HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Kingella negevensis (GCA_030181105.1)

Select a Genome:
BAKTA Annotations for GCA_030181105.1
Genome Selected: Kingella negevensis
ContigsBases CDSrRNA tmRNAtRNA
11 2189528 2219 15 1 60
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4607 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:10]    |    Number of Records Found: 4607 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
4501 JARWIF010000002.1 GCA030181105_02219 gene open 545602-545781
4502 JARWIF010000002.1 GCA030181105_02220 gene open 545847-546602
4503 JARWIF010000002.1 GCA030181105_02221 gene open 546608-547210
4504 JARWIF010000002.1 GCA030181105_02222 gene open 547290-547676
4505 JARWIF010000002.1 GCA030181105_02223 gene open 547696-548178
4506 JARWIF010000002.1 GCA030181105_02224 gene open 548196-548459
4507 JARWIF010000002.1 GCA030181105_02225 gene open 548515-549888
4508 JARWIF010000002.1 GCA030181105_02226 gene open 549965-551029
4509 JARWIF010000002.1 GCA030181105_02227 gene open 551016-552323
4510 JARWIF010000002.1 GCA030181105_02228 gene open 552461-552880
4511 JARWIF010000002.1 GCA030181105_02229 gene open 553151-553459
4512 JARWIF010000002.1 GCA030181105_02230 gene open 553456-553590
4513 JARWIF010000002.1 GCA030181105_02231 gene open 553833-554603
4514 JARWIF010000002.1 GCA030181105_02232 gene open 554694-555155
4515 JARWIF010000002.1 GCA030181105_02233 gene open 555152-555748
4516 JARWIF010000002.1 GCA030181105_02234 gene open 555761-557215
4517 JARWIF010000002.1 GCA030181105_02235 gene open 557216-557794 gpI
4518 JARWIF010000002.1 GCA030181105_02236 gene open 557787-558386
4519 JARWIF010000002.1 GCA030181105_02237 gene open 558387-559283
4520 JARWIF010000002.1 GCA030181105_02238 gene open 559283-561949
4521 JARWIF010000002.1 GCA030181105_02239 gene open 561999-562181
4522 JARWIF010000002.1 GCA030181105_02240 gene open 562349-562639
4523 JARWIF010000002.1 GCA030181105_02241 gene open 562777-563211
4524 JARWIF010000002.1 GCA030181105_02242 gene open 563257-564606 gp29
4525 JARWIF010000002.1 GCA030181105_02243 gene open 564596-564958
4526 JARWIF010000002.1 GCA030181105_02244 gene open 564968-565504
4527 JARWIF010000002.1 GCA030181105_02245 gene open 565501-566136
4528 JARWIF010000002.1 GCA030181105_02246 gene open 565968-566450
4529 JARWIF010000002.1 GCA030181105_02247 gene open 566468-566731
4530 JARWIF010000002.1 GCA030181105_02248 gene open 567014-567241
4531 JARWIF010000002.1 GCA030181105_02249 gene open 567467-571306 glcD
4532 JARWIF010000002.1 GCA030181105_02250 gene open 571388-572275
4533 JARWIF010000002.1 GCA030181105_02251 gene open 572259-573320
4534 JARWIF010000002.1 GCA030181105_02252 gene open 573323-574732
4535 JARWIF010000002.1 GCA030181105_02253 gene open 574784-575260
4536 JARWIF010000002.1 GCA030181105_02254 gene open 575295-575558
4537 JARWIF010000002.1 GCA030181105_02255 gene open 575576-576058
4538 JARWIF010000002.1 GCA030181105_02256 gene open 576426-577676 coaBC
4539 JARWIF010000002.1 GCA030181105_02257 gene open 577771-578271 lptE
4540 JARWIF010000002.1 GCA030181105_02258 gene open 578271-579281 holA
4541 JARWIF010000002.1 GCA030181105_02259 gene open 579348-579776
4542 JARWIF010000002.1 GCA030181105_02260 gene open 579907-582330 lon
4543 JARWIF010000002.1 GCA030181105_02261 gene open 582597-582875
4544 JARWIF010000002.1 GCA030181105_02262 gene open 582924-583583 ung
4545 JARWIF010000002.1 GCA030181105_02263 gene open 583692-584861
4546 JARWIF010000002.1 GCA030181105_02264 gene open 585065-585868 cysE
4547 JARWIF010000002.1 GCA030181105_02265 gene open 585918-586865 trxB
4548 JARWIF010000002.1 GCA030181105_02266 gene open 587039-588268 glp
4549 JARWIF010000002.1 GCA030181105_02267 gene open 588332-589306 moaA
4550 JARWIF010000002.1 GCA030181105_02268 gene open 589309-589869 moaB
4551 JARWIF010000002.1 GCA030181105_02269 gene open 589893-590477
4552 JARWIF010000002.1 GCA030181105_02270 gene open 590610-590825
4553 JARWIF010000002.1 GCA030181105_02271 gene open 590835-591044
4554 JARWIF010000002.1 GCA030181105_02272 gene open 591162-591407
4555 JARWIF010000002.1 GCA030181105_02273 gene open 591409-591837
