HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Corynebacterium accolens (GCA_030228965.1)

Select a Genome:
BAKTA Annotations for GCA_030228965.1
Genome Selected: Corynebacterium accolens
ContigsBases CDSrRNA tmRNAtRNA
44 2484696 2292 3 1 51
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4704 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:9]    |    Number of Records Found: 4704 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
4001 JASPIK010000013.1 GCA030228965_00282 gene open 56730-57461
4002 JASPIK010000013.1 GCA030228965_00283 gene open 57474-58250
4003 JASPIK010000013.1 GCA030228965_00284 gene open 58296-59396
4004 JASPIK010000013.1 GCA030228965_00285 gene open 59496-60992
4005 JASPIK010000013.1 GCA030228965_00286 gene open 61031-61567
4006 JASPIK010000013.1 GCA030228965_00287 gene open 61573-61884
4007 JASPIK010000013.1 GCA030228965_00288 gene open 62109-64214 sucB
4008 JASPIK010000013.1 GCA030228965_00289 gene open 64513-67356 gcvP
4009 JASPIK010000013.1 GCA030228965_00290 gene open 67359-68471 gcvT
4010 JASPIK010000013.1 GCA030228965_00291 gene open 68517-68909 gcvH
4011 JASPIK010000013.1 GCA030228965_00292 gene open 69027-69830 lipB
4012 JASPIK010000013.1 GCA030228965_00293 gene open 69967-71031 lipA
4013 JASPIK010000013.1 GCA030228965_00294 gene open 71114-71899
4014 JASPIK010000013.1 GCA030228965_00295 gene open 72053-72526
4015 JASPIK010000013.1 GCA030228965_00296 gene open 72645-74078 glnA
4016 JASPIK010000014.1 repeat_region open 48626-48927 CRISPR array with 5 repeats of length 36%2C consensus sequence GCTGGGGTTCAGTTCTCATTACCCCTGATAGACTTC and spacer length 28
4017 JASPIK010000014.1 GCA030228965_00297 CDS open 386-718 _na     110_aa crcB Fluoride ion transporter CrcB
4018 JASPIK010000014.1 GCA030228965_00298 CDS open 898-2229 _na     443_aa DUF445 domain-containing protein
4019 JASPIK010000014.1 GCA030228965_00299 CDS open 2263-2697 _na     144_aa CsbD-like domain-containing protein
4020 JASPIK010000014.1 GCA030228965_00300 CDS open 2703-2993 _na     96_aa DUF2516 domain-containing protein
4021 JASPIK010000014.1 GCA030228965_00301 CDS open 2996-3439 _na     147_aa Deoxyribose-phosphate aldolase
4022 JASPIK010000014.1 GCA030228965_00302 CDS open 3477-4280 _na     267_aa DUF2993 domain-containing protein
4023 JASPIK010000014.1 GCA030228965_00303 CDS open 4330-5139 _na     269_aa Methylase
4024 JASPIK010000014.1 GCA030228965_00304 CDS open 5171-5662 _na     163_aa DUF2505 domain-containing protein
4025 JASPIK010000014.1 GCA030228965_00305 CDS open 5687-6808 _na     373_aa UDP-N-acetylmuramate dehydrogenase
4026 JASPIK010000014.1 GCA030228965_00306 CDS open 7025-7501 _na     158_aa S-ribosylhomocysteine lyase
4027 JASPIK010000014.1 GCA030228965_00307 CDS open 7572-8741 _na     389_aa yihY YihY family protein
4028 JASPIK010000014.1 GCA030228965_00308 CDS open 8808-10325 _na     505_aa AMP-dependent synthetase/ligase domain-containing protein
4029 JASPIK010000014.1 GCA030228965_00309 CDS open 10337-12046 _na     569_aa long-chain-fatty-acid--CoA ligase
4030 JASPIK010000014.1 GCA030228965_00310 CDS open 12117-12686 _na     189_aa Methylated-DNA--protein-cysteine methyltransferase
4031 JASPIK010000014.1 GCA030228965_00311 CDS open 12708-14426 _na     572_aa long-chain-fatty-acid--CoA ligase
4032 JASPIK010000014.1 GCA030228965_00312 CDS open 14493-15758 _na     421_aa mshA D-inositol-3-phosphate glycosyltransferase
4033 JASPIK010000014.1 GCA030228965_00313 CDS open 15800-16546 _na     248_aa phosphoglyceromutase
4034 JASPIK010000014.1 GCA030228965_00314 CDS open 16597-17877 _na     426_aa senX3 Sensor-like histidine kinase SenX3
4035 JASPIK010000014.1 GCA030228965_00315 CDS open 17874-18584 _na     236_aa regX3 Sensory transduction protein RegX3
4036 JASPIK010000014.1 GCA030228965_00316 CDS open 18581-19480 _na     299_aa DUF3109 domain-containing protein
4037 JASPIK010000014.1 GCA030228965_00317 CDS open 19598-20443 _na     281_aa Ppx/GppA phosphatase family
4038 JASPIK010000014.1 GCA030228965_00318 CDS open 20453-21694 _na     413_aa hypothetical protein
4039 JASPIK010000014.1 GCA030228965_00319 CDS open 21776-22567 _na     263_aa proC pyrroline-5-carboxylate reductase
4040 JASPIK010000014.1 GCA030228965_00320 CDS open 22819-23007 _na     62_aa Helix-turn-helix domain-containing protein
4041 JASPIK010000014.1 GCA030228965_00321 CDS open 23283-23384 _na     33_aa 30S ribosomal protein bS22
4042 JASPIK010000014.1 GCA030228965_00322 CDS open 23596-23961 _na     121_aa doxX DoxX family protein
4043 JASPIK010000014.1 GCA030228965_00323 CDS open 24036-25073 _na     345_aa HAD hydrolase%2C family IB
4044 JASPIK010000014.1 GCA030228965_00324 CDS open 25171-25410 _na     79_aa Glutaredoxin family protein
4045 JASPIK010000014.1 GCA030228965_00325 CDS open 25487-26821 _na     444_aa glutamyl-tRNA reductase
4046 JASPIK010000014.1 GCA030228965_00326 CDS open 26822-27718 _na     298_aa hemC hydroxymethylbilane synthase
4047 JASPIK010000014.1 GCA030228965_00327 CDS open 27883-29604 _na     573_aa uroporphyrinogen-III C-methyltransferase
4048 JASPIK010000014.1 GCA030228965_00328 CDS open 29634-30617 _na     327_aa hemB porphobilinogen synthase
4049 JASPIK010000014.1 GCA030228965_00329 CDS open 30627-31457 _na     276_aa hypothetical protein
4050 JASPIK010000014.1 GCA030228965_00330 CDS open 31454-32008 _na     184_aa terC Tellurium resistance protein TerC
4051 JASPIK010000014.1 GCA030228965_00331 CDS open 32192-33226 _na     344_aa hemE uroporphyrinogen decarboxylase
4052 JASPIK010000014.1 GCA030228965_00332 CDS open 33227-34609 _na     460_aa protoporphyrinogen oxidase
4053 JASPIK010000014.1 GCA030228965_00333 CDS open 34951-35997 _na     348_aa HNH nuclease domain-containing protein
