BAKTAGenome Explorer: Corynebacterium accolens (GCA_030176695.1)
Select a Genome:
|
BAKTA Annotations for GCA_030176695.1
|
Search & Sort all 4679 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 3001 | JASNUD010000013.1 | GCA030176695_00307 | gene | open | 58822-59223 | |||
| 3002 | JASNUD010000013.1 | GCA030176695_00308 | gene | open | 59313-63164 | |||
| 3003 | JASNUD010000013.1 | GCA030176695_00309 | gene | open | 63282-64175 | |||
| 3004 | JASNUD010000013.1 | GCA030176695_00310 | gene | open | 64217-65521 | |||
| 3005 | JASNUD010000013.1 | GCA030176695_00253 | gene | open | 11179-11267 | trnS | ||
| 3006 | JASNUD010000013.1 | GCA030176695_00270 | gene | open | 29222-29309 | trnS | ||
| 3007 | JASNUD010000013.1 | GCA030176695_00287 | gene | open | 44576-44648 | trnR | ||
| 3008 | JASNUD010000013.1 | GCA030176695_00295 | gene | open | 51012-51100 | trnS | ||
| 3009 | JASNUD010000013.1 | GCA030176695_00253 | tRNA | open | 11179-11267 | trnS | tRNA-Ser(gga) | |
| 3010 | JASNUD010000013.1 | GCA030176695_00270 | tRNA | open | 29222-29309 | trnS | tRNA-Ser(cga) | |
| 3011 | JASNUD010000013.1 | GCA030176695_00287 | tRNA | open | 44576-44648 | trnR | tRNA-Arg(acg) | |
| 3012 | JASNUD010000013.1 | GCA030176695_00295 | tRNA | open | 51012-51100 | trnS | tRNA-Ser(gct) | |
| 3013 | JASNUD010000014.1 | GCA030176695_00312 | CDS | open | 265-897 | _na 210_aa | orn | oligoribonuclease |
| 3014 | JASNUD010000014.1 | GCA030176695_00313 | CDS | open | 1068-2612 | _na 514_aa | Amino acid carrier protein | |
| 3015 | JASNUD010000014.1 | GCA030176695_00314 | CDS | open | 2609-3409 | _na 266_aa | cmrA | mycolate reductase |
| 3016 | JASNUD010000014.1 | GCA030176695_00316 | CDS | open | 4221-5156 | _na 311_aa | HTH lysR-type domain-containing protein | |
| 3017 | JASNUD010000014.1 | GCA030176695_00317 | CDS | open | 5298-7262 | _na 654_aa | Copper resistance protein D domain-containing protein | |
| 3018 | JASNUD010000014.1 | GCA030176695_00318 | CDS | open | 7455-8051 | _na 198_aa | Single-stranded DNA-binding protein | |
| 3019 | JASNUD010000014.1 | GCA030176695_00319 | CDS | open | 8162-9832 | _na 556_aa | ettA | energy-dependent translational throttle protein EttA |
| 3020 | JASNUD010000014.1 | GCA030176695_00320 | CDS | open | 9848-10258 | _na 136_aa | Thioesterase domain-containing protein | |
| 3021 | JASNUD010000014.1 | GCA030176695_00321 | CDS | open | 10301-10939 | _na 212_aa | DUF1707 domain-containing protein | |
| 3022 | JASNUD010000014.1 | GCA030176695_00322 | CDS | open | 11197-12288 | _na 363_aa | ald | alanine dehydrogenase |
| 3023 | JASNUD010000014.1 | GCA030176695_00323 | CDS | open | 12421-12804 | _na 127_aa | Globin | |
| 3024 | JASNUD010000014.1 | GCA030176695_00324 | CDS | open | 12805-13785 | _na 326_aa | mscS | Mechanosensitive ion channel protein MscS |
| 3025 | JASNUD010000014.1 | GCA030176695_00325 | CDS | open | 14047-15123 | _na 358_aa | cystathionine gamma-synthase | |
| 3026 | JASNUD010000014.1 | GCA030176695_00326 | CDS | open | 15150-17021 | _na 623_aa | FAD-dependent urate hydroxylase HpyO/Asp monooxygenase CreE-like FAD/NAD(P)-binding domain-containing protein | |
| 3027 | JASNUD010000014.1 | GCA030176695_00327 | CDS | open | 17101-17790 | _na 229_aa | SDR family oxidoreductase | |
| 3028 | JASNUD010000014.1 | GCA030176695_00328 | CDS | open | 17795-20311 | _na 838_aa | pepN | aminopeptidase N |
| 3029 | JASNUD010000014.1 | GCA030176695_00329 | CDS | open | 20410-21033 | _na 207_aa | DSBA-like thioredoxin domain-containing protein | |
| 3030 | JASNUD010000014.1 | GCA030176695_00330 | CDS | open | 21034-21435 | _na 133_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 3031 | JASNUD010000014.1 | GCA030176695_00331 | CDS | open | 21556-22035 | _na 159_aa | ribose-5-phosphate isomerase | |
| 3032 | JASNUD010000014.1 | GCA030176695_00332 | CDS | open | 22124-22957 | _na 277_aa | NADP-dependent oxidoreductase domain-containing protein | |
| 3033 | JASNUD010000014.1 | GCA030176695_00334 | CDS | open | 23285-24133 | _na 282_aa | DUF1542 domain-containing protein | |
| 3034 | JASNUD010000014.1 | GCA030176695_00336 | CDS | open | 24436-25791 | _na 451_aa | tig | trigger factor |
| 3035 | JASNUD010000014.1 | GCA030176695_00337 | CDS | open | 25983-26594 | _na 203_aa | ATP-dependent Clp protease proteolytic subunit | |
| 3036 | JASNUD010000014.1 | GCA030176695_00338 | CDS | open | 26615-27238 | _na 207_aa | ATP-dependent Clp protease proteolytic subunit | |
| 3037 | JASNUD010000014.1 | GCA030176695_00339 | CDS | open | 27508-29010 | _na 500_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 3038 | JASNUD010000014.1 | GCA030176695_00340 | CDS | open | 29334-30638 | _na 434_aa | Phosphate transporter | |
| 3039 | JASNUD010000014.1 | GCA030176695_00341 | CDS | open | 30642-30932 | _na 96_aa | DUF4190 domain-containing protein | |
| 3040 | JASNUD010000014.1 | GCA030176695_00342 | CDS | open | 31097-31351 | _na 84_aa | hypothetical protein | |
| 3041 | JASNUD010000014.1 | GCA030176695_00343 | CDS | open | 31435-32199 | _na 254_aa | fabG | 3-oxoacyl-ACP reductase FabG |
| 3042 | JASNUD010000014.1 | GCA030176695_00344 | CDS | open | 32430-33725 | _na 431_aa | clpX | ATP-dependent Clp protease ATP-binding subunit ClpX |
| 3043 | JASNUD010000014.1 | GCA030176695_00345 | CDS | open | 33765-34523 | _na 252_aa | HTH tetR-type domain-containing protein | |
| 3044 | JASNUD010000014.1 | GCA030176695_00346 | CDS | open | 34938-35894 | _na 318_aa | malate dehydrogenase | |
| 3045 | JASNUD010000014.1 | GCA030176695_00347 | CDS | open | 35891-36712 | _na 273_aa | panC | pantoate--beta-alanine ligase |
| 3046 | JASNUD010000014.1 | GCA030176695_00348 | CDS | open | 36724-37545 | _na 273_aa | panB | 3-methyl-2-oxobutanoate hydroxymethyltransferase |
| 3047 | JASNUD010000014.1 | GCA030176695_00349 | CDS | open | 37570-40335 | _na 921_aa | valine--tRNA ligase | |
| 3048 | JASNUD010000014.1 | GCA030176695_00350 | CDS | open | 40335-41906 | _na 523_aa | folC | bifunctional tetrahydrofolate synthase/dihydrofolate synthase |
| 3049 | JASNUD010000014.1 | GCA030176695_00351 | CDS | open | 41903-42397 | _na 164_aa | DUF4233 domain-containing protein | |
| 3050 | JASNUD010000014.1 | GCA030176695_00352 | CDS | open | 42403-42714 | _na 103_aa | Ribosomal protein L7/L12 C-terminal domain-containing protein | |
| 3051 | JASNUD010000014.1 | GCA030176695_00353 | CDS | open | 42742-43188 | _na 148_aa | ndk | nucleoside-diphosphate kinase |
| 3052 | JASNUD010000014.1 | GCA030176695_00354 | CDS | open | 43336-43686 | _na 116_aa | HTH arsR-type domain-containing protein | |
| 3053 | JASNUD010000014.1 | GCA030176695_00355 | CDS | open | 43797-44861 | _na 354_aa | arsB | ACR3 family arsenite efflux transporter |
