HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Corynebacterium pseudodiphtheriticum (GCA_030176715.1)

Select a Genome:
BAKTA Annotations for GCA_030176715.1
Genome Selected: Corynebacterium pseudodiphtheriticum
ContigsBases CDSrRNA tmRNAtRNA
30 2294956 2042 3 1 47
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4201 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:5]    |    Number of Records Found: 4201 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2001 JASNVN010000006.1 GCA030176715_01803 gene open 136178-136780 rsmG
2002 JASNVN010000006.1 GCA030176715_01804 gene open 136780-137787 yidC
2003 JASNVN010000006.1 GCA030176715_01805 gene open 137807-138112 yidD
2004 JASNVN010000006.1 GCA030176715_01806 gene open 138109-138447 rnpA
2005 JASNVN010000006.1 GCA030176715_01807 gene open 138535-138678 rpmH
2006 JASNVN010000006.1 GCA030176715_01808 gene open 139540-141288 dnaA
2007 JASNVN010000006.1 GCA030176715_01809 gene open 141995-143182 dnaN
2008 JASNVN010000006.1 GCA030176715_01810 gene open 143182-144516 recF
2009 JASNVN010000006.1 GCA030176715_01811 gene open 144513-145190 dciA
2010 JASNVN010000006.1 GCA030176715_01812 gene open 145324-147351 gyrB
2011 JASNVN010000006.1 GCA030176715_01813 gene open 147442-148332 pdxS
2012 JASNVN010000006.1 GCA030176715_01814 gene open 148351-150000
2013 JASNVN010000006.1 GCA030176715_01815 gene open 150368-152968 gyrA
2014 JASNVN010000006.1 GCA030176715_01816 gene open 152973-153323
2015 JASNVN010000006.1 GCA030176715_01817 gene open 153404-153477 trnI
2016 JASNVN010000006.1 GCA030176715_01818 gene open 153491-153563 trnA
2017 JASNVN010000006.1 GCA030176715_01817 tRNA open 153404-153477 trnI tRNA-Ile(gat)
2018 JASNVN010000006.1 GCA030176715_01818 tRNA open 153491-153563 trnA tRNA-Ala(tgc)
2019 JASNVN010000007.1 regulatory_region open 49059-49176 L31-Corynebacteriaceae ribosomal protein leader
2020 JASNVN010000007.1 GCA030176715_01819 CDS open 276-1097 _na     273_aa Class I SAM-dependent methyltransferase
2021 JASNVN010000007.1 GCA030176715_01820 CDS open 1187-1480 _na     97_aa ABM domain-containing protein
2022 JASNVN010000007.1 GCA030176715_01821 CDS open 1848-2327 _na     159_aa Lipoprotein
2023 JASNVN010000007.1 GCA030176715_01822 CDS open 2324-2545 _na     73_aa DUF6973 domain-containing protein
2024 JASNVN010000007.1 GCA030176715_01823 CDS open 2733-4193 _na     486_aa glyceraldehyde-3-phosphate dehydrogenase
2025 JASNVN010000007.1 GCA030176715_01824 CDS open 4264-5262 _na     332_aa Propionate 3-nitronate monooxygenase
2026 JASNVN010000007.1 GCA030176715_01825 CDS open 5340-6044 _na     234_aa pth aminoacyl-tRNA hydrolase
2027 JASNVN010000007.1 GCA030176715_01826 CDS open 6045-6605 _na     186_aa NADPH-dependent FMN reductase-like domain-containing protein
2028 JASNVN010000007.1 GCA030176715_01827 CDS open 6746-8392 _na     548_aa peptide chain release factor 3
2029 JASNVN010000007.1 GCA030176715_01828 CDS open 8421-10022 _na     533_aa Alpha/beta hydrolase
2030 JASNVN010000007.1 GCA030176715_01829 CDS open 10079-10504 _na     141_aa Secreted protein
2031 JASNVN010000007.1 GCA030176715_01830 CDS open 10727-11596 _na     289_aa PNPLA domain-containing protein
2032 JASNVN010000007.1 GCA030176715_01831 CDS open 11670-12041 _na     123_aa BON domain-containing protein
2033 JASNVN010000007.1 GCA030176715_01832 CDS open 12061-12714 _na     217_aa Cytochrome C biogenesis protein transmembrane domain-containing protein
2034 JASNVN010000007.1 GCA030176715_01833 CDS open 12821-14014 _na     397_aa DUF6882 domain-containing protein
2035 JASNVN010000007.1 GCA030176715_01834 CDS open 14145-14645 _na     166_aa rraA ribonuclease E activity regulator RraA
2036 JASNVN010000007.1 GCA030176715_01835 CDS open 14648-15940 _na     430_aa aceA isocitrate lyase
2037 JASNVN010000007.1 GCA030176715_01836 CDS open 16367-18052 _na     561_aa malate synthase G
2038 JASNVN010000007.1 GCA030176715_01837 CDS open 18053-18550 _na     165_aa hypothetical protein
2039 JASNVN010000007.1 GCA030176715_01838 CDS open 18651-19403 _na     250_aa DUF1648 domain-containing protein
2040 JASNVN010000007.1 GCA030176715_01839 CDS open 19378-20439 _na     353_aa 3-hydroxyisobutyryl-CoA hydrolase
2041 JASNVN010000007.1 GCA030176715_01840 CDS open 20577-20900 _na     107_aa ABM domain-containing protein
2042 JASNVN010000007.1 GCA030176715_01841 CDS open 20964-21455 _na     163_aa SCP domain-containing protein
2043 JASNVN010000007.1 GCA030176715_01842 CDS open 21556-23376 _na     606_aa ccmA heme ABC exporter ATP-binding protein CcmA
2044 JASNVN010000007.1 GCA030176715_01843 CDS open 23543-24838 _na     431_aa Secreted protein
2045 JASNVN010000007.1 GCA030176715_01844 CDS open 24840-25901 _na     353_aa 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase
2046 JASNVN010000007.1 GCA030176715_01845 CDS open 25919-26833 _na     304_aa rsmA 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA
2047 JASNVN010000007.1 GCA030176715_01846 CDS open 26853-28019 _na     388_aa G5 domain-containing protein
2048 JASNVN010000007.1 GCA030176715_01847 CDS open 28296-29135 _na     279_aa tatD TatD family hydrolase
2049 JASNVN010000007.1 GCA030176715_01848 CDS open 29215-30525 _na     436_aa Major facilitator superfamily (MFS) profile domain-containing protein
2050 JASNVN010000007.1 GCA030176715_01849 CDS open 30578-32431 _na     617_aa Methionine--tRNA ligase
2051 JASNVN010000007.1 GCA030176715_01850 CDS open 32551-34410 _na     619_aa betP Glycine betaine transporter BetP
2052 JASNVN010000007.1 GCA030176715_01851 CDS open 34600-35499 _na     299_aa rsmI 16S rRNA (cytidine(1402)-2'-O)-methyltransferase
2053 JASNVN010000007.1 GCA030176715_01852 CDS open 35633-37264 _na     543_aa Dolichyl-phosphate-mannose--protein mannosyltransferase
2054 JASNVN010000007.1 GCA030176715_01853 CDS open 37231-37941 _na     236_aa Putative zinc-finger domain-containing protein
2055 JASNVN010000007.1 GCA030176715_01854 CDS open 37928-38362 _na     144_aa doxX DoxX family protein