4054 JASPIK010000014.1 GCA030228965_00334 CDS open 36113-36922 _na     269_aa 6-phosphogluconate dehydrogenase NADP-binding domain-containing protein
4055 JASPIK010000014.1 GCA030228965_00335 CDS open 37089-38399 _na     436_aa hemL glutamate-1-semialdehyde 2%2C1-aminomutase
4056 JASPIK010000014.1 GCA030228965_00336 CDS open 38436-39044 _na     202_aa Phosphoglycerate mutase
4057 JASPIK010000014.1 GCA030228965_00337 CDS open 39044-39661 _na     205_aa Thioredoxin domain-containing protein
4058 JASPIK010000014.1 GCA030228965_00338 CDS open 39662-40465 _na     267_aa Cytochrome C biogenesis protein transmembrane domain-containing protein
4059 JASPIK010000014.1 GCA030228965_00339 CDS open 40473-42104 _na     543_aa ResB-like domain-containing protein
4060 JASPIK010000014.1 GCA030228965_00340 CDS open 42187-43293 _na     368_aa ccsB c-type cytochrome biogenesis protein CcsB
4061 JASPIK010000014.1 GCA030228965_00341 CDS open 43294-43551 _na     85_aa HTH cro/C1-type domain-containing protein
4062 JASPIK010000014.1 GCA030228965_00342 CDS open 43548-43823 _na     91_aa Secreted protein
4063 JASPIK010000014.1 GCA030228965_00343 CDS open 43862-44185 _na     107_aa DUF4229 domain-containing protein
4064 JASPIK010000014.1 GCA030228965_00344 CDS open 44207-45112 _na     301_aa 1%2C4-dihydroxy-2-naphthoate polyprenyltransferase
4065 JASPIK010000014.1 GCA030228965_00345 CDS open 45168-46325 _na     385_aa menE o-succinylbenzoate--CoA ligase
4066 JASPIK010000014.1 GCA030228965_00346 CDS open 46371-46511 _na     46_aa hypothetical protein
4067 JASPIK010000014.1 GCA030228965_00347 CDS open 46527-47507 _na     326_aa 1%2C4-dihydroxy-2-naphthoyl-CoA synthase
4068 JASPIK010000014.1 GCA030228965_00348 CDS open 47798-48259 _na     153_aa Septicolysin
4069 JASPIK010000014.1 GCA030228965_00349 CDS open 48967-49272 _na     101_aa cas2 CRISPR-associated endonuclease Cas2
4070 JASPIK010000014.1 GCA030228965_00350 CDS open 49280-50194 _na     304_aa cas1 type II CRISPR-associated endonuclease Cas1
4071 JASPIK010000014.1 GCA030228965_00351 CDS open 50199-53498 _na     1099_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
4072 JASPIK010000014.1 GCA030228965_00352 CDS open 53754-54764 _na     336_aa o-succinylbenzoate synthase
4073 JASPIK010000014.1 GCA030228965_00353 CDS open 54826-55371 _na     181_aa osmC OsmC family protein
4074 JASPIK010000014.1 GCA030228965_00354 CDS open 55599-56768 _na     389_aa SsuA/THI5-like domain-containing protein
4075 JASPIK010000014.1 GCA030228965_00355 CDS open 56783-57661 _na     292_aa Nitrate ABC transporter%2C permease
4076 JASPIK010000014.1 GCA030228965_00356 CDS open 57654-58418 _na     254_aa ABC transporter domain-containing protein
4077 JASPIK010000014.1 GCA030228965_00357 CDS open 59668-60357 _na     229_aa IS3 family transposase
4078 JASPIK010000014.1 GCA030228965_00358 CDS open 60341-61252 _na     303_aa eamA EamA domain-containing protein
4079 JASPIK010000014.1 GCA030228965_00359 CDS open 61523-62455 _na     310_aa ATP-grasp domain-containing protein
4080 JASPIK010000014.1 GCA030228965_00360 CDS open 63087-63851 _na     254_aa Amine oxidase domain-containing protein
4081 JASPIK010000014.1 GCA030228965_00361 CDS open 64089-64415 _na     108_aa DDE domain-containing protein
4082 JASPIK010000014.1 GCA030228965_00362 CDS open 64774-65016 _na     80_aa Toxin-antitoxin system%2C toxin component
4083 JASPIK010000014.1 GCA030228965_00297 gene open 386-718 crcB
4084 JASPIK010000014.1 GCA030228965_00298 gene open 898-2229
4085 JASPIK010000014.1 GCA030228965_00299 gene open 2263-2697
4086 JASPIK010000014.1 GCA030228965_00300 gene open 2703-2993
4087 JASPIK010000014.1 GCA030228965_00301 gene open 2996-3439
4088 JASPIK010000014.1 GCA030228965_00302 gene open 3477-4280
4089 JASPIK010000014.1 GCA030228965_00303 gene open 4330-5139
4090 JASPIK010000014.1 GCA030228965_00304 gene open 5171-5662
4091 JASPIK010000014.1 GCA030228965_00305 gene open 5687-6808
4092 JASPIK010000014.1 GCA030228965_00306 gene open 7025-7501
4093 JASPIK010000014.1 GCA030228965_00307 gene open 7572-8741 yihY
4094 JASPIK010000014.1 GCA030228965_00308 gene open 8808-10325
4095 JASPIK010000014.1 GCA030228965_00309 gene open 10337-12046
4096 JASPIK010000014.1 GCA030228965_00310 gene open 12117-12686
4097 JASPIK010000014.1 GCA030228965_00311 gene open 12708-14426
4098 JASPIK010000014.1 GCA030228965_00312 gene open 14493-15758 mshA
4099 JASPIK010000014.1 GCA030228965_00313 gene open 15800-16546
4100 JASPIK010000014.1 GCA030228965_00314 gene open 16597-17877 senX3
4101 JASPIK010000014.1 GCA030228965_00315 gene open 17874-18584 regX3
4102 JASPIK010000014.1 GCA030228965_00316 gene open 18581-19480
4103 JASPIK010000014.1 GCA030228965_00317 gene open 19598-20443
4104 JASPIK010000014.1 GCA030228965_00318 gene open 20453-21694
4105 JASPIK010000014.1 GCA030228965_00319 gene open 21776-22567 proC
4106 JASPIK010000014.1 GCA030228965_00320 gene open 22819-23007
4107 JASPIK010000014.1 GCA030228965_00321 gene open 23283-23384
4108 JASPIK010000014.1 GCA030228965_00322 gene open 23596-23961 doxX
4109 JASPIK010000014.1 GCA030228965_00323 gene open 24036-25073
4110 JASPIK010000014.1 GCA030228965_00324 gene open 25171-25410
4111 JASPIK010000014.1 GCA030228965_00325 gene open 25487-26821
4112 JASPIK010000014.1 GCA030228965_00326 gene open 26822-27718 hemC
4113 JASPIK010000014.1 GCA030228965_00327 gene open 27883-29604
4114 JASPIK010000014.1 GCA030228965_00328 gene open 29634-30617 hemB
4115 JASPIK010000014.1 GCA030228965_00329 gene open 30627-31457
4116 JASPIK010000014.1 GCA030228965_00330 gene open 31454-32008 terC
4117 JASPIK010000014.1 GCA030228965_00331 gene open 32192-33226 hemE