| 3054 | JASNUD010000014.1 | GCA030176695_00356 | CDS | open | 44858-45649 | _na 263_aa | HTH marR-type domain-containing protein | |
| 3055 | JASNUD010000014.1 | GCA030176695_00357 | CDS | open | 45850-49722 | _na 1290_aa | S1 motif domain-containing protein | |
| 3056 | JASNUD010000014.1 | GCA030176695_00358 | CDS | open | 49947-50252 | _na 101_aa | rplU | 50S ribosomal protein L21 |
| 3057 | JASNUD010000014.1 | GCA030176695_00359 | CDS | open | 50296-50574 | _na 92_aa | rpmA | 50S ribosomal protein L27 |
| 3058 | JASNUD010000014.1 | GCA030176695_00360 | CDS | open | 50747-52279 | _na 510_aa | obgE | GTPase ObgE |
| 3059 | JASNUD010000014.1 | GCA030176695_00361 | CDS | open | 52417-53649 | _na 410_aa | Glutamate 5-kinase | |
| 3060 | JASNUD010000014.1 | GCA030176695_00362 | CDS | open | 53673-54602 | _na 309_aa | D-isomer specific 2-hydroxyacid dehydrogenase NAD-binding domain-containing protein | |
| 3061 | JASNUD010000014.1 | GCA030176695_00363 | CDS | open | 54759-55448 | _na 229_aa | Diphtheria toxin repressor | |
| 3062 | JASNUD010000014.1 | GCA030176695_00364 | CDS | open | 55506-56303 | _na 265_aa | ABC transporter permease | |
| 3063 | JASNUD010000014.1 | GCA030176695_00365 | CDS | open | 56291-57115 | _na 274_aa | ABC 3 transport family protein | |
| 3064 | JASNUD010000014.1 | GCA030176695_00366 | CDS | open | 57112-57810 | _na 232_aa | ABC transporter domain-containing protein | |
| 3065 | JASNUD010000014.1 | GCA030176695_00367 | CDS | open | 57807-58886 | _na 359_aa | Zinc ABC transporter substrate-binding protein | |
| 3066 | JASNUD010000014.1 | GCA030176695_00368 | CDS | open | 59112-60380 | _na 422_aa | glutamate-5-semialdehyde dehydrogenase | |
| 3067 | JASNUD010000014.1 | GCA030176695_00369 | CDS | open | 60385-61311 | _na 308_aa | PE-PPE domain-containing protein | |
| 3068 | JASNUD010000014.1 | GCA030176695_00370 | CDS | open | 61330-61947 | _na 205_aa | nadD | nicotinate-nucleotide adenylyltransferase |
| 3069 | JASNUD010000014.1 | GCA030176695_00371 | CDS | open | 62038-62508 | _na 156_aa | rsfS | ribosome silencing factor |
| 3070 | JASNUD010000014.1 | GCA030176695_00372 | CDS | open | 62516-63214 | _na 232_aa | Phosphoglycerate mutase | |
| 3071 | JASNUD010000014.1 | GCA030176695_00373 | CDS | open | 63214-64011 | _na 265_aa | degV | DegV family EDD domain-containing protein |
| 3072 | JASNUD010000014.1 | GCA030176695_00374 | CDS | open | 64247-64540 | _na 97_aa | hypothetical protein | |
| 3073 | JASNUD010000014.1 | GCA030176695_00312 | gene | open | 265-897 | orn | ||
| 3074 | JASNUD010000014.1 | GCA030176695_00313 | gene | open | 1068-2612 | |||
| 3075 | JASNUD010000014.1 | GCA030176695_00314 | gene | open | 2609-3409 | cmrA | ||
| 3076 | JASNUD010000014.1 | GCA030176695_00316 | gene | open | 4221-5156 | |||
| 3077 | JASNUD010000014.1 | GCA030176695_00317 | gene | open | 5298-7262 | |||
| 3078 | JASNUD010000014.1 | GCA030176695_00318 | gene | open | 7455-8051 | |||
| 3079 | JASNUD010000014.1 | GCA030176695_00319 | gene | open | 8162-9832 | ettA | ||
| 3080 | JASNUD010000014.1 | GCA030176695_00320 | gene | open | 9848-10258 | |||
| 3081 | JASNUD010000014.1 | GCA030176695_00321 | gene | open | 10301-10939 | |||
| 3082 | JASNUD010000014.1 | GCA030176695_00322 | gene | open | 11197-12288 | ald | ||
| 3083 | JASNUD010000014.1 | GCA030176695_00323 | gene | open | 12421-12804 | |||
| 3084 | JASNUD010000014.1 | GCA030176695_00324 | gene | open | 12805-13785 | mscS | ||
| 3085 | JASNUD010000014.1 | GCA030176695_00325 | gene | open | 14047-15123 | |||
| 3086 | JASNUD010000014.1 | GCA030176695_00326 | gene | open | 15150-17021 | |||
| 3087 | JASNUD010000014.1 | GCA030176695_00327 | gene | open | 17101-17790 | |||
| 3088 | JASNUD010000014.1 | GCA030176695_00328 | gene | open | 17795-20311 | pepN | ||
| 3089 | JASNUD010000014.1 | GCA030176695_00329 | gene | open | 20410-21033 | |||
| 3090 | JASNUD010000014.1 | GCA030176695_00330 | gene | open | 21034-21435 | |||
| 3091 | JASNUD010000014.1 | GCA030176695_00331 | gene | open | 21556-22035 | |||
| 3092 | JASNUD010000014.1 | GCA030176695_00332 | gene | open | 22124-22957 | |||
| 3093 | JASNUD010000014.1 | GCA030176695_00334 | gene | open | 23285-24133 | |||
| 3094 | JASNUD010000014.1 | GCA030176695_00336 | gene | open | 24436-25791 | tig | ||
| 3095 | JASNUD010000014.1 | GCA030176695_00337 | gene | open | 25983-26594 | |||
| 3096 | JASNUD010000014.1 | GCA030176695_00338 | gene | open | 26615-27238 | |||
| 3097 | JASNUD010000014.1 | GCA030176695_00339 | gene | open | 27508-29010 | |||
| 3098 | JASNUD010000014.1 | GCA030176695_00340 | gene | open | 29334-30638 | |||
| 3099 | JASNUD010000014.1 | GCA030176695_00341 | gene | open | 30642-30932 | |||
| 3100 | JASNUD010000014.1 | GCA030176695_00342 | gene | open | 31097-31351 | |||
| 3101 | JASNUD010000014.1 | GCA030176695_00343 | gene | open | 31435-32199 | fabG | ||
| 3102 | JASNUD010000014.1 | GCA030176695_00344 | gene | open | 32430-33725 | clpX | ||
| 3103 | JASNUD010000014.1 | GCA030176695_00345 | gene | open | 33765-34523 | |||
| 3104 | JASNUD010000014.1 | GCA030176695_00346 | gene | open | 34938-35894 | |||
| 3105 | JASNUD010000014.1 | GCA030176695_00347 | gene | open | 35891-36712 | panC | ||
| 3106 | JASNUD010000014.1 | GCA030176695_00348 | gene | open | 36724-37545 | panB | ||
| 3107 | JASNUD010000014.1 | GCA030176695_00349 | gene | open | 37570-40335 | |||
| 3108 | JASNUD010000014.1 | GCA030176695_00350 | gene | open | 40335-41906 | folC | ||
| 3109 | JASNUD010000014.1 | GCA030176695_00351 | gene | open | 41903-42397 | |||
| 3110 | JASNUD010000014.1 | GCA030176695_00352 | gene | open | 42403-42714 | |||
| 3111 | JASNUD010000014.1 | GCA030176695_00353 | gene | open | 42742-43188 | ndk | ||
| 3112 | JASNUD010000014.1 | GCA030176695_00354 | gene | open | 43336-43686 | |||
| 3113 | JASNUD010000014.1 | GCA030176695_00355 | gene | open | 43797-44861 | arsB | ||
| 3114 | JASNUD010000014.1 | GCA030176695_00356 | gene | open | 44858-45649 | |||
| 3115 | JASNUD010000014.1 | GCA030176695_00357 | gene | open | 45850-49722 | |||
| 3116 | JASNUD010000014.1 | GCA030176695_00358 | gene | open | 49947-50252 | rplU | ||
| 3117 | JASNUD010000014.1 | GCA030176695_00359 | gene | open | 50296-50574 | rpmA | ||
| 3118 | JASNUD010000014.1 | GCA030176695_00360 | gene | open | 50747-52279 | obgE | ||
| 3119 | JASNUD010000014.1 | GCA030176695_00361 | gene | open | 52417-53649 | |||
| 3120 | JASNUD010000014.1 | GCA030176695_00362 | gene | open | 53673-54602 | |||
| 3121 | JASNUD010000014.1 | GCA030176695_00363 | gene | open | 54759-55448 | |||
| 3122 | JASNUD010000014.1 | GCA030176695_00364 | gene | open | 55506-56303 | |||
| 3123 | JASNUD010000014.1 | GCA030176695_00365 | gene | open | 56291-57115 | |||
