011.1 GCA030176375_00115 CDS open 11928-12758 _na     276_aa SURF1-like protein
3509 JASNUJ010000011.1 GCA030176375_00116 CDS open 12736-13041 _na     101_aa CHY-type domain-containing protein
3510 JASNUJ010000011.1 GCA030176375_00117 CDS open 13058-14365 _na     435_aa Peptidase M20 dimerisation domain-containing protein
3511 JASNUJ010000011.1 GCA030176375_00118 CDS open 14430-15422 _na     330_aa bioB biotin synthase BioB
3512 JASNUJ010000011.1 GCA030176375_00119 CDS open 15422-15685 _na     87_aa Aminotransferase
3513 JASNUJ010000011.1 GCA030176375_00120 CDS open 15906-17027 _na     373_aa AAA+ ATPase domain-containing protein
3514 JASNUJ010000011.1 GCA030176375_00121 CDS open 16978-17961 _na     327_aa NAD-dependent protein deacetylase
3515 JASNUJ010000011.1 GCA030176375_00122 CDS open 17962-18975 _na     337_aa AB hydrolase-1 domain-containing protein
3516 JASNUJ010000011.1 GCA030176375_00123 CDS open 19344-20819 _na     491_aa amn AMP nucleosidase
3517 JASNUJ010000011.1 GCA030176375_00124 CDS open 20892-21404 _na     170_aa Phosphoribosyltransferase domain-containing protein
3518 JASNUJ010000011.1 GCA030176375_00125 CDS open 21426-22907 _na     493_aa STAS domain-containing protein
3519 JASNUJ010000011.1 GCA030176375_00126 CDS open 23193-23681 _na     162_aa Ferritin
3520 JASNUJ010000011.1 GCA030176375_00127 CDS open 23756-24109 _na     117_aa TIGR04086 family membrane protein
3521 JASNUJ010000011.1 GCA030176375_00128 CDS open 24122-24718 _na     198_aa HAD hydrolase%2C family IA
3522 JASNUJ010000011.1 GCA030176375_00129 CDS open 24701-25834 _na     377_aa HTH marR-type domain-containing protein
3523 JASNUJ010000011.1 GCA030176375_00130 CDS open 25931-26512 _na     193_aa TIGR00730 family Rossman fold protein
3524 JASNUJ010000011.1 GCA030176375_00131 CDS open 26584-28254 _na     556_aa DUF885 domain-containing protein
3525 JASNUJ010000011.1 GCA030176375_00132 CDS open 28264-29370 _na     368_aa abrB Membrane protein AbrB duplication
3526 JASNUJ010000011.1 GCA030176375_00133 CDS open 29429-30199 _na     256_aa putative membrane transporter protein
3527 JASNUJ010000011.1 GCA030176375_00134 CDS open 30201-32471 _na     756_aa hrpB ATP-dependent helicase HrpB
3528 JASNUJ010000011.1 GCA030176375_00135 CDS open 32472-33137 _na     221_aa Maltose/galactoside acetyltransferase domain-containing protein
3529 JASNUJ010000011.1 GCA030176375_00136 CDS open 33177-33866 _na     229_aa alkB Alkylated DNA repair protein AlkB
3530 JASNUJ010000011.1 GCA030176375_00137 CDS open 33906-34445 _na     179_aa NADPH-dependent FMN reductase-like domain-containing protein
3531 JASNUJ010000011.1 GCA030176375_00138 CDS open 34482-35201 _na     239_aa Oxidoreductase
3532 JASNUJ010000011.1 GCA030176375_00139 CDS open 35270-36847 _na     525_aa Aldehyde dehydrogenase domain-containing protein
3533 JASNUJ010000011.1 GCA030176375_00140 CDS open 36893-39133 _na     746_aa High-affinity choline transporter
3534 JASNUJ010000011.1 GCA030176375_00141 CDS open 39467-41242 _na     591_aa betA choline dehydrogenase
3535 JASNUJ010000011.1 GCA030176375_00142 CDS open 41433-41561 _na     42_aa Chemotaxis protein
3536 JASNUJ010000011.1 GCA030176375_00143 CDS open 41815-42024 _na     69_aa hypothetical protein
3537 JASNUJ010000011.1 GCA030176375_00144 CDS open 42138-42497 _na     119_aa arsR HTH arsR-type domain-containing protein
3538 JASNUJ010000011.1 GCA030176375_00145 CDS open 42494-44386 _na     630_aa zntA ATPase P
3539 JASNUJ010000011.1 GCA030176375_00146 CDS open 44710-44871 _na     53_aa oxidoreductase
3540 JASNUJ010000011.1 GCA030176375_00147 CDS open 45300-46025 _na     241_aa Conserved hypothetical protein CHP02391 domain-containing protein
3541 JASNUJ010000011.1 GCA030176375_00148 CDS open 46139-46366 _na     75_aa VOC family protein
3542 JASNUJ010000011.1 GCA030176375_00149 CDS open 46327-46488 _na     53_aa Glyoxalase-like domain-containing protein
3543 JASNUJ010000011.1 GCA030176375_00150 CDS open 46489-47118 _na     209_aa RiboL-PSP-HEPN domain-containing protein
3544 JASNUJ010000011.1 GCA030176375_00151 CDS open 47416-47964 _na     182_aa NAD-dependent epimerase/dehydratase domain-containing protein
3545 JASNUJ010000011.1 GCA030176375_00152 CDS open 48133-48381 _na     82_aa hypothetical protein
3546 JASNUJ010000011.1 GCA030176375_00153 CDS open 49786-50469 _na     227_aa Threonine efflux protein
3547 JASNUJ010000011.1 GCA030176375_00154 CDS open 50549-51223 _na     224_aa Threonine efflux protein
3548 JASNUJ010000011.1 GCA030176375_00155 CDS open 51233-51562 _na     109_aa UPF0145 protein HMPREF1264_01360
3549 JASNUJ010000011.1 GCA030176375_00156 CDS open 51620-51904 _na     94_aa hypothetical protein
3550 JASNUJ010000011.1 GCA030176375_00157 CDS open 51905-52732 _na     275_aa VOC domain-containing protein
3551 JASNUJ010000011.1 GCA030176375_00158 CDS open 52751-53080 _na     109_aa Methylated-DNA-[protein]-cysteine S-methyltransferase DNA binding domain-containing protein
3552 JASNUJ010000011.1 GCA030176375_00159 CDS open 53064-54689 _na     541_aa Amidohydrolase 3 domain-containing protein
3553 JASNUJ010000011.1 GCA030176375_00160 CDS open 54974-56248 _na     424_aa Major facilitator superfamily (MFS) profile domain-containing protein
3554 JASNUJ010000011.1 GCA030176375_00161 CDS open 56245-57588 _na     447_aa Helix-turn-helix domain-containing protein
3555 JASNUJ010000011.1 GCA030176375_00162 CDS open 57885-59213 _na     442_aa gabT 4-aminobutyrate--2-oxoglutarate transaminase
3556 JASNUJ010000011.1 GCA030176375_00163 CDS open 59242-60297 _na     351_aa Histidinol-phosphate transaminase