4118 JASPIK010000014.1 GCA030228965_00332 gene open 33227-34609
4119 JASPIK010000014.1 GCA030228965_00333 gene open 34951-35997
4120 JASPIK010000014.1 GCA030228965_00334 gene open 36113-36922
4121 JASPIK010000014.1 GCA030228965_00335 gene open 37089-38399 hemL
4122 JASPIK010000014.1 GCA030228965_00336 gene open 38436-39044
4123 JASPIK010000014.1 GCA030228965_00337 gene open 39044-39661
4124 JASPIK010000014.1 GCA030228965_00338 gene open 39662-40465
4125 JASPIK010000014.1 GCA030228965_00339 gene open 40473-42104
4126 JASPIK010000014.1 GCA030228965_00340 gene open 42187-43293 ccsB
4127 JASPIK010000014.1 GCA030228965_00341 gene open 43294-43551
4128 JASPIK010000014.1 GCA030228965_00342 gene open 43548-43823
4129 JASPIK010000014.1 GCA030228965_00343 gene open 43862-44185
4130 JASPIK010000014.1 GCA030228965_00344 gene open 44207-45112
4131 JASPIK010000014.1 GCA030228965_00345 gene open 45168-46325 menE
4132 JASPIK010000014.1 GCA030228965_00346 gene open 46371-46511
4133 JASPIK010000014.1 GCA030228965_00347 gene open 46527-47507
4134 JASPIK010000014.1 GCA030228965_00348 gene open 47798-48259
4135 JASPIK010000014.1 GCA030228965_00349 gene open 48967-49272 cas2
4136 JASPIK010000014.1 GCA030228965_00350 gene open 49280-50194 cas1
4137 JASPIK010000014.1 GCA030228965_00351 gene open 50199-53498 cas9
4138 JASPIK010000014.1 GCA030228965_00352 gene open 53754-54764
4139 JASPIK010000014.1 GCA030228965_00353 gene open 54826-55371 osmC
4140 JASPIK010000014.1 GCA030228965_00354 gene open 55599-56768
4141 JASPIK010000014.1 GCA030228965_00355 gene open 56783-57661
4142 JASPIK010000014.1 GCA030228965_00356 gene open 57654-58418
4143 JASPIK010000014.1 GCA030228965_00357 gene open 59668-60357
4144 JASPIK010000014.1 GCA030228965_00358 gene open 60341-61252 eamA
4145 JASPIK010000014.1 GCA030228965_00359 gene open 61523-62455
4146 JASPIK010000014.1 GCA030228965_00360 gene open 63087-63851
4147 JASPIK010000014.1 GCA030228965_00361 gene open 64089-64415
4148 JASPIK010000014.1 GCA030228965_00362 gene open 64774-65016
4149 JASPIK010000015.1 GCA030228965_00363 CDS open 148-540 _na     130_aa hypothetical protein
4150 JASPIK010000015.1 GCA030228965_00364 CDS open 644-1351 _na     235_aa DUF4232 domain-containing protein
4151 JASPIK010000015.1 GCA030228965_00365 CDS open 1548-2330 _na     260_aa ABC transporter domain-containing protein
4152 JASPIK010000015.1 GCA030228965_00366 CDS open 2330-3241 _na     303_aa Fe/B12 periplasmic-binding domain-containing protein
4153 JASPIK010000015.1 GCA030228965_00367 CDS open 3248-4291 _na     347_aa Iron ABC transporter permease
4154 JASPIK010000015.1 GCA030228965_00368 CDS open 4291-5394 _na     367_aa Iron ABC transporter permease
4155 JASPIK010000015.1 GCA030228965_00369 CDS open 5520-5804 _na     94_aa hypothetical protein
4156 JASPIK010000015.1 GCA030228965_00370 CDS open 5807-6031 _na     74_aa Integrase catalytic domain-containing protein
4157 JASPIK010000015.1 GCA030228965_00371 CDS open 6068-6553 _na     161_aa IS3 family transposase
4158 JASPIK010000015.1 GCA030228965_00372 CDS open 7000-7152 _na     50_aa hypothetical protein
4159 JASPIK010000015.1 GCA030228965_00373 CDS open 7520-7660 _na     46_aa hypothetical protein
4160 JASPIK010000015.1 GCA030228965_00374 CDS open 7784-8722 _na     312_aa IS3 family transposase
4161 JASPIK010000015.1 GCA030228965_00375 CDS open 8735-9001 _na     88_aa DUF4340 domain-containing protein
4162 JASPIK010000015.1 GCA030228965_00376 CDS open 9247-9891 _na     214_aa DUF6973 domain-containing protein
4163 JASPIK010000015.1 GCA030228965_00377 CDS open 9909-10202 _na     97_aa Major facilitator superfamily (MFS) profile domain-containing protein
4164 JASPIK010000015.1 GCA030228965_00379 CDS open 10796-13465 _na     889_aa polA DNA polymerase I
4165 JASPIK010000015.1 GCA030228965_00380 CDS open 13470-14408 _na     312_aa Winged helix DNA-binding domain-containing protein
4166 JASPIK010000015.1 GCA030228965_00381 CDS open 14447-14818 _na     123_aa hypothetical protein
4167 JASPIK010000015.1 GCA030228965_00382 CDS open 14782-15249 _na     155_aa RDD domain-containing protein
4168 JASPIK010000015.1 GCA030228965_00383 CDS open 15260-15991 _na     243_aa Methyltransferase type 11 domain-containing protein
4169 JASPIK010000015.1 GCA030228965_00384 CDS open 16241-17704 _na     487_aa rpsA 30S ribosomal protein S1
4170 JASPIK010000015.1 GCA030228965_00385 CDS open 18018-20066 _na     682_aa PTS system%2C glucose subfamily%2C IIA component
4171 JASPIK010000015.1 GCA030228965_00386 CDS open 20140-20742 _na     200_aa coaE dephospho-CoA kinase
4172 JASPIK010000015.1 GCA030228965_00387 CDS open 20932-21180 _na     82_aa hypothetical protein
4173 JASPIK010000015.1 GCA030228965_00388 CDS open 21220-23313 _na     697_aa uvrB excinuclease ABC subunit UvrB
4174 JASPIK010000015.1 GCA030228965_00389 CDS open 23465-23917 _na     150_aa uspA UspA domain-containing protein
4175 JASPIK010000015.1 GCA030228965_00390 CDS open 24001-24441 _na     146_aa uspA UspA domain-containing protein
4176 JASPIK010000015.1 GCA030228965_00391 CDS open 24531-26789 _na     752_aa UvrD-like helicase ATP-binding domain-containing protein
4177 JASPIK010000015.1 GCA030228965_00392 CDS open 26931-27947 _na     338_aa doxX DoxX family protein
4178 JASPIK010000015.1 GCA030228965_00393 CDS open 28025-28627 _na     200_aa Metallo-beta-lactamase domain-containing protein
4179 JASPIK010000015.1 GCA030228965_00394 CDS open 28692-31532 _na     946_aa uvrA excinuclease ABC subunit UvrA
4180 JASPIK010000015.1 GCA030228965_00395 CDS open 31598-32452 _na     284_aa S-adenosylmethionine synthetase
4181 JASPIK010000015.1 GCA030228965_00396 CDS open 32799-33245 _na     148_aa infC translation initiation factor IF-3