| 3124 | JASNUD010000014.1 | GCA030176695_00366 | gene | open | 57112-57810 | |||
| 3125 | JASNUD010000014.1 | GCA030176695_00367 | gene | open | 57807-58886 | |||
| 3126 | JASNUD010000014.1 | GCA030176695_00368 | gene | open | 59112-60380 | |||
| 3127 | JASNUD010000014.1 | GCA030176695_00369 | gene | open | 60385-61311 | |||
| 3128 | JASNUD010000014.1 | GCA030176695_00370 | gene | open | 61330-61947 | nadD | ||
| 3129 | JASNUD010000014.1 | GCA030176695_00371 | gene | open | 62038-62508 | rsfS | ||
| 3130 | JASNUD010000014.1 | GCA030176695_00372 | gene | open | 62516-63214 | |||
| 3131 | JASNUD010000014.1 | GCA030176695_00373 | gene | open | 63214-64011 | degV | ||
| 3132 | JASNUD010000014.1 | GCA030176695_00374 | gene | open | 64247-64540 | |||
| 3133 | JASNUD010000014.1 | GCA030176695_00311 | gene | open | 140-215 | trnH | ||
| 3134 | JASNUD010000014.1 | GCA030176695_00315 | gene | open | 4107-4180 | trnR | ||
| 3135 | JASNUD010000014.1 | GCA030176695_00333 | gene | open | 23092-23163 | trnG | ||
| 3136 | JASNUD010000014.1 | GCA030176695_00335 | gene | open | 24268-24341 | trnP | ||
| 3137 | JASNUD010000014.1 | GCA030176695_00311 | tRNA | open | 140-215 | trnH | tRNA-His(gtg) | |
| 3138 | JASNUD010000014.1 | GCA030176695_00315 | tRNA | open | 4107-4180 | trnR | tRNA-Arg(tct) | |
| 3139 | JASNUD010000014.1 | GCA030176695_00333 | tRNA | open | 23092-23163 | trnG | tRNA-Gly(tcc) | |
| 3140 | JASNUD010000014.1 | GCA030176695_00335 | tRNA | open | 24268-24341 | trnP | tRNA-Pro(tgg) | |
| 3141 | JASNUD010000015.1 | regulatory_region | open | 25609-25675 | L31-Corynebacteriaceae ribosomal protein leader | |||
| 3142 | JASNUD010000015.1 | GCA030176695_00375 | CDS | open | 73-990 | _na 305_aa | 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase | |
| 3143 | JASNUD010000015.1 | GCA030176695_00376 | CDS | open | 987-1850 | _na 287_aa | rsmA | 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA |
| 3144 | JASNUD010000015.1 | GCA030176695_00377 | CDS | open | 1959-3134 | _na 391_aa | G5 domain-containing protein | |
| 3145 | JASNUD010000015.1 | GCA030176695_00378 | CDS | open | 3410-4246 | _na 278_aa | tatD | TatD family hydrolase |
| 3146 | JASNUD010000015.1 | GCA030176695_00379 | CDS | open | 4272-4460 | _na 62_aa | N-acetyltransferase domain-containing protein | |
| 3147 | JASNUD010000015.1 | GCA030176695_00380 | CDS | open | 4560-4766 | _na 68_aa | GNAT family N-acetyltransferase | |
| 3148 | JASNUD010000015.1 | GCA030176695_00381 | CDS | open | 4778-5278 | _na 166_aa | N-acetyltransferase domain-containing protein | |
| 3149 | JASNUD010000015.1 | GCA030176695_00382 | CDS | open | 5378-7210 | _na 610_aa | Methionine--tRNA ligase | |
| 3150 | JASNUD010000015.1 | GCA030176695_00383 | CDS | open | 7345-9201 | _na 618_aa | betP | Glycine betaine transporter BetP |
| 3151 | JASNUD010000015.1 | GCA030176695_00384 | CDS | open | 9484-10332 | _na 282_aa | rsmI | 16S rRNA (cytidine(1402)-2'-O)-methyltransferase |
| 3152 | JASNUD010000015.1 | GCA030176695_00385 | CDS | open | 10357-11982 | _na 541_aa | Dolichyl-phosphate-mannose--protein mannosyltransferase | |
| 3153 | JASNUD010000015.1 | GCA030176695_00386 | CDS | open | 12003-12704 | _na 233_aa | Putative zinc-finger domain-containing protein | |
| 3154 | JASNUD010000015.1 | GCA030176695_00387 | CDS | open | 12691-13104 | _na 137_aa | doxX | DoxX family protein |
| 3155 | JASNUD010000015.1 | GCA030176695_00388 | CDS | open | 13276-13938 | _na 220_aa | DNA-3-methyladenine glycosylase I | |
| 3156 | JASNUD010000015.1 | GCA030176695_00389 | CDS | open | 13935-15311 | _na 458_aa | glpR | gephyrin-like molybdotransferase receptor GlpR |
| 3157 | JASNUD010000015.1 | GCA030176695_00390 | CDS | open | 15544-16254 | _na 236_aa | [ribosomal protein uS5]-alanine N-acetyltransferase | |
| 3158 | JASNUD010000015.1 | GCA030176695_00391 | CDS | open | 16254-17588 | _na 444_aa | glp | gephyrin-like molybdotransferase Glp |
| 3159 | JASNUD010000015.1 | GCA030176695_00392 | CDS | open | 17663-18613 | _na 316_aa | UTP--glucose-1-phosphate uridylyltransferase | |
| 3160 | JASNUD010000015.1 | GCA030176695_00393 | CDS | open | 18658-19239 | _na 193_aa | 5-formyltetrahydrofolate cyclo-ligase | |
| 3161 | JASNUD010000015.1 | GCA030176695_00394 | CDS | open | 19281-20006 | _na 241_aa | cpaB | Flp pilus assembly protein CpaB |
| 3162 | JASNUD010000015.1 | GCA030176695_00395 | CDS | open | 20234-20731 | _na 165_aa | mscL | large-conductance mechanosensitive channel protein MscL |
| 3163 | JASNUD010000015.1 | GCA030176695_00396 | CDS | open | 20843-21073 | _na 76_aa | DUF5709 domain-containing protein | |
| 3164 | JASNUD010000015.1 | GCA030176695_00397 | CDS | open | 21102-21710 | _na 202_aa | MoaB/Mog domain-containing protein | |
| 3165 | JASNUD010000015.1 | GCA030176695_00398 | CDS | open | 21772-23274 | _na 500_aa | PDZ domain-containing protein | |
| 3166 | JASNUD010000015.1 | GCA030176695_00399 | CDS | open | 23594-24967 | _na 457_aa | Glycerol-3-phosphate transporter | |
| 3167 | JASNUD010000015.1 | GCA030176695_00400 | CDS | open | 25144-25317 | _na 57_aa | rpmF | 50S ribosomal protein L32 |
| 3168 | JASNUD010000015.1 | GCA030176695_00401 | CDS | open | 25333-25602 | _na 89_aa | rpmE2 | type B 50S ribosomal protein L31 |
| 3169 | JASNUD010000015.1 | GCA030176695_00402 | CDS | open | 26116-26352 | _na 78_aa | rpmB | 50S ribosomal protein L28 |
| 3170 | JASNUD010000015.1 | GCA030176695_00403 | CDS | open | 26355-26519 | _na 54_aa | rpmG | 50S ribosomal protein L33 |
| 3171 | JASNUD010000015.1 | GCA030176695_00404 | CDS | open | 26523-26828 | _na 101_aa | rpsN | 30S ribosomal protein S14 |
| 3172 | JASNUD010000015.1 | GCA030176695_00405 | CDS | open | 26844-27098 | _na 84_aa | rpsR | 30S ribosomal protein S18 |
| 3173 | JASNUD010000015.1 | GCA030176695_00406 | CDS | open | 27430-28212 | _na 260_aa | DUF294 domain-containing protein | |
| 3174 | JASNUD010000015.1 | GCA030176695_00407 | CDS | open | 28325-29044 | _na 239_aa | HTH tetR-type domain-containing protein | |
| 3175 | JASNUD010000015.1 | GCA030176695_00408 | CDS | open | 29082-29693 | _na 203_aa | Protein kinase | |
| 3176 | JASNUD010000015.1 | GCA030176695_00409 | CDS | open | 29726-30706 | _na 326_aa | Penicillin-binding protein transpeptidase domain-containing protein | |
| 3177 | JASNUD010000015.1 | GCA030176695_00410 | CDS | open | 30738-32270 | _na 510_aa | purH | bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase |
| 3178 | JASNUD010000015.1 | GCA030176695_00411 | CDS | open | 32298-32861 | _na 187_aa | purN | phosphoribosylglycinamide formyltransferase |
| 3179 | JASNUD010000015.1 | GCA030176695_00412 | CDS | open | 32929-34695 | _na 588_aa | DUF6350 domain-containing protein | |
