HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Corynebacterium accolens (GCA_030176885.1)

Select a Genome:
BAKTA Annotations for GCA_030176885.1
Genome Selected: Corynebacterium accolens
ContigsBases CDSrRNA tmRNAtRNA
30 2442367 2253 4 1 47
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4620 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 4620 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1 JASNVU010000001.1 GCA030176885_00682 gene open 28797-29250 RNaseP_bact_a
2 JASNVU010000001.1 GCA030176885_00682 ncRNA open 28797-29250 Bacterial RNase P class A
3 JASNVU010000001.1 repeat_region open 46819-51004 CRISPR array with 69 repeats of length 28%2C consensus sequence GGCTCATCCCCGCTCACGCGGGGAGCAC and spacer length 33
4 JASNVU010000001.1 GCA030176885_00656 CDS open 199-1533 _na     444_aa Dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex
5 JASNVU010000001.1 GCA030176885_00657 CDS open 1831-4674 _na     947_aa gcvP aminomethyl-transferring glycine dehydrogenase
6 JASNVU010000001.1 GCA030176885_00658 CDS open 4677-5789 _na     370_aa gcvT glycine cleavage system aminomethyltransferase GcvT
7 JASNVU010000001.1 GCA030176885_00659 CDS open 5835-6227 _na     130_aa gcvH glycine cleavage system protein GcvH
8 JASNVU010000001.1 GCA030176885_00660 CDS open 6346-7149 _na     267_aa lipB lipoyl(octanoyl) transferase LipB
9 JASNVU010000001.1 GCA030176885_00661 CDS open 7286-8350 _na     354_aa lipA lipoyl synthase
10 JASNVU010000001.1 GCA030176885_00662 CDS open 8433-9218 _na     261_aa DUF4191 domain-containing protein
11 JASNVU010000001.1 GCA030176885_00663 CDS open 9372-9845 _na     157_aa RDD domain-containing protein
12 JASNVU010000001.1 GCA030176885_00664 CDS open 9964-11397 _na     477_aa glnA type I glutamate--ammonia ligase
13 JASNVU010000001.1 GCA030176885_00665 CDS open 11687-12574 _na     295_aa Voltage-dependent anion channel
14 JASNVU010000001.1 GCA030176885_00666 CDS open 12605-12979 _na     124_aa hypothetical protein
15 JASNVU010000001.1 GCA030176885_00667 CDS open 12976-13521 _na     181_aa Nudix hydrolase domain-containing protein
16 JASNVU010000001.1 GCA030176885_00668 CDS open 13552-14397 _na     281_aa Peptidase S1 domain-containing protein
17 JASNVU010000001.1 GCA030176885_00669 CDS open 14372-14518 _na     48_aa Cell division protein
18 JASNVU010000001.1 GCA030176885_00670 CDS open 14526-15968 _na     480_aa thrC threonine synthase
19 JASNVU010000001.1 GCA030176885_00671 CDS open 16052-17314 _na     420_aa Major facilitator superfamily (MFS) profile domain-containing protein
20 JASNVU010000001.1 GCA030176885_00672 CDS open 17319-18095 _na     258_aa AAA+ ATPase domain-containing protein
21 JASNVU010000001.1 GCA030176885_00673 CDS open 18291-18401 _na     36_aa hypothetical protein
22 JASNVU010000001.1 GCA030176885_00674 CDS open 18502-19005 _na     167_aa LytR/CpsA/Psr regulator C-terminal domain-containing protein
23 JASNVU010000001.1 GCA030176885_00675 CDS open 18971-19333 _na     120_aa Amphi-Trp domain-containing protein
24 JASNVU010000001.1 GCA030176885_00676 CDS open 19430-22489 _na     1019_aa bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase
25 JASNVU010000001.1 GCA030176885_00677 CDS open 22497-23834 _na     445_aa glnA type I glutamate--ammonia ligase
26 JASNVU010000001.1 GCA030176885_00678 CDS open 24030-25070 _na     346_aa DUF2786 domain-containing protein
27 JASNVU010000001.1 GCA030176885_00679 CDS open 25245-27002 _na     585_aa CHAD domain-containing protein
28 JASNVU010000001.1 GCA030176885_00680 CDS open 27072-27266 _na     64_aa SPOR domain-containing protein
29 JASNVU010000001.1 GCA030176885_00681 CDS open 27519-28793 _na     424_aa Galactokinase N-terminal domain-containing protein
30 JASNVU010000001.1 GCA030176885_00683 CDS open 29266-30441 _na     391_aa bifunctional RNase H/acid phosphatase
31 JASNVU010000001.1 GCA030176885_00684 CDS open 30438-31157 _na     239_aa C4-type zinc ribbon domain-containing protein
32 JASNVU010000001.1 GCA030176885_00685 CDS open 31158-32300 _na     380_aa Nif3-like dinuclear metal center hexameric protein
33 JASNVU010000001.1 GCA030176885_00686 CDS open 32394-32885 _na     163_aa protein-tyrosine-phosphatase
34 JASNVU010000001.1 GCA030176885_00687 CDS open 32896-33837 _na     313_aa SURF1-like protein
35 JASNVU010000001.1 GCA030176885_00689 CDS open 34087-34485 _na     132_aa DUF3052 domain-containing protein
36 JASNVU010000001.1 GCA030176885_00690 CDS open 34844-37588 _na     914_aa aceE pyruvate dehydrogenase (acetyl-transferring)%2C homodimeric type
37 JASNVU010000001.1 GCA030176885_00691 CDS open 37743-38042 _na     99_aa Acyl carrier protein
38 JASNVU010000001.1 GCA030176885_00692 CDS open 38039-38827 _na     262_aa TIGR01457 family HAD hydrolase
39 JASNVU010000001.1 GCA030176885_00693 CDS open 38904-39320 _na     138_aa hypothetical protein
40 JASNVU010000001.1 GCA030176885_00694 CDS open 39931-40047 _na     38_aa hypothetical protein
41 JASNVU010000001.1 GCA030176885_00695 CDS open 40130-40957 _na     275_aa Beta-lactamase-related domain-containing protein
42 JASNVU010000001.1 GCA030176885_00696 CDS open 41138-42229 _na     363_aa NADH:flavin oxidoreductase/NADH oxidase N-terminal domain-containing protein
43 JASNVU010000001.1 GCA030176885_00697 CDS open 42401-43999 _na     532_aa mscS Mechanosensitive ion channel MscS domain-containing protein
44 JASNVU010000001.1 GCA030176885_00698 CDS open 44107-45213 _na     368_aa Glycine transporter domain-containing protein
45 JASNVU010000001.1 GCA030176885_00699 CDS open 45274-45825 _na     183_aa DUF3558 domain-containing protein
46 JASNVU010000001.1 GCA030176885_00701 CDS open 46335-46502 _na     55_aa hypothetical protein
47 JASNVU010000001.1 GCA030176885_00702 CDS open 51437-52375 _na     312_aa cas1e type I-E CRISPR-associated endonuclease Cas1e
48 JASNVU010000001.1 GCA030176885_00703 CDS open 52375-53073 _na     232_aa cas6e type I-E CRISPR-associated protein Cas6/Cse3/CasE