2056 JASNVN010000007.1 GCA030176715_01855 CDS open 38477-39148 _na     223_aa DNA-3-methyladenine glycosylase I
2057 JASNVN010000007.1 GCA030176715_01856 CDS open 39152-40669 _na     505_aa glpR gephyrin-like molybdotransferase receptor GlpR
2058 JASNVN010000007.1 GCA030176715_01857 CDS open 40775-41467 _na     230_aa [ribosomal protein uS5]-alanine N-acetyltransferase
2059 JASNVN010000007.1 GCA030176715_01858 CDS open 41535-42839 _na     434_aa glp gephyrin-like molybdotransferase Glp
2060 JASNVN010000007.1 GCA030176715_01859 CDS open 42877-43848 _na     323_aa UTP--glucose-1-phosphate uridylyltransferase
2061 JASNVN010000007.1 GCA030176715_01860 CDS open 43925-44587 _na     220_aa 5-formyltetrahydrofolate cyclo-ligase
2062 JASNVN010000007.1 GCA030176715_01861 CDS open 44640-45482 _na     280_aa SAF domain-containing protein
2063 JASNVN010000007.1 GCA030176715_01862 CDS open 45520-45981 _na     153_aa mscL large conductance mechanosensitive channel protein MscL
2064 JASNVN010000007.1 GCA030176715_01863 CDS open 45975-46214 _na     79_aa hypothetical protein
2065 JASNVN010000007.1 GCA030176715_01864 CDS open 46297-46890 _na     197_aa MoaB/Mog domain-containing protein
2066 JASNVN010000007.1 GCA030176715_01865 CDS open 46944-48326 _na     460_aa Serine protease
2067 JASNVN010000007.1 GCA030176715_01866 CDS open 48594-48767 _na     57_aa rpmF 50S ribosomal protein L32
2068 JASNVN010000007.1 GCA030176715_01867 CDS open 48787-49050 _na     87_aa type B 50S ribosomal protein L31
2069 JASNVN010000007.1 GCA030176715_01868 CDS open 49431-49667 _na     78_aa rpmB 50S ribosomal protein L28
2070 JASNVN010000007.1 GCA030176715_01869 CDS open 49670-49834 _na     54_aa rpmG 50S ribosomal protein L33
2071 JASNVN010000007.1 GCA030176715_01870 CDS open 49837-50142 _na     101_aa rpsN 30S ribosomal protein S14
2072 JASNVN010000007.1 GCA030176715_01871 CDS open 50158-50412 _na     84_aa rpsR 30S ribosomal protein S18
2073 JASNVN010000007.1 GCA030176715_01872 CDS open 50635-51303 _na     222_aa HTH tetR-type domain-containing protein
2074 JASNVN010000007.1 GCA030176715_01873 CDS open 51428-52249 _na     273_aa Electron transfer flavoprotein alpha/beta-subunit N-terminal domain-containing protein
2075 JASNVN010000007.1 GCA030176715_01874 CDS open 52258-53229 _na     323_aa Electron transfer flavoprotein alpha/beta-subunit N-terminal domain-containing protein
2076 JASNVN010000007.1 GCA030176715_01875 CDS open 53233-54633 _na     466_aa cytochrome b/b6 domain-containing protein
2077 JASNVN010000007.1 GCA030176715_01876 CDS open 54644-55651 _na     335_aa Alpha/beta hydrolase
2078 JASNVN010000007.1 GCA030176715_01877 CDS open 55790-57526 _na     578_aa purH bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase
2079 JASNVN010000007.1 GCA030176715_01878 CDS open 57589-58173 _na     194_aa purN phosphoribosylglycinamide formyltransferase
2080 JASNVN010000007.1 GCA030176715_01879 CDS open 58185-59843 _na     552_aa Beta-carotene 15%2C15'-monooxygenase
2081 JASNVN010000007.1 GCA030176715_01880 CDS open 60243-60995 _na     250_aa Peptidase M23 domain-containing protein
2082 JASNVN010000007.1 GCA030176715_01881 CDS open 61392-62174 _na     260_aa Peptidase M23 domain-containing protein
2083 JASNVN010000007.1 GCA030176715_01882 CDS open 62180-64720 _na     846_aa pcrA DNA helicase PcrA
2084 JASNVN010000007.1 GCA030176715_01883 CDS open 64802-65113 _na     103_aa chorismate mutase
2085 JASNVN010000007.1 GCA030176715_01884 CDS open 65426-65971 _na     181_aa OsmC-like protein
2086 JASNVN010000007.1 GCA030176715_01885 CDS open 66052-67104 _na     350_aa Acyl-CoA dehydrogenase
2087 JASNVN010000007.1 GCA030176715_01886 CDS open 67108-67635 _na     175_aa Flavin reductase like domain-containing protein
2088 JASNVN010000007.1 GCA030176715_01887 CDS open 67933-70056 _na     707_aa Peptidoglycan recognition protein family domain-containing protein
2089 JASNVN010000007.1 GCA030176715_01888 CDS open 70140-71252 _na     370_aa Cation transporter
2090 JASNVN010000007.1 GCA030176715_01889 CDS open 71249-72919 _na     556_aa pgi glucose-6-phosphate isomerase
2091 JASNVN010000007.1 GCA030176715_01890 CDS open 72916-73812 _na     298_aa DNA-(apurinic or apyrimidinic site) lyase
2092 JASNVN010000007.1 GCA030176715_01891 CDS open 73945-78780 _na     1611_aa ATP-dependent helicase
2093 JASNVN010000007.1 GCA030176715_01892 CDS open 78811-79569 _na     252_aa 3'(2')%2C5-bisphosphonucleoside 3'(2')-phosphohydrolase
2094 JASNVN010000007.1 GCA030176715_01893 CDS open 79691-80557 _na     288_aa thymidylate synthase
2095 JASNVN010000007.1 GCA030176715_01894 CDS open 80557-81102 _na     181_aa dihydrofolate reductase
2096 JASNVN010000007.1 GCA030176715_01895 CDS open 81103-81390 _na     95_aa Glutaredoxin-like protein
2097 JASNVN010000007.1 GCA030176715_01897 CDS open 81887-82873 _na     328_aa Rv2525c-like glycoside hydrolase-like domain-containing protein
2098 JASNVN010000007.1 GCA030176715_01898 CDS open 82918-84063 _na     381_aa bifunctional 2-methylcitrate synthase/citrate synthase
2099 JASNVN010000007.1 GCA030176715_01899 CDS open 84132-85049 _na     305_aa prpB methylisocitrate lyase
2100 JASNVN010000007.1 GCA030176715_01900 CDS open 85049-86560 _na     503_aa prpD 2-methylcitrate dehydratase PrpD
2101 JASNVN010000007.1 GCA030176715_01901 CDS open 86675-87667 _na     330_aa Serine hydrolase
2102 JASNVN010000007.1 GCA030176715_01902 CDS open 87768-89456 _na     562_aa actP Cation/acetate symporter ActP
2103 JASNVN010000007.1 GCA030176715_01903 CDS open 89460-89801 _na     113_aa DUF485 domain-containing protein
2104 JASNVN010000007.1 GCA030176715_01904 CDS open 90203-91075 _na     290_aa NADP-dependent oxidoreductase domain-containing protein
2105 JASNVN010000007.1 GCA030176715_01905 CDS open 91147-91515 _na     122_aa Peptidyl-prolyl cis-trans isomerase
2106 JASNVN010000007.1 GCA030176715_01906 CDS open 91715-93100 _na     461_aa citrate synthase