| 3180 | JASNUD010000015.1 | GCA030176695_00413 | CDS | open | 35214-35969 | _na 251_aa | Peptidase M23 domain-containing protein | |
| 3181 | JASNUD010000015.1 | GCA030176695_00414 | CDS | open | 36774-37532 | _na 252_aa | Peptidase M23 domain-containing protein | |
| 3182 | JASNUD010000015.1 | GCA030176695_00415 | CDS | open | 37529-40072 | _na 847_aa | pcrA | DNA helicase PcrA |
| 3183 | JASNUD010000015.1 | GCA030176695_00416 | CDS | open | 40170-40493 | _na 107_aa | chorismate mutase | |
| 3184 | JASNUD010000015.1 | GCA030176695_00417 | CDS | open | 40559-41905 | _na 448_aa | Na+/H+ antiporter NhaC-like C-terminal domain-containing protein | |
| 3185 | JASNUD010000015.1 | GCA030176695_00418 | CDS | open | 41973-43640 | _na 555_aa | pgi | glucose-6-phosphate isomerase |
| 3186 | JASNUD010000015.1 | GCA030176695_00419 | CDS | open | 43848-44273 | _na 141_aa | yccF | YccF domain-containing protein |
| 3187 | JASNUD010000015.1 | GCA030176695_00420 | CDS | open | 44309-45115 | _na 268_aa | DNA-(apurinic or apyrimidinic site) lyase | |
| 3188 | JASNUD010000015.1 | GCA030176695_00421 | CDS | open | 45185-50098 | _na 1637_aa | ATP-dependent helicase | |
| 3189 | JASNUD010000015.1 | GCA030176695_00422 | CDS | open | 50134-50892 | _na 252_aa | 3'(2')%2C5-bisphosphonucleoside 3'(2')-phosphohydrolase | |
| 3190 | JASNUD010000015.1 | GCA030176695_00423 | CDS | open | 50889-51557 | _na 222_aa | HTH tetR-type domain-containing protein | |
| 3191 | JASNUD010000015.1 | GCA030176695_00424 | CDS | open | 51665-52558 | _na 297_aa | NAD-dependent epimerase/dehydratase domain-containing protein | |
| 3192 | JASNUD010000015.1 | GCA030176695_00425 | CDS | open | 52607-53434 | _na 275_aa | thymidylate synthase | |
| 3193 | JASNUD010000015.1 | GCA030176695_00426 | CDS | open | 53434-53964 | _na 176_aa | dihydrofolate reductase | |
| 3194 | JASNUD010000015.1 | GCA030176695_00427 | CDS | open | 53964-54245 | _na 93_aa | Glutaredoxin-like protein | |
| 3195 | JASNUD010000015.1 | GCA030176695_00429 | CDS | open | 55036-55149 | _na 37_aa | DJ-1/PfpI domain-containing protein | |
| 3196 | JASNUD010000015.1 | GCA030176695_00430 | CDS | open | 55518-55991 | _na 157_aa | ABC transporter permease | |
| 3197 | JASNUD010000015.1 | GCA030176695_00431 | CDS | open | 55988-56713 | _na 241_aa | ABC transmembrane type-1 domain-containing protein | |
| 3198 | JASNUD010000015.1 | GCA030176695_00432 | CDS | open | 56710-58179 | _na 489_aa | ccmA | heme ABC exporter ATP-binding protein CcmA |
| 3199 | JASNUD010000015.1 | GCA030176695_00433 | CDS | open | 58187-59935 | _na 582_aa | ABC transporter domain-containing protein | |
| 3200 | JASNUD010000015.1 | GCA030176695_00434 | CDS | open | 59928-61700 | _na 590_aa | ABC transporter ATP-binding protein | |
| 3201 | JASNUD010000015.1 | GCA030176695_00435 | CDS | open | 61845-62597 | _na 250_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 3202 | JASNUD010000015.1 | GCA030176695_00436 | CDS | open | 62600-63046 | _na 148_aa | DUF2871 domain-containing protein | |
| 3203 | JASNUD010000015.1 | GCA030176695_00437 | CDS | open | 63258-63473 | _na 71_aa | Secreted protein | |
| 3204 | JASNUD010000015.1 | GCA030176695_00375 | gene | open | 73-990 | |||
| 3205 | JASNUD010000015.1 | GCA030176695_00376 | gene | open | 987-1850 | rsmA | ||
| 3206 | JASNUD010000015.1 | GCA030176695_00377 | gene | open | 1959-3134 | |||
| 3207 | JASNUD010000015.1 | GCA030176695_00378 | gene | open | 3410-4246 | tatD | ||
| 3208 | JASNUD010000015.1 | GCA030176695_00379 | gene | open | 4272-4460 | |||
| 3209 | JASNUD010000015.1 | GCA030176695_00380 | gene | open | 4560-4766 | |||
| 3210 | JASNUD010000015.1 | GCA030176695_00381 | gene | open | 4778-5278 | |||
| 3211 | JASNUD010000015.1 | GCA030176695_00382 | gene | open | 5378-7210 | |||
| 3212 | JASNUD010000015.1 | GCA030176695_00383 | gene | open | 7345-9201 | betP | ||
| 3213 | JASNUD010000015.1 | GCA030176695_00384 | gene | open | 9484-10332 | rsmI | ||
| 3214 | JASNUD010000015.1 | GCA030176695_00385 | gene | open | 10357-11982 | |||
| 3215 | JASNUD010000015.1 | GCA030176695_00386 | gene | open | 12003-12704 | |||
| 3216 | JASNUD010000015.1 | GCA030176695_00387 | gene | open | 12691-13104 | doxX | ||
| 3217 | JASNUD010000015.1 | GCA030176695_00388 | gene | open | 13276-13938 | |||
| 3218 | JASNUD010000015.1 | GCA030176695_00389 | gene | open | 13935-15311 | glpR | ||
| 3219 | JASNUD010000015.1 | GCA030176695_00390 | gene | open | 15544-16254 | |||
| 3220 | JASNUD010000015.1 | GCA030176695_00391 | gene | open | 16254-17588 | glp | ||
| 3221 | JASNUD010000015.1 | GCA030176695_00392 | gene | open | 17663-18613 | |||
| 3222 | JASNUD010000015.1 | GCA030176695_00393 | gene | open | 18658-19239 | |||
| 3223 | JASNUD010000015.1 | GCA030176695_00394 | gene | open | 19281-20006 | cpaB | ||
| 3224 | JASNUD010000015.1 | GCA030176695_00395 | gene | open | 20234-20731 | mscL | ||
| 3225 | JASNUD010000015.1 | GCA030176695_00396 | gene | open | 20843-21073 | |||
| 3226 | JASNUD010000015.1 | GCA030176695_00397 | gene | open | 21102-21710 | |||
| 3227 | JASNUD010000015.1 | GCA030176695_00398 | gene | open | 21772-23274 | |||
| 3228 | JASNUD010000015.1 | GCA030176695_00399 | gene | open | 23594-24967 | |||
| 3229 | JASNUD010000015.1 | GCA030176695_00400 | gene | open | 25144-25317 | rpmF | ||
| 3230 | JASNUD010000015.1 | GCA030176695_00401 | gene | open | 25333-25602 | rpmE2 | ||
| 3231 | JASNUD010000015.1 | GCA030176695_00402 | gene | open | 26116-26352 | rpmB | ||
| 3232 | JASNUD010000015.1 | GCA030176695_00403 | gene | open | 26355-26519 | rpmG | ||
| 3233 | JASNUD010000015.1 | GCA030176695_00404 | gene | open | 26523-26828 | rpsN | ||
| 3234 | JASNUD010000015.1 | GCA030176695_00405 | gene | open | 26844-27098 | rpsR | ||
| 3235 | JASNUD010000015.1 | GCA030176695_00406 | gene | open | 27430-28212 | |||
| 3236 | JASNUD010000015.1 | GCA030176695_00407 | gene | open | 28325-29044 | |||
| 3237 | JASNUD010000015.1 | GCA030176695_00408 | gene | open | 29082-29693 | |||
| 3238 | JASNUD010000015.1 | GCA030176695_00409 | gene | open | 29726-30706 | |||
| 3239 | JASNUD010000015.1 | GCA030176695_00410 | gene | open | 30738-32270 | purH | ||
| 3240 | JASNUD010000015.1 | GCA030176695_00411 | gene | open | 32298-32861 | purN | ||
| 3241 | JASNUD010000015.1 | GCA030176695_00412 | gene | open | 32929-34695 | |||
| 3242 | JASNUD010000015.1 | GCA030176695_00413 | gene | open | 35214-35969 | |||
| 3243 | JASNUD010000015.1 | GCA030176695_00414 | gene | open | 36774-37532 | |||
| 3244 | JASNUD010000015.1 | GCA030176695_00415 | gene | open | 37529-40072 | pcrA | ||
| 3245 | JASNUD010000015.1 | GCA030176695_00416 | gene | open | 40170-40493 | |||
| 3246 | JASNUD010000015.1 | GCA030176695_00417 | gene | open | 40559-41905 | |||