3557 JASNUJ010000011.1 GCA030176375_00164 CDS open 60401-61726 _na     441_aa Amino acid transporter transmembrane domain-containing protein
3558 JASNUJ010000011.1 GCA030176375_00165 CDS open 61797-63050 _na     417_aa Peptidase M20 dimerisation domain-containing protein
3559 JASNUJ010000011.1 GCA030176375_00166 CDS open 63218-64486 _na     422_aa pucR PucR C-terminal helix-turn-helix domain-containing protein
3560 JASNUJ010000011.1 GCA030176375_00167 CDS open 64494-66149 _na     551_aa acetolactate synthase
3561 JASNUJ010000011.1 GCA030176375_00168 CDS open 66280-67179 _na     299_aa lysR LysR family transcriptional regulator
3562 JASNUJ010000011.1 GCA030176375_00169 CDS open 67481-68329 _na     282_aa Serine hydrolase
3563 JASNUJ010000011.1 GCA030176375_00170 CDS open 68348-69679 _na     443_aa Amino acid transporter transmembrane domain-containing protein
3564 JASNUJ010000011.1 GCA030176375_00171 CDS open 69905-70756 _na     283_aa prsW Protease PrsW
3565 JASNUJ010000011.1 GCA030176375_00172 CDS open 70757-71338 _na     193_aa Secreted protein
3566 JASNUJ010000011.1 GCA030176375_00173 CDS open 71381-73315 _na     644_aa Peptidase M13
3567 JASNUJ010000011.1 GCA030176375_00174 CDS open 73350-74252 _na     300_aa Alpha/beta hydrolase fold-3 domain-containing protein
3568 JASNUJ010000011.1 GCA030176375_00175 CDS open 74318-75754 _na     478_aa PepSY domain-containing protein
3569 JASNUJ010000011.1 GCA030176375_00176 CDS open 75693-79106 _na     1137_aa arabinosyltransferase domain-containing protein
3570 JASNUJ010000011.1 GCA030176375_00177 CDS open 79229-81205 _na     658_aa Galactan 5-O-arabinofuranosyltransferase
3571 JASNUJ010000011.1 GCA030176375_00178 CDS open 81350-82108 _na     252_aa decaprenylphospho-beta-D-erythro-pentofuranosid-2-ulose 2-reductase
3572 JASNUJ010000011.1 GCA030176375_00179 CDS open 82153-83568 _na     471_aa FAD-binding oxidoreductase
3573 JASNUJ010000011.1 GCA030176375_00180 CDS open 83696-83971 _na     91_aa cpaF CpaF family protein
3574 JASNUJ010000011.1 GCA030176375_00181 CDS open 84006-84470 _na     154_aa DUF202 domain-containing protein
3575 JASNUJ010000011.1 GCA030176375_00182 CDS open 84492-85388 _na     298_aa DUF4192 domain-containing protein
3576 JASNUJ010000011.1 GCA030176375_00183 CDS open 85400-85840 _na     146_aa GtrA/DPMS transmembrane domain-containing protein
3577 JASNUJ010000011.1 GCA030176375_00184 CDS open 85853-86770 _na     305_aa Glycosyltransferase family 2 protein
3578 JASNUJ010000011.1 GCA030176375_00185 CDS open 86851-87507 _na     218_aa GNAT family protein
3579 JASNUJ010000011.1 GCA030176375_00186 CDS open 87511-88311 _na     266_aa ABC transporter domain-containing protein
3580 JASNUJ010000011.1 GCA030176375_00187 CDS open 88368-89258 _na     296_aa ABC-2 type transporter transmembrane domain-containing protein
3581 JASNUJ010000011.1 GCA030176375_00188 CDS open 89434-90687 _na     417_aa Aminotransferase class V domain-containing protein
3582 JASNUJ010000011.1 GCA030176375_00189 CDS open 90715-91671 _na     318_aa Enoyl reductase (ER) domain-containing protein
3583 JASNUJ010000011.1 GCA030176375_00191 CDS open 91993-92286 _na     97_aa hypothetical protein
3584 JASNUJ010000011.1 GCA030176375_00192 CDS open 92653-93957 _na     434_aa LGFP repeat protein
3585 JASNUJ010000011.1 GCA030176375_00193 CDS open 93999-94892 _na     297_aa Alpha-L-arabinofuranosidase B arabinose-binding domain-containing protein
3586 JASNUJ010000011.1 GCA030176375_00194 CDS open 95010-99029 _na     1339_aa ALF repeat-containing protein
3587 JASNUJ010000011.1 GCA030176375_00195 CDS open 99032-99865 _na     277_aa DUF4123 domain-containing protein
3588 JASNUJ010000011.1 GCA030176375_00196 CDS open 99871-100842 _na     323_aa hypothetical protein
3589 JASNUJ010000011.1 GCA030176375_00197 CDS open 101143-101544 _na     133_aa DUF2283 domain-containing protein
3590 JASNUJ010000011.1 GCA030176375_00198 CDS open 101650-102114 _na     154_aa ATP-grasp domain-containing protein
3591 JASNUJ010000011.1 GCA030176375_00199 CDS open 102595-102864 _na     89_aa Transposase
3592 JASNUJ010000011.1 GCA030176375_00200 CDS open 102861-103475 _na     204_aa IS3 family transposase
3593 JASNUJ010000011.1 GCA030176375_00103 gene open 196-810
3594 JASNUJ010000011.1 GCA030176375_00104 gene open 858-3092 zntA
3595 JASNUJ010000011.1 GCA030176375_00105 gene open 3144-3470 copZ
3596 JASNUJ010000011.1 GCA030176375_00106 gene open 3584-4711 baeS
3597 JASNUJ010000011.1 GCA030176375_00107 gene open 4708-5430 ompR
3598 JASNUJ010000011.1 GCA030176375_00108 gene open 5835-6410
3599 JASNUJ010000011.1 GCA030176375_00109 gene open 6482-7963 sufI
3600 JASNUJ010000011.1 GCA030176375_00110 gene open 9027-9326
3601 JASNUJ010000011.1 GCA030176375_00111 gene open 9616-9756
3602 JASNUJ010000011.1 GCA030176375_00112 gene open 9796-10086
3603 JASNUJ010000011.1 GCA030176375_00113 gene open 10225-11358
3604 JASNUJ010000011.1 GCA030176375_00114 gene open 11587-11928
3605 JASNUJ010000011.1 GCA030176375_00115 gene open 11928-12758
3606 JASNUJ010000011.1 GCA030176375_00116 gene open 12736-13041
3607 JASNUJ010000011.1 GCA030176375_00117 gene open 13058-14365
3608 JASNUJ010000011.1 GCA030176375_00118 gene open 14430-15422 bioB
3609 JASNUJ010000011.1 GCA030176375_00119 gene open 15422-15685
3610 JASNUJ010000011.1 GCA030176375_00120 gene open 15906-17027
3611 JASNUJ010000011.1 GCA030176375_00121 gene open 16978-17961
3612 JASNUJ010000011.1 GCA030176375_00122 gene open 17962-18975
3613 JASNUJ010000011.1 GCA030176375_00123 gene open 19344-20819 amn
3614 JASNUJ010000011.1 GCA030176375_00124 gene open 20892-21404