4182 JASPIK010000015.1 GCA030228965_00397 CDS open 33282-33476 _na     64_aa rpmI 50S ribosomal protein L35
4183 JASPIK010000015.1 GCA030228965_00398 CDS open 33533-33916 _na     127_aa rplT 50S ribosomal protein L20
4184 JASPIK010000015.1 GCA030228965_00399 CDS open 34080-34505 _na     141_aa TM2 domain-containing protein
4185 JASPIK010000015.1 GCA030228965_00400 CDS open 34599-35405 _na     268_aa RNA 2-O ribose methyltransferase substrate binding domain-containing protein
4186 JASPIK010000015.1 GCA030228965_00401 CDS open 35526-36572 _na     348_aa pheS phenylalanine--tRNA ligase subunit alpha
4187 JASPIK010000015.1 GCA030228965_00402 CDS open 36596-39112 _na     838_aa pheT phenylalanine--tRNA ligase subunit beta
4188 JASPIK010000015.1 GCA030228965_00403 CDS open 39315-40358 _na     347_aa argC N-acetyl-gamma-glutamyl-phosphate reductase
4189 JASPIK010000015.1 GCA030228965_00404 CDS open 40387-41556 _na     389_aa argJ bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ
4190 JASPIK010000015.1 GCA030228965_00405 CDS open 41565-42500 _na     311_aa Acetylglutamate kinase
4191 JASPIK010000015.1 GCA030228965_00406 CDS open 42497-43675 _na     392_aa acetylornithine transaminase
4192 JASPIK010000015.1 GCA030228965_00407 CDS open 43672-44592 _na     306_aa argF ornithine carbamoyltransferase
4193 JASPIK010000015.1 GCA030228965_00408 CDS open 44595-45077 _na     160_aa arginine repressor
4194 JASPIK010000015.1 GCA030228965_00409 CDS open 45156-46376 _na     406_aa argininosuccinate synthase
4195 JASPIK010000015.1 GCA030228965_00410 CDS open 46383-47813 _na     476_aa argH argininosuccinate lyase
4196 JASPIK010000015.1 GCA030228965_00411 CDS open 48030-49547 _na     505_aa Amino acid permease/ SLC12A domain-containing protein
4197 JASPIK010000015.1 GCA030228965_00412 CDS open 49561-50598 _na     345_aa Ornithine cyclodeaminase
4198 JASPIK010000015.1 GCA030228965_00413 CDS open 50736-51893 _na     385_aa thiF ThiF family adenylyltransferase
4199 JASPIK010000015.1 GCA030228965_00414 CDS open 51893-52675 _na     260_aa Thiazole synthase
4200 JASPIK010000015.1 GCA030228965_00415 CDS open 52685-52888 _na     67_aa thiS sulfur carrier protein ThiS
4201 JASPIK010000015.1 GCA030228965_00416 CDS open 52913-54034 _na     373_aa thiO glycine oxidase ThiO
4202 JASPIK010000015.1 GCA030228965_00417 CDS open 54027-54701 _na     224_aa thiamine phosphate synthase
4203 JASPIK010000015.1 GCA030228965_00418 CDS open 54691-56622 _na     643_aa thiC phosphomethylpyrimidine synthase ThiC
4204 JASPIK010000015.1 GCA030228965_00419 CDS open 56867-57034 _na     55_aa UPF0434 protein jk0859
4205 JASPIK010000015.1 GCA030228965_00420 CDS open 57089-58375 _na     428_aa tyrS tyrosine--tRNA ligase
4206 JASPIK010000015.1 GCA030228965_00363 gene open 148-540
4207 JASPIK010000015.1 GCA030228965_00364 gene open 644-1351
4208 JASPIK010000015.1 GCA030228965_00365 gene open 1548-2330
4209 JASPIK010000015.1 GCA030228965_00366 gene open 2330-3241
4210 JASPIK010000015.1 GCA030228965_00367 gene open 3248-4291
4211 JASPIK010000015.1 GCA030228965_00368 gene open 4291-5394
4212 JASPIK010000015.1 GCA030228965_00369 gene open 5520-5804
4213 JASPIK010000015.1 GCA030228965_00370 gene open 5807-6031
4214 JASPIK010000015.1 GCA030228965_00371 gene open 6068-6553
4215 JASPIK010000015.1 GCA030228965_00372 gene open 7000-7152
4216 JASPIK010000015.1 GCA030228965_00373 gene open 7520-7660
4217 JASPIK010000015.1 GCA030228965_00374 gene open 7784-8722
4218 JASPIK010000015.1 GCA030228965_00375 gene open 8735-9001
4219 JASPIK010000015.1 GCA030228965_00376 gene open 9247-9891
4220 JASPIK010000015.1 GCA030228965_00377 gene open 9909-10202
4221 JASPIK010000015.1 GCA030228965_00379 gene open 10796-13465 polA
4222 JASPIK010000015.1 GCA030228965_00380 gene open 13470-14408
4223 JASPIK010000015.1 GCA030228965_00381 gene open 14447-14818
4224 JASPIK010000015.1 GCA030228965_00382 gene open 14782-15249
4225 JASPIK010000015.1 GCA030228965_00383 gene open 15260-15991
4226 JASPIK010000015.1 GCA030228965_00384 gene open 16241-17704 rpsA
4227 JASPIK010000015.1 GCA030228965_00385 gene open 18018-20066
4228 JASPIK010000015.1 GCA030228965_00386 gene open 20140-20742 coaE
4229 JASPIK010000015.1 GCA030228965_00387 gene open 20932-21180
4230 JASPIK010000015.1 GCA030228965_00388 gene open 21220-23313 uvrB
4231 JASPIK010000015.1 GCA030228965_00389 gene open 23465-23917 uspA
4232 JASPIK010000015.1 GCA030228965_00390 gene open 24001-24441 uspA
4233 JASPIK010000015.1 GCA030228965_00391 gene open 24531-26789
4234 JASPIK010000015.1 GCA030228965_00392 gene open 26931-27947 doxX
4235 JASPIK010000015.1 GCA030228965_00393 gene open 28025-28627
4236 JASPIK010000015.1 GCA030228965_00394 gene open 28692-31532 uvrA
4237 JASPIK010000015.1 GCA030228965_00395 gene open 31598-32452
4238 JASPIK010000015.1 GCA030228965_00396 gene open 32799-33245 infC
4239 JASPIK010000015.1 GCA030228965_00397 gene open 33282-33476 rpmI
4240 JASPIK010000015.1 GCA030228965_00398 gene open 33533-33916 rplT
4241 JASPIK010000015.1 GCA030228965_00399 gene open 34080-34505
4242 JASPIK010000015.1 GCA030228965_00400 gene open 34599-35405
4243 JASPIK010000015.1 GCA030228965_00401 gene open 35526-36572 pheS
4244 JASPIK010000015.1 GCA030228965_00402 gene open 36596-39112 pheT
4245 JASPIK010000015.1 GCA030228965_00403 gene open 39315-40358 argC
4246 JASPIK010000015.1 GCA030228965_00404 gene open 40387-41556 argJ
4247 JASPIK010000015.1 GCA030228965_00405 gene open 41565-42500
4248 JASPIK010000015.1 GCA030228965_00406 gene open 42497-43675
4249 JASPIK010000015.1 GCA030228965_00407 gene open 43672-44592 argF
4250 JASPIK010000015.1 GCA030228965_00408 gene open 44595-45077
4251 JASPIK010000015.1 GCA030228965_00409 gene open 45156-46376