2107 JASNVN010000007.1 GCA030176715_01907 CDS open 93283-94416 _na     377_aa serC phosphoserine transaminase
2108 JASNVN010000007.1 GCA030176715_01908 CDS open 94453-95874 _na     473_aa sepH septation protein SepH
2109 JASNVN010000007.1 GCA030176715_01909 CDS open 95923-96888 _na     321_aa DUF6928 domain-containing protein
2110 JASNVN010000007.1 GCA030176715_01910 CDS open 96903-97838 _na     311_aa spoU tRNA/rRNA methyltransferase SpoU type domain-containing protein
2111 JASNVN010000007.1 GCA030176715_01911 CDS open 97887-99365 _na     492_aa MFS transporter%2C AGZA family%2C xanthine/uracil permease
2112 JASNVN010000007.1 GCA030176715_01912 CDS open 99674-100462 _na     262_aa Glutamine cyclotransferase
2113 JASNVN010000007.1 GCA030176715_01913 CDS open 100479-101018 _na     179_aa DUF2771 domain-containing protein
2114 JASNVN010000007.1 GCA030176715_01914 CDS open 101032-101415 _na     127_aa CSD domain-containing protein
2115 JASNVN010000007.1 GCA030176715_01915 CDS open 101943-102614 _na     223_aa Resuscitation-promoting factor core lysozyme-like domain-containing protein
2116 JASNVN010000007.1 GCA030176715_01916 CDS open 102796-102987 _na     63_aa hypothetical protein
2117 JASNVN010000007.1 GCA030176715_01917 CDS open 103059-105716 _na     885_aa Helicase XPB/Ssl2 N-terminal domain-containing protein
2118 JASNVN010000007.1 GCA030176715_01918 CDS open 105802-105921 _na     39_aa hypA Hydrogenase nickel incorporation protein hypA
2119 JASNVN010000007.1 GCA030176715_01919 CDS open 106114-107784 _na     556_aa DNA repair helicase XPB
2120 JASNVN010000007.1 GCA030176715_01920 CDS open 107890-108546 _na     218_aa DUF3239 domain-containing protein
2121 JASNVN010000007.1 GCA030176715_01921 CDS open 108568-109389 _na     273_aa putative membrane transporter protein
2122 JASNVN010000007.1 GCA030176715_01819 gene open 276-1097
2123 JASNVN010000007.1 GCA030176715_01820 gene open 1187-1480
2124 JASNVN010000007.1 GCA030176715_01821 gene open 1848-2327
2125 JASNVN010000007.1 GCA030176715_01822 gene open 2324-2545
2126 JASNVN010000007.1 GCA030176715_01823 gene open 2733-4193
2127 JASNVN010000007.1 GCA030176715_01824 gene open 4264-5262
2128 JASNVN010000007.1 GCA030176715_01825 gene open 5340-6044 pth
2129 JASNVN010000007.1 GCA030176715_01826 gene open 6045-6605
2130 JASNVN010000007.1 GCA030176715_01827 gene open 6746-8392
2131 JASNVN010000007.1 GCA030176715_01828 gene open 8421-10022
2132 JASNVN010000007.1 GCA030176715_01829 gene open 10079-10504
2133 JASNVN010000007.1 GCA030176715_01830 gene open 10727-11596
2134 JASNVN010000007.1 GCA030176715_01831 gene open 11670-12041
2135 JASNVN010000007.1 GCA030176715_01832 gene open 12061-12714
2136 JASNVN010000007.1 GCA030176715_01833 gene open 12821-14014
2137 JASNVN010000007.1 GCA030176715_01834 gene open 14145-14645 rraA
2138 JASNVN010000007.1 GCA030176715_01835 gene open 14648-15940 aceA
2139 JASNVN010000007.1 GCA030176715_01836 gene open 16367-18052
2140 JASNVN010000007.1 GCA030176715_01837 gene open 18053-18550
2141 JASNVN010000007.1 GCA030176715_01838 gene open 18651-19403
2142 JASNVN010000007.1 GCA030176715_01839 gene open 19378-20439
2143 JASNVN010000007.1 GCA030176715_01840 gene open 20577-20900
2144 JASNVN010000007.1 GCA030176715_01841 gene open 20964-21455
2145 JASNVN010000007.1 GCA030176715_01842 gene open 21556-23376 ccmA
2146 JASNVN010000007.1 GCA030176715_01843 gene open 23543-24838
2147 JASNVN010000007.1 GCA030176715_01844 gene open 24840-25901
2148 JASNVN010000007.1 GCA030176715_01845 gene open 25919-26833 rsmA
2149 JASNVN010000007.1 GCA030176715_01846 gene open 26853-28019
2150 JASNVN010000007.1 GCA030176715_01847 gene open 28296-29135 tatD
2151 JASNVN010000007.1 GCA030176715_01848 gene open 29215-30525
2152 JASNVN010000007.1 GCA030176715_01849 gene open 30578-32431
2153 JASNVN010000007.1 GCA030176715_01850 gene open 32551-34410 betP
2154 JASNVN010000007.1 GCA030176715_01851 gene open 34600-35499 rsmI
2155 JASNVN010000007.1 GCA030176715_01852 gene open 35633-37264
2156 JASNVN010000007.1 GCA030176715_01853 gene open 37231-37941
2157 JASNVN010000007.1 GCA030176715_01854 gene open 37928-38362 doxX
2158 JASNVN010000007.1 GCA030176715_01855 gene open 38477-39148
2159 JASNVN010000007.1 GCA030176715_01856 gene open 39152-40669 glpR
2160 JASNVN010000007.1 GCA030176715_01857 gene open 40775-41467
2161 JASNVN010000007.1 GCA030176715_01858 gene open 41535-42839 glp
2162 JASNVN010000007.1 GCA030176715_01859 gene open 42877-43848
2163 JASNVN010000007.1 GCA030176715_01860 gene open 43925-44587
2164 JASNVN010000007.1 GCA030176715_01861 gene open 44640-45482
2165 JASNVN010000007.1 GCA030176715_01862 gene open 45520-45981 mscL
2166 JASNVN010000007.1 GCA030176715_01863 gene open 45975-46214
2167 JASNVN010000007.1 GCA030176715_01864 gene open 46297-46890
2168 JASNVN010000007.1 GCA030176715_01865 gene open 46944-48326
2169 JASNVN010000007.1 GCA030176715_01866 gene open 48594-48767 rpmF
2170 JASNVN010000007.1 GCA030176715_01867 gene open 48787-49050
2171 JASNVN010000007.1 GCA030176715_01868 gene open 49431-49667 rpmB
2172 JASNVN010000007.1 GCA030176715_01869 gene open 49670-49834 rpmG
2173 JASNVN010000007.1 GCA030176715_01870 gene open 49837-50142 rpsN
2174 JASNVN010000007.1 GCA030176715_01871 gene open 50158-50412 rpsR
2175 JASNVN010000007.1 GCA030176715_01872 gene open 50635-51303
2176 JASNVN010000007.1 GCA030176715_01873 gene open 51428-52249
2177 JASNVN010000007.1 GCA030176715_01874 gene open 52258-53229
2178 JASNVN010000007.1 GCA030176715_01875 gene open 53233-54633
2179 JASNVN010000007.1 GCA030176715_01876 gene open 54644-55651
2180 JASNVN010000007.1 GCA030176715_01877 gene open 55790-57526 purH
2181 JASNVN010000007.1 GCA030176715_01878 gene open 57589-58173 purN
2182 JASNVN010000007.1 GCA030176715_01879 gene open 58185-59843
2183 JASNVN010000007.1 GCA030176715_01880 gene open 60243-60995
2184 JASNVN010000007.1 GCA030176715_01881 gene open 61392-62174