3615 JASNUJ010000011.1 GCA030176375_00125 gene open 21426-22907
3616 JASNUJ010000011.1 GCA030176375_00126 gene open 23193-23681
3617 JASNUJ010000011.1 GCA030176375_00127 gene open 23756-24109
3618 JASNUJ010000011.1 GCA030176375_00128 gene open 24122-24718
3619 JASNUJ010000011.1 GCA030176375_00129 gene open 24701-25834
3620 JASNUJ010000011.1 GCA030176375_00130 gene open 25931-26512
3621 JASNUJ010000011.1 GCA030176375_00131 gene open 26584-28254
3622 JASNUJ010000011.1 GCA030176375_00132 gene open 28264-29370 abrB
3623 JASNUJ010000011.1 GCA030176375_00133 gene open 29429-30199
3624 JASNUJ010000011.1 GCA030176375_00134 gene open 30201-32471 hrpB
3625 JASNUJ010000011.1 GCA030176375_00135 gene open 32472-33137
3626 JASNUJ010000011.1 GCA030176375_00136 gene open 33177-33866 alkB
3627 JASNUJ010000011.1 GCA030176375_00137 gene open 33906-34445
3628 JASNUJ010000011.1 GCA030176375_00138 gene open 34482-35201
3629 JASNUJ010000011.1 GCA030176375_00139 gene open 35270-36847
3630 JASNUJ010000011.1 GCA030176375_00140 gene open 36893-39133
3631 JASNUJ010000011.1 GCA030176375_00141 gene open 39467-41242 betA
3632 JASNUJ010000011.1 GCA030176375_00142 gene open 41433-41561
3633 JASNUJ010000011.1 GCA030176375_00143 gene open 41815-42024
3634 JASNUJ010000011.1 GCA030176375_00144 gene open 42138-42497 arsR
3635 JASNUJ010000011.1 GCA030176375_00145 gene open 42494-44386 zntA
3636 JASNUJ010000011.1 GCA030176375_00146 gene open 44710-44871
3637 JASNUJ010000011.1 GCA030176375_00147 gene open 45300-46025
3638 JASNUJ010000011.1 GCA030176375_00148 gene open 46139-46366
3639 JASNUJ010000011.1 GCA030176375_00149 gene open 46327-46488
3640 JASNUJ010000011.1 GCA030176375_00150 gene open 46489-47118
3641 JASNUJ010000011.1 GCA030176375_00151 gene open 47416-47964
3642 JASNUJ010000011.1 GCA030176375_00152 gene open 48133-48381
3643 JASNUJ010000011.1 GCA030176375_00153 gene open 49786-50469
3644 JASNUJ010000011.1 GCA030176375_00154 gene open 50549-51223
3645 JASNUJ010000011.1 GCA030176375_00155 gene open 51233-51562
3646 JASNUJ010000011.1 GCA030176375_00156 gene open 51620-51904
3647 JASNUJ010000011.1 GCA030176375_00157 gene open 51905-52732
3648 JASNUJ010000011.1 GCA030176375_00158 gene open 52751-53080
3649 JASNUJ010000011.1 GCA030176375_00159 gene open 53064-54689
3650 JASNUJ010000011.1 GCA030176375_00160 gene open 54974-56248
3651 JASNUJ010000011.1 GCA030176375_00161 gene open 56245-57588
3652 JASNUJ010000011.1 GCA030176375_00162 gene open 57885-59213 gabT
3653 JASNUJ010000011.1 GCA030176375_00163 gene open 59242-60297
3654 JASNUJ010000011.1 GCA030176375_00164 gene open 60401-61726
3655 JASNUJ010000011.1 GCA030176375_00165 gene open 61797-63050
3656 JASNUJ010000011.1 GCA030176375_00166 gene open 63218-64486 pucR
3657 JASNUJ010000011.1 GCA030176375_00167 gene open 64494-66149
3658 JASNUJ010000011.1 GCA030176375_00168 gene open 66280-67179 lysR
3659 JASNUJ010000011.1 GCA030176375_00169 gene open 67481-68329
3660 JASNUJ010000011.1 GCA030176375_00170 gene open 68348-69679
3661 JASNUJ010000011.1 GCA030176375_00171 gene open 69905-70756 prsW
3662 JASNUJ010000011.1 GCA030176375_00172 gene open 70757-71338
3663 JASNUJ010000011.1 GCA030176375_00173 gene open 71381-73315
3664 JASNUJ010000011.1 GCA030176375_00174 gene open 73350-74252
3665 JASNUJ010000011.1 GCA030176375_00175 gene open 74318-75754
3666 JASNUJ010000011.1 GCA030176375_00176 gene open 75693-79106
3667 JASNUJ010000011.1 GCA030176375_00177 gene open 79229-81205
3668 JASNUJ010000011.1 GCA030176375_00178 gene open 81350-82108
3669 JASNUJ010000011.1 GCA030176375_00179 gene open 82153-83568
3670 JASNUJ010000011.1 GCA030176375_00180 gene open 83696-83971 cpaF
3671 JASNUJ010000011.1 GCA030176375_00181 gene open 84006-84470
3672 JASNUJ010000011.1 GCA030176375_00182 gene open 84492-85388
3673 JASNUJ010000011.1 GCA030176375_00183 gene open 85400-85840
3674 JASNUJ010000011.1 GCA030176375_00184 gene open 85853-86770
3675 JASNUJ010000011.1 GCA030176375_00185 gene open 86851-87507
3676 JASNUJ010000011.1 GCA030176375_00186 gene open 87511-88311
3677 JASNUJ010000011.1 GCA030176375_00187 gene open 88368-89258
3678 JASNUJ010000011.1 GCA030176375_00188 gene open 89434-90687
3679 JASNUJ010000011.1 GCA030176375_00189 gene open 90715-91671
3680 JASNUJ010000011.1 GCA030176375_00191 gene open 91993-92286
3681 JASNUJ010000011.1 GCA030176375_00192 gene open 92653-93957
3682 JASNUJ010000011.1 GCA030176375_00193 gene open 93999-94892
3683 JASNUJ010000011.1 GCA030176375_00194 gene open 95010-99029
3684 JASNUJ010000011.1 GCA030176375_00195 gene open 99032-99865
3685 JASNUJ010000011.1 GCA030176375_00196 gene open 99871-100842
3686 JASNUJ010000011.1 GCA030176375_00197 gene open 101143-101544
3687 JASNUJ010000011.1 GCA030176375_00198 gene open 101650-102114
3688 JASNUJ010000011.1 GCA030176375_00199 gene open 102595-102864
3689 JASNUJ010000011.1 GCA030176375_00200 gene open 102861-103475
3690 JASNUJ010000011.1 GCA030176375_00190 gene open 91800-91884 trnS
3691 JASNUJ010000011.1 GCA030176375_00190 tRNA open 91800-91884 trnS tRNA-Ser(tga)
3692 JASNUJ010000012.1 GCA030176375_00201 CDS open 267-2216 _na     649_aa Protein PS1
3693 JASNUJ010000012.1 GCA030176375_00202 CDS open 2219-2746 _na     175_aa DUF732 domain-containing protein
3694 JASNUJ010000012.1 GCA030176375_00203 CDS open 2780-3700 _na     306_aa Carbohydrate esterase
3695 JASNUJ010000012.1 GCA030176375_00204 CDS open 3760-5505 _na     581_aa FadD32-like long-chain-fatty-acid--AMP ligase
3696 JASNUJ010000012.1 GCA030176375_00205 CDS open 5596-10353 _na     1585_aa pks13 polyketide synthase Pks13