4252 JASPIK010000015.1 GCA030228965_00410 gene open 46383-47813 argH
4253 JASPIK010000015.1 GCA030228965_00411 gene open 48030-49547
4254 JASPIK010000015.1 GCA030228965_00412 gene open 49561-50598
4255 JASPIK010000015.1 GCA030228965_00413 gene open 50736-51893 thiF
4256 JASPIK010000015.1 GCA030228965_00414 gene open 51893-52675
4257 JASPIK010000015.1 GCA030228965_00415 gene open 52685-52888 thiS
4258 JASPIK010000015.1 GCA030228965_00416 gene open 52913-54034 thiO
4259 JASPIK010000015.1 GCA030228965_00417 gene open 54027-54701
4260 JASPIK010000015.1 GCA030228965_00418 gene open 54691-56622 thiC
4261 JASPIK010000015.1 GCA030228965_00419 gene open 56867-57034
4262 JASPIK010000015.1 GCA030228965_00420 gene open 57089-58375 tyrS
4263 JASPIK010000015.1 GCA030228965_00378 gene open 10599-10672 trnL
4264 JASPIK010000015.1 GCA030228965_00378 tRNA open 10599-10672 trnL tRNA-Leu(caa)
4265 JASPIK010000016.1 GCA030228965_00438 gene open 17484-17939 RNaseP_bact_a
4266 JASPIK010000016.1 GCA030228965_00438 ncRNA open 17484-17939 Bacterial RNase P class A
4267 JASPIK010000016.1 GCA030228965_00421 CDS open 376-1263 _na     295_aa Voltage-dependent anion channel
4268 JASPIK010000016.1 GCA030228965_00422 CDS open 1294-1668 _na     124_aa hypothetical protein
4269 JASPIK010000016.1 GCA030228965_00423 CDS open 1665-2210 _na     181_aa Nudix hydrolase domain-containing protein
4270 JASPIK010000016.1 GCA030228965_00424 CDS open 2241-3086 _na     281_aa Peptidase S1 domain-containing protein
4271 JASPIK010000016.1 GCA030228965_00425 CDS open 3061-3207 _na     48_aa Cell division protein
4272 JASPIK010000016.1 GCA030228965_00426 CDS open 3215-4657 _na     480_aa thrC threonine synthase
4273 JASPIK010000016.1 GCA030228965_00427 CDS open 4741-6003 _na     420_aa Major facilitator superfamily (MFS) profile domain-containing protein
4274 JASPIK010000016.1 GCA030228965_00428 CDS open 6008-6784 _na     258_aa AAA+ ATPase domain-containing protein
4275 JASPIK010000016.1 GCA030228965_00429 CDS open 6833-7063 _na     76_aa hypothetical protein
4276 JASPIK010000016.1 GCA030228965_00430 CDS open 7189-7692 _na     167_aa LytR/CpsA/Psr regulator C-terminal domain-containing protein
4277 JASPIK010000016.1 GCA030228965_00431 CDS open 7658-8020 _na     120_aa Amphi-Trp domain-containing protein
4278 JASPIK010000016.1 GCA030228965_00432 CDS open 8117-11176 _na     1019_aa bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase
4279 JASPIK010000016.1 GCA030228965_00433 CDS open 11184-12521 _na     445_aa glnA type I glutamate--ammonia ligase
4280 JASPIK010000016.1 GCA030228965_00434 CDS open 12717-13757 _na     346_aa DUF2786 domain-containing protein
4281 JASPIK010000016.1 GCA030228965_00435 CDS open 13933-15690 _na     585_aa CHAD domain-containing protein
4282 JASPIK010000016.1 GCA030228965_00436 CDS open 15760-15954 _na     64_aa SPOR domain-containing protein
4283 JASPIK010000016.1 GCA030228965_00437 CDS open 16206-17480 _na     424_aa Galactokinase N-terminal domain-containing protein
4284 JASPIK010000016.1 GCA030228965_00439 CDS open 18008-19072 _na     354_aa adhP alcohol dehydrogenase AdhP
4285 JASPIK010000016.1 GCA030228965_00440 CDS open 19405-20601 _na     398_aa bifunctional RNase H/acid phosphatase
4286 JASPIK010000016.1 GCA030228965_00441 CDS open 20598-21317 _na     239_aa C4-type zinc ribbon domain-containing protein
4287 JASPIK010000016.1 GCA030228965_00442 CDS open 21318-22460 _na     380_aa Nif3-like dinuclear metal center hexameric protein
4288 JASPIK010000016.1 GCA030228965_00443 CDS open 22554-23045 _na     163_aa protein-tyrosine-phosphatase
4289 JASPIK010000016.1 GCA030228965_00444 CDS open 23056-24021 _na     321_aa SURF1-like protein
4290 JASPIK010000016.1 GCA030228965_00446 CDS open 24270-24668 _na     132_aa DUF3052 domain-containing protein
4291 JASPIK010000016.1 GCA030228965_00447 CDS open 25027-27771 _na     914_aa aceE pyruvate dehydrogenase (acetyl-transferring)%2C homodimeric type
4292 JASPIK010000016.1 GCA030228965_00448 CDS open 27925-28224 _na     99_aa Acyl carrier protein
4293 JASPIK010000016.1 GCA030228965_00449 CDS open 28221-29009 _na     262_aa TIGR01457 family HAD hydrolase
4294 JASPIK010000016.1 GCA030228965_00450 CDS open 29086-29502 _na     138_aa hypothetical protein
4295 JASPIK010000016.1 GCA030228965_00451 CDS open 30119-30235 _na     38_aa hypothetical protein
4296 JASPIK010000016.1 GCA030228965_00452 CDS open 30319-31146 _na     275_aa Beta-lactamase-related domain-containing protein
4297 JASPIK010000016.1 GCA030228965_00453 CDS open 31327-32418 _na     363_aa NADH:flavin oxidoreductase/NADH oxidase N-terminal domain-containing protein
4298 JASPIK010000016.1 GCA030228965_00454 CDS open 32590-34188 _na     532_aa mscS Mechanosensitive ion channel MscS domain-containing protein
4299 JASPIK010000016.1 GCA030228965_00455 CDS open 34296-35402 _na     368_aa Glycine transporter domain-containing protein
4300 JASPIK010000016.1 GCA030228965_00456 CDS open 35463-36005 _na     180_aa DUF3558 domain-containing protein
4301 JASPIK010000016.1 GCA030228965_00458 CDS open 36250-36690 _na     146_aa DUF5067 domain-containing protein
4302 JASPIK010000016.1 GCA030228965_00459 CDS open 36778-37605 _na     275_aa Ascorbate-specific PTS system EIIA component
4303 JASPIK010000016.1 GCA030228965_00460 CDS open 37616-39205 _na     529_aa Ascorbate-specific PTS system EIIC component
4304 JASPIK010000016.1 GCA030228965_00461 CDS open 39360-39779 _na     139_aa Organic hydroperoxide resistance protein
4305 JASPIK010000016.1 GCA030228965_00462 CDS open 39905-41374 _na     489_aa DUF3375 domain-containing protein
4306 JASPIK010000016.1 GCA030228965_00463 CDS open 41374-42024 _na     216_aa DUF4194 domain-containing protein