2185 JASNVN010000007.1 GCA030176715_01882 gene open 62180-64720 pcrA
2186 JASNVN010000007.1 GCA030176715_01883 gene open 64802-65113
2187 JASNVN010000007.1 GCA030176715_01884 gene open 65426-65971
2188 JASNVN010000007.1 GCA030176715_01885 gene open 66052-67104
2189 JASNVN010000007.1 GCA030176715_01886 gene open 67108-67635
2190 JASNVN010000007.1 GCA030176715_01887 gene open 67933-70056
2191 JASNVN010000007.1 GCA030176715_01888 gene open 70140-71252
2192 JASNVN010000007.1 GCA030176715_01889 gene open 71249-72919 pgi
2193 JASNVN010000007.1 GCA030176715_01890 gene open 72916-73812
2194 JASNVN010000007.1 GCA030176715_01891 gene open 73945-78780
2195 JASNVN010000007.1 GCA030176715_01892 gene open 78811-79569
2196 JASNVN010000007.1 GCA030176715_01893 gene open 79691-80557
2197 JASNVN010000007.1 GCA030176715_01894 gene open 80557-81102
2198 JASNVN010000007.1 GCA030176715_01895 gene open 81103-81390
2199 JASNVN010000007.1 GCA030176715_01897 gene open 81887-82873
2200 JASNVN010000007.1 GCA030176715_01898 gene open 82918-84063
2201 JASNVN010000007.1 GCA030176715_01899 gene open 84132-85049 prpB
2202 JASNVN010000007.1 GCA030176715_01900 gene open 85049-86560 prpD
2203 JASNVN010000007.1 GCA030176715_01901 gene open 86675-87667
2204 JASNVN010000007.1 GCA030176715_01902 gene open 87768-89456 actP
2205 JASNVN010000007.1 GCA030176715_01903 gene open 89460-89801
2206 JASNVN010000007.1 GCA030176715_01904 gene open 90203-91075
2207 JASNVN010000007.1 GCA030176715_01905 gene open 91147-91515
2208 JASNVN010000007.1 GCA030176715_01906 gene open 91715-93100
2209 JASNVN010000007.1 GCA030176715_01907 gene open 93283-94416 serC
2210 JASNVN010000007.1 GCA030176715_01908 gene open 94453-95874 sepH
2211 JASNVN010000007.1 GCA030176715_01909 gene open 95923-96888
2212 JASNVN010000007.1 GCA030176715_01910 gene open 96903-97838 spoU
2213 JASNVN010000007.1 GCA030176715_01911 gene open 97887-99365
2214 JASNVN010000007.1 GCA030176715_01912 gene open 99674-100462
2215 JASNVN010000007.1 GCA030176715_01913 gene open 100479-101018
2216 JASNVN010000007.1 GCA030176715_01914 gene open 101032-101415
2217 JASNVN010000007.1 GCA030176715_01915 gene open 101943-102614
2218 JASNVN010000007.1 GCA030176715_01916 gene open 102796-102987
2219 JASNVN010000007.1 GCA030176715_01917 gene open 103059-105716
2220 JASNVN010000007.1 GCA030176715_01918 gene open 105802-105921 hypA
2221 JASNVN010000007.1 GCA030176715_01919 gene open 106114-107784
2222 JASNVN010000007.1 GCA030176715_01920 gene open 107890-108546
2223 JASNVN010000007.1 GCA030176715_01921 gene open 108568-109389
2224 JASNVN010000007.1 GCA030176715_01896 gene open 81504-81576 trnR
2225 JASNVN010000007.1 GCA030176715_01896 tRNA open 81504-81576 trnR tRNA-Arg(cct)
2226 JASNVN010000008.1 repeat_region open 66934-67095 CRISPR array with 3 repeats of length 30%2C consensus sequence GGCTCATCCCCGCATGCGCGGGGAAAACAG and spacer length 31
2227 JASNVN010000008.1 GCA030176715_01923 CDS open 311-1894 _na     527_aa Divalent anion:Na+ symporter (DASS) family transporter
2228 JASNVN010000008.1 GCA030176715_01924 CDS open 1961-3325 _na     454_aa mgtE magnesium transporter
2229 JASNVN010000008.1 GCA030176715_01925 CDS open 3472-4212 _na     246_aa DUF2470 domain-containing protein
2230 JASNVN010000008.1 GCA030176715_01926 CDS open 4242-5630 _na     462_aa Heparan-alpha-glucosaminide N-acetyltransferase catalytic domain-containing protein
2231 JASNVN010000008.1 GCA030176715_01928 CDS open 5895-6929 _na     344_aa hisC histidinol-phosphate transaminase
2232 JASNVN010000008.1 GCA030176715_01929 CDS open 6929-7348 _na     139_aa Phage holin family protein
2233 JASNVN010000008.1 GCA030176715_01930 CDS open 7535-7756 _na     73_aa Cell wall anchor protein
2234 JASNVN010000008.1 GCA030176715_01932 CDS open 8039-9079 _na     346_aa Enoyl reductase (ER) domain-containing protein
2235 JASNVN010000008.1 GCA030176715_01933 CDS open 9076-10311 _na     411_aa Aminotransferase class V domain-containing protein
2236 JASNVN010000008.1 GCA030176715_01934 CDS open 10468-11385 _na     305_aa ABC-2 type transporter transmembrane domain-containing protein
2237 JASNVN010000008.1 GCA030176715_01935 CDS open 11431-12216 _na     261_aa ABC transporter domain-containing protein
2238 JASNVN010000008.1 GCA030176715_01936 CDS open 12261-13205 _na     314_aa Glycosyltransferase 2-like domain-containing protein
2239 JASNVN010000008.1 GCA030176715_01937 CDS open 13282-13818 _na     178_aa Suppressor of fused-like domain-containing protein
2240 JASNVN010000008.1 GCA030176715_01938 CDS open 13855-14322 _na     155_aa GtrA/DPMS transmembrane domain-containing protein
2241 JASNVN010000008.1 GCA030176715_01939 CDS open 14406-15284 _na     292_aa DUF2877 domain-containing protein
2242 JASNVN010000008.1 GCA030176715_01940 CDS open 15330-15578 _na     82_aa hypothetical protein
2243 JASNVN010000008.1 GCA030176715_01941 CDS open 15587-17002 _na     471_aa FAD-binding PCMH-type domain-containing protein
2244 JASNVN010000008.1 GCA030176715_01942 CDS open 17051-17812 _na     253_aa decaprenylphospho-beta-D-erythro-pentofuranosid-2-ulose 2-reductase
2245 JASNVN010000008.1 GCA030176715_01943 CDS open 17843-19756 _na     637_aa Galactan 5-O-arabinofuranosyltransferase
2246 JASNVN010000008.1 GCA030176715_01944 CDS open 19846-23181 _na     1111_aa Arabinosyltransferase C
2247 JASNVN010000008.1 GCA030176715_01945 CDS open 23185-25221 _na     678_aa Galactan 5-O-arabinofuranosyltransferase
2248 JASNVN010000008.1 GCA030176715_01946 CDS open 25246-26178 _na     310_aa NAD-dependent epimerase/dehydratase domain-containing protein
2249 JASNVN010000008.1 GCA030176715_01947 CDS open 26255-26671 _na     138_aa DUF2304 domain-containing protein
2250 JASNVN010000008.1 GCA030176715_01948 CDS open 26672-27364 _na     230_aa Glycosyltransferase 2-like domain-containing protein
2251 JASNVN010000008.1 GCA030176715_01949 CDS open 27381-28721 _na     446_aa Polysaccharide biosynthesis protein C-terminal domain-containing protein