3697 JASNUJ010000012.1 GCA030176375_00206 CDS open 10328-11884 _na     518_aa Acetyl-CoA carboxylase%2C carboxyltransferase component (Subunits alpha and beta)
3698 JASNUJ010000012.1 GCA030176375_00207 CDS open 12519-12692 _na     57_aa Secreted protein
3699 JASNUJ010000012.1 GCA030176375_00208 CDS open 12986-13459 _na     157_aa hypothetical protein
3700 JASNUJ010000012.1 GCA030176375_00209 CDS open 13472-13891 _na     139_aa ybjN YbjN domain-containing protein
3701 JASNUJ010000012.1 GCA030176375_00210 CDS open 13896-14315 _na     139_aa ybjN YbjN domain-containing protein
3702 JASNUJ010000012.1 GCA030176375_00211 CDS open 14757-16100 _na     447_aa Secretory lipase
3703 JASNUJ010000012.1 GCA030176375_00212 CDS open 16383-16721 _na     112_aa DUF3054 domain-containing protein
3704 JASNUJ010000012.1 GCA030176375_00213 CDS open 16718-17746 _na     342_aa TIGR00374 family protein
3705 JASNUJ010000012.1 GCA030176375_00214 CDS open 17747-19900 _na     717_aa Membrane transport protein MMPL domain-containing protein
3706 JASNUJ010000012.1 GCA030176375_00215 CDS open 19915-20508 _na     197_aa NYN domain-containing protein
3707 JASNUJ010000012.1 GCA030176375_00216 CDS open 20509-21285 _na     258_aa trmB tRNA (guanosine(46)-N7)-methyltransferase TrmB
3708 JASNUJ010000012.1 GCA030176375_00217 CDS open 21647-23473 _na     608_aa phosphoenolpyruvate carboxykinase (GTP)
3709 JASNUJ010000012.1 GCA030176375_00218 CDS open 24508-25791 _na     427_aa Arginine deiminase
3710 JASNUJ010000012.1 GCA030176375_00219 CDS open 25807-27123 _na     438_aa Septum formation initiator
3711 JASNUJ010000012.1 GCA030176375_00220 CDS open 27120-27293 _na     57_aa hypothetical protein
3712 JASNUJ010000012.1 GCA030176375_00221 CDS open 27460-29034 _na     524_aa Ascorbate-specific PTS system EIIC component
3713 JASNUJ010000012.1 GCA030176375_00222 CDS open 29044-29883 _na     279_aa Ascorbate-specific PTS system EIIA component
3714 JASNUJ010000012.1 GCA030176375_00223 CDS open 30050-31321 _na     423_aa Cell filamentation protein Fic
3715 JASNUJ010000012.1 GCA030176375_00224 CDS open 31465-34821 _na     1118_aa DNA polymerase III subunit
3716 JASNUJ010000012.1 GCA030176375_00225 CDS open 35223-35936 _na     237_aa CPBP family intramembrane metalloprotease
3717 JASNUJ010000012.1 GCA030176375_00226 CDS open 35971-36717 _na     248_aa Methyltransferase type 11 domain-containing protein
3718 JASNUJ010000012.1 GCA030176375_00227 CDS open 36742-37851 _na     369_aa Glycosyl transferase family 1 domain-containing protein
3719 JASNUJ010000012.1 GCA030176375_00228 CDS open 37745-39226 _na     493_aa Glycosyltransferase RgtA/B/C/D-like domain-containing protein
3720 JASNUJ010000012.1 GCA030176375_00229 CDS open 39207-40400 _na     397_aa DUF3068 domain-containing protein
3721 JASNUJ010000012.1 GCA030176375_00230 CDS open 40451-41584 _na     377_aa Acyltransferase
3722 JASNUJ010000012.1 GCA030176375_00231 CDS open 41490-44654 _na     1054_aa F5/8 type C domain-containing protein
3723 JASNUJ010000012.1 GCA030176375_00232 CDS open 44669-44866 _na     65_aa DUF2613 domain-containing protein
3724 JASNUJ010000012.1 GCA030176375_00233 CDS open 44889-45377 _na     162_aa uspA UspA domain-containing protein
3725 JASNUJ010000012.1 GCA030176375_00234 CDS open 45394-46593 _na     399_aa beta-N-acetylhexosaminidase
3726 JASNUJ010000012.1 GCA030176375_00235 CDS open 46628-48316 _na     562_aa YoaR-like putative peptidoglycan binding domain-containing protein
3727 JASNUJ010000012.1 GCA030176375_00236 CDS open 48330-48455 _na     41_aa hypothetical protein
3728 JASNUJ010000012.1 GCA030176375_00237 CDS open 48778-49023 _na     81_aa copG Ribbon-helix-helix protein CopG domain-containing protein
3729 JASNUJ010000012.1 GCA030176375_00239 CDS open 49556-50125 _na     189_aa dcd dCTP deaminase
3730 JASNUJ010000012.1 GCA030176375_00240 CDS open 50162-51484 _na     440_aa UDP-glucose 6-dehydrogenase
3731 JASNUJ010000012.1 GCA030176375_00241 CDS open 51481-52812 _na     443_aa YibE/F family protein
3732 JASNUJ010000012.1 GCA030176375_00242 CDS open 52865-54100 _na     411_aa alanine transaminase
3733 JASNUJ010000012.1 GCA030176375_00243 CDS open 54150-54800 _na     216_aa DUF1707 domain-containing protein
3734 JASNUJ010000012.1 GCA030176375_00244 CDS open 54876-56183 _na     435_aa Cation/H+ exchanger transmembrane domain-containing protein
3735 JASNUJ010000012.1 GCA030176375_00245 CDS open 56218-59235 _na     1005_aa 4Fe-4S ferredoxin-type domain-containing protein
3736 JASNUJ010000012.1 GCA030176375_00246 CDS open 59341-60240 _na     299_aa ER-bound oxygenase mpaB/mpaB'/Rubber oxygenase catalytic domain-containing protein
3737 JASNUJ010000012.1 GCA030176375_00247 CDS open 60240-61046 _na     268_aa FAD/NAD(P)-binding domain-containing protein
3738 JASNUJ010000012.1 GCA030176375_00248 CDS open 61215-62801 _na     528_aa succinic semialdehyde dehydrogenase
3739 JASNUJ010000012.1 GCA030176375_00249 CDS open 62879-63934 _na     351_aa ER-bound oxygenase mpaB/mpaB'/Rubber oxygenase catalytic domain-containing protein
3740 JASNUJ010000012.1 GCA030176375_00250 CDS open 64335-64913 _na     192_aa Cholesterol esterase
3741 JASNUJ010000012.1 GCA030176375_00251 CDS open 64903-65547 _na     214_aa Secreted protein
3742 JASNUJ010000012.1 GCA030176375_00252 CDS open 65544-66173 _na     209_aa DUF2993 domain-containing protein
3743 JASNUJ010000012.1 GCA030176375_00253 CDS open 66192-68156 _na     654_aa ABC transmembrane type-1 domain-containing protein
3744 JASNUJ010000012.1 GCA030176375_00254 CDS open 68156-69898 _na     580_aa ABC transmembrane type-1 domain-containing protein