| 3247 | JASNUD010000015.1 | GCA030176695_00418 | gene | open | 41973-43640 | pgi | ||
| 3248 | JASNUD010000015.1 | GCA030176695_00419 | gene | open | 43848-44273 | yccF | ||
| 3249 | JASNUD010000015.1 | GCA030176695_00420 | gene | open | 44309-45115 | |||
| 3250 | JASNUD010000015.1 | GCA030176695_00421 | gene | open | 45185-50098 | |||
| 3251 | JASNUD010000015.1 | GCA030176695_00422 | gene | open | 50134-50892 | |||
| 3252 | JASNUD010000015.1 | GCA030176695_00423 | gene | open | 50889-51557 | |||
| 3253 | JASNUD010000015.1 | GCA030176695_00424 | gene | open | 51665-52558 | |||
| 3254 | JASNUD010000015.1 | GCA030176695_00425 | gene | open | 52607-53434 | |||
| 3255 | JASNUD010000015.1 | GCA030176695_00426 | gene | open | 53434-53964 | |||
| 3256 | JASNUD010000015.1 | GCA030176695_00427 | gene | open | 53964-54245 | |||
| 3257 | JASNUD010000015.1 | GCA030176695_00429 | gene | open | 55036-55149 | |||
| 3258 | JASNUD010000015.1 | GCA030176695_00430 | gene | open | 55518-55991 | |||
| 3259 | JASNUD010000015.1 | GCA030176695_00431 | gene | open | 55988-56713 | |||
| 3260 | JASNUD010000015.1 | GCA030176695_00432 | gene | open | 56710-58179 | ccmA | ||
| 3261 | JASNUD010000015.1 | GCA030176695_00433 | gene | open | 58187-59935 | |||
| 3262 | JASNUD010000015.1 | GCA030176695_00434 | gene | open | 59928-61700 | |||
| 3263 | JASNUD010000015.1 | GCA030176695_00435 | gene | open | 61845-62597 | |||
| 3264 | JASNUD010000015.1 | GCA030176695_00436 | gene | open | 62600-63046 | |||
| 3265 | JASNUD010000015.1 | GCA030176695_00437 | gene | open | 63258-63473 | |||
| 3266 | JASNUD010000015.1 | GCA030176695_00428 | gene | open | 54360-54435 | trnR | ||
| 3267 | JASNUD010000015.1 | GCA030176695_00428 | tRNA | open | 54360-54435 | trnR | tRNA-Arg(cct) | |
| 3268 | JASNUD010000016.1 | repeat_region | open | 15011-15185 | CRISPR array with 3 repeats of length 38%2C consensus sequence TGAAGTCTATCAGGGGTAATGAGAACTGAACCCCAGCT and spacer length 26 | |||
| 3269 | JASNUD010000016.1 | repeat_region | open | 15396-15843 | CRISPR array with 7 repeats of length 36%2C consensus sequence GAAGTCTATCAGGGGTAATGAGAACTGAACCCCAGC and spacer length 28 | |||
| 3270 | JASNUD010000016.1 | GCA030176695_00438 | CDS | open | 265-843 | _na 192_aa | hypothetical protein | |
| 3271 | JASNUD010000016.1 | GCA030176695_00439 | CDS | open | 1475-2407 | _na 310_aa | ATP-grasp domain-containing protein | |
| 3272 | JASNUD010000016.1 | GCA030176695_00440 | CDS | open | 2678-3589 | _na 303_aa | eamA | EamA domain-containing protein |
| 3273 | JASNUD010000016.1 | GCA030176695_00441 | CDS | open | 3877-4476 | _na 199_aa | IS3 family transposase | |
| 3274 | JASNUD010000016.1 | GCA030176695_00442 | CDS | open | 5511-6275 | _na 254_aa | ABC transporter domain-containing protein | |
| 3275 | JASNUD010000016.1 | GCA030176695_00443 | CDS | open | 6268-7146 | _na 292_aa | Nitrate ABC transporter%2C permease | |
| 3276 | JASNUD010000016.1 | GCA030176695_00444 | CDS | open | 7161-8330 | _na 389_aa | SsuA/THI5-like domain-containing protein | |
| 3277 | JASNUD010000016.1 | GCA030176695_00445 | CDS | open | 8558-9103 | _na 181_aa | osmC | OsmC family protein |
| 3278 | JASNUD010000016.1 | GCA030176695_00446 | CDS | open | 9165-10175 | _na 336_aa | o-succinylbenzoate synthase | |
| 3279 | JASNUD010000016.1 | GCA030176695_00447 | CDS | open | 10431-13730 | _na 1099_aa | cas9 | type II CRISPR RNA-guided endonuclease Cas9 |
| 3280 | JASNUD010000016.1 | GCA030176695_00448 | CDS | open | 13735-14649 | _na 304_aa | cas1 | type II CRISPR-associated endonuclease Cas1 |
| 3281 | JASNUD010000016.1 | GCA030176695_00449 | CDS | open | 14657-14962 | _na 101_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 3282 | JASNUD010000016.1 | GCA030176695_00450 | CDS | open | 15990-16451 | _na 153_aa | Septicolysin | |
| 3283 | JASNUD010000016.1 | GCA030176695_00451 | CDS | open | 16742-17722 | _na 326_aa | 1%2C4-dihydroxy-2-naphthoyl-CoA synthase | |
| 3284 | JASNUD010000016.1 | GCA030176695_00452 | CDS | open | 17738-17878 | _na 46_aa | hypothetical protein | |
| 3285 | JASNUD010000016.1 | GCA030176695_00453 | CDS | open | 17924-19081 | _na 385_aa | menE | o-succinylbenzoate--CoA ligase |
| 3286 | JASNUD010000016.1 | GCA030176695_00454 | CDS | open | 19137-20042 | _na 301_aa | 1%2C4-dihydroxy-2-naphthoate polyprenyltransferase | |
| 3287 | JASNUD010000016.1 | GCA030176695_00455 | CDS | open | 20064-20387 | _na 107_aa | DUF4229 domain-containing protein | |
| 3288 | JASNUD010000016.1 | GCA030176695_00456 | CDS | open | 20426-20701 | _na 91_aa | Secreted protein | |
| 3289 | JASNUD010000016.1 | GCA030176695_00457 | CDS | open | 20698-20955 | _na 85_aa | HTH cro/C1-type domain-containing protein | |
| 3290 | JASNUD010000016.1 | GCA030176695_00458 | CDS | open | 20956-22062 | _na 368_aa | ccsB | c-type cytochrome biogenesis protein CcsB |
| 3291 | JASNUD010000016.1 | GCA030176695_00459 | CDS | open | 22145-23776 | _na 543_aa | ResB-like domain-containing protein | |
| 3292 | JASNUD010000016.1 | GCA030176695_00460 | CDS | open | 23784-24587 | _na 267_aa | Cytochrome C biogenesis protein transmembrane domain-containing protein | |
| 3293 | JASNUD010000016.1 | GCA030176695_00461 | CDS | open | 24588-25205 | _na 205_aa | Thioredoxin domain-containing protein | |
| 3294 | JASNUD010000016.1 | GCA030176695_00462 | CDS | open | 25205-25813 | _na 202_aa | Phosphoglycerate mutase | |
| 3295 | JASNUD010000016.1 | GCA030176695_00463 | CDS | open | 25850-27160 | _na 436_aa | hemL | glutamate-1-semialdehyde 2%2C1-aminomutase |
| 3296 | JASNUD010000016.1 | GCA030176695_00464 | CDS | open | 27327-28136 | _na 269_aa | 6-phosphogluconate dehydrogenase NADP-binding domain-containing protein | |
| 3297 | JASNUD010000016.1 | GCA030176695_00465 | CDS | open | 28252-29292 | _na 346_aa | HNH nuclease domain-containing protein | |
| 3298 | JASNUD010000016.1 | GCA030176695_00466 | CDS | open | 29698-31080 | _na 460_aa | protoporphyrinogen oxidase | |
| 3299 | JASNUD010000016.1 | GCA030176695_00467 | CDS | open | 31081-32115 | _na 344_aa | hemE | uroporphyrinogen decarboxylase |
| 3300 | JASNUD010000016.1 | GCA030176695_00468 | CDS | open | 32299-32853 | _na 184_aa | terC | Tellurium resistance protein TerC |
| 3301 | JASNUD010000016.1 | GCA030176695_00469 | CDS | open | 32850-33680 | _na 276_aa | hypothetical protein | |
| 3302 | JASNUD010000016.1 | GCA030176695_00470 | CDS | open | 33690-34673 | _na 327_aa | hemB | porphobilinogen synthase |
| 3303 | JASNUD010000016.1 | GCA030176695_00471 | CDS | open | 34703-36424 | _na 573_aa | uroporphyrinogen-III C-methyltransferase | |
| 3304 | JASNUD010000016.1 | GCA030176695_00472 | CDS | open | 36589-37485 | _na 298_aa | hemC | hydroxymethylbilane synthase |