2252 JASNVN010000008.1 GCA030176715_01950 CDS open 28734-29627 _na     297_aa Glycosyltransferase 2-like domain-containing protein
2253 JASNVN010000008.1 GCA030176715_01951 CDS open 29627-30532 _na     301_aa Alpha/beta hydrolase fold domain-containing protein
2254 JASNVN010000008.1 GCA030176715_01952 CDS open 30676-31290 _na     204_aa Maltokinase N-terminal cap domain-containing protein
2255 JASNVN010000008.1 GCA030176715_01953 CDS open 31339-33324 _na     661_aa Peptidase M13
2256 JASNVN010000008.1 GCA030176715_01954 CDS open 33353-34054 _na     233_aa DUF3515 domain-containing protein
2257 JASNVN010000008.1 GCA030176715_01955 CDS open 34057-34911 _na     284_aa prsW Protease PrsW
2258 JASNVN010000008.1 GCA030176715_01956 CDS open 34912-36510 _na     532_aa Aldehyde dehydrogenase domain-containing protein
2259 JASNVN010000008.1 GCA030176715_01957 CDS open 36593-37354 _na     253_aa Peptidase S1 domain-containing protein
2260 JASNVN010000008.1 GCA030176715_01958 CDS open 37515-38456 _na     313_aa Peptidase S1 domain-containing protein
2261 JASNVN010000008.1 GCA030176715_01959 CDS open 38584-38757 _na     57_aa hypothetical protein
2262 JASNVN010000008.1 GCA030176715_01960 CDS open 38899-41058 _na     719_aa High-affinity choline transporter
2263 JASNVN010000008.1 GCA030176715_01961 CDS open 41277-43079 _na     600_aa betA choline dehydrogenase
2264 JASNVN010000008.1 GCA030176715_01962 CDS open 43096-44694 _na     532_aa PepSY domain-containing protein
2265 JASNVN010000008.1 GCA030176715_01963 CDS open 45006-45938 _na     310_aa aldose epimerase
2266 JASNVN010000008.1 GCA030176715_01964 CDS open 46137-47792 _na     551_aa Solute:sodium symporter (SSS) family transporter
2267 JASNVN010000008.1 GCA030176715_01965 CDS open 47811-48143 _na     110_aa Cell wall anchor protein
2268 JASNVN010000008.1 GCA030176715_01966 CDS open 48158-49402 _na     414_aa galT galactose-1-phosphate uridylyltransferase
2269 JASNVN010000008.1 GCA030176715_01967 CDS open 49395-50639 _na     414_aa galK galactokinase
2270 JASNVN010000008.1 GCA030176715_01968 CDS open 50791-51195 _na     134_aa panD aspartate 1-decarboxylase
2271 JASNVN010000008.1 GCA030176715_01969 CDS open 51197-52657 _na     486_aa Divalent anion:Na+ symporter (DASS) family transporter
2272 JASNVN010000008.1 GCA030176715_01970 CDS open 52674-53981 _na     435_aa dcuA C4-dicarboxylate transporter DcuA
2273 JASNVN010000008.1 GCA030176715_01971 CDS open 54525-56162 _na     545_aa HNH nuclease domain-containing protein
2274 JASNVN010000008.1 GCA030176715_01972 CDS open 56516-57181 _na     221_aa MOSC domain-containing protein
2275 JASNVN010000008.1 GCA030176715_01973 CDS open 57308-58672 _na     454_aa Major facilitator superfamily (MFS) profile domain-containing protein
2276 JASNVN010000008.1 GCA030176715_01974 CDS open 58897-59727 _na     276_aa VOC domain-containing protein
2277 JASNVN010000008.1 GCA030176715_01975 CDS open 59727-60047 _na     106_aa RNA-binding S4 domain-containing protein
2278 JASNVN010000008.1 GCA030176715_01976 CDS open 60081-60812 _na     243_aa SDR family oxidoreductase
2279 JASNVN010000008.1 GCA030176715_01977 CDS open 60951-61958 _na     335_aa Ammonia monooxygenase
2280 JASNVN010000008.1 GCA030176715_01978 CDS open 62465-62767 _na     100_aa hypothetical protein
2281 JASNVN010000008.1 GCA030176715_01979 CDS open 63017-63847 _na     276_aa yaeC YaeC family lipoprotein
2282 JASNVN010000008.1 GCA030176715_01980 CDS open 63878-64936 _na     352_aa ABC transporter domain-containing protein
2283 JASNVN010000008.1 GCA030176715_01981 CDS open 64936-65613 _na     225_aa ABC transmembrane type-1 domain-containing protein
2284 JASNVN010000008.1 GCA030176715_01982 CDS open 65959-66162 _na     67_aa hypothetical protein
2285 JASNVN010000008.1 GCA030176715_01983 CDS open 66282-66521 _na     79_aa hypothetical protein
2286 JASNVN010000008.1 GCA030176715_01984 CDS open 66529-66921 _na     130_aa toxin glutamine deamidase domain-containing protein
2287 JASNVN010000008.1 GCA030176715_01985 CDS open 67372-67482 _na     36_aa hypothetical protein
2288 JASNVN010000008.1 GCA030176715_01986 CDS open 67524-69302 _na     592_aa DUF885 domain-containing protein
2289 JASNVN010000008.1 GCA030176715_01987 CDS open 69451-70698 _na     415_aa HTH marR-type domain-containing protein
2290 JASNVN010000008.1 GCA030176715_01988 CDS open 70800-71318 _na     172_aa Gamma carbonic anhydrase family protein
2291 JASNVN010000008.1 GCA030176715_01989 CDS open 71358-72023 _na     221_aa Haloacid dehalogenase
2292 JASNVN010000008.1 GCA030176715_01990 CDS open 72086-74302 _na     738_aa Leucine-rich repeat domain-containing protein
2293 JASNVN010000008.1 GCA030176715_01991 CDS open 74465-74779 _na     104_aa Secreted protein
2294 JASNVN010000008.1 GCA030176715_01992 CDS open 74893-75750 _na     285_aa heme ABC transporter ATP-binding protein
2295 JASNVN010000008.1 GCA030176715_01993 CDS open 75747-76832 _na     361_aa Iron ABC transporter permease
2296 JASNVN010000008.1 GCA030176715_01994 CDS open 76786-77913 _na     375_aa ABC transporter substrate-binding protein
2297 JASNVN010000008.1 GCA030176715_01995 CDS open 77989-79947 _na     652_aa htaA HtaA domain-containing protein
2298 JASNVN010000008.1 GCA030176715_01996 CDS open 80058-80642 _na     194_aa hypothetical protein
2299 JASNVN010000008.1 GCA030176715_01997 CDS open 80754-83495 _na     913_aa htaA HtaA domain-containing protein
2300 JASNVN010000008.1 GCA030176715_01998 CDS open 83625-84617 _na     330_aa htaA HtaA domain-containing protein
2301 JASNVN010000008.1 GCA030176715_01999 CDS open 85073-87385 _na     770_aa htaA HtaA domain-containing protein
2302 JASNVN010000008.1 GCA030176715_02000 CDS open 87575-88579 _na     334_aa nrdF class 1b ribonucleoside-diphosphate reductase subunit beta
2303 JASNVN010000008.1 GCA030176715_02001 CDS open 88583-89041 _na     152_aa nrdI class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI
2304 JASNVN010000008.1 GCA030176715_02002 CDS open 89745-91031 _na     428_aa AB hydrolase-1 domain-containing protein
2305 JASNVN010000008.1 GCA030176715_02003 CDS open 91041-92045 _na     334_aa Deacetylase sirtuin-type domain-containing protein
2306 JASNVN010000008.1 GCA030176715_02004 CDS open 92094-92399 _na     101_aa Aminotransferase
2307 JASNVN010000008.1 GCA030176715_02005 CDS open 92466-93446 _na     326_aa bioB biotin synthase BioB
2308 JASNVN010000008.1 GCA030176715_02006 CDS open 93567-94346 _na     259_aa DUF4442 domain-containing protein
2309 JASNVN010000008.1 GCA030176715_02007 CDS open 94383-95723 _na     446_aa Peptidase M20 dimerisation domain-containing protein
2310 JASNVN010000008.1 GCA030176715_02008 CDS open 95731-96777 _na     348_aa ABC transporter permease
2311 JASNVN010000008.1 GCA030176715_02009 CDS open 96780-97871 _na     363_aa Fe/B12 periplasmic-binding domain-containing protein
2312 JASNVN010000008.1 GCA030176715_02010 CDS open 97873-98556 _na     227_aa Heme oxygenase
2313 JASNVN010000008.1 GCA030176715_01923 gene open 311-1894
2314 JASNVN010000008.1 GCA030176715_01924 gene open 1961-3325 mgtE
2315 JASNVN010000008.1 GCA030176715_01925 gene open 3472-4212
2316 JASNVN010000008.1 GCA030176715_01926 gene open 4242-5630
2317 JASNVN010000008.1 GCA030176715_01928 gene open 5895-6929 hisC
2318 JASNVN010000008.1 GCA030176715_01929 gene open 6929-7348
2319 JASNVN010000008.1 GCA030176715_01930 gene open 7535-7756
2320 JASNVN010000008.1 GCA030176715_01932 gene open 8039-9079
2321 JASNVN010000008.1 GCA030176715_01933 gene open 9076-10311
2322 JASNVN010000008.1 GCA030176715_01934 gene open 10468-11385
2323 JASNVN010000008.1 GCA030176715_01935 gene open 11431-12216
2324 JASNVN010000008.1 GCA030176715_01936 gene open 12261-13205
2325 JASNVN010000008.1 GCA030176715_01937 gene open 13282-13818
2326 JASNVN010000008.1 GCA030176715_01938 gene open 13855-14322
2327 JASNVN010000008.1 GCA030176715_01939 gene open 14406-15284
2328 JASNVN010000008.1 GCA030176715_01940 gene open 15330-15578
2329 JASNVN010000008.1 GCA030176715_01941 gene open 15587-17002
2330 JASNVN010000008.1 GCA030176715_01942 gene open 17051-17812
2331 JASNVN010000008.1 GCA030176715_01943 gene open 17843-19756
2332 JASNVN010000008.1 GCA030176715_01944 gene open 19846-23181
2333 JASNVN010000008.1 GCA030176715_01945 gene open 23185-25221
2334 JASNVN010000008.1 GCA030176715_01946 gene open 25246-26178
2335 JASNVN010000008.1 GCA030176715_01947 gene open 26255-26671
2336 JASNVN010000008.1 GCA030176715_01948 gene open 26672-27364
2337 JASNVN010000008.1 GCA030176715_01949 gene open 27381-28721
2338 JASNVN010000008.1 GCA030176715_01950 gene open 28734-29627
2339 JASNVN010000008.1 GCA030176715_01951 gene open 29627-30532
2340 JASNVN010000008.1 GCA030176715_01952 gene open 30676-31290
2341 JASNVN010000008.1 GCA030176715_01953 gene open 31339-33324
2342 JASNVN010000008.1 GCA030176715_01954 gene open 33353-34054
2343 JASNVN010000008.1 GCA030176715_01955 gene open 34057-34911 prsW
2344 JASNVN010000008.1 GCA030176715_01956 gene open 34912-36510
2345 JASNVN010000008.1 GCA030176715_01957 gene open 36593-37354
2346 JASNVN010000008.1 GCA030176715_01958 gene open 37515-38456
2347 JASNVN010000008.1 GCA030176715_01959 gene open 38584-38757
2348 JASNVN010000008.1 GCA030176715_01960 gene open 38899-41058
2349 JASNVN010000008.1 GCA030176715_01961 gene open 41277-43079 betA
2350 JASNVN010000008.1 GCA030176715_01962 gene open 43096-44694
2351 JASNVN010000008.1 GCA030176715_01963 gene open 45006-45938
2352 JASNVN010000008.1 GCA030176715_01964 gene open 46137-47792
2353 JASNVN010000008.1 GCA030176715_01965 gene open 47811-48143
2354 JASNVN010000008.1 GCA030176715_01966 gene open 48158-49402 galT
2355 JASNVN010000008.1 GCA030176715_01967 gene open 49395-50639 galK
2356 JASNVN010000008.1 GCA030176715_01968 gene open 50791-51195 panD
2357 JASNVN010000008.1 GCA030176715_01969 gene open 51197-52657
2358 JASNVN010000008.1 GCA030176715_01970 gene open 52674-53981 dcuA
2359 JASNVN010000008.1 GCA030176715_01971 gene open 54525-56162
2360 JASNVN010000008.1 GCA030176715_01972 gene open 56516-57181
2361 JASNVN010000008.1 GCA030176715_01973 gene open 57308-58672
2362 JASNVN010000008.1 GCA030176715_01974 gene open 58897-59727
2363 JASNVN010000008.1 GCA030176715_01975 gene open 59727-60047
2364 JASNVN010000008.1 GCA030176715_01976 gene open 60081-60812
2365 JASNVN010000008.1 GCA030176715_01977 gene open 60951-61958
2366 JASNVN010000008.1 GCA030176715_01978 gene open 62465-62767
2367 JASNVN010000008.1 GCA030176715_01979 gene open 63017-63847 yaeC
2368 JASNVN010000008.1 GCA030176715_01980 gene open 63878-64936
2369 JASNVN010000008.1 GCA030176715_01981 gene open 64936-65613
2370 JASNVN010000008.1 GCA030176715_01982 gene open 65959-66162
2371 JASNVN010000008.1 GCA030176715_01983 gene open 66282-66521
2372 JASNVN010000008.1 GCA030176715_01984 gene open 66529-66921
2373 JASNVN010000008.1 GCA030176715_01985 gene open 67372-67482
2374 JASNVN010000008.1 GCA030176715_01986 gene open 67524-69302
2375 JASNVN010000008.1 GCA030176715_01987 gene open 69451-70698
2376 JASNVN010000008.1 GCA030176715_01988 gene open 70800-71318
2377 JASNVN010000008.1 GCA030176715_01989 gene open 71358-72023
2378 JASNVN010000008.1 GCA030176715_01990 gene open 72086-74302
2379 JASNVN010000008.1 GCA030176715_01991 gene open 74465-74779
2380 JASNVN010000008.1 GCA030176715_01992 gene open 74893-75750
2381 JASNVN010000008.1 GCA030176715_01993 gene open 75747-76832
2382 JASNVN010000008.1 GCA030176715_01994 gene open 76786-77913
2383 JASNVN010000008.1 GCA030176715_01995 gene open 77989-79947 htaA
2384 JASNVN010000008.1 GCA030176715_01996 gene open 80058-80642
2385 JASNVN010000008.1 GCA030176715_01997 gene open 80754-83495 htaA
2386 JASNVN010000008.1 GCA030176715_01998 gene open 83625-84617 htaA
2387 JASNVN010000008.1 GCA030176715_01999 gene open 85073-87385 htaA
2388 JASNVN010000008.1 GCA030176715_02000 gene open 87575-88579 nrdF