3745 JASNUJ010000012.1 GCA030176375_00255 CDS open 70009-70425 _na     138_aa Methylenetetrahydrofolate--tRNA-(Uracil-5-)-methyltransferase
3746 JASNUJ010000012.1 GCA030176375_00256 CDS open 70598-71383 _na     261_aa phosphoadenylyl-sulfate reductase
3747 JASNUJ010000012.1 GCA030176375_00257 CDS open 71383-72282 _na     299_aa Sulfate adenylyltransferase subunit 2
3748 JASNUJ010000012.1 GCA030176375_00258 CDS open 72282-73565 _na     427_aa sulfate adenylyltransferase
3749 JASNUJ010000012.1 GCA030176375_00259 CDS open 73773-74363 _na     196_aa nucleosidase
3750 JASNUJ010000012.1 GCA030176375_00260 CDS open 74500-77325 _na     941_aa von Willebrand factor type A domain-containing protein
3751 JASNUJ010000012.1 GCA030176375_00261 CDS open 77343-78203 _na     286_aa Gram-positive pilin subunit D1 N-terminal domain-containing protein
3752 JASNUJ010000012.1 GCA030176375_00262 CDS open 78204-79124 _na     306_aa Sortase
3753 JASNUJ010000012.1 GCA030176375_00263 CDS open 79287-80813 _na     508_aa SpaH/EbpB family LPXTG-anchored major pilin
3754 JASNUJ010000012.1 GCA030176375_00264 CDS open 81116-82549 _na     477_aa AI-2E family transporter
3755 JASNUJ010000012.1 GCA030176375_00265 CDS open 82690-86130 _na     1146_aa L-glutamate gamma-semialdehyde dehydrogenase
3756 JASNUJ010000012.1 GCA030176375_00266 CDS open 86982-88871 _na     629_aa LPXTG cell wall anchor domain-containing protein
3757 JASNUJ010000012.1 GCA030176375_00267 CDS open 89010-89684 _na     224_aa Response regulatory domain-containing protein
3758 JASNUJ010000012.1 GCA030176375_00268 CDS open 89669-89824 _na     51_aa hypothetical protein
3759 JASNUJ010000012.1 GCA030176375_00269 CDS open 89916-91094 _na     392_aa histidine kinase
3760 JASNUJ010000012.1 GCA030176375_00270 CDS open 91321-91542 _na     73_aa hypothetical protein
3761 JASNUJ010000012.1 GCA030176375_00271 CDS open 92038-93900 _na     620_aa dnaK molecular chaperone DnaK
3762 JASNUJ010000012.1 GCA030176375_00272 CDS open 93918-94622 _na     234_aa grpE Protein GrpE
3763 JASNUJ010000012.1 GCA030176375_00273 CDS open 94721-95926 _na     401_aa dnaJ molecular chaperone DnaJ
3764 JASNUJ010000012.1 GCA030176375_00274 CDS open 95947-96489 _na     180_aa hspR heat shock protein transcriptional repressor HspR
3765 JASNUJ010000012.1 GCA030176375_00201 gene open 267-2216
3766 JASNUJ010000012.1 GCA030176375_00202 gene open 2219-2746
3767 JASNUJ010000012.1 GCA030176375_00203 gene open 2780-3700
3768 JASNUJ010000012.1 GCA030176375_00204 gene open 3760-5505
3769 JASNUJ010000012.1 GCA030176375_00205 gene open 5596-10353 pks13
3770 JASNUJ010000012.1 GCA030176375_00206 gene open 10328-11884
3771 JASNUJ010000012.1 GCA030176375_00207 gene open 12519-12692
3772 JASNUJ010000012.1 GCA030176375_00208 gene open 12986-13459
3773 JASNUJ010000012.1 GCA030176375_00209 gene open 13472-13891 ybjN
3774 JASNUJ010000012.1 GCA030176375_00210 gene open 13896-14315 ybjN
3775 JASNUJ010000012.1 GCA030176375_00211 gene open 14757-16100
3776 JASNUJ010000012.1 GCA030176375_00212 gene open 16383-16721
3777 JASNUJ010000012.1 GCA030176375_00213 gene open 16718-17746
3778 JASNUJ010000012.1 GCA030176375_00214 gene open 17747-19900
3779 JASNUJ010000012.1 GCA030176375_00215 gene open 19915-20508
3780 JASNUJ010000012.1 GCA030176375_00216 gene open 20509-21285 trmB
3781 JASNUJ010000012.1 GCA030176375_00217 gene open 21647-23473
3782 JASNUJ010000012.1 GCA030176375_00218 gene open 24508-25791
3783 JASNUJ010000012.1 GCA030176375_00219 gene open 25807-27123
3784 JASNUJ010000012.1 GCA030176375_00220 gene open 27120-27293
3785 JASNUJ010000012.1 GCA030176375_00221 gene open 27460-29034
3786 JASNUJ010000012.1 GCA030176375_00222 gene open 29044-29883
3787 JASNUJ010000012.1 GCA030176375_00223 gene open 30050-31321
3788 JASNUJ010000012.1 GCA030176375_00224 gene open 31465-34821
3789 JASNUJ010000012.1 GCA030176375_00225 gene open 35223-35936
3790 JASNUJ010000012.1 GCA030176375_00226 gene open 35971-36717
3791 JASNUJ010000012.1 GCA030176375_00227 gene open 36742-37851
3792 JASNUJ010000012.1 GCA030176375_00228 gene open 37745-39226
3793 JASNUJ010000012.1 GCA030176375_00229 gene open 39207-40400
3794 JASNUJ010000012.1 GCA030176375_00230 gene open 40451-41584
3795 JASNUJ010000012.1 GCA030176375_00231 gene open 41490-44654
3796 JASNUJ010000012.1 GCA030176375_00232 gene open 44669-44866
3797 JASNUJ010000012.1 GCA030176375_00233 gene open 44889-45377 uspA
3798 JASNUJ010000012.1 GCA030176375_00234 gene open 45394-46593
3799 JASNUJ010000012.1 GCA030176375_00235 gene open 46628-48316
3800 JASNUJ010000012.1 GCA030176375_00236 gene open 48330-48455
3801 JASNUJ010000012.1 GCA030176375_00237 gene open 48778-49023 copG
3802 JASNUJ010000012.1 GCA030176375_00239 gene open 49556-50125 dcd
3803 JASNUJ010000012.1 GCA030176375_00240 gene open 50162-51484
3804 JASNUJ010000012.1 GCA030176375_00241 gene open 51481-52812
3805 JASNUJ010000012.1 GCA030176375_00242 gene open 52865-54100
3806 JASNUJ010000012.1 GCA030176375_00243 gene open 54150-54800
3807 JASNUJ010000012.1 GCA030176375_00244 gene open 54876-56183
3808 JASNUJ010000012.1 GCA030176375_00245 gene open 56218-59235
3809 JASNUJ010000012.1 GCA030176375_00246 gene open 59341-60240
3810 JASNUJ010000012.1 GCA030176375_00247 gene open 60240-61046
3811 JASNUJ010000012.1 GCA030176375_00248 gene open 61215-62801
3812 JASNUJ010000012.1 GCA030176375_00249 gene open 62879-63934
3813 JASNUJ010000012.1 GCA030176375_00250 gene open 64335-64913
3814 JASNUJ010000012.1 GCA030176375_00251 gene open 64903-65547
3815 JASNUJ010000012.1 GCA030176375_00252 gene open 65544-66173
3816 JASNUJ010000012.1 GCA030176375_00253 gene open 66192-68156