49 JASNVU010000001.1 GCA030176885_00704 CDS open 53070-53672 _na     200_aa cas5e type I-E CRISPR-associated protein Cas5/CasD
50 JASNVU010000001.1 GCA030176885_00705 CDS open 53800-54942 _na     380_aa cas7e type I-E CRISPR-associated protein Cas7/Cse4/CasC
51 JASNVU010000001.1 GCA030176885_00706 CDS open 54978-55649 _na     223_aa casB type I-E CRISPR-associated protein Cse2/CasB
52 JASNVU010000001.1 GCA030176885_00707 CDS open 55642-57387 _na     581_aa casA type I-E CRISPR-associated protein Cse1/CasA
53 JASNVU010000001.1 GCA030176885_00708 CDS open 57487-59691 _na     734_aa CRISPR-associated helicase Cas3'
54 JASNVU010000001.1 GCA030176885_00709 CDS open 59935-60045 _na     36_aa hypothetical protein
55 JASNVU010000001.1 GCA030176885_00710 CDS open 60787-61206 _na     139_aa Organic hydroperoxide resistance protein
56 JASNVU010000001.1 GCA030176885_00711 CDS open 61331-62800 _na     489_aa DUF3375 domain-containing protein
57 JASNVU010000001.1 GCA030176885_00712 CDS open 62800-63450 _na     216_aa DUF4194 domain-containing protein
58 JASNVU010000001.1 GCA030176885_00713 CDS open 63443-66814 _na     1123_aa ATP-binding protein
59 JASNVU010000001.1 GCA030176885_00714 CDS open 66801-67934 _na     377_aa jetD Wadjet protein JetD C-terminal domain-containing protein
60 JASNVU010000001.1 GCA030176885_00715 CDS open 68071-68454 _na     127_aa hypothetical protein
61 JASNVU010000001.1 GCA030176885_00716 CDS open 68516-69685 _na     389_aa 8-amino-7-oxononanoate synthase
62 JASNVU010000001.1 GCA030176885_00717 CDS open 69682-70398 _na     238_aa 6-carboxyhexanoate--CoA ligase
63 JASNVU010000001.1 GCA030176885_00719 CDS open 70930-72303 _na     457_aa Aldehyde dehydrogenase domain-containing protein
64 JASNVU010000001.1 GCA030176885_00720 CDS open 72435-73640 _na     401_aa ER-bound oxygenase mpaB/mpaB'/Rubber oxygenase catalytic domain-containing protein
65 JASNVU010000001.1 GCA030176885_00721 CDS open 73674-74984 _na     436_aa ER-bound oxygenase mpaB/mpaB'/Rubber oxygenase catalytic domain-containing protein
66 JASNVU010000001.1 GCA030176885_00722 CDS open 75434-76486 _na     350_aa Vanillate O-demethylase oxidoreductase
67 JASNVU010000001.1 GCA030176885_00723 CDS open 76563-77486 _na     307_aa eamA EamA domain-containing protein
68 JASNVU010000001.1 GCA030176885_00724 CDS open 77631-79007 _na     458_aa accC acetyl-CoA carboxylase biotin carboxylase subunit
69 JASNVU010000001.1 GCA030176885_00725 CDS open 79025-79576 _na     183_aa accB acetyl-CoA carboxylase biotin carboxyl carrier protein
70 JASNVU010000001.1 GCA030176885_00726 CDS open 79579-81135 _na     518_aa Pyruvate carboxyltransferase domain-containing protein
71 JASNVU010000001.1 GCA030176885_00727 CDS open 81561-82907 _na     448_aa Major facilitator superfamily (MFS) profile domain-containing protein
72 JASNVU010000001.1 GCA030176885_00728 CDS open 82983-83624 _na     213_aa Succinyl-CoA:3-ketoacid-coenzyme A transferase subunit B
73 JASNVU010000001.1 GCA030176885_00729 CDS open 83624-84367 _na     247_aa 3-oxoacid CoA-transferase%2C A subunit
74 JASNVU010000001.1 GCA030176885_00730 CDS open 84483-85256 _na     257_aa Pca regulon regulatory protein
75 JASNVU010000001.1 GCA030176885_00731 CDS open 85266-86483 _na     405_aa putative acetyl-CoA acetyltransferase
76 JASNVU010000001.1 GCA030176885_00732 CDS open 86530-87816 _na     428_aa Phosphatidic acid phosphatase type 2/haloperoxidase domain-containing protein
77 JASNVU010000001.1 GCA030176885_00733 CDS open 87961-88056 _na     31_aa hypothetical protein
78 JASNVU010000001.1 GCA030176885_00734 CDS open 88225-88506 _na     93_aa ytxH YtxH domain-containing protein
79 JASNVU010000001.1 GCA030176885_00735 CDS open 88574-90493 _na     639_aa DNA primase
80 JASNVU010000001.1 GCA030176885_00736 CDS open 90603-91142 _na     179_aa Ribonuclease
81 JASNVU010000001.1 GCA030176885_00737 CDS open 91145-91378 _na     77_aa Barstar family protein
82 JASNVU010000001.1 GCA030176885_00738 CDS open 91587-92879 _na     430_aa deoxyguanosinetriphosphate triphosphohydrolase
83 JASNVU010000001.1 GCA030176885_00739 CDS open 92930-94693 _na     587_aa ABC3 transporter permease protein domain-containing protein
84 JASNVU010000001.1 GCA030176885_00740 CDS open 94693-95331 _na     212_aa ABC transporter domain-containing protein
85 JASNVU010000001.1 GCA030176885_00741 CDS open 95475-96050 _na     191_aa DUF218 domain-containing protein
86 JASNVU010000001.1 GCA030176885_00742 CDS open 96092-98140 _na     682_aa TPM domain-containing protein
87 JASNVU010000001.1 GCA030176885_00743 CDS open 98172-98699 _na     175_aa Htaa domain-containing protein
88 JASNVU010000001.1 GCA030176885_00744 CDS open 98699-99208 _na     169_aa DUF4178 domain-containing protein
89 JASNVU010000001.1 GCA030176885_00745 CDS open 99213-100592 _na     459_aa glycine--tRNA ligase
90 JASNVU010000001.1 GCA030176885_00746 CDS open 100781-101071 _na     96_aa HTH arsR-type domain-containing protein
91 JASNVU010000001.1 GCA030176885_00747 CDS open 101131-101559 _na     142_aa Ferric uptake regulation protein
92 JASNVU010000001.1 GCA030176885_00748 CDS open 101591-102343 _na     250_aa isoprenyl transferase
93 JASNVU010000001.1 GCA030176885_00749 CDS open 102354-103070 _na     238_aa recO DNA repair protein RecO
94 JASNVU010000001.1 GCA030176885_00750 CDS open 103077-104114 _na     345_aa era GTPase Era
95 JASNVU010000001.1 GCA030176885_00751 CDS open 104244-104801 _na     185_aa Secreted protein
96 JASNVU010000001.1 GCA030176885_00752 CDS open 105027-106046 _na     339_aa formamidase
97 JASNVU010000001.1 GCA030176885_00753 CDS open 106173-107021 _na     282_aa pdxY pyridoxal kinase PdxY
98 JASNVU010000001.1 GCA030176885_00754 CDS open 107079-107693 _na     204_aa ybeY rRNA maturation RNase YbeY
99 JASNVU010000001.1 GCA030176885_00755 CDS open 107694-108671 _na     325_aa PhoH-like protein
100 JASNVU010000001.1 GCA030176885_00756 CDS open 108682-109425 _na     247_aa 16S rRNA (uracil(1498)-N(3))-methyltransferase
