HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Kingella negevensis (GCA_030181065.1)

Select a Genome:
BAKTA Annotations for GCA_030181065.1
Genome Selected: Kingella negevensis
ContigsBases CDSrRNA tmRNAtRNA
30 2160838 2195 9 1 55
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4533 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:10]    |    Number of Records Found: 4533 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
4501 JARWIG010000014.1 GCA030181065_00586 CDS open 1748-2650 _na     300_aa tspB Neisseria meningitidis TspB protein
4502 JARWIG010000014.1 GCA030181065_00587 CDS open 2628-3113 _na     161_aa hypothetical protein
4503 JARWIG010000014.1 GCA030181065_00588 CDS open 3150-3434 _na     94_aa hypothetical protein
4504 JARWIG010000014.1 GCA030181065_00589 CDS open 3449-3679 _na     76_aa Bacteriophage coat protein B
4505 JARWIG010000014.1 GCA030181065_00590 CDS open 3876-4169 _na     97_aa hypothetical protein
4506 JARWIG010000014.1 GCA030181065_00591 CDS open 4240-5109 _na     289_aa Phasyl DNA replicon protein arp
4507 JARWIG010000014.1 GCA030181065_00584 gene open 349-1431
4508 JARWIG010000014.1 GCA030181065_00585 gene open 1432-1743
4509 JARWIG010000014.1 GCA030181065_00586 gene open 1748-2650 tspB
4510 JARWIG010000014.1 GCA030181065_00587 gene open 2628-3113
4511 JARWIG010000014.1 GCA030181065_00588 gene open 3150-3434
4512 JARWIG010000014.1 GCA030181065_00589 gene open 3449-3679
4513 JARWIG010000014.1 GCA030181065_00590 gene open 3876-4169
4514 JARWIG010000014.1 GCA030181065_00591 gene open 4240-5109
4515 JARWIG010000015.1 GCA030181065_00592 CDS open 292-1911 _na     539_aa shlB Hemolysin transporter protein ShlB
4516 JARWIG010000015.1 GCA030181065_00592 gene open 292-1911 shlB
4517 JARWIG010000016.1 GCA030181065_00593 CDS open 78-728 _na     216_aa Cupin superfamily protein
4518 JARWIG010000016.1 GCA030181065_00594 CDS open 1204-1323 _na     39_aa hypothetical protein
4519 JARWIG010000016.1 GCA030181065_00593 gene open 78-728
4520 JARWIG010000016.1 GCA030181065_00594 gene open 1204-1323
4521 JARWIG010000017.1 repeat_region open 732-943 CRISPR array with 4 repeats of length 28%2C consensus sequence TTTCTAAGCCACCTATGCGGTGGAAAAC and spacer length 32
4522 JARWIG010000018.1 GCA030181065_00595 CDS open 71-406 _na     111_aa HTH cro/C1-type domain-containing protein
4523 JARWIG010000018.1 GCA030181065_00596 CDS open 559-744 _na     61_aa xkdX XkdX family protein
4524 JARWIG010000018.1 GCA030181065_00595 gene open 71-406
4525 JARWIG010000018.1 GCA030181065_00596 gene open 559-744 xkdX
4526 JARWIG010000019.1 GCA030181065_00597 CDS open 76-711 _na     211_aa Transposase
4527 JARWIG010000019.1 GCA030181065_00597 gene open 76-711
4528 JARWIG010000024.1 GCA030181065_00957 CDS open 3-407 _na     134_aa Lipoprotein
4529 JARWIG010000024.1 GCA030181065_00957 gene open 3-407
4530 JARWIG010000025.1 GCA030181065_00958 CDS open 151-351 _na     66_aa hypothetical protein
4531 JARWIG010000025.1 GCA030181065_00958 gene open 151-351
4532 JARWIG010000027.1 GCA030181065_00959 CDS open 2-214 _na     70_aa Tc1-like transposase DDE domain-containing protein
4533 JARWIG010000027.1 GCA030181065_00959 gene open 2-214