3817 JASNUJ010000012.1 GCA030176375_00254 gene open 68156-69898
3818 JASNUJ010000012.1 GCA030176375_00255 gene open 70009-70425
3819 JASNUJ010000012.1 GCA030176375_00256 gene open 70598-71383
3820 JASNUJ010000012.1 GCA030176375_00257 gene open 71383-72282
3821 JASNUJ010000012.1 GCA030176375_00258 gene open 72282-73565
3822 JASNUJ010000012.1 GCA030176375_00259 gene open 73773-74363
3823 JASNUJ010000012.1 GCA030176375_00260 gene open 74500-77325
3824 JASNUJ010000012.1 GCA030176375_00261 gene open 77343-78203
3825 JASNUJ010000012.1 GCA030176375_00262 gene open 78204-79124
3826 JASNUJ010000012.1 GCA030176375_00263 gene open 79287-80813
3827 JASNUJ010000012.1 GCA030176375_00264 gene open 81116-82549
3828 JASNUJ010000012.1 GCA030176375_00265 gene open 82690-86130
3829 JASNUJ010000012.1 GCA030176375_00266 gene open 86982-88871
3830 JASNUJ010000012.1 GCA030176375_00267 gene open 89010-89684
3831 JASNUJ010000012.1 GCA030176375_00268 gene open 89669-89824
3832 JASNUJ010000012.1 GCA030176375_00269 gene open 89916-91094
3833 JASNUJ010000012.1 GCA030176375_00270 gene open 91321-91542
3834 JASNUJ010000012.1 GCA030176375_00271 gene open 92038-93900 dnaK
3835 JASNUJ010000012.1 GCA030176375_00272 gene open 93918-94622 grpE
3836 JASNUJ010000012.1 GCA030176375_00273 gene open 94721-95926 dnaJ
3837 JASNUJ010000012.1 GCA030176375_00274 gene open 95947-96489 hspR
3838 JASNUJ010000012.1 GCA030176375_00238 gene open 49419-49492 trnG
3839 JASNUJ010000012.1 GCA030176375_00238 tRNA open 49419-49492 trnG tRNA-Gly(ccc)
3840 JASNUJ010000013.1 GCA030176375_00312 gene open 41469-41924 RNaseP_bact_a
3841 JASNUJ010000013.1 GCA030176375_00312 ncRNA open 41469-41924 Bacterial RNase P class A
3842 JASNUJ010000013.1 repeat_region open 19891-22431 CRISPR array with 42 repeats of length 28%2C consensus sequence GTGCTCCCCGCGTGAGCGGGGATGAGCC and spacer length 33
3843 JASNUJ010000013.1 GCA030176375_00276 CDS open 491-1207 _na     238_aa 6-carboxyhexanoate--CoA ligase
3844 JASNUJ010000013.1 GCA030176375_00277 CDS open 1204-2373 _na     389_aa 8-amino-7-oxononanoate synthase
3845 JASNUJ010000013.1 GCA030176375_00278 CDS open 2435-2818 _na     127_aa hypothetical protein
3846 JASNUJ010000013.1 GCA030176375_00279 CDS open 2953-4086 _na     377_aa jetD Wadjet protein JetD C-terminal domain-containing protein
3847 JASNUJ010000013.1 GCA030176375_00280 CDS open 4073-7444 _na     1123_aa ATP-binding protein
3848 JASNUJ010000013.1 GCA030176375_00281 CDS open 7437-8087 _na     216_aa DUF4194 domain-containing protein
3849 JASNUJ010000013.1 GCA030176375_00282 CDS open 8087-9556 _na     489_aa DUF3375 domain-containing protein
3850 JASNUJ010000013.1 GCA030176375_00283 CDS open 9682-10101 _na     139_aa Organic hydroperoxide resistance protein
3851 JASNUJ010000013.1 GCA030176375_00284 CDS open 10619-13399 _na     926_aa CRISPR-associated helicase Cas3
3852 JASNUJ010000013.1 GCA030176375_00285 CDS open 13498-15243 _na     581_aa casA type I-E CRISPR-associated protein Cse1/CasA
3853 JASNUJ010000013.1 GCA030176375_00286 CDS open 15236-15907 _na     223_aa casB type I-E CRISPR-associated protein Cse2/CasB
3854 JASNUJ010000013.1 GCA030176375_00287 CDS open 15943-17085 _na     380_aa cas7e type I-E CRISPR-associated protein Cas7/Cse4/CasC
3855 JASNUJ010000013.1 GCA030176375_00288 CDS open 17213-17815 _na     200_aa cas5e type I-E CRISPR-associated protein Cas5/CasD
3856 JASNUJ010000013.1 GCA030176375_00289 CDS open 17812-18510 _na     232_aa cas6e type I-E CRISPR-associated protein Cas6/Cse3/CasE
3857 JASNUJ010000013.1 GCA030176375_00290 CDS open 18510-19448 _na     312_aa cas1e type I-E CRISPR-associated endonuclease Cas1e
3858 JASNUJ010000013.1 GCA030176375_00291 CDS open 22510-22659 _na     49_aa hypothetical protein
3859 JASNUJ010000013.1 GCA030176375_00292 CDS open 22738-22905 _na     55_aa hypothetical protein
3860 JASNUJ010000013.1 GCA030176375_00294 CDS open 23415-23945 _na     176_aa DUF3558 domain-containing protein
3861 JASNUJ010000013.1 GCA030176375_00295 CDS open 24025-25131 _na     368_aa Glycine transporter domain-containing protein
3862 JASNUJ010000013.1 GCA030176375_00296 CDS open 25233-26831 _na     532_aa mscS Mechanosensitive ion channel MscS domain-containing protein
3863 JASNUJ010000013.1 GCA030176375_00297 CDS open 27003-28094 _na     363_aa NADH:flavin oxidoreductase/NADH oxidase N-terminal domain-containing protein
3864 JASNUJ010000013.1 GCA030176375_00298 CDS open 28306-29100 _na     264_aa Beta-lactamase-related domain-containing protein
3865 JASNUJ010000013.1 GCA030176375_00299 CDS open 29183-29299 _na     38_aa hypothetical protein
3866 JASNUJ010000013.1 GCA030176375_00300 CDS open 29911-30327 _na     138_aa hypothetical protein
3867 JASNUJ010000013.1 GCA030176375_00301 CDS open 30404-31192 _na     262_aa TIGR01457 family HAD hydrolase
3868 JASNUJ010000013.1 GCA030176375_00302 CDS open 31189-31488 _na     99_aa Acyl carrier protein
3869 JASNUJ010000013.1 GCA030176375_00303 CDS open 31642-34386 _na     914_aa aceE pyruvate dehydrogenase (acetyl-transferring)%2C homodimeric type
3870 JASNUJ010000013.1 GCA030176375_00304 CDS open 34745-35143 _na     132_aa DUF3052 domain-containing protein
3871 JASNUJ010000013.1 GCA030176375_00306 CDS open 35393-36352 _na     319_aa SURF1 family protein
3872 JASNUJ010000013.1 GCA030176375_00307 CDS open 36363-36854 _na     163_aa protein-tyrosine-phosphatase
3873 JASNUJ010000013.1 GCA030176375_00308 CDS open 36948-38090 _na     380_aa Nif3-like dinuclear metal center hexameric protein
3874 JASNUJ010000013.1 GCA030176375_00309 CDS open 38091-38810 _na     239_aa C4-type zinc ribbon domain-containing protein