101 JASNVU010000001.1 GCA030176885_00757 CDS open 109425-110585 _na     386_aa dnaJ molecular chaperone DnaJ
102 JASNVU010000001.1 GCA030176885_00758 CDS open 110667-111707 _na     346_aa hrcA heat-inducible transcriptional repressor HrcA
103 JASNVU010000001.1 GCA030176885_00759 CDS open 111871-113010 _na     379_aa hemW radical SAM family heme chaperone HemW
104 JASNVU010000001.1 GCA030176885_00760 CDS open 113160-114548 _na     462_aa Hemolysin family protein
105 JASNVU010000001.1 GCA030176885_00761 CDS open 114548-115606 _na     352_aa CNNM transmembrane domain-containing protein
106 JASNVU010000001.1 GCA030176885_00762 CDS open 115713-116516 _na     267_aa ATP-binding protein
107 JASNVU010000001.1 GCA030176885_00763 CDS open 117032-117982 _na     316_aa DUF559 domain-containing protein
108 JASNVU010000001.1 GCA030176885_00764 CDS open 118122-118802 _na     226_aa DUF222 domain-containing protein
109 JASNVU010000001.1 GCA030176885_00765 CDS open 119027-120859 _na     610_aa Acyl-CoA synthetase
110 JASNVU010000001.1 GCA030176885_00766 CDS open 121011-121286 _na     91_aa hypothetical protein
111 JASNVU010000001.1 GCA030176885_00767 CDS open 121279-121482 _na     67_aa hypothetical protein
112 JASNVU010000001.1 GCA030176885_00768 CDS open 121521-122783 _na     420_aa Carboxylic ester hydrolase
113 JASNVU010000001.1 GCA030176885_00769 CDS open 122787-123338 _na     183_aa idi isopentenyl-diphosphate Delta-isomerase
114 JASNVU010000001.1 GCA030176885_00770 CDS open 123335-123883 _na     182_aa Secreted protein
115 JASNVU010000001.1 GCA030176885_00771 CDS open 124057-125943 _na     628_aa Iron ABC transporter ATP-binding protein
116 JASNVU010000001.1 GCA030176885_00772 CDS open 125986-127116 _na     376_aa cysteine-S-conjugate beta-lyase
117 JASNVU010000001.1 GCA030176885_00773 CDS open 127327-128754 _na     475_aa brnQ branched-chain amino acid transport system II carrier protein
118 JASNVU010000001.1 GCA030176885_00774 CDS open 128952-129971 _na     339_aa Luciferase-like domain-containing protein
119 JASNVU010000001.1 GCA030176885_00775 CDS open 130160-131680 _na     506_aa Solute-binding protein family 5 domain-containing protein
120 JASNVU010000001.1 GCA030176885_00776 CDS open 131677-132642 _na     321_aa ABC transmembrane type-1 domain-containing protein
121 JASNVU010000001.1 GCA030176885_00777 CDS open 132639-133460 _na     273_aa ABC transmembrane type-1 domain-containing protein
122 JASNVU010000001.1 GCA030176885_00778 CDS open 133457-134905 _na     482_aa nikD nickel import ATP-binding protein NikD
123 JASNVU010000001.1 GCA030176885_00779 CDS open 134966-136657 _na     563_aa Integral membrane bound transporter domain-containing protein
124 JASNVU010000001.1 GCA030176885_00780 CDS open 136718-138598 _na     626_aa Choline transporter
125 JASNVU010000001.1 GCA030176885_00781 CDS open 138598-138978 _na     126_aa Oxidoreductase
126 JASNVU010000001.1 GCA030176885_00782 CDS open 138981-140357 _na     458_aa Peptidase M20 dimerisation domain-containing protein
127 JASNVU010000001.1 GCA030176885_00783 CDS open 140515-141504 _na     329_aa HNH nuclease domain-containing protein
128 JASNVU010000001.1 GCA030176885_00784 CDS open 141903-143129 _na     408_aa efeB iron uptake transporter deferrochelatase/peroxidase subunit
129 JASNVU010000001.1 GCA030176885_00785 CDS open 143129-144250 _na     373_aa Imelysin-like domain-containing protein
130 JASNVU010000001.1 GCA030176885_00786 CDS open 144254-146155 _na     633_aa Phospholipase C
131 JASNVU010000001.1 GCA030176885_00787 CDS open 146402-148252 _na     616_aa lepA translation elongation factor 4
132 JASNVU010000001.1 GCA030176885_00788 CDS open 148271-148807 _na     178_aa PemK-like protein
133 JASNVU010000001.1 GCA030176885_00789 CDS open 149033-149296 _na     87_aa rpsT 30S ribosomal protein S20
134 JASNVU010000001.1 GCA030176885_00790 CDS open 149395-149973 _na     192_aa HTH tetR-type domain-containing protein
135 JASNVU010000001.1 GCA030176885_00791 CDS open 150402-151244 _na     280_aa Site-specific DNA-methyltransferase (adenine-specific)
136 JASNVU010000001.1 GCA030176885_00792 CDS open 151237-152598 _na     453_aa yqaJ YqaJ viral recombinase domain-containing protein
137 JASNVU010000001.1 GCA030176885_00793 CDS open 152595-153242 _na     215_aa lysE Lysine transporter LysE
138 JASNVU010000001.1 GCA030176885_00794 CDS open 153239-153613 _na     124_aa ankyrin repeat domain-containing protein
139 JASNVU010000001.1 GCA030176885_00795 CDS open 153639-154607 _na     322_aa holA DNA polymerase III subunit delta
140 JASNVU010000001.1 GCA030176885_00796 CDS open 154615-156018 _na     467_aa ComEC/Rec2-related protein domain-containing protein
141 JASNVU010000001.1 GCA030176885_00797 CDS open 156039-156716 _na     225_aa Helix-hairpin-helix DNA-binding motif class 1 domain-containing protein
142 JASNVU010000001.1 GCA030176885_00798 CDS open 156875-157672 _na     265_aa degV DegV family EDD domain-containing protein
143 JASNVU010000001.1 GCA030176885_00799 CDS open 157672-158370 _na     232_aa Phosphoglycerate mutase
144 JASNVU010000001.1 GCA030176885_00800 CDS open 158378-158848 _na     156_aa rsfS ribosome silencing factor
145 JASNVU010000001.1 GCA030176885_00801 CDS open 158939-159556 _na     205_aa nadD nicotinate-nucleotide adenylyltransferase
146 JASNVU010000001.1 GCA030176885_00802 CDS open 159575-160426 _na     283_aa PE-PPE domain-containing protein
147 JASNVU010000001.1 GCA030176885_00803 CDS open 160506-161774 _na     422_aa glutamate-5-semialdehyde dehydrogenase
148 JASNVU010000001.1 GCA030176885_00804 CDS open 162000-163079 _na     359_aa Zinc ABC transporter substrate-binding protein
149 JASNVU010000001.1 GCA030176885_00805 CDS open 163076-163774 _na     232_aa ABC transporter domain-containing protein
150 JASNVU010000001.1 GCA030176885_00806 CDS open 163771-164595 _na     274_aa ABC 3 transport family protein