2389 JASNVN010000008.1 GCA030176715_02001 gene open 88583-89041 nrdI
2390 JASNVN010000008.1 GCA030176715_02002 gene open 89745-91031
2391 JASNVN010000008.1 GCA030176715_02003 gene open 91041-92045
2392 JASNVN010000008.1 GCA030176715_02004 gene open 92094-92399
2393 JASNVN010000008.1 GCA030176715_02005 gene open 92466-93446 bioB
2394 JASNVN010000008.1 GCA030176715_02006 gene open 93567-94346
2395 JASNVN010000008.1 GCA030176715_02007 gene open 94383-95723
2396 JASNVN010000008.1 GCA030176715_02008 gene open 95731-96777
2397 JASNVN010000008.1 GCA030176715_02009 gene open 96780-97871
2398 JASNVN010000008.1 GCA030176715_02010 gene open 97873-98556
2399 JASNVN010000008.1 GCA030176715_01922 gene open 81-153 trnR
2400 JASNVN010000008.1 GCA030176715_01927 gene open 5726-5814 trnS
2401 JASNVN010000008.1 GCA030176715_01931 gene open 7924-8011 trnS
2402 JASNVN010000008.1 GCA030176715_01922 tRNA open 81-153 trnR tRNA-Arg(acg)
2403 JASNVN010000008.1 GCA030176715_01927 tRNA open 5726-5814 trnS tRNA-Ser(gct)
2404 JASNVN010000008.1 GCA030176715_01931 tRNA open 7924-8011 trnS tRNA-Ser(tga)
2405 JASNVN010000009.1 GCA030176715_02042 gene open 32294-32388 Bacteria_small_SRP
2406 JASNVN010000009.1 GCA030176715_02042 ncRNA open 32294-32388 Bacterial small signal recognition particle RNA
2407 JASNVN010000009.1 GCA030176715_02011 CDS open 201-1562 _na     453_aa Collagen-like protein
2408 JASNVN010000009.1 GCA030176715_02012 CDS open 1787-2077 _na     96_aa Peptidase M23
2409 JASNVN010000009.1 GCA030176715_02013 CDS open 2165-3697 _na     510_aa X-X-X-Leu-X-X-Gly heptad repeats protein
2410 JASNVN010000009.1 GCA030176715_02014 CDS open 3917-5464 _na     515_aa Catalase core domain-containing protein
2411 JASNVN010000009.1 GCA030176715_02015 CDS open 5616-6164 _na     182_aa RNA polymerase sigma factor
2412 JASNVN010000009.1 GCA030176715_02016 CDS open 6253-7560 _na     435_aa ykvI Membrane protein YkvI
2413 JASNVN010000009.1 GCA030176715_02017 CDS open 7667-8704 _na     345_aa aspartate-semialdehyde dehydrogenase
2414 JASNVN010000009.1 GCA030176715_02018 CDS open 8749-10014 _na     421_aa aspartate kinase
2415 JASNVN010000009.1 GCA030176715_02019 CDS open 10364-12187 _na     607_aa leuA 2-isopropylmalate synthase
2416 JASNVN010000009.1 GCA030176715_02020 CDS open 12304-13734 _na     476_aa DNA polymerase III subunit epsilon
2417 JASNVN010000009.1 GCA030176715_02021 CDS open 13765-15201 _na     478_aa murT Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit MurT
2418 JASNVN010000009.1 GCA030176715_02022 CDS open 15217-16053 _na     278_aa gatD Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit GatD
2419 JASNVN010000009.1 GCA030176715_02023 CDS open 16103-17020 _na     305_aa FAD-binding FR-type domain-containing protein
2420 JASNVN010000009.1 GCA030176715_02024 CDS open 17077-17736 _na     219_aa recR recombination mediator RecR
2421 JASNVN010000009.1 GCA030176715_02025 CDS open 17737-18075 _na     112_aa YbaB/EbfC family nucleoid-associated protein
2422 JASNVN010000009.1 GCA030176715_02026 CDS open 18202-20994 _na     930_aa DNA polymerase III subunit gamma and tau
2423 JASNVN010000009.1 GCA030176715_02027 CDS open 21073-21684 _na     203_aa Suppressor of fused-like domain-containing protein
2424 JASNVN010000009.1 GCA030176715_02028 CDS open 21632-22900 _na     422_aa Aminotransferase class I/classII domain-containing protein
2425 JASNVN010000009.1 GCA030176715_02029 CDS open 23052-23882 _na     276_aa ABC transporter domain-containing protein
2426 JASNVN010000009.1 GCA030176715_02030 CDS open 23875-24774 _na     299_aa ABC transporter permease
2427 JASNVN010000009.1 GCA030176715_02031 CDS open 24784-25974 _na     396_aa SsuA/THI5-like domain-containing protein
2428 JASNVN010000009.1 GCA030176715_02032 CDS open 26820-27074 _na     84_aa DUF6968 domain-containing protein
2429 JASNVN010000009.1 GCA030176715_02033 CDS open 27025-27555 _na     176_aa Transposase IS116/IS110/IS902 C-terminal domain-containing protein
2430 JASNVN010000009.1 GCA030176715_02034 CDS open 27652-28023 _na     123_aa Transposase IS110-like N-terminal domain-containing protein
2431 JASNVN010000009.1 GCA030176715_02035 CDS open 28147-28287 _na     46_aa hypothetical protein
2432 JASNVN010000009.1 GCA030176715_02036 CDS open 28527-29012 _na     161_aa Rrf2 family transcriptional regulator
2433 JASNVN010000009.1 GCA030176715_02037 CDS open 29032-30240 _na     402_aa nitric oxide dioxygenase
2434 JASNVN010000009.1 GCA030176715_02038 CDS open 30372-30662 _na     96_aa hypothetical protein
2435 JASNVN010000009.1 GCA030176715_02039 CDS open 30815-31111 _na     98_aa Aminoacyl-tRNA synthetase class II (D/K/N) domain-containing protein
2436 JASNVN010000009.1 GCA030176715_02040 CDS open 31092-31253 _na     53_aa hypothetical protein
2437 JASNVN010000009.1 GCA030176715_02041 CDS open 31360-32175 _na     271_aa hypothetical protein
2438 JASNVN010000009.1 GCA030176715_02043 CDS open 32520-33893 _na     457_aa YibE/F family protein
2439 JASNVN010000009.1 GCA030176715_02044 CDS open 34270-34662 _na     130_aa crcB Fluoride ion transporter CrcB
2440 JASNVN010000009.1 GCA030176715_02045 CDS open 34650-35564 _na     304_aa FAD-binding FR-type domain-containing protein
2441 JASNVN010000009.1 GCA030176715_02046 CDS open 35627-36787 _na     386_aa Glycosyl transferase family 1 domain-containing protein
2442 JASNVN010000009.1 GCA030176715_02047 CDS open 36855-37610 _na     251_aa Ion transport domain-containing protein
2443 JASNVN010000009.1 GCA030176715_02048 CDS open 37795-38568 _na     257_aa Methyltransferase type 11 domain-containing protein
2444 JASNVN010000009.1 GCA030176715_02049 CDS open 38574-39032 _na     152_aa Phage holin family protein
2445 JASNVN010000009.1 GCA030176715_02050 CDS open 39216-39461 _na     81_aa hypothetical protein
2446 JASNVN010000009.1 GCA030176715_02051 CDS open 39801-41633 _na     610_aa phosphoenolpyruvate carboxykinase (GTP)