4556 JARWIF010000002.1 GCA030181105_02274 gene open 591988-592656 degU
4557 JARWIF010000002.1 GCA030181105_02275 gene open 592653-594044
4558 JARWIF010000002.1 GCA030181105_02276 gene open 594148-594540
4559 JARWIF010000002.1 GCA030181105_02277 gene open 594701-596083
4560 JARWIF010000002.1 GCA030181105_02278 gene open 596168-597391 narT
4561 JARWIF010000002.1 GCA030181105_02279 gene open 597585-598268 narI
4562 JARWIF010000002.1 GCA030181105_02280 gene open 598265-598939 narJ
4563 JARWIF010000002.1 GCA030181105_02281 gene open 598942-600501
4564 JARWIF010000002.1 GCA030181105_02282 gene open 600700-600930
4565 JARWIF010000002.1 GCA030181105_02283 gene open 600923-604597
4566 JARWIF010000002.1 GCA030181105_02047 gene open 396858-396933 trnI
4567 JARWIF010000002.1 GCA030181105_02078 gene open 416549-416635 trnL
4568 JARWIF010000002.1 GCA030181105_02183 gene open 512256-512331 trnF
4569 JARWIF010000002.1 GCA030181105_02047 tRNA open 396858-396933 trnI tRNA-Ile2(cat)
4570 JARWIF010000002.1 GCA030181105_02078 tRNA open 416549-416635 trnL tRNA-Leu(cag)
4571 JARWIF010000002.1 GCA030181105_02183 tRNA open 512256-512331 trnF tRNA-Phe(gaa)
4572 JARWIF010000003.1 GCA030181105_02284 gene open 25-136 rrf
4573 JARWIF010000003.1 GCA030181105_02285 gene open 255-3138 rrl
4574 JARWIF010000003.1 GCA030181105_02288 gene open 3878-5418 rrs
4575 JARWIF010000003.1 GCA030181105_02284 rRNA open 25-136 rrf 5S ribosomal RNA
4576 JARWIF010000003.1 GCA030181105_02285 rRNA open 255-3138 rrl 23S ribosomal RNA
4577 JARWIF010000003.1 GCA030181105_02288 rRNA open 3878-5418 rrs 16S ribosomal RNA
4578 JARWIF010000003.1 GCA030181105_02286 gene open 3598-3673 trnA
4579 JARWIF010000003.1 GCA030181105_02287 gene open 3733-3809 trnI
4580 JARWIF010000003.1 GCA030181105_02286 tRNA open 3598-3673 trnA tRNA-Ala(tgc)
4581 JARWIF010000003.1 GCA030181105_02287 tRNA open 3733-3809 trnI tRNA-Ile(gat)
4582 JARWIF010000004.1 GCA030181105_02289 CDS open 259-906 _na     215_aa Phasyl DNA replicon protein arp
4583 JARWIF010000004.1 GCA030181105_02290 CDS open 977-1270 _na     97_aa hypothetical protein
4584 JARWIF010000004.1 GCA030181105_02291 CDS open 1467-1697 _na     76_aa Bacteriophage coat protein B
4585 JARWIF010000004.1 GCA030181105_02292 CDS open 1712-1996 _na     94_aa hypothetical protein
4586 JARWIF010000004.1 GCA030181105_02293 CDS open 2033-2518 _na     161_aa hypothetical protein
4587 JARWIF010000004.1 GCA030181105_02294 CDS open 2496-3398 _na     300_aa tspB Neisseria meningitidis TspB protein
4588 JARWIF010000004.1 GCA030181105_02295 CDS open 3403-3714 _na     103_aa DUF2523 domain-containing protein
4589 JARWIF010000004.1 GCA030181105_02296 CDS open 3715-4797 _na     360_aa Zonular occludens toxin (Zot)
4590 JARWIF010000004.1 GCA030181105_02289 gene open 259-906
4591 JARWIF010000004.1 GCA030181105_02290 gene open 977-1270
4592 JARWIF010000004.1 GCA030181105_02291 gene open 1467-1697
4593 JARWIF010000004.1 GCA030181105_02292 gene open 1712-1996
4594 JARWIF010000004.1 GCA030181105_02293 gene open 2033-2518
4595 JARWIF010000004.1 GCA030181105_02294 gene open 2496-3398 tspB
4596 JARWIF010000004.1 GCA030181105_02295 gene open 3403-3714
4597 JARWIF010000004.1 GCA030181105_02296 gene open 3715-4797
4598 JARWIF010000005.1 repeat_region open 5-282 CRISPR array with 5 repeats of length 28%2C consensus sequence GTTTTCCACCGCATAGGTGGCTTAGAAA and spacer length 32
4599 JARWIF010000005.1 repeat_region open 425-583 CRISPR array with 3 repeats of length 30%2C consensus sequence CGTTTTCCACCGCATAGGTGGCTTAGAAAG and spacer length 30
4600 JARWIF010000006.1 GCA030181105_02297 CDS open 98-589 _na     163_aa Transposase
4601 JARWIF010000006.1 GCA030181105_02297 gene open 98-589
4602 JARWIF010000007.1 GCA030181105_02298 CDS open 149-334 _na     61_aa xkdX XkdX family protein
4603 JARWIF010000007.1 GCA030181105_02299 CDS open 487-822 _na     111_aa HTH cro/C1-type domain-containing protein
4604 JARWIF010000007.1 GCA030181105_02298 gene open 149-334 xkdX
4605 JARWIF010000007.1 GCA030181105_02299 gene open 487-822
4606 JARWIF010000010.1 GCA030181105_01669 CDS open 151-351 _na     66_aa hypothetical protein
4607 JARWIF010000010.1 GCA030181105_01669 gene open 151-351