3875 JASNUJ010000013.1 GCA030176375_00310 CDS open 38807-40003 _na     398_aa bifunctional RNase H/acid phosphatase
3876 JASNUJ010000013.1 GCA030176375_00311 CDS open 40336-41400 _na     354_aa adhP alcohol dehydrogenase AdhP
3877 JASNUJ010000013.1 GCA030176375_00313 CDS open 41928-43202 _na     424_aa Galactokinase N-terminal domain-containing protein
3878 JASNUJ010000013.1 GCA030176375_00314 CDS open 43454-43648 _na     64_aa SPOR domain-containing protein
3879 JASNUJ010000013.1 GCA030176375_00315 CDS open 43720-45480 _na     586_aa CHAD domain-containing protein
3880 JASNUJ010000013.1 GCA030176375_00316 CDS open 45655-46695 _na     346_aa DUF2786 domain-containing protein
3881 JASNUJ010000013.1 GCA030176375_00317 CDS open 46891-48228 _na     445_aa glnA type I glutamate--ammonia ligase
3882 JASNUJ010000013.1 GCA030176375_00318 CDS open 48236-51295 _na     1019_aa bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase
3883 JASNUJ010000013.1 GCA030176375_00319 CDS open 51392-51754 _na     120_aa Amphi-Trp domain-containing protein
3884 JASNUJ010000013.1 GCA030176375_00320 CDS open 51720-52223 _na     167_aa LytR/CpsA/Psr regulator C-terminal domain-containing protein
3885 JASNUJ010000013.1 GCA030176375_00321 CDS open 52322-52432 _na     36_aa hypothetical protein
3886 JASNUJ010000013.1 GCA030176375_00322 CDS open 52629-53405 _na     258_aa AAA+ ATPase domain-containing protein
3887 JASNUJ010000013.1 GCA030176375_00323 CDS open 53410-54672 _na     420_aa Major facilitator superfamily (MFS) profile domain-containing protein
3888 JASNUJ010000013.1 GCA030176375_00324 CDS open 54756-56198 _na     480_aa thrC threonine synthase
3889 JASNUJ010000013.1 GCA030176375_00325 CDS open 56206-56352 _na     48_aa Cell division protein
3890 JASNUJ010000013.1 GCA030176375_00326 CDS open 56327-57172 _na     281_aa Peptidase S1 domain-containing protein
3891 JASNUJ010000013.1 GCA030176375_00327 CDS open 57203-57748 _na     181_aa Nudix hydrolase domain-containing protein
3892 JASNUJ010000013.1 GCA030176375_00328 CDS open 57745-58119 _na     124_aa hypothetical protein
3893 JASNUJ010000013.1 GCA030176375_00329 CDS open 58150-59037 _na     295_aa Voltage-dependent anion channel
3894 JASNUJ010000013.1 GCA030176375_00330 CDS open 59331-60764 _na     477_aa glnA type I glutamate--ammonia ligase
3895 JASNUJ010000013.1 GCA030176375_00331 CDS open 60883-61356 _na     157_aa RDD domain-containing protein
3896 JASNUJ010000013.1 GCA030176375_00332 CDS open 61510-62295 _na     261_aa DUF4191 domain-containing protein
3897 JASNUJ010000013.1 GCA030176375_00333 CDS open 62378-63442 _na     354_aa lipA lipoyl synthase
3898 JASNUJ010000013.1 GCA030176375_00334 CDS open 63579-64382 _na     267_aa lipB lipoyl(octanoyl) transferase LipB
3899 JASNUJ010000013.1 GCA030176375_00335 CDS open 64501-64893 _na     130_aa gcvH glycine cleavage system protein GcvH
3900 JASNUJ010000013.1 GCA030176375_00336 CDS open 64939-66051 _na     370_aa gcvT glycine cleavage system aminomethyltransferase GcvT
3901 JASNUJ010000013.1 GCA030176375_00337 CDS open 66054-68897 _na     947_aa gcvP aminomethyl-transferring glycine dehydrogenase
3902 JASNUJ010000013.1 GCA030176375_00338 CDS open 69196-70116 _na     306_aa hypothetical protein
3903 JASNUJ010000013.1 GCA030176375_00276 gene open 491-1207
3904 JASNUJ010000013.1 GCA030176375_00277 gene open 1204-2373
3905 JASNUJ010000013.1 GCA030176375_00278 gene open 2435-2818
3906 JASNUJ010000013.1 GCA030176375_00279 gene open 2953-4086 jetD
3907 JASNUJ010000013.1 GCA030176375_00280 gene open 4073-7444
3908 JASNUJ010000013.1 GCA030176375_00281 gene open 7437-8087
3909 JASNUJ010000013.1 GCA030176375_00282 gene open 8087-9556
3910 JASNUJ010000013.1 GCA030176375_00283 gene open 9682-10101
3911 JASNUJ010000013.1 GCA030176375_00284 gene open 10619-13399
3912 JASNUJ010000013.1 GCA030176375_00285 gene open 13498-15243 casA
3913 JASNUJ010000013.1 GCA030176375_00286 gene open 15236-15907 casB
3914 JASNUJ010000013.1 GCA030176375_00287 gene open 15943-17085 cas7e
3915 JASNUJ010000013.1 GCA030176375_00288 gene open 17213-17815 cas5e
3916 JASNUJ010000013.1 GCA030176375_00289 gene open 17812-18510 cas6e
3917 JASNUJ010000013.1 GCA030176375_00290 gene open 18510-19448 cas1e
3918 JASNUJ010000013.1 GCA030176375_00291 gene open 22510-22659
3919 JASNUJ010000013.1 GCA030176375_00292 gene open 22738-22905
3920 JASNUJ010000013.1 GCA030176375_00294 gene open 23415-23945
3921 JASNUJ010000013.1 GCA030176375_00295 gene open 24025-25131
3922 JASNUJ010000013.1 GCA030176375_00296 gene open 25233-26831 mscS
3923 JASNUJ010000013.1 GCA030176375_00297 gene open 27003-28094
3924 JASNUJ010000013.1 GCA030176375_00298 gene open 28306-29100
3925 JASNUJ010000013.1 GCA030176375_00299 gene open 29183-29299
3926 JASNUJ010000013.1 GCA030176375_00300 gene open 29911-30327
3927 JASNUJ010000013.1 GCA030176375_00301 gene open 30404-31192
3928 JASNUJ010000013.1 GCA030176375_00302 gene open 31189-31488
3929 JASNUJ010000013.1 GCA030176375_00303 gene open 31642-34386 aceE
3930 JASNUJ010000013.1 GCA030176375_00304 gene open 34745-35143
3931 JASNUJ010000013.1 GCA030176375_00306 gene open 35393-36352
3932 JASNUJ010000013.1 GCA030176375_00307 gene open 36363-36854
3933 JASNUJ010000013.1 GCA030176375_00308 gene open 36948-38090
3934 JASNUJ010000013.1 GCA030176375_00309 gene open 38091-38810
3935 JASNUJ010000013.1 GCA030176375_00310 gene open 38807-40003
3936 JASNUJ010000013.1 GCA030176375_00311 gene open 40336-41400 adhP
3937 JASNUJ010000013.1 GCA030176375_00313 gene open 41928-43202
3938 JASNUJ010000013.1 GCA030176375_00314 gene open 43454-43648