| 3305 | JASNUD010000016.1 | GCA030176695_00473 | CDS | open | 37486-38820 | _na 444_aa | glutamyl-tRNA reductase | |
| 3306 | JASNUD010000016.1 | GCA030176695_00474 | CDS | open | 38897-39136 | _na 79_aa | Glutaredoxin family protein | |
| 3307 | JASNUD010000016.1 | GCA030176695_00475 | CDS | open | 39234-40271 | _na 345_aa | HAD hydrolase%2C family IB | |
| 3308 | JASNUD010000016.1 | GCA030176695_00476 | CDS | open | 40346-40711 | _na 121_aa | doxX | DoxX family protein |
| 3309 | JASNUD010000016.1 | GCA030176695_00477 | CDS | open | 40923-41024 | _na 33_aa | 30S ribosomal protein bS22 | |
| 3310 | JASNUD010000016.1 | GCA030176695_00478 | CDS | open | 41300-41488 | _na 62_aa | Helix-turn-helix domain-containing protein | |
| 3311 | JASNUD010000016.1 | GCA030176695_00479 | CDS | open | 41740-42531 | _na 263_aa | proC | pyrroline-5-carboxylate reductase |
| 3312 | JASNUD010000016.1 | GCA030176695_00480 | CDS | open | 42613-43854 | _na 413_aa | hypothetical protein | |
| 3313 | JASNUD010000016.1 | GCA030176695_00481 | CDS | open | 43864-44709 | _na 281_aa | Ppx/GppA phosphatase family | |
| 3314 | JASNUD010000016.1 | GCA030176695_00482 | CDS | open | 44827-45726 | _na 299_aa | DUF3109 domain-containing protein | |
| 3315 | JASNUD010000016.1 | GCA030176695_00483 | CDS | open | 45723-46433 | _na 236_aa | regX3 | Sensory transduction protein RegX3 |
| 3316 | JASNUD010000016.1 | GCA030176695_00484 | CDS | open | 46430-47710 | _na 426_aa | senX3 | Sensor-like histidine kinase SenX3 |
| 3317 | JASNUD010000016.1 | GCA030176695_00485 | CDS | open | 47761-48507 | _na 248_aa | phosphoglyceromutase | |
| 3318 | JASNUD010000016.1 | GCA030176695_00486 | CDS | open | 48549-49814 | _na 421_aa | mshA | D-inositol-3-phosphate glycosyltransferase |
| 3319 | JASNUD010000016.1 | GCA030176695_00487 | CDS | open | 49881-51599 | _na 572_aa | long-chain-fatty-acid--CoA ligase | |
| 3320 | JASNUD010000016.1 | GCA030176695_00488 | CDS | open | 51621-52190 | _na 189_aa | Methylated-DNA--protein-cysteine methyltransferase | |
| 3321 | JASNUD010000016.1 | GCA030176695_00489 | CDS | open | 52261-53970 | _na 569_aa | long-chain-fatty-acid--CoA ligase | |
| 3322 | JASNUD010000016.1 | GCA030176695_00490 | CDS | open | 53982-55499 | _na 505_aa | AMP-dependent synthetase/ligase domain-containing protein | |
| 3323 | JASNUD010000016.1 | GCA030176695_00491 | CDS | open | 55566-56735 | _na 389_aa | yihY | YihY family protein |
| 3324 | JASNUD010000016.1 | GCA030176695_00492 | CDS | open | 56806-57282 | _na 158_aa | S-ribosylhomocysteine lyase | |
| 3325 | JASNUD010000016.1 | GCA030176695_00493 | CDS | open | 57499-58620 | _na 373_aa | UDP-N-acetylmuramate dehydrogenase | |
| 3326 | JASNUD010000016.1 | GCA030176695_00494 | CDS | open | 58645-59136 | _na 163_aa | DUF2505 domain-containing protein | |
| 3327 | JASNUD010000016.1 | GCA030176695_00495 | CDS | open | 59168-59977 | _na 269_aa | Methylase | |
| 3328 | JASNUD010000016.1 | GCA030176695_00496 | CDS | open | 60027-60830 | _na 267_aa | DUF2993 domain-containing protein | |
| 3329 | JASNUD010000016.1 | GCA030176695_00497 | CDS | open | 60868-61311 | _na 147_aa | Deoxyribose-phosphate aldolase | |
| 3330 | JASNUD010000016.1 | GCA030176695_00498 | CDS | open | 61314-61604 | _na 96_aa | DUF2516 domain-containing protein | |
| 3331 | JASNUD010000016.1 | GCA030176695_00499 | CDS | open | 61610-62044 | _na 144_aa | CsbD-like domain-containing protein | |
| 3332 | JASNUD010000016.1 | GCA030176695_00500 | CDS | open | 62078-63409 | _na 443_aa | DUF445 domain-containing protein | |
| 3333 | JASNUD010000016.1 | GCA030176695_00501 | CDS | open | 63589-63921 | _na 110_aa | crcB | Fluoride ion transporter CrcB |
| 3334 | JASNUD010000016.1 | GCA030176695_00438 | gene | open | 265-843 | |||
| 3335 | JASNUD010000016.1 | GCA030176695_00439 | gene | open | 1475-2407 | |||
| 3336 | JASNUD010000016.1 | GCA030176695_00440 | gene | open | 2678-3589 | eamA | ||
| 3337 | JASNUD010000016.1 | GCA030176695_00441 | gene | open | 3877-4476 | |||
| 3338 | JASNUD010000016.1 | GCA030176695_00442 | gene | open | 5511-6275 | |||
| 3339 | JASNUD010000016.1 | GCA030176695_00443 | gene | open | 6268-7146 | |||
| 3340 | JASNUD010000016.1 | GCA030176695_00444 | gene | open | 7161-8330 | |||
| 3341 | JASNUD010000016.1 | GCA030176695_00445 | gene | open | 8558-9103 | osmC | ||
| 3342 | JASNUD010000016.1 | GCA030176695_00446 | gene | open | 9165-10175 | |||
| 3343 | JASNUD010000016.1 | GCA030176695_00447 | gene | open | 10431-13730 | cas9 | ||
| 3344 | JASNUD010000016.1 | GCA030176695_00448 | gene | open | 13735-14649 | cas1 | ||
| 3345 | JASNUD010000016.1 | GCA030176695_00449 | gene | open | 14657-14962 | cas2 | ||
| 3346 | JASNUD010000016.1 | GCA030176695_00450 | gene | open | 15990-16451 | |||
| 3347 | JASNUD010000016.1 | GCA030176695_00451 | gene | open | 16742-17722 | |||
| 3348 | JASNUD010000016.1 | GCA030176695_00452 | gene | open | 17738-17878 | |||
| 3349 | JASNUD010000016.1 | GCA030176695_00453 | gene | open | 17924-19081 | menE | ||
| 3350 | JASNUD010000016.1 | GCA030176695_00454 | gene | open | 19137-20042 | |||
| 3351 | JASNUD010000016.1 | GCA030176695_00455 | gene | open | 20064-20387 | |||
| 3352 | JASNUD010000016.1 | GCA030176695_00456 | gene | open | 20426-20701 | |||
| 3353 | JASNUD010000016.1 | GCA030176695_00457 | gene | open | 20698-20955 | |||
| 3354 | JASNUD010000016.1 | GCA030176695_00458 | gene | open | 20956-22062 | ccsB | ||
| 3355 | JASNUD010000016.1 | GCA030176695_00459 | gene | open | 22145-23776 | |||
| 3356 | JASNUD010000016.1 | GCA030176695_00460 | gene | open | 23784-24587 | |||
| 3357 | JASNUD010000016.1 | GCA030176695_00461 | gene | open | 24588-25205 | |||
| 3358 | JASNUD010000016.1 | GCA030176695_00462 | gene | open | 25205-25813 | |||
| 3359 | JASNUD010000016.1 | GCA030176695_00463 | gene | open | 25850-27160 | hemL | ||
| 3360 | JASNUD010000016.1 | GCA030176695_00464 | gene | open | 27327-28136 | |||
| 3361 | JASNUD010000016.1 | GCA030176695_00465 | gene | open | 28252-29292 | |||
| 3362 | JASNUD010000016.1 | GCA030176695_00466 | gene | open | 29698-31080 | |||
| 3363 | JASNUD010000016.1 | GCA030176695_00467 | gene | open | 31081-32115 | hemE | ||
| 3364 | JASNUD010000016.1 | GCA030176695_00468 | gene | open | 32299-32853 | terC | ||
| 3365 | JASNUD010000016.1 | GCA030176695_00469 | gene | open | 32850-33680 | |||
| 3366 | JASNUD010000016.1 | GCA030176695_00470 | gene | open | 33690-34673 | hemB | ||
| 3367 | JASNUD010000016.1 | GCA030176695_00471 | gene | open | 34703-36424 | |||
| 3368 | JASNUD010000016.1 | GCA030176695_00472 | gene | open | 36589-37485 | hemC | ||
| 3369 | JASNUD010000016.1 | GCA030176695_00473 | gene | open | 37486-38820 | |||
| 3370 | JASNUD010000016.1 | GCA030176695_00474 | gene | open | 38897-39136 | |||
