HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Corynebacterium propinquum (GCA_030228935.1)

Select a Genome:
BAKTA Annotations for GCA_030228935.1
Genome Selected: Corynebacterium propinquum
ContigsBases CDSrRNA tmRNAtRNA
34 2442739 2196 3 1 48
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4509 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:10]    |    Number of Records Found: 4509 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer
Range
(bp)
Show Sequences
(length) NA / AA
BAKTA
Gene
BAKTA
GeneProduct
4501 JASPHT010000022.1 GCA030228935_00880 CDS open 130-1329 _na     399_aa IS1249 family transposase
4502 JASPHT010000022.1 GCA030228935_00880 gene open 130-1329
4503 JASPHT010000023.1 GCA030228935_00881 CDS open 90-668 _na     192_aa hypothetical protein
4504 JASPHT010000023.1 GCA030228935_00881 gene open 90-668
4505 JASPHT010000024.1 GCA030228935_00882 CDS open 77-787 _na     236_aa tnp IS6 family IS1628 transposase
4506 JASPHT010000024.1 GCA030228935_00882 gene open 77-787 tnp
4507 JASPHT010000026.1 GCA030228935_00883 CDS open 74-364 _na     96_aa transposase
4508 JASPHT010000026.1 GCA030228935_00883 gene open 74-364
4509 JASPHT010000029.1 repeat_region open 1-273 CRISPR array with 5 repeats of length 29%2C consensus sequence GGGCTCATCCCCGCATGCGCGGGGAAAAC and spacer length 32