151 JASNVU010000001.1 GCA030176885_00807 CDS open 164583-165380 _na     265_aa ABC transporter permease
152 JASNVU010000001.1 GCA030176885_00808 CDS open 165448-166137 _na     229_aa Diphtheria toxin repressor
153 JASNVU010000001.1 GCA030176885_00809 CDS open 166294-167223 _na     309_aa D-isomer specific 2-hydroxyacid dehydrogenase NAD-binding domain-containing protein
154 JASNVU010000001.1 GCA030176885_00810 CDS open 167246-168478 _na     410_aa Glutamate 5-kinase
155 JASNVU010000001.1 GCA030176885_00811 CDS open 168616-170148 _na     510_aa obgE GTPase ObgE
156 JASNVU010000001.1 GCA030176885_00812 CDS open 170321-170599 _na     92_aa rpmA 50S ribosomal protein L27
157 JASNVU010000001.1 GCA030176885_00813 CDS open 170643-170948 _na     101_aa rplU 50S ribosomal protein L21
158 JASNVU010000001.1 GCA030176885_00814 CDS open 171173-175030 _na     1285_aa S1 motif domain-containing protein
159 JASNVU010000001.1 GCA030176885_00815 CDS open 175231-176022 _na     263_aa HTH marR-type domain-containing protein
160 JASNVU010000001.1 GCA030176885_00816 CDS open 176019-177083 _na     354_aa arsB ACR3 family arsenite efflux transporter
161 JASNVU010000001.1 GCA030176885_00817 CDS open 177194-177544 _na     116_aa HTH arsR-type domain-containing protein
162 JASNVU010000001.1 GCA030176885_00818 CDS open 177692-178138 _na     148_aa ndk nucleoside-diphosphate kinase
163 JASNVU010000001.1 GCA030176885_00819 CDS open 178189-178500 _na     103_aa Ribosomal protein L7/L12 C-terminal domain-containing protein
164 JASNVU010000001.1 GCA030176885_00820 CDS open 178506-179000 _na     164_aa DUF4233 domain-containing protein
165 JASNVU010000001.1 GCA030176885_00821 CDS open 178997-180568 _na     523_aa folC bifunctional tetrahydrofolate synthase/dihydrofolate synthase
166 JASNVU010000001.1 GCA030176885_00822 CDS open 180568-183300 _na     910_aa valine--tRNA ligase
167 JASNVU010000001.1 GCA030176885_00823 CDS open 183358-184179 _na     273_aa panB 3-methyl-2-oxobutanoate hydroxymethyltransferase
168 JASNVU010000001.1 GCA030176885_00824 CDS open 184191-185012 _na     273_aa panC pantoate--beta-alanine ligase
169 JASNVU010000001.1 GCA030176885_00825 CDS open 185009-185965 _na     318_aa malate dehydrogenase
170 JASNVU010000001.1 GCA030176885_00826 CDS open 186380-187138 _na     252_aa HTH tetR-type domain-containing protein
171 JASNVU010000001.1 GCA030176885_00827 CDS open 187178-188473 _na     431_aa clpX ATP-dependent Clp protease ATP-binding subunit ClpX
172 JASNVU010000001.1 GCA030176885_00828 CDS open 188704-189468 _na     254_aa fabG 3-oxoacyl-ACP reductase FabG
173 JASNVU010000001.1 GCA030176885_00829 CDS open 189553-189807 _na     84_aa hypothetical protein
174 JASNVU010000001.1 GCA030176885_00830 CDS open 189972-190262 _na     96_aa DUF4190 domain-containing protein
175 JASNVU010000001.1 GCA030176885_00831 CDS open 190266-191570 _na     434_aa Phosphate transporter
176 JASNVU010000001.1 GCA030176885_00832 CDS open 191894-193396 _na     500_aa Major facilitator superfamily (MFS) profile domain-containing protein
177 JASNVU010000001.1 GCA030176885_00833 CDS open 193667-194290 _na     207_aa ATP-dependent Clp protease proteolytic subunit
178 JASNVU010000001.1 GCA030176885_00834 CDS open 194311-194922 _na     203_aa ATP-dependent Clp protease proteolytic subunit
179 JASNVU010000001.1 GCA030176885_00835 CDS open 195113-196468 _na     451_aa tig trigger factor
180 JASNVU010000001.1 GCA030176885_00837 CDS open 196771-197610 _na     279_aa DUF1542 domain-containing protein
181 JASNVU010000001.1 GCA030176885_00839 CDS open 198422-198649 _na     75_aa DNA-binding protein
182 JASNVU010000001.1 GCA030176885_00840 CDS open 198789-199622 _na     277_aa NADP-dependent oxidoreductase domain-containing protein
183 JASNVU010000001.1 GCA030176885_00841 CDS open 199710-200252 _na     180_aa ribose-5-phosphate isomerase
184 JASNVU010000001.1 GCA030176885_00842 CDS open 200309-200710 _na     133_aa Major facilitator superfamily (MFS) profile domain-containing protein
185 JASNVU010000001.1 GCA030176885_00843 CDS open 200711-201334 _na     207_aa DSBA-like thioredoxin domain-containing protein
186 JASNVU010000001.1 GCA030176885_00844 CDS open 201433-203949 _na     838_aa pepN aminopeptidase N
187 JASNVU010000001.1 GCA030176885_00845 CDS open 203954-204643 _na     229_aa SDR family oxidoreductase
188 JASNVU010000001.1 GCA030176885_00846 CDS open 204702-205928 _na     408_aa Avi-7169 family alkylhydroperoxidase domain-containing protein
189 JASNVU010000001.1 GCA030176885_00847 CDS open 205982-207586 _na     534_aa nikD nickel import ATP-binding protein NikD
190 JASNVU010000001.1 GCA030176885_00848 CDS open 207586-208398 _na     270_aa ABC transmembrane type-1 domain-containing protein
191 JASNVU010000001.1 GCA030176885_00849 CDS open 208395-209426 _na     343_aa ABC transmembrane type-1 domain-containing protein
192 JASNVU010000001.1 GCA030176885_00850 CDS open 209430-211085 _na     551_aa TIGR04028 family ABC transporter substrate-binding protein
193 JASNVU010000001.1 GCA030176885_00851 CDS open 211288-213159 _na     623_aa FAD-dependent urate hydroxylase HpyO/Asp monooxygenase CreE-like FAD/NAD(P)-binding domain-containing protein
194 JASNVU010000001.1 GCA030176885_00852 CDS open 213181-214257 _na     358_aa cystathionine gamma-synthase
195 JASNVU010000001.1 GCA030176885_00853 CDS open 214519-215499 _na     326_aa mscS Mechanosensitive ion channel protein MscS
196 JASNVU010000001.1 GCA030176885_00854 CDS open 215500-215883 _na     127_aa Globin
197 JASNVU010000001.1 GCA030176885_00855 CDS open 216017-217108 _na     363_aa ald alanine dehydrogenase
198 JASNVU010000001.1 GCA030176885_00856 CDS open 217366-218004 _na     212_aa DUF1707 domain-containing protein
199 JASNVU010000001.1 GCA030176885_00857 CDS open 218047-218457 _na     136_aa Thioesterase domain-containing protein
200 JASNVU010000001.1 GCA030176885_00858 CDS open 218472-220142 _na     556_aa ettA energy-dependent translational throttle protein EttA