| 3371 | JASNUD010000016.1 | GCA030176695_00475 | gene | open | 39234-40271 | |||
| 3372 | JASNUD010000016.1 | GCA030176695_00476 | gene | open | 40346-40711 | doxX | ||
| 3373 | JASNUD010000016.1 | GCA030176695_00477 | gene | open | 40923-41024 | |||
| 3374 | JASNUD010000016.1 | GCA030176695_00478 | gene | open | 41300-41488 | |||
| 3375 | JASNUD010000016.1 | GCA030176695_00479 | gene | open | 41740-42531 | proC | ||
| 3376 | JASNUD010000016.1 | GCA030176695_00480 | gene | open | 42613-43854 | |||
| 3377 | JASNUD010000016.1 | GCA030176695_00481 | gene | open | 43864-44709 | |||
| 3378 | JASNUD010000016.1 | GCA030176695_00482 | gene | open | 44827-45726 | |||
| 3379 | JASNUD010000016.1 | GCA030176695_00483 | gene | open | 45723-46433 | regX3 | ||
| 3380 | JASNUD010000016.1 | GCA030176695_00484 | gene | open | 46430-47710 | senX3 | ||
| 3381 | JASNUD010000016.1 | GCA030176695_00485 | gene | open | 47761-48507 | |||
| 3382 | JASNUD010000016.1 | GCA030176695_00486 | gene | open | 48549-49814 | mshA | ||
| 3383 | JASNUD010000016.1 | GCA030176695_00487 | gene | open | 49881-51599 | |||
| 3384 | JASNUD010000016.1 | GCA030176695_00488 | gene | open | 51621-52190 | |||
| 3385 | JASNUD010000016.1 | GCA030176695_00489 | gene | open | 52261-53970 | |||
| 3386 | JASNUD010000016.1 | GCA030176695_00490 | gene | open | 53982-55499 | |||
| 3387 | JASNUD010000016.1 | GCA030176695_00491 | gene | open | 55566-56735 | yihY | ||
| 3388 | JASNUD010000016.1 | GCA030176695_00492 | gene | open | 56806-57282 | |||
| 3389 | JASNUD010000016.1 | GCA030176695_00493 | gene | open | 57499-58620 | |||
| 3390 | JASNUD010000016.1 | GCA030176695_00494 | gene | open | 58645-59136 | |||
| 3391 | JASNUD010000016.1 | GCA030176695_00495 | gene | open | 59168-59977 | |||
| 3392 | JASNUD010000016.1 | GCA030176695_00496 | gene | open | 60027-60830 | |||
| 3393 | JASNUD010000016.1 | GCA030176695_00497 | gene | open | 60868-61311 | |||
| 3394 | JASNUD010000016.1 | GCA030176695_00498 | gene | open | 61314-61604 | |||
| 3395 | JASNUD010000016.1 | GCA030176695_00499 | gene | open | 61610-62044 | |||
| 3396 | JASNUD010000016.1 | GCA030176695_00500 | gene | open | 62078-63409 | |||
| 3397 | JASNUD010000016.1 | GCA030176695_00501 | gene | open | 63589-63921 | crcB | ||
| 3398 | JASNUD010000017.1 | GCA030176695_00502 | CDS | open | 133-1419 | _na 428_aa | tyrS | tyrosine--tRNA ligase |
| 3399 | JASNUD010000017.1 | GCA030176695_00503 | CDS | open | 1474-1641 | _na 55_aa | UPF0434 protein jk0859 | |
| 3400 | JASNUD010000017.1 | GCA030176695_00504 | CDS | open | 1886-3817 | _na 643_aa | thiC | phosphomethylpyrimidine synthase ThiC |
| 3401 | JASNUD010000017.1 | GCA030176695_00505 | CDS | open | 3807-4481 | _na 224_aa | thiamine phosphate synthase | |
| 3402 | JASNUD010000017.1 | GCA030176695_00506 | CDS | open | 4456-5595 | _na 379_aa | thiO | glycine oxidase ThiO |
| 3403 | JASNUD010000017.1 | GCA030176695_00507 | CDS | open | 5620-5823 | _na 67_aa | thiS | sulfur carrier protein ThiS |
| 3404 | JASNUD010000017.1 | GCA030176695_00508 | CDS | open | 5833-6615 | _na 260_aa | Thiazole synthase | |
| 3405 | JASNUD010000017.1 | GCA030176695_00509 | CDS | open | 6615-7772 | _na 385_aa | thiF | ThiF family adenylyltransferase |
| 3406 | JASNUD010000017.1 | GCA030176695_00510 | CDS | open | 7910-8947 | _na 345_aa | Ornithine cyclodeaminase | |
| 3407 | JASNUD010000017.1 | GCA030176695_00511 | CDS | open | 8961-10478 | _na 505_aa | Amino acid permease/ SLC12A domain-containing protein | |
| 3408 | JASNUD010000017.1 | GCA030176695_00512 | CDS | open | 10695-12125 | _na 476_aa | argH | argininosuccinate lyase |
| 3409 | JASNUD010000017.1 | GCA030176695_00513 | CDS | open | 12132-13352 | _na 406_aa | argininosuccinate synthase | |
| 3410 | JASNUD010000017.1 | GCA030176695_00514 | CDS | open | 13431-13913 | _na 160_aa | arginine repressor | |
| 3411 | JASNUD010000017.1 | GCA030176695_00515 | CDS | open | 13916-14836 | _na 306_aa | argF | ornithine carbamoyltransferase |
| 3412 | JASNUD010000017.1 | GCA030176695_00516 | CDS | open | 14833-16011 | _na 392_aa | acetylornithine transaminase | |
| 3413 | JASNUD010000017.1 | GCA030176695_00517 | CDS | open | 16008-16943 | _na 311_aa | Acetylglutamate kinase | |
| 3414 | JASNUD010000017.1 | GCA030176695_00518 | CDS | open | 16952-18121 | _na 389_aa | argJ | bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ |
| 3415 | JASNUD010000017.1 | GCA030176695_00519 | CDS | open | 18150-19193 | _na 347_aa | argC | N-acetyl-gamma-glutamyl-phosphate reductase |
| 3416 | JASNUD010000017.1 | GCA030176695_00520 | CDS | open | 19396-21912 | _na 838_aa | pheT | phenylalanine--tRNA ligase subunit beta |
| 3417 | JASNUD010000017.1 | GCA030176695_00521 | CDS | open | 21936-22982 | _na 348_aa | pheS | phenylalanine--tRNA ligase subunit alpha |
| 3418 | JASNUD010000017.1 | GCA030176695_00522 | CDS | open | 23103-23909 | _na 268_aa | RNA 2-O ribose methyltransferase substrate binding domain-containing protein | |
| 3419 | JASNUD010000017.1 | GCA030176695_00523 | CDS | open | 24003-24428 | _na 141_aa | TM2 domain-containing protein | |
| 3420 | JASNUD010000017.1 | GCA030176695_00524 | CDS | open | 24592-24975 | _na 127_aa | rplT | 50S ribosomal protein L20 |
| 3421 | JASNUD010000017.1 | GCA030176695_00525 | CDS | open | 25032-25226 | _na 64_aa | rpmI | 50S ribosomal protein L35 |
| 3422 | JASNUD010000017.1 | GCA030176695_00526 | CDS | open | 25263-25709 | _na 148_aa | infC | translation initiation factor IF-3 |
| 3423 | JASNUD010000017.1 | GCA030176695_00527 | CDS | open | 26056-26910 | _na 284_aa | S-adenosylmethionine synthetase | |
| 3424 | JASNUD010000017.1 | GCA030176695_00528 | CDS | open | 26976-29816 | _na 946_aa | uvrA | excinuclease ABC subunit UvrA |
| 3425 | JASNUD010000017.1 | GCA030176695_00529 | CDS | open | 29881-30483 | _na 200_aa | Metallo-beta-lactamase domain-containing protein | |
| 3426 | JASNUD010000017.1 | GCA030176695_00530 | CDS | open | 30561-31577 | _na 338_aa | doxX | DoxX family protein |
| 3427 | JASNUD010000017.1 | GCA030176695_00531 | CDS | open | 31719-33977 | _na 752_aa | UvrD-like helicase ATP-binding domain-containing protein | |
| 3428 | JASNUD010000017.1 | GCA030176695_00532 | CDS | open | 34067-34507 | _na 146_aa | uspA | UspA domain-containing protein |
| 3429 | JASNUD010000017.1 | GCA030176695_00533 | CDS | open | 34591-35043 | _na 150_aa | uspA | UspA domain-containing protein |
| 3430 | JASNUD010000017.1 | GCA030176695_00534 | CDS | open | 35195-37288 | _na 697_aa | uvrB | excinuclease ABC subunit UvrB |
| 3431 | JASNUD010000017.1 | GCA030176695_00535 | CDS | open | 37328-37576 | _na 82_aa | hypothetical protein | |
| 3432 | JASNUD010000017.1 | GCA030176695_00536 | CDS | open | 37766-38368 | _na 200_aa | coaE | dephospho-CoA kinase |