4307 JASPIK010000016.1 GCA030228965_00464 CDS open 42017-45388 _na     1123_aa ATP-binding protein
4308 JASPIK010000016.1 GCA030228965_00465 CDS open 45375-46508 _na     377_aa jetD Wadjet protein JetD C-terminal domain-containing protein
4309 JASPIK010000016.1 GCA030228965_00421 gene open 376-1263
4310 JASPIK010000016.1 GCA030228965_00422 gene open 1294-1668
4311 JASPIK010000016.1 GCA030228965_00423 gene open 1665-2210
4312 JASPIK010000016.1 GCA030228965_00424 gene open 2241-3086
4313 JASPIK010000016.1 GCA030228965_00425 gene open 3061-3207
4314 JASPIK010000016.1 GCA030228965_00426 gene open 3215-4657 thrC
4315 JASPIK010000016.1 GCA030228965_00427 gene open 4741-6003
4316 JASPIK010000016.1 GCA030228965_00428 gene open 6008-6784
4317 JASPIK010000016.1 GCA030228965_00429 gene open 6833-7063
4318 JASPIK010000016.1 GCA030228965_00430 gene open 7189-7692
4319 JASPIK010000016.1 GCA030228965_00431 gene open 7658-8020
4320 JASPIK010000016.1 GCA030228965_00432 gene open 8117-11176
4321 JASPIK010000016.1 GCA030228965_00433 gene open 11184-12521 glnA
4322 JASPIK010000016.1 GCA030228965_00434 gene open 12717-13757
4323 JASPIK010000016.1 GCA030228965_00435 gene open 13933-15690
4324 JASPIK010000016.1 GCA030228965_00436 gene open 15760-15954
4325 JASPIK010000016.1 GCA030228965_00437 gene open 16206-17480
4326 JASPIK010000016.1 GCA030228965_00439 gene open 18008-19072 adhP
4327 JASPIK010000016.1 GCA030228965_00440 gene open 19405-20601
4328 JASPIK010000016.1 GCA030228965_00441 gene open 20598-21317
4329 JASPIK010000016.1 GCA030228965_00442 gene open 21318-22460
4330 JASPIK010000016.1 GCA030228965_00443 gene open 22554-23045
4331 JASPIK010000016.1 GCA030228965_00444 gene open 23056-24021
4332 JASPIK010000016.1 GCA030228965_00446 gene open 24270-24668
4333 JASPIK010000016.1 GCA030228965_00447 gene open 25027-27771 aceE
4334 JASPIK010000016.1 GCA030228965_00448 gene open 27925-28224
4335 JASPIK010000016.1 GCA030228965_00449 gene open 28221-29009
4336 JASPIK010000016.1 GCA030228965_00450 gene open 29086-29502
4337 JASPIK010000016.1 GCA030228965_00451 gene open 30119-30235
4338 JASPIK010000016.1 GCA030228965_00452 gene open 30319-31146
4339 JASPIK010000016.1 GCA030228965_00453 gene open 31327-32418
4340 JASPIK010000016.1 GCA030228965_00454 gene open 32590-34188 mscS
4341 JASPIK010000016.1 GCA030228965_00455 gene open 34296-35402
4342 JASPIK010000016.1 GCA030228965_00456 gene open 35463-36005
4343 JASPIK010000016.1 GCA030228965_00458 gene open 36250-36690
4344 JASPIK010000016.1 GCA030228965_00459 gene open 36778-37605
4345 JASPIK010000016.1 GCA030228965_00460 gene open 37616-39205
4346 JASPIK010000016.1 GCA030228965_00461 gene open 39360-39779
4347 JASPIK010000016.1 GCA030228965_00462 gene open 39905-41374
4348 JASPIK010000016.1 GCA030228965_00463 gene open 41374-42024
4349 JASPIK010000016.1 GCA030228965_00464 gene open 42017-45388
4350 JASPIK010000016.1 GCA030228965_00465 gene open 45375-46508 jetD
4351 JASPIK010000016.1 GCA030228965_00445 gene open 24127-24202 trnV
4352 JASPIK010000016.1 GCA030228965_00457 gene open 36048-36121 trnI
4353 JASPIK010000016.1 GCA030228965_00445 tRNA open 24127-24202 trnV tRNA-Val(tac)
4354 JASPIK010000016.1 GCA030228965_00457 tRNA open 36048-36121 trnI tRNA-Ile2(cat)
4355 JASPIK010000017.1 GCA030228965_00466 CDS open 242-610 _na     122_aa DUF1700 domain-containing protein
4356 JASPIK010000017.1 GCA030228965_00467 CDS open 612-938 _na     108_aa padR Transcription regulator PadR N-terminal domain-containing protein
4357 JASPIK010000017.1 GCA030228965_00468 CDS open 1027-1164 _na     45_aa hypothetical protein
4358 JASPIK010000017.1 GCA030228965_00469 CDS open 1409-1996 _na     195_aa Phosphotyrosine protein phosphatase I domain-containing protein
4359 JASPIK010000017.1 GCA030228965_00470 CDS open 2163-4010 _na     615_aa aminodeoxychorismate synthase
4360 JASPIK010000017.1 GCA030228965_00471 CDS open 4007-4759 _na     250_aa Aminotransferase class IV
4361 JASPIK010000017.1 GCA030228965_00472 CDS open 4862-5791 _na     309_aa Alpha/beta hydrolase fold-3 domain-containing protein
4362 JASPIK010000017.1 GCA030228965_00473 CDS open 5815-6030 _na     71_aa hypothetical protein
4363 JASPIK010000017.1 GCA030228965_00474 CDS open 6093-7289 _na     398_aa glf UDP-galactopyranose mutase
4364 JASPIK010000017.1 GCA030228965_00475 CDS open 7447-9345 _na     632_aa Peptidoglycan recognition protein family domain-containing protein
4365 JASPIK010000017.1 GCA030228965_00476 CDS open 9368-10198 _na     276_aa HAD hydrolase%2C family IIB
4366 JASPIK010000017.1 GCA030228965_00477 CDS open 10221-11768 _na     515_aa glpK glycerol kinase GlpK
4367 JASPIK010000017.1 GCA030228965_00478 CDS open 11799-12536 _na     245_aa Glycerol uptake facilitator protein
4368 JASPIK010000017.1 GCA030228965_00479 CDS open 12549-14285 _na     578_aa Glycerol-3-phosphate dehydrogenase
4369 JASPIK010000017.1 GCA030228965_00480 CDS open 14574-16205 _na     543_aa Phospholipid/glycerol acyltransferase domain-containing protein
4370 JASPIK010000017.1 GCA030228965_00481 CDS open 16233-17489 _na     418_aa serS serine--tRNA ligase
4371 JASPIK010000017.1 GCA030228965_00482 CDS open 17555-18304 _na     249_aa HTH gntR-type domain-containing protein
4372 JASPIK010000017.1 GCA030228965_00483 CDS open 18332-19381 _na     349_aa Septum formation-related domain-containing protein
4373 JASPIK010000017.1 GCA030228965_00484 CDS open 19382-19729 _na     115_aa Metallopeptidase family protein
4374 JASPIK010000017.1 GCA030228965_00485 CDS open 19726-20379 _na     217_aa Phosphoglycerate mutase (2%2C3-diphosphoglycerate-dependent)