2447 JASNVN010000009.1 GCA030176715_02052 CDS open 41899-42696 _na     265_aa trmB tRNA (guanosine(46)-N7)-methyltransferase TrmB
2448 JASNVN010000009.1 GCA030176715_02053 CDS open 42837-43496 _na     219_aa NYN domain-containing protein
2449 JASNVN010000009.1 GCA030176715_02054 CDS open 43505-45862 _na     785_aa Membrane transport protein MMPL domain-containing protein
2450 JASNVN010000009.1 GCA030176715_02055 CDS open 45875-46912 _na     345_aa TIGR00374 family protein
2451 JASNVN010000009.1 GCA030176715_02056 CDS open 46918-47316 _na     132_aa Major facilitator superfamily (MFS) profile domain-containing protein
2452 JASNVN010000009.1 GCA030176715_02057 CDS open 47323-48198 _na     291_aa rarD EamA family transporter RarD
2453 JASNVN010000009.1 GCA030176715_02058 CDS open 48726-48992 _na     88_aa hypothetical protein
2454 JASNVN010000009.1 GCA030176715_02059 CDS open 48985-50529 _na     514_aa Propionyl-CoA carboxylase beta chain 5
2455 JASNVN010000009.1 GCA030176715_02060 CDS open 50530-55563 _na     1677_aa pks13 polyketide synthase Pks13
2456 JASNVN010000009.1 GCA030176715_02061 CDS open 55564-57408 _na     614_aa FadD32-like long-chain-fatty-acid--AMP ligase
2457 JASNVN010000009.1 GCA030176715_02062 CDS open 57681-58592 _na     303_aa Cutinase
2458 JASNVN010000009.1 GCA030176715_02063 CDS open 58657-59283 _na     208_aa DUF732 domain-containing protein
2459 JASNVN010000009.1 GCA030176715_02064 CDS open 59283-61280 _na     665_aa Trehalose O-mycolyltransferase
2460 JASNVN010000009.1 GCA030176715_02065 CDS open 61608-62630 _na     340_aa Acyl-CoA:diacylglycerol acyltransferase
2461 JASNVN010000009.1 GCA030176715_02066 CDS open 62837-63820 _na     327_aa decaprenyl-phosphate phosphoribosyltransferase
2462 JASNVN010000009.1 GCA030176715_02067 CDS open 63821-64351 _na     176_aa Phosphatidic acid phosphatase type 2/haloperoxidase domain-containing protein
2463 JASNVN010000009.1 GCA030176715_02068 CDS open 64341-66275 _na     644_aa Glycosyltransferase
2464 JASNVN010000009.1 GCA030176715_02069 CDS open 66370-67560 _na     396_aa glf UDP-galactopyranose mutase
2465 JASNVN010000009.1 GCA030176715_02070 CDS open 67973-69997 _na     674_aa Peptidoglycan recognition protein family domain-containing protein
2466 JASNVN010000009.1 GCA030176715_02071 CDS open 69994-71559 _na     521_aa glpK glycerol kinase GlpK
2467 JASNVN010000009.1 GCA030176715_02072 CDS open 71567-72400 _na     277_aa Cof-like hydrolase
2468 JASNVN010000009.1 GCA030176715_02073 CDS open 72418-73314 _na     298_aa Phospholipid/glycerol acyltransferase domain-containing protein
2469 JASNVN010000009.1 GCA030176715_02074 CDS open 73311-74624 _na     437_aa serS serine--tRNA ligase
2470 JASNVN010000009.1 GCA030176715_02075 CDS open 74642-75628 _na     328_aa Septum formation-related domain-containing protein
2471 JASNVN010000009.1 GCA030176715_02076 CDS open 75688-76035 _na     115_aa Metallopeptidase family protein
2472 JASNVN010000009.1 GCA030176715_02077 CDS open 76082-76735 _na     217_aa Phosphoglycerate mutase
2473 JASNVN010000009.1 GCA030176715_02078 CDS open 76738-77661 _na     307_aa pheA prephenate dehydratase
2474 JASNVN010000009.1 GCA030176715_02079 CDS open 77686-78810 _na     374_aa amidase
2475 JASNVN010000009.1 GCA030176715_02080 CDS open 78871-80706 _na     611_aa Cell envelope-related transcriptional attenuator domain-containing protein
2476 JASNVN010000009.1 GCA030176715_02081 CDS open 80754-81842 _na     362_aa NADH:flavin oxidoreductase/NADH oxidase N-terminal domain-containing protein
2477 JASNVN010000009.1 GCA030176715_02082 CDS open 81961-82881 _na     306_aa DUF5926 domain-containing protein
2478 JASNVN010000009.1 GCA030176715_02083 CDS open 82892-83629 _na     245_aa GP-PDE domain-containing protein
2479 JASNVN010000009.1 GCA030176715_02084 CDS open 83690-84352 _na     220_aa msrA Peptide methionine sulfoxide reductase MsrA
2480 JASNVN010000009.1 GCA030176715_02085 CDS open 84566-85168 _na     200_aa Superoxide dismutase
2481 JASNVN010000009.1 GCA030176715_02086 CDS open 85656-86864 _na     402_aa Major facilitator superfamily (MFS) profile domain-containing protein
2482 JASNVN010000009.1 GCA030176715_02087 CDS open 86861-88519 _na     552_aa yprB YprB ribonuclease H-like domain-containing protein
2483 JASNVN010000009.1 GCA030176715_02088 CDS open 88606-89241 _na     211_aa DUF6474 domain-containing protein
2484 JASNVN010000009.1 GCA030176715_02089 CDS open 89251-89889 _na     212_aa Response regulatory domain-containing protein
2485 JASNVN010000009.1 GCA030176715_02090 CDS open 89943-91265 _na     440_aa Histidine kinase domain-containing protein
2486 JASNVN010000009.1 GCA030176715_02091 CDS open 91375-92637 _na     420_aa yidC Membrane protein insertase YidC
2487 JASNVN010000009.1 GCA030176715_02092 CDS open 92634-93260 _na     208_aa HTH tetR-type domain-containing protein
2488 JASNVN010000009.1 GCA030176715_02093 CDS open 93449-93706 _na     85_aa GlsB/YeaQ/YmgE family stress response membrane protein
2489 JASNVN010000009.1 GCA030176715_02094 CDS open 93710-94606 _na     298_aa uspA UspA domain-containing protein
2490 JASNVN010000009.1 GCA030176715_02095 CDS open 94986-95990 _na     334_aa Pseudouridine synthase RsuA/RluA-like domain-containing protein
2491 JASNVN010000009.1 GCA030176715_02096 CDS open 96001-97698 _na     565_aa Amine oxidase domain-containing protein
2492 JASNVN010000009.1 GCA030176715_02097 CDS open 97695-98633 _na     312_aa squalene/phytoene synthase family protein
2493 JASNVN010000009.1 GCA030176715_02011 gene open 201-1562
2494 JASNVN010000009.1 GCA030176715_02012 gene open 1787-2077
2495 JASNVN010000009.1 GCA030176715_02013 gene open 2165-3697
2496 JASNVN010000009.1 GCA030176715_02014 gene open 3917-5464
2497 JASNVN010000009.1 GCA030176715_02015 gene open 5616-6164
2498 JASNVN010000009.1 GCA030176715_02016 gene open 6253-7560 ykvI
2499 JASNVN010000009.1 GCA030176715_02017 gene open 7667-8704
2500 JASNVN010000009.1 GCA030176715_02018 gene open 8749-10014