201 JASNVU010000001.1 GCA030176885_00859 CDS open 220253-220849 _na     198_aa Single-stranded DNA-binding protein
202 JASNVU010000001.1 GCA030176885_00860 CDS open 221042-223006 _na     654_aa Copper resistance protein D domain-containing protein
203 JASNVU010000001.1 GCA030176885_00861 CDS open 223148-224083 _na     311_aa HTH lysR-type domain-containing protein
204 JASNVU010000001.1 GCA030176885_00863 CDS open 224675-225517 _na     280_aa RelA/SpoT domain-containing protein
205 JASNVU010000001.1 GCA030176885_00864 CDS open 225819-226679 _na     286_aa cmrA mycolate reductase
206 JASNVU010000001.1 GCA030176885_00865 CDS open 226676-228220 _na     514_aa Amino acid carrier protein
207 JASNVU010000001.1 GCA030176885_00866 CDS open 228382-229023 _na     213_aa orn oligoribonuclease
208 JASNVU010000001.1 GCA030176885_00868 CDS open 229177-230121 _na     314_aa Luciferase-like domain-containing protein
209 JASNVU010000001.1 GCA030176885_00869 CDS open 230142-231347 _na     401_aa L%2CD-TPase catalytic domain-containing protein
210 JASNVU010000001.1 GCA030176885_00871 CDS open 232198-232548 _na     116_aa hypothetical protein
211 JASNVU010000001.1 GCA030176885_00872 CDS open 233478-233744 _na     88_aa HNH endonuclease
212 JASNVU010000001.1 GCA030176885_00873 CDS open 233890-234279 _na     129_aa Terminase small subunit
213 JASNVU010000001.1 GCA030176885_00874 CDS open 234269-235669 _na     466_aa Terminase
214 JASNVU010000001.1 GCA030176885_00875 CDS open 235669-235911 _na     80_aa hypothetical protein
215 JASNVU010000001.1 GCA030176885_00876 CDS open 235983-237026 _na     347_aa Phage portal protein
216 JASNVU010000001.1 GCA030176885_00877 CDS open 237023-237826 _na     267_aa N-acetylmuramoyl-L-alanine amidase domain-containing protein
217 JASNVU010000001.1 GCA030176885_00878 CDS open 238007-238246 _na     79_aa Holin
218 JASNVU010000001.1 GCA030176885_00879 CDS open 238230-239765 _na     511_aa Phage major capsid protein
219 JASNVU010000001.1 GCA030176885_00880 CDS open 239765-240058 _na     97_aa Phage gp6-like head-tail connector protein
220 JASNVU010000001.1 GCA030176885_00881 CDS open 240058-240390 _na     110_aa hypothetical protein
221 JASNVU010000001.1 GCA030176885_00882 CDS open 240401-240844 _na     147_aa Phage tail protein
222 JASNVU010000001.1 GCA030176885_00883 CDS open 240847-241269 _na     140_aa HK97 gp10 family phage protein
223 JASNVU010000001.1 GCA030176885_00884 CDS open 241270-241569 _na     99_aa Transposase
224 JASNVU010000001.1 GCA030176885_00885 CDS open 241682-243868 _na     728_aa Phage tail protein
225 JASNVU010000001.1 GCA030176885_00886 CDS open 243853-245382 _na     509_aa Minor tail protein
226 JASNVU010000001.1 GCA030176885_00887 CDS open 245382-246485 _na     367_aa Collagen-like protein
227 JASNVU010000001.1 GCA030176885_00888 CDS open 246482-247261 _na     259_aa Tyrosine-type recombinase/integrase
228 JASNVU010000001.1 GCA030176885_00889 CDS open 247436-248203 _na     255_aa ABC transporter domain-containing protein
229 JASNVU010000001.1 GCA030176885_00890 CDS open 248194-249249 _na     351_aa Iron-siderophore ABC transporter permease
230 JASNVU010000001.1 GCA030176885_00891 CDS open 249249-250424 _na     391_aa Fe/B12 periplasmic-binding domain-containing protein
231 JASNVU010000001.1 GCA030176885_00892 CDS open 250508-251716 _na     402_aa glutaminase
232 JASNVU010000001.1 GCA030176885_00893 CDS open 251844-252122 _na     92_aa DUF3618 domain-containing protein
233 JASNVU010000001.1 GCA030176885_00894 CDS open 252211-252687 _na     158_aa bcp thioredoxin-dependent thiol peroxidase
234 JASNVU010000001.1 GCA030176885_00895 CDS open 252692-253309 _na     205_aa HTH tetR-type domain-containing protein
235 JASNVU010000001.1 GCA030176885_00896 CDS open 253394-254380 _na     328_aa HNH nuclease domain-containing protein
236 JASNVU010000001.1 GCA030176885_00897 CDS open 254402-255076 _na     224_aa bioD dethiobiotin synthase
237 JASNVU010000001.1 GCA030176885_00898 CDS open 255073-256365 _na     430_aa adenosylmethionine--8-amino-7-oxononanoate transaminase
238 JASNVU010000001.1 GCA030176885_00899 CDS open 256526-257773 _na     415_aa Major facilitator superfamily (MFS) profile domain-containing protein
239 JASNVU010000001.1 GCA030176885_00900 CDS open 257778-258683 _na     301_aa Band 7 domain-containing protein
240 JASNVU010000001.1 GCA030176885_00901 CDS open 258740-259984 _na     414_aa AB hydrolase-1 domain-containing protein
241 JASNVU010000001.1 GCA030176885_00902 CDS open 259990-260859 _na     289_aa pflA pyruvate formate-lyase-activating protein
242 JASNVU010000001.1 GCA030176885_00903 CDS open 260862-261113 _na     83_aa grcA2 autonomous glycyl radical cofactor GrcA2
243 JASNVU010000001.1 GCA030176885_00904 CDS open 261137-263224 _na     695_aa pflB formate C-acetyltransferase
244 JASNVU010000001.1 GCA030176885_00905 CDS open 263536-265443 _na     635_aa Oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase domain-containing protein
245 JASNVU010000001.1 GCA030176885_00907 CDS open 265674-266150 _na     158_aa Transcriptional regulator
246 JASNVU010000001.1 GCA030176885_00908 CDS open 266154-266504 _na     116_aa DUF3817 domain-containing protein
247 JASNVU010000001.1 GCA030176885_00909 CDS open 266505-267107 _na     200_aa rdgB RdgB/HAM1 family non-canonical purine NTP pyrophosphatase
248 JASNVU010000001.1 GCA030176885_00910 CDS open 267101-267829 _na     242_aa rph ribonuclease PH
249 JASNVU010000001.1 GCA030176885_00911 CDS open 267845-268606 _na     253_aa Metallo-beta-lactamase domain-containing protein
250 JASNVU010000001.1 GCA030176885_00912 CDS open 268667-269446 _na     259_aa murI glutamate racemase
251 JASNVU010000001.1 GCA030176885_00913 CDS open 269446-270072 _na     208_aa Rhomboid family intramembrane serine protease
252 JASNVU010000001.1 GCA030176885_00914 CDS open 270092-271006 _na     304_aa P1 family peptidase