4375 JASPIK010000017.1 GCA030228965_00486 CDS open 20389-21297 _na     302_aa pheA prephenate dehydratase
4376 JASPIK010000017.1 GCA030228965_00487 CDS open 21331-22467 _na     378_aa Amidase domain-containing protein
4377 JASPIK010000017.1 GCA030228965_00488 CDS open 22464-23174 _na     236_aa CAAX amino terminal protease
4378 JASPIK010000017.1 GCA030228965_00489 CDS open 23234-24529 _na     431_aa Cell envelope-related transcriptional attenuator domain-containing protein
4379 JASPIK010000017.1 GCA030228965_00490 CDS open 24815-25735 _na     306_aa DUF5926 domain-containing protein
4380 JASPIK010000017.1 GCA030228965_00491 CDS open 25756-26460 _na     234_aa GP-PDE domain-containing protein
4381 JASPIK010000017.1 GCA030228965_00492 CDS open 26460-27407 _na     315_aa L-lactate dehydrogenase
4382 JASPIK010000017.1 GCA030228965_00493 CDS open 27495-29237 _na     580_aa Alpha/beta-hydrolase catalytic domain-containing protein
4383 JASPIK010000017.1 GCA030228965_00494 CDS open 29234-29881 _na     215_aa msrA Peptide methionine sulfoxide reductase MsrA
4384 JASPIK010000017.1 GCA030228965_00495 CDS open 30046-30648 _na     200_aa Superoxide dismutase
4385 JASPIK010000017.1 GCA030228965_00496 CDS open 30774-31925 _na     383_aa Major facilitator superfamily (MFS) profile domain-containing protein
4386 JASPIK010000017.1 GCA030228965_00497 CDS open 31936-33234 _na     432_aa Copper oxidase
4387 JASPIK010000017.1 GCA030228965_00498 CDS open 33231-34664 _na     477_aa yprB YprB ribonuclease H-like domain-containing protein
4388 JASPIK010000017.1 GCA030228965_00499 CDS open 34733-35365 _na     210_aa DUF6474 domain-containing protein
4389 JASPIK010000017.1 GCA030228965_00500 CDS open 35551-35862 _na     103_aa Lsr2 family protein
4390 JASPIK010000017.1 GCA030228965_00501 CDS open 35867-36505 _na     212_aa Response regulatory domain-containing protein
4391 JASPIK010000017.1 GCA030228965_00502 CDS open 36543-37706 _na     387_aa nreB Oxygen sensor histidine kinase NreB
4392 JASPIK010000017.1 GCA030228965_00503 CDS open 37735-38235 _na     166_aa DUF2020 domain-containing protein
4393 JASPIK010000017.1 GCA030228965_00504 CDS open 38232-38384 _na     50_aa Secreted protein
4394 JASPIK010000017.1 GCA030228965_00505 CDS open 38384-39046 _na     220_aa Sortase
4395 JASPIK010000017.1 GCA030228965_00506 CDS open 39090-40034 _na     314_aa yidC Membrane protein insertase YidC
4396 JASPIK010000017.1 GCA030228965_00507 CDS open 39991-40599 _na     202_aa HTH tetR-type domain-containing protein
4397 JASPIK010000017.1 GCA030228965_00508 CDS open 40678-40929 _na     83_aa Major facilitator superfamily (MFS) profile domain-containing protein
4398 JASPIK010000017.1 GCA030228965_00509 CDS open 41109-42008 _na     299_aa uspA UspA domain-containing protein
4399 JASPIK010000017.1 GCA030228965_00510 CDS open 42234-43175 _na     313_aa Pseudouridine synthase RsuA/RluA-like domain-containing protein
4400 JASPIK010000017.1 GCA030228965_00511 CDS open 43441-43920 _na     159_aa hypothetical protein
4401 JASPIK010000017.1 GCA030228965_00512 CDS open 44225-44437 _na     70_aa GtrA-like protein domain-containing protein
4402 JASPIK010000017.1 GCA030228965_00466 gene open 242-610
4403 JASPIK010000017.1 GCA030228965_00467 gene open 612-938 padR
4404 JASPIK010000017.1 GCA030228965_00468 gene open 1027-1164
4405 JASPIK010000017.1 GCA030228965_00469 gene open 1409-1996
4406 JASPIK010000017.1 GCA030228965_00470 gene open 2163-4010
4407 JASPIK010000017.1 GCA030228965_00471 gene open 4007-4759
4408 JASPIK010000017.1 GCA030228965_00472 gene open 4862-5791
4409 JASPIK010000017.1 GCA030228965_00473 gene open 5815-6030
4410 JASPIK010000017.1 GCA030228965_00474 gene open 6093-7289 glf
4411 JASPIK010000017.1 GCA030228965_00475 gene open 7447-9345
4412 JASPIK010000017.1 GCA030228965_00476 gene open 9368-10198
4413 JASPIK010000017.1 GCA030228965_00477 gene open 10221-11768 glpK
4414 JASPIK010000017.1 GCA030228965_00478 gene open 11799-12536
4415 JASPIK010000017.1 GCA030228965_00479 gene open 12549-14285
4416 JASPIK010000017.1 GCA030228965_00480 gene open 14574-16205
4417 JASPIK010000017.1 GCA030228965_00481 gene open 16233-17489 serS
4418 JASPIK010000017.1 GCA030228965_00482 gene open 17555-18304
4419 JASPIK010000017.1 GCA030228965_00483 gene open 18332-19381
4420 JASPIK010000017.1 GCA030228965_00484 gene open 19382-19729
4421 JASPIK010000017.1 GCA030228965_00485 gene open 19726-20379
4422 JASPIK010000017.1 GCA030228965_00486 gene open 20389-21297 pheA
4423 JASPIK010000017.1 GCA030228965_00487 gene open 21331-22467
4424 JASPIK010000017.1 GCA030228965_00488 gene open 22464-23174
4425 JASPIK010000017.1 GCA030228965_00489 gene open 23234-24529
4426 JASPIK010000017.1 GCA030228965_00490 gene open 24815-25735
4427 JASPIK010000017.1 GCA030228965_00491 gene open 25756-26460
4428 JASPIK010000017.1 GCA030228965_00492 gene open 26460-27407
4429 JASPIK010000017.1 GCA030228965_00493 gene open 27495-29237
4430 JASPIK010000017.1 GCA030228965_00494 gene open 29234-29881 msrA
4431 JASPIK010000017.1 GCA030228965_00495 gene open 30046-30648
4432 JASPIK010000017.1 GCA030228965_00496 gene open 30774-31925
4433 JASPIK010000017.1 GCA030228965_00497 gene open 31936-33234
4434 JASPIK010000017.1 GCA030228965_00498 gene open 33231-34664 yprB
4435 JASPIK010000017.1 GCA030228965_00499 gene open 34733-35365
4436 JASPIK010000017.1 GCA030228965_00500 gene open 35551-35862
4437 JASPIK010000017.1 GCA030228965_00501 gene open 35867-36505
4438 JASPIK010000017.1 GCA030228965_00502 gene open 36543-37706 nreB
4439 JASPIK010000017.1 GCA030228965_00503 gene open 37735-38235
4440 JASPIK010000017.1 GCA030228965_00504 gene open 38232-38384
4441 JASPIK010000017.1 GCA030228965_00505 gene open 38384-39046