3939 JASNUJ010000013.1 GCA030176375_00315 gene open 43720-45480
3940 JASNUJ010000013.1 GCA030176375_00316 gene open 45655-46695
3941 JASNUJ010000013.1 GCA030176375_00317 gene open 46891-48228 glnA
3942 JASNUJ010000013.1 GCA030176375_00318 gene open 48236-51295
3943 JASNUJ010000013.1 GCA030176375_00319 gene open 51392-51754
3944 JASNUJ010000013.1 GCA030176375_00320 gene open 51720-52223
3945 JASNUJ010000013.1 GCA030176375_00321 gene open 52322-52432
3946 JASNUJ010000013.1 GCA030176375_00322 gene open 52629-53405
3947 JASNUJ010000013.1 GCA030176375_00323 gene open 53410-54672
3948 JASNUJ010000013.1 GCA030176375_00324 gene open 54756-56198 thrC
3949 JASNUJ010000013.1 GCA030176375_00325 gene open 56206-56352
3950 JASNUJ010000013.1 GCA030176375_00326 gene open 56327-57172
3951 JASNUJ010000013.1 GCA030176375_00327 gene open 57203-57748
3952 JASNUJ010000013.1 GCA030176375_00328 gene open 57745-58119
3953 JASNUJ010000013.1 GCA030176375_00329 gene open 58150-59037
3954 JASNUJ010000013.1 GCA030176375_00330 gene open 59331-60764 glnA
3955 JASNUJ010000013.1 GCA030176375_00331 gene open 60883-61356
3956 JASNUJ010000013.1 GCA030176375_00332 gene open 61510-62295
3957 JASNUJ010000013.1 GCA030176375_00333 gene open 62378-63442 lipA
3958 JASNUJ010000013.1 GCA030176375_00334 gene open 63579-64382 lipB
3959 JASNUJ010000013.1 GCA030176375_00335 gene open 64501-64893 gcvH
3960 JASNUJ010000013.1 GCA030176375_00336 gene open 64939-66051 gcvT
3961 JASNUJ010000013.1 GCA030176375_00337 gene open 66054-68897 gcvP
3962 JASNUJ010000013.1 GCA030176375_00338 gene open 69196-70116
3963 JASNUJ010000013.1 GCA030176375_00275 gene open 167-239 trnN
3964 JASNUJ010000013.1 GCA030176375_00293 gene open 23299-23372 trnI
3965 JASNUJ010000013.1 GCA030176375_00305 gene open 35211-35286 trnV
3966 JASNUJ010000013.1 GCA030176375_00275 tRNA open 167-239 trnN tRNA-Asn(gtt)
3967 JASNUJ010000013.1 GCA030176375_00293 tRNA open 23299-23372 trnI tRNA-Ile2(cat)
3968 JASNUJ010000013.1 GCA030176375_00305 tRNA open 35211-35286 trnV tRNA-Val(tac)
3969 JASNUJ010000014.1 GCA030176375_00339 CDS open 120-353 _na     77_aa Integrase catalytic domain-containing protein
3970 JASNUJ010000014.1 GCA030176375_00340 CDS open 591-923 _na     110_aa crcB Fluoride ion transporter CrcB
3971 JASNUJ010000014.1 GCA030176375_00341 CDS open 1103-2434 _na     443_aa DUF445 domain-containing protein
3972 JASNUJ010000014.1 GCA030176375_00342 CDS open 2468-2902 _na     144_aa CsbD-like domain-containing protein
3973 JASNUJ010000014.1 GCA030176375_00343 CDS open 2908-3198 _na     96_aa DUF2516 domain-containing protein
3974 JASNUJ010000014.1 GCA030176375_00344 CDS open 3201-3644 _na     147_aa Deoxyribose-phosphate aldolase
3975 JASNUJ010000014.1 GCA030176375_00345 CDS open 3714-4517 _na     267_aa DUF2993 domain-containing protein
3976 JASNUJ010000014.1 GCA030176375_00346 CDS open 4567-5376 _na     269_aa Methylase
3977 JASNUJ010000014.1 GCA030176375_00347 CDS open 5409-5900 _na     163_aa DUF2505 domain-containing protein
3978 JASNUJ010000014.1 GCA030176375_00348 CDS open 5925-7052 _na     375_aa UDP-N-acetylmuramate dehydrogenase
3979 JASNUJ010000014.1 GCA030176375_00349 CDS open 7295-7771 _na     158_aa S-ribosylhomocysteine lyase
3980 JASNUJ010000014.1 GCA030176375_00350 CDS open 7842-9011 _na     389_aa yihY YihY family protein
3981 JASNUJ010000014.1 GCA030176375_00351 CDS open 9060-10625 _na     521_aa AMP-dependent synthetase/ligase domain-containing protein
3982 JASNUJ010000014.1 GCA030176375_00352 CDS open 10637-12346 _na     569_aa long-chain-fatty-acid--CoA ligase
3983 JASNUJ010000014.1 GCA030176375_00353 CDS open 12417-12965 _na     182_aa Methylated-DNA--protein-cysteine methyltransferase
3984 JASNUJ010000014.1 GCA030176375_00354 CDS open 12989-14707 _na     572_aa long-chain-fatty-acid--CoA ligase
3985 JASNUJ010000014.1 GCA030176375_00355 CDS open 14774-16039 _na     421_aa mshA D-inositol-3-phosphate glycosyltransferase
3986 JASNUJ010000014.1 GCA030176375_00356 CDS open 16081-16827 _na     248_aa phosphoglyceromutase
3987 JASNUJ010000014.1 GCA030176375_00357 CDS open 16879-18159 _na     426_aa senX3 Sensor-like histidine kinase SenX3
3988 JASNUJ010000014.1 GCA030176375_00358 CDS open 18156-18866 _na     236_aa regX3 Sensory transduction protein RegX3
3989 JASNUJ010000014.1 GCA030176375_00359 CDS open 18863-19762 _na     299_aa DUF3109 domain-containing protein
3990 JASNUJ010000014.1 GCA030176375_00360 CDS open 19880-20725 _na     281_aa Ppx/GppA phosphatase family
3991 JASNUJ010000014.1 GCA030176375_00361 CDS open 20735-21955 _na     406_aa tctB tripartite tricarboxylate transporter TctB family protein
3992 JASNUJ010000014.1 GCA030176375_00362 CDS open 22037-22828 _na     263_aa proC pyrroline-5-carboxylate reductase
3993 JASNUJ010000014.1 GCA030176375_00363 CDS open 23080-23268 _na     62_aa Helix-turn-helix domain-containing protein
3994 JASNUJ010000014.1 GCA030176375_00364 CDS open 23613-23714 _na     33_aa 30S ribosomal protein bS22
3995 JASNUJ010000014.1 GCA030176375_00365 CDS open 23926-24291 _na     121_aa doxX DoxX family protein
3996 JASNUJ010000014.1 GCA030176375_00366 CDS open 24366-25403 _na     345_aa HAD hydrolase%2C family IB
3997 JASNUJ010000014.1 GCA030176375_00367 CDS open 25501-25740 _na     79_aa Glutaredoxin family protein
3998 JASNUJ010000014.1 GCA030176375_00368 CDS open 25817-27151 _na     444_aa glutamyl-tRNA reductase
3999 JASNUJ010000014.1 GCA030176375_00369 CDS open 27152-28039 _na     295_aa hemC hydroxymethylbilane synthase
4000 JASNUJ010000014.1 GCA030176375_00370 CDS open 28204-29925 _na     573_aa uroporphyrinogen-III C-methyltransferase