253 JASNVU010000001.1 GCA030176885_00915 CDS open 271006-271542 _na     178_aa DUF2017 domain-containing protein
254 JASNVU010000001.1 GCA030176885_00916 CDS open 271547-271873 _na     108_aa clpS ATP-dependent Clp protease adapter ClpS
255 JASNVU010000001.1 GCA030176885_00917 CDS open 271991-273319 _na     442_aa nicotinate phosphoribosyltransferase
256 JASNVU010000001.1 GCA030176885_00918 CDS open 273338-275302 _na     654_aa DNA 5'-3' helicase
257 JASNVU010000001.1 GCA030176885_00919 CDS open 275268-275990 _na     240_aa peptidyl-tRNA hydrolase
258 JASNVU010000001.1 GCA030176885_00920 CDS open 275983-277101 _na     372_aa serB phosphoserine phosphatase SerB
259 JASNVU010000001.1 GCA030176885_00921 CDS open 277171-278865 _na     564_aa Cytochrome c oxidase subunit 1
260 JASNVU010000001.1 GCA030176885_00922 CDS open 279188-280177 _na     329_aa nrdF class 1b ribonucleoside-diphosphate reductase subunit beta
261 JASNVU010000001.1 GCA030176885_00923 CDS open 280308-280994 _na     228_aa HTH gntR-type domain-containing protein
262 JASNVU010000001.1 GCA030176885_00924 CDS open 280991-283153 _na     720_aa nrdE class 1b ribonucleoside-diphosphate reductase subunit alpha
263 JASNVU010000001.1 GCA030176885_00925 CDS open 283208-283639 _na     143_aa nrdI class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI
264 JASNVU010000001.1 GCA030176885_00926 CDS open 283664-283903 _na     79_aa nrdH Glutaredoxin-like protein NrdH
265 JASNVU010000001.1 GCA030176885_00927 CDS open 284273-284395 _na     40_aa ykgO type B 50S ribosomal protein L36
266 JASNVU010000001.1 GCA030176885_00928 CDS open 284523-285872 _na     449_aa Major facilitator superfamily (MFS) profile domain-containing protein
267 JASNVU010000001.1 GCA030176885_00929 CDS open 285900-286721 _na     273_aa nadE ammonia-dependent NAD(+) synthetase
268 JASNVU010000001.1 GCA030176885_00930 CDS open 286718-287455 _na     245_aa Fructosamine kinase
269 JASNVU010000001.1 GCA030176885_00931 CDS open 287570-288367 _na     265_aa SGNH hydrolase-type esterase domain-containing protein
270 JASNVU010000001.1 GCA030176885_00933 CDS open 288566-289291 _na     241_aa Thioredoxin-like fold domain-containing protein
271 JASNVU010000001.1 GCA030176885_00934 CDS open 289345-289863 _na     172_aa mauE Methylamine utilisation protein MauE domain-containing protein
272 JASNVU010000001.1 GCA030176885_00935 CDS open 289868-290179 _na     103_aa fluoride efflux transporter family protein
273 JASNVU010000001.1 GCA030176885_00936 CDS open 290176-290535 _na     119_aa fluC Fluoride-specific ion channel FluC
274 JASNVU010000001.1 GCA030176885_00937 CDS open 290754-293279 _na     841_aa ABC transporter permease
275 JASNVU010000001.1 GCA030176885_00938 CDS open 293298-294026 _na     242_aa ABC transporter domain-containing protein
276 JASNVU010000001.1 GCA030176885_00939 CDS open 294948-295862 _na     304_aa HTH lysR-type domain-containing protein
277 JASNVU010000001.1 GCA030176885_00940 CDS open 295915-296949 _na     344_aa Sulfate exporter family transporter
278 JASNVU010000001.1 GCA030176885_00941 CDS open 297319-297558 _na     79_aa Resolvase/invertase-type recombinase catalytic domain-containing protein
279 JASNVU010000001.1 GCA030176885_00942 CDS open 297623-298357 _na     244_aa IS3 family transposase
280 JASNVU010000001.1 GCA030176885_00943 CDS open 298529-298849 _na     106_aa Transposase
281 JASNVU010000001.1 GCA030176885_00944 CDS open 299124-299867 _na     247_aa DUF222 domain-containing protein
282 JASNVU010000001.1 GCA030176885_00656 gene open 199-1533
283 JASNVU010000001.1 GCA030176885_00657 gene open 1831-4674 gcvP
284 JASNVU010000001.1 GCA030176885_00658 gene open 4677-5789 gcvT
285 JASNVU010000001.1 GCA030176885_00659 gene open 5835-6227 gcvH
286 JASNVU010000001.1 GCA030176885_00660 gene open 6346-7149 lipB
287 JASNVU010000001.1 GCA030176885_00661 gene open 7286-8350 lipA
288 JASNVU010000001.1 GCA030176885_00662 gene open 8433-9218
289 JASNVU010000001.1 GCA030176885_00663 gene open 9372-9845
290 JASNVU010000001.1 GCA030176885_00664 gene open 9964-11397 glnA
291 JASNVU010000001.1 GCA030176885_00665 gene open 11687-12574
292 JASNVU010000001.1 GCA030176885_00666 gene open 12605-12979
293 JASNVU010000001.1 GCA030176885_00667 gene open 12976-13521
294 JASNVU010000001.1 GCA030176885_00668 gene open 13552-14397
295 JASNVU010000001.1 GCA030176885_00669 gene open 14372-14518
296 JASNVU010000001.1 GCA030176885_00670 gene open 14526-15968 thrC
297 JASNVU010000001.1 GCA030176885_00671 gene open 16052-17314
298 JASNVU010000001.1 GCA030176885_00672 gene open 17319-18095
299 JASNVU010000001.1 GCA030176885_00673 gene open 18291-18401
300 JASNVU010000001.1 GCA030176885_00674 gene open 18502-19005
301 JASNVU010000001.1 GCA030176885_00675 gene open 18971-19333
302 JASNVU010000001.1 GCA030176885_00676 gene open 19430-22489
303 JASNVU010000001.1 GCA030176885_00677 gene open 22497-23834 glnA
304 JASNVU010000001.1 GCA030176885_00678 gene open 24030-25070
305 JASNVU010000001.1 GCA030176885_00679 gene open 25245-27002
306 JASNVU010000001.1 GCA030176885_00680 gene open 27072-27266
307 JASNVU010000001.1 GCA030176885_00681 gene open 27519-28793
308 JASNVU010000001.1 GCA030176885_00683 gene open 29266-30441
309 JASNVU010000001.1 GCA030176885_00684 gene open 30438-31157
310 JASNVU010000001.1 GCA030176885_00685 gene open 31158-32300
311 JASNVU010000001.1 GCA030176885_00686 gene open 32394-32885
312 JASNVU010000001.1 GCA030176885_00687 gene open 32896-33837
313 JASNVU010000001.1 GCA030176885_00689 gene open 34087-34485
314 JASNVU010000001.1 GCA030176885_00690 gene open 34844-37588 aceE
315 JASNVU010000001.1 GCA030176885_00691 gene open 37743-38042
316 JASNVU010000001.1 GCA030176885_00692 gene open 38039-38827
317 JASNVU010000001.1 GCA030176885_00693 gene open 38904-39320
318 JASNVU010000001.1 GCA030176885_00694 gene open 39931-40047
319 JASNVU010000001.1 GCA030176885_00695 gene open 40130-40957
320 JASNVU010000001.1 GCA030176885_00696 gene open 41138-42229