4442 JASPIK010000017.1 GCA030228965_00506 gene open 39090-40034 yidC
4443 JASPIK010000017.1 GCA030228965_00507 gene open 39991-40599
4444 JASPIK010000017.1 GCA030228965_00508 gene open 40678-40929
4445 JASPIK010000017.1 GCA030228965_00509 gene open 41109-42008 uspA
4446 JASPIK010000017.1 GCA030228965_00510 gene open 42234-43175
4447 JASPIK010000017.1 GCA030228965_00511 gene open 43441-43920
4448 JASPIK010000017.1 GCA030228965_00512 gene open 44225-44437
4449 JASPIK010000018.1 GCA030228965_00513 CDS open 84-647 _na     187_aa Amino acid permease/ SLC12A domain-containing protein
4450 JASPIK010000018.1 GCA030228965_00514 CDS open 647-1957 _na     436_aa GS catalytic domain-containing protein
4451 JASPIK010000018.1 GCA030228965_00515 CDS open 1947-3104 _na     385_aa Amidohydrolase-related domain-containing protein
4452 JASPIK010000018.1 GCA030228965_00516 CDS open 3118-4296 _na     392_aa Peptidase M20 dimerisation domain-containing protein
4453 JASPIK010000018.1 GCA030228965_00517 CDS open 4296-5150 _na     284_aa HTH rpiR-type domain-containing protein
4454 JASPIK010000018.1 GCA030228965_00518 CDS open 5304-7238 _na     644_aa site-specific DNA-methyltransferase (adenine-specific)
4455 JASPIK010000018.1 GCA030228965_00519 CDS open 7238-8389 _na     383_aa Type I restriction modification DNA specificity domain-containing protein
4456 JASPIK010000018.1 GCA030228965_00520 CDS open 8382-11468 _na     1028_aa type I site-specific deoxyribonuclease
4457 JASPIK010000018.1 GCA030228965_00521 CDS open 11541-11879 _na     112_aa Nitrogen regulatory protein P-II
4458 JASPIK010000018.1 GCA030228965_00522 CDS open 11907-13229 _na     440_aa Ammonium transporter
4459 JASPIK010000018.1 GCA030228965_00523 CDS open 13540-15540 _na     666_aa Peptidase S9 prolyl oligopeptidase catalytic domain-containing protein
4460 JASPIK010000018.1 GCA030228965_00524 CDS open 15551-15979 _na     142_aa OsmC-like protein
4461 JASPIK010000018.1 GCA030228965_00525 CDS open 16058-16963 _na     301_aa Rv2525c-like glycoside hydrolase-like domain-containing protein
4462 JASPIK010000018.1 GCA030228965_00526 CDS open 16966-17895 _na     309_aa Lipoprotein
4463 JASPIK010000018.1 GCA030228965_00527 CDS open 17935-19578 _na     547_aa actP Cation/acetate symporter ActP
4464 JASPIK010000018.1 GCA030228965_00528 CDS open 19579-19926 _na     115_aa DUF485 domain-containing protein
4465 JASPIK010000018.1 GCA030228965_00529 CDS open 20320-21183 _na     287_aa NADP-dependent oxidoreductase domain-containing protein
4466 JASPIK010000018.1 GCA030228965_00530 CDS open 21293-21652 _na     119_aa Peptidyl-prolyl cis-trans isomerase
4467 JASPIK010000018.1 GCA030228965_00531 CDS open 21774-23066 _na     430_aa citrate synthase
4468 JASPIK010000018.1 GCA030228965_00532 CDS open 23224-24342 _na     372_aa serC phosphoserine transaminase
4469 JASPIK010000018.1 GCA030228965_00533 CDS open 24449-25297 _na     282_aa sepH septation protein SepH
4470 JASPIK010000018.1 GCA030228965_00534 CDS open 25301-26131 _na     276_aa DUF6928 domain-containing protein
4471 JASPIK010000018.1 GCA030228965_00535 CDS open 26092-26898 _na     268_aa spoU tRNA/rRNA methyltransferase SpoU type domain-containing protein
4472 JASPIK010000018.1 GCA030228965_00536 CDS open 26909-28312 _na     467_aa MFS transporter
4473 JASPIK010000018.1 GCA030228965_00537 CDS open 28364-29032 _na     222_aa DUF3027 domain-containing protein
4474 JASPIK010000018.1 GCA030228965_00538 CDS open 29038-29844 _na     268_aa Glutamine cyclotransferase
4475 JASPIK010000018.1 GCA030228965_00539 CDS open 29851-30384 _na     177_aa DUF2771 domain-containing protein
4476 JASPIK010000018.1 GCA030228965_00540 CDS open 30381-30761 _na     126_aa CSD domain-containing protein
4477 JASPIK010000018.1 GCA030228965_00541 CDS open 31057-31677 _na     206_aa Resuscitation-promoting factor core lysozyme-like domain-containing protein
4478 JASPIK010000018.1 GCA030228965_00542 CDS open 31726-31911 _na     61_aa hypothetical protein
4479 JASPIK010000018.1 GCA030228965_00543 CDS open 31977-34004 _na     675_aa Helicase XPB/Ssl2 N-terminal domain-containing protein
4480 JASPIK010000018.1 GCA030228965_00544 CDS open 34001-35623 _na     540_aa DNA repair helicase XPB
4481 JASPIK010000018.1 GCA030228965_00545 CDS open 35623-36255 _na     210_aa DUF3239 domain-containing protein
4482 JASPIK010000018.1 GCA030228965_00546 CDS open 36315-36578 _na     87_aa RelE/StbE family addiction module toxin
4483 JASPIK010000018.1 GCA030228965_00547 CDS open 36562-36798 _na     78_aa copG Ribbon-helix-helix protein CopG domain-containing protein
4484 JASPIK010000018.1 GCA030228965_00548 CDS open 36935-37567 _na     210_aa Globin domain-containing protein
4485 JASPIK010000018.1 GCA030228965_00513 gene open 84-647
4486 JASPIK010000018.1 GCA030228965_00514 gene open 647-1957
4487 JASPIK010000018.1 GCA030228965_00515 gene open 1947-3104
4488 JASPIK010000018.1 GCA030228965_00516 gene open 3118-4296
4489 JASPIK010000018.1 GCA030228965_00517 gene open 4296-5150
4490 JASPIK010000018.1 GCA030228965_00518 gene open 5304-7238
4491 JASPIK010000018.1 GCA030228965_00519 gene open 7238-8389
4492 JASPIK010000018.1 GCA030228965_00520 gene open 8382-11468
4493 JASPIK010000018.1 GCA030228965_00521 gene open 11541-11879
4494 JASPIK010000018.1 GCA030228965_00522 gene open 11907-13229
4495 JASPIK010000018.1 GCA030228965_00523 gene open 13540-15540
4496 JASPIK010000018.1 GCA030228965_00524 gene open 15551-15979
4497 JASPIK010000018.1 GCA030228965_00525 gene open 16058-16963
4498 JASPIK010000018.1 GCA030228965_00526 gene open 16966-17895
4499 JASPIK010000018.1 GCA030228965_00527 gene open 17935-19578 actP
4500 JASPIK010000018.1 GCA030228965_00528 gene open 19579-19926