| 3433 | JASNUD010000017.1 | GCA030176695_00537 | CDS | open | 38442-40490 | _na 682_aa | PTS system%2C glucose subfamily%2C IIA component | |
| 3434 | JASNUD010000017.1 | GCA030176695_00538 | CDS | open | 40804-42267 | _na 487_aa | rpsA | 30S ribosomal protein S1 |
| 3435 | JASNUD010000017.1 | GCA030176695_00539 | CDS | open | 42517-43248 | _na 243_aa | Methyltransferase type 11 domain-containing protein | |
| 3436 | JASNUD010000017.1 | GCA030176695_00540 | CDS | open | 43259-43726 | _na 155_aa | RDD domain-containing protein | |
| 3437 | JASNUD010000017.1 | GCA030176695_00541 | CDS | open | 43690-44061 | _na 123_aa | hypothetical protein | |
| 3438 | JASNUD010000017.1 | GCA030176695_00542 | CDS | open | 44100-45038 | _na 312_aa | Winged helix DNA-binding domain-containing protein | |
| 3439 | JASNUD010000017.1 | GCA030176695_00543 | CDS | open | 45043-47712 | _na 889_aa | polA | DNA polymerase I |
| 3440 | JASNUD010000017.1 | GCA030176695_00545 | CDS | open | 48306-48599 | _na 97_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 3441 | JASNUD010000017.1 | GCA030176695_00546 | CDS | open | 48617-49270 | _na 217_aa | DUF6973 domain-containing protein | |
| 3442 | JASNUD010000017.1 | GCA030176695_00547 | CDS | open | 49516-49782 | _na 88_aa | DUF4340 domain-containing protein | |
| 3443 | JASNUD010000017.1 | GCA030176695_00548 | CDS | open | 49795-50733 | _na 312_aa | IS3 family transposase | |
| 3444 | JASNUD010000017.1 | GCA030176695_00549 | CDS | open | 50857-50997 | _na 46_aa | hypothetical protein | |
| 3445 | JASNUD010000017.1 | GCA030176695_00550 | CDS | open | 51365-51517 | _na 50_aa | hypothetical protein | |
| 3446 | JASNUD010000017.1 | GCA030176695_00551 | CDS | open | 51964-52449 | _na 161_aa | IS3 family transposase | |
| 3447 | JASNUD010000017.1 | GCA030176695_00552 | CDS | open | 52486-52710 | _na 74_aa | Integrase catalytic domain-containing protein | |
| 3448 | JASNUD010000017.1 | GCA030176695_00553 | CDS | open | 52713-52997 | _na 94_aa | hypothetical protein | |
| 3449 | JASNUD010000017.1 | GCA030176695_00554 | CDS | open | 53123-53305 | _na 60_aa | Iron ABC transporter permease | |
| 3450 | JASNUD010000017.1 | GCA030176695_00555 | CDS | open | 53351-54226 | _na 291_aa | iron ABC transporter permease | |
| 3451 | JASNUD010000017.1 | GCA030176695_00556 | CDS | open | 54226-55269 | _na 347_aa | Iron ABC transporter permease | |
| 3452 | JASNUD010000017.1 | GCA030176695_00557 | CDS | open | 55276-56187 | _na 303_aa | Fe/B12 periplasmic-binding domain-containing protein | |
| 3453 | JASNUD010000017.1 | GCA030176695_00558 | CDS | open | 56187-56969 | _na 260_aa | ABC transporter domain-containing protein | |
| 3454 | JASNUD010000017.1 | GCA030176695_00559 | CDS | open | 57166-57873 | _na 235_aa | DUF4232 domain-containing protein | |
| 3455 | JASNUD010000017.1 | GCA030176695_00560 | CDS | open | 57977-58369 | _na 130_aa | hypothetical protein | |
| 3456 | JASNUD010000017.1 | GCA030176695_00502 | gene | open | 133-1419 | tyrS | ||
| 3457 | JASNUD010000017.1 | GCA030176695_00503 | gene | open | 1474-1641 | |||
| 3458 | JASNUD010000017.1 | GCA030176695_00504 | gene | open | 1886-3817 | thiC | ||
| 3459 | JASNUD010000017.1 | GCA030176695_00505 | gene | open | 3807-4481 | |||
| 3460 | JASNUD010000017.1 | GCA030176695_00506 | gene | open | 4456-5595 | thiO | ||
| 3461 | JASNUD010000017.1 | GCA030176695_00507 | gene | open | 5620-5823 | thiS | ||
| 3462 | JASNUD010000017.1 | GCA030176695_00508 | gene | open | 5833-6615 | |||
| 3463 | JASNUD010000017.1 | GCA030176695_00509 | gene | open | 6615-7772 | thiF | ||
| 3464 | JASNUD010000017.1 | GCA030176695_00510 | gene | open | 7910-8947 | |||
| 3465 | JASNUD010000017.1 | GCA030176695_00511 | gene | open | 8961-10478 | |||
| 3466 | JASNUD010000017.1 | GCA030176695_00512 | gene | open | 10695-12125 | argH | ||
| 3467 | JASNUD010000017.1 | GCA030176695_00513 | gene | open | 12132-13352 | |||
| 3468 | JASNUD010000017.1 | GCA030176695_00514 | gene | open | 13431-13913 | |||
| 3469 | JASNUD010000017.1 | GCA030176695_00515 | gene | open | 13916-14836 | argF | ||
| 3470 | JASNUD010000017.1 | GCA030176695_00516 | gene | open | 14833-16011 | |||
| 3471 | JASNUD010000017.1 | GCA030176695_00517 | gene | open | 16008-16943 | |||
| 3472 | JASNUD010000017.1 | GCA030176695_00518 | gene | open | 16952-18121 | argJ | ||
| 3473 | JASNUD010000017.1 | GCA030176695_00519 | gene | open | 18150-19193 | argC | ||
| 3474 | JASNUD010000017.1 | GCA030176695_00520 | gene | open | 19396-21912 | pheT | ||
| 3475 | JASNUD010000017.1 | GCA030176695_00521 | gene | open | 21936-22982 | pheS | ||
| 3476 | JASNUD010000017.1 | GCA030176695_00522 | gene | open | 23103-23909 | |||
| 3477 | JASNUD010000017.1 | GCA030176695_00523 | gene | open | 24003-24428 | |||
| 3478 | JASNUD010000017.1 | GCA030176695_00524 | gene | open | 24592-24975 | rplT | ||
| 3479 | JASNUD010000017.1 | GCA030176695_00525 | gene | open | 25032-25226 | rpmI | ||
| 3480 | JASNUD010000017.1 | GCA030176695_00526 | gene | open | 25263-25709 | infC | ||
| 3481 | JASNUD010000017.1 | GCA030176695_00527 | gene | open | 26056-26910 | |||
| 3482 | JASNUD010000017.1 | GCA030176695_00528 | gene | open | 26976-29816 | uvrA | ||
| 3483 | JASNUD010000017.1 | GCA030176695_00529 | gene | open | 29881-30483 | |||
| 3484 | JASNUD010000017.1 | GCA030176695_00530 | gene | open | 30561-31577 | doxX | ||
| 3485 | JASNUD010000017.1 | GCA030176695_00531 | gene | open | 31719-33977 | |||
| 3486 | JASNUD010000017.1 | GCA030176695_00532 | gene | open | 34067-34507 | uspA | ||
| 3487 | JASNUD010000017.1 | GCA030176695_00533 | gene | open | 34591-35043 | uspA | ||
| 3488 | JASNUD010000017.1 | GCA030176695_00534 | gene | open | 35195-37288 | uvrB | ||
| 3489 | JASNUD010000017.1 | GCA030176695_00535 | gene | open | 37328-37576 | |||
| 3490 | JASNUD010000017.1 | GCA030176695_00536 | gene | open | 37766-38368 | coaE | ||
| 3491 | JASNUD010000017.1 | GCA030176695_00537 | gene | open | 38442-40490 | |||
| 3492 | JASNUD010000017.1 | GCA030176695_00538 | gene | open | 40804-42267 | rpsA | ||
| 3493 | JASNUD010000017.1 | GCA030176695_00539 | gene | open | 42517-43248 | |||
| 3494 | JASNUD010000017.1 | GCA030176695_00540 | gene | open | 43259-43726 | |||
| 3495 | JASNUD010000017.1 | GCA030176695_00541 | gene | open | 43690-44061 | |||
| 3496 | JASNUD010000017.1 | GCA030176695_00542 | gene | open | 44100-45038 | |||
| 3497 | JASNUD010000017.1 | GCA030176695_00543 | gene | open | 45043-47712 | polA | ||
| 3498 | JASNUD010000017.1 | GCA030176695_00545 | gene | open | 48306-48599 | |||
| 3499 | JASNUD010000017.1 | GCA030176695_00546 | gene | open | 48617-49270 | |||
| 3500 | JASNUD010000017.1 | GCA030176695_00547 | gene | open | 49516-49782 |