321 JASNVU010000001.1 GCA030176885_00697 gene open 42401-43999 mscS
322 JASNVU010000001.1 GCA030176885_00698 gene open 44107-45213
323 JASNVU010000001.1 GCA030176885_00699 gene open 45274-45825
324 JASNVU010000001.1 GCA030176885_00701 gene open 46335-46502
325 JASNVU010000001.1 GCA030176885_00702 gene open 51437-52375 cas1e
326 JASNVU010000001.1 GCA030176885_00703 gene open 52375-53073 cas6e
327 JASNVU010000001.1 GCA030176885_00704 gene open 53070-53672 cas5e
328 JASNVU010000001.1 GCA030176885_00705 gene open 53800-54942 cas7e
329 JASNVU010000001.1 GCA030176885_00706 gene open 54978-55649 casB
330 JASNVU010000001.1 GCA030176885_00707 gene open 55642-57387 casA
331 JASNVU010000001.1 GCA030176885_00708 gene open 57487-59691
332 JASNVU010000001.1 GCA030176885_00709 gene open 59935-60045
333 JASNVU010000001.1 GCA030176885_00710 gene open 60787-61206
334 JASNVU010000001.1 GCA030176885_00711 gene open 61331-62800
335 JASNVU010000001.1 GCA030176885_00712 gene open 62800-63450
336 JASNVU010000001.1 GCA030176885_00713 gene open 63443-66814
337 JASNVU010000001.1 GCA030176885_00714 gene open 66801-67934 jetD
338 JASNVU010000001.1 GCA030176885_00715 gene open 68071-68454
339 JASNVU010000001.1 GCA030176885_00716 gene open 68516-69685
340 JASNVU010000001.1 GCA030176885_00717 gene open 69682-70398
341 JASNVU010000001.1 GCA030176885_00719 gene open 70930-72303
342 JASNVU010000001.1 GCA030176885_00720 gene open 72435-73640
343 JASNVU010000001.1 GCA030176885_00721 gene open 73674-74984
344 JASNVU010000001.1 GCA030176885_00722 gene open 75434-76486
345 JASNVU010000001.1 GCA030176885_00723 gene open 76563-77486 eamA
346 JASNVU010000001.1 GCA030176885_00724 gene open 77631-79007 accC
347 JASNVU010000001.1 GCA030176885_00725 gene open 79025-79576 accB
348 JASNVU010000001.1 GCA030176885_00726 gene open 79579-81135
349 JASNVU010000001.1 GCA030176885_00727 gene open 81561-82907
350 JASNVU010000001.1 GCA030176885_00728 gene open 82983-83624
351 JASNVU010000001.1 GCA030176885_00729 gene open 83624-84367
352 JASNVU010000001.1 GCA030176885_00730 gene open 84483-85256
353 JASNVU010000001.1 GCA030176885_00731 gene open 85266-86483
354 JASNVU010000001.1 GCA030176885_00732 gene open 86530-87816
355 JASNVU010000001.1 GCA030176885_00733 gene open 87961-88056
356 JASNVU010000001.1 GCA030176885_00734 gene open 88225-88506 ytxH
357 JASNVU010000001.1 GCA030176885_00735 gene open 88574-90493
358 JASNVU010000001.1 GCA030176885_00736 gene open 90603-91142
359 JASNVU010000001.1 GCA030176885_00737 gene open 91145-91378
360 JASNVU010000001.1 GCA030176885_00738 gene open 91587-92879
361 JASNVU010000001.1 GCA030176885_00739 gene open 92930-94693
362 JASNVU010000001.1 GCA030176885_00740 gene open 94693-95331
363 JASNVU010000001.1 GCA030176885_00741 gene open 95475-96050
364 JASNVU010000001.1 GCA030176885_00742 gene open 96092-98140
365 JASNVU010000001.1 GCA030176885_00743 gene open 98172-98699
366 JASNVU010000001.1 GCA030176885_00744 gene open 98699-99208
367 JASNVU010000001.1 GCA030176885_00745 gene open 99213-100592
368 JASNVU010000001.1 GCA030176885_00746 gene open 100781-101071
369 JASNVU010000001.1 GCA030176885_00747 gene open 101131-101559
370 JASNVU010000001.1 GCA030176885_00748 gene open 101591-102343
371 JASNVU010000001.1 GCA030176885_00749 gene open 102354-103070 recO
372 JASNVU010000001.1 GCA030176885_00750 gene open 103077-104114 era
373 JASNVU010000001.1 GCA030176885_00751 gene open 104244-104801
374 JASNVU010000001.1 GCA030176885_00752 gene open 105027-106046
375 JASNVU010000001.1 GCA030176885_00753 gene open 106173-107021 pdxY
376 JASNVU010000001.1 GCA030176885_00754 gene open 107079-107693 ybeY
377 JASNVU010000001.1 GCA030176885_00755 gene open 107694-108671
378 JASNVU010000001.1 GCA030176885_00756 gene open 108682-109425
379 JASNVU010000001.1 GCA030176885_00757 gene open 109425-110585 dnaJ
380 JASNVU010000001.1 GCA030176885_00758 gene open 110667-111707 hrcA
381 JASNVU010000001.1 GCA030176885_00759 gene open 111871-113010 hemW
382 JASNVU010000001.1 GCA030176885_00760 gene open 113160-114548
383 JASNVU010000001.1 GCA030176885_00761 gene open 114548-115606
384 JASNVU010000001.1 GCA030176885_00762 gene open 115713-116516
385 JASNVU010000001.1 GCA030176885_00763 gene open 117032-117982
386 JASNVU010000001.1 GCA030176885_00764 gene open 118122-118802
387 JASNVU010000001.1 GCA030176885_00765 gene open 119027-120859
388 JASNVU010000001.1 GCA030176885_00766 gene open 121011-121286
389 JASNVU010000001.1 GCA030176885_00767 gene open 121279-121482
390 JASNVU010000001.1 GCA030176885_00768 gene open 121521-122783
391 JASNVU010000001.1 GCA030176885_00769 gene open 122787-123338 idi
392 JASNVU010000001.1 GCA030176885_00770 gene open 123335-123883
393 JASNVU010000001.1 GCA030176885_00771 gene open 124057-125943
394 JASNVU010000001.1 GCA030176885_00772 gene open 125986-127116
395 JASNVU010000001.1 GCA030176885_00773 gene open 127327-128754 brnQ
396 JASNVU010000001.1 GCA030176885_00774 gene open 128952-129971
397 JASNVU010000001.1 GCA030176885_00775 gene open 130160-131680
398 JASNVU010000001.1 GCA030176885_00776 gene open 131677-132642
399 JASNVU010000001.1 GCA030176885_00777 gene open 132639-133460
400 JASNVU010000001.1 GCA030176885_00778 gene open 133457-134905 nikD
401 JASNVU010000001.1 GCA030176885_00779 gene open 134966-136657
402 JASNVU010000001.1 GCA030176885_00780 gene open 136718-138598
403 JASNVU010000001.1 GCA030176885_00781 gene open 138598-138978
404 JASNVU010000001.1 GCA030176885_00782 gene open 138981-140357
405 JASNVU010000001.1 GCA030176885_00783 gene open 140515-141504
406 JASNVU010000001.1 GCA030176885_00784 gene open 141903-143129 efeB
407 JASNVU010000001.1 GCA030176885_00785 gene open 143129-144250
408 JASNVU010000001.1 GCA030176885_00786 gene open 144254-146155
409 JASNVU010000001.1 GCA030176885_00787 gene open 146402-148252 lepA
410 JASNVU010000001.1 GCA030176885_00788 gene open 148271-148807
411 JASNVU010000001.1 GCA030176885_00789 gene open 149033-149296 rpsT
412 JASNVU010000001.1 GCA030176885_00790 gene open 149395-149973
413 JASNVU010000001.1 GCA030176885_00791 gene open 150402-151244
414 JASNVU010000001.1 GCA030176885_00792 gene open 151237-152598 yqaJ
415 JASNVU010000001.1 GCA030176885_00793 gene open 152595-153242 lysE
416 JASNVU010000001.1 GCA030176885_00794 gene open 153239-153613
417 JASNVU010000001.1 GCA030176885_00795 gene open 153639-154607 holA
418 JASNVU010000001.1 GCA030176885_00796 gene open 154615-156018
419 JASNVU010000001.1 GCA030176885_00797 gene open 156039-156716
420 JASNVU010000001.1 GCA030176885_00798 gene open 156875-157672 degV
421 JASNVU010000001.1 GCA030176885_00799 gene open 157672-158370
422 JASNVU010000001.1 GCA030176885_00800 gene open 158378-158848 rsfS
423 JASNVU010000001.1 GCA030176885_00801 gene open 158939-159556 nadD
424 JASNVU010000001.1 GCA030176885_00802 gene open 159575-160426
425 JASNVU010000001.1 GCA030176885_00803 gene open 160506-161774
426 JASNVU010000001.1 GCA030176885_00804 gene open 162000-163079
427 JASNVU010000001.1 GCA030176885_00805 gene open 163076-163774
428 JASNVU010000001.1 GCA030176885_00806 gene open 163771-164595
429 JASNVU010000001.1 GCA030176885_00807 gene open 164583-165380
430 JASNVU010000001.1 GCA030176885_00808 gene open 165448-166137
431 JASNVU010000001.1 GCA030176885_00809 gene open 166294-167223
432 JASNVU010000001.1 GCA030176885_00810 gene open 167246-168478
433 JASNVU010000001.1 GCA030176885_00811 gene open 168616-170148 obgE
434 JASNVU010000001.1 GCA030176885_00812 gene open 170321-170599 rpmA
435 JASNVU010000001.1 GCA030176885_00813 gene open 170643-170948 rplU
436 JASNVU010000001.1 GCA030176885_00814 gene open 171173-175030
437 JASNVU010000001.1 GCA030176885_00815 gene open 175231-176022
438 JASNVU010000001.1 GCA030176885_00816 gene open 176019-177083 arsB
439 JASNVU010000001.1 GCA030176885_00817 gene open 177194-177544
440 JASNVU010000001.1 GCA030176885_00818 gene open 177692-178138 ndk
441 JASNVU010000001.1 GCA030176885_00819 gene open 178189-178500
442 JASNVU010000001.1 GCA030176885_00820 gene open 178506-179000
443 JASNVU010000001.1 GCA030176885_00821 gene open 178997-180568 folC
444 JASNVU010000001.1 GCA030176885_00822 gene open 180568-183300
445 JASNVU010000001.1 GCA030176885_00823 gene open 183358-184179 panB
446 JASNVU010000001.1 GCA030176885_00824 gene open 184191-185012 panC
447 JASNVU010000001.1 GCA030176885_00825 gene open 185009-185965
448 JASNVU010000001.1 GCA030176885_00826 gene open 186380-187138
449 JASNVU010000001.1 GCA030176885_00827 gene open 187178-188473 clpX
450 JASNVU010000001.1 GCA030176885_00828 gene open 188704-189468 fabG
451 JASNVU010000001.1 GCA030176885_00829 gene open 189553-189807
452 JASNVU010000001.1 GCA030176885_00830 gene open 189972-190262
453 JASNVU010000001.1 GCA030176885_00831 gene open 190266-191570
454 JASNVU010000001.1 GCA030176885_00832 gene open 191894-193396
455 JASNVU010000001.1 GCA030176885_00833 gene open 193667-194290
456 JASNVU010000001.1 GCA030176885_00834 gene open 194311-194922
457 JASNVU010000001.1 GCA030176885_00835 gene open 195113-196468 tig
458 JASNVU010000001.1 GCA030176885_00837 gene open 196771-197610
459 JASNVU010000001.1 GCA030176885_00839 gene open 198422-198649
460 JASNVU010000001.1 GCA030176885_00840 gene open 198789-199622
461 JASNVU010000001.1 GCA030176885_00841 gene open 199710-200252
462 JASNVU010000001.1 GCA030176885_00842 gene open 200309-200710
463 JASNVU010000001.1 GCA030176885_00843 gene open 200711-201334
464 JASNVU010000001.1 GCA030176885_00844 gene open 201433-203949 pepN
465 JASNVU010000001.1 GCA030176885_00845 gene open 203954-204643
466 JASNVU010000001.1 GCA030176885_00846 gene open 204702-205928
467 JASNVU010000001.1 GCA030176885_00847 gene open 205982-207586 nikD
468 JASNVU010000001.1 GCA030176885_00848 gene open 207586-208398
469 JASNVU010000001.1 GCA030176885_00849 gene open 208395-209426
470 JASNVU010000001.1 GCA030176885_00850 gene open 209430-211085
471 JASNVU010000001.1 GCA030176885_00851 gene open 211288-213159
472 JASNVU010000001.1 GCA030176885_00852 gene open 213181-214257
473 JASNVU010000001.1 GCA030176885_00853 gene open 214519-215499 mscS
474 JASNVU010000001.1 GCA030176885_00854 gene open 215500-215883
475 JASNVU010000001.1 GCA030176885_00855 gene open 216017-217108 ald
476 JASNVU010000001.1 GCA030176885_00856 gene open 217366-218004
477 JASNVU010000001.1 GCA030176885_00857 gene open 218047-218457
478 JASNVU010000001.1 GCA030176885_00858 gene open 218472-220142 ettA
479 JASNVU010000001.1 GCA030176885_00859 gene open 220253-220849
480 JASNVU010000001.1 GCA030176885_00860 gene open 221042-223006
481 JASNVU010000001.1 GCA030176885_00861 gene open 223148-224083
482 JASNVU010000001.1 GCA030176885_00863 gene open 224675-225517
483 JASNVU010000001.1 GCA030176885_00864 gene open 225819-226679 cmrA
484 JASNVU010000001.1 GCA030176885_00865 gene open 226676-228220
485 JASNVU010000001.1 GCA030176885_00866 gene open 228382-229023 orn
486 JASNVU010000001.1 GCA030176885_00868 gene open 229177-230121
487 JASNVU010000001.1 GCA030176885_00869 gene open 230142-231347
488 JASNVU010000001.1 GCA030176885_00871 gene open 232198-232548
489 JASNVU010000001.1 GCA030176885_00872 gene open 233478-233744
490 JASNVU010000001.1 GCA030176885_00873 gene open 233890-234279
491 JASNVU010000001.1 GCA030176885_00874 gene open 234269-235669
492 JASNVU010000001.1 GCA030176885_00875 gene open 235669-235911
493 JASNVU010000001.1 GCA030176885_00876 gene open 235983-237026
494 JASNVU010000001.1 GCA030176885_00877 gene open 237023-237826
495 JASNVU010000001.1 GCA030176885_00878 gene open 238007-238246
496 JASNVU010000001.1 GCA030176885_00879 gene open 238230-239765
497 JASNVU010000001.1 GCA030176885_00880 gene open 239765-240058
498 JASNVU010000001.1 GCA030176885_00881 gene open 240058-240390
499 JASNVU010000001.1 GCA030176885_00882 gene open 240401-240844
500 JASNVU010000001.1 GCA030176885_00883 gene open 240847-241269