HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Streptococcus sinensis (GCA_030586725.1)

Select a Genome:
BAKTA Annotations for GCA_030586725.1
Genome Selected: Streptococcus sinensis
ContigsBases CDSrRNA tmRNAtRNA
50 2134166 2015 3 1 39
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4176 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:6]    |    Number of Records Found: 4176 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2501 JASKOR010000010.1 GCA030586725_00008 CDS open 6917-7609 _na     230_aa Methionine ABC transporter permease protein
2502 JASKOR010000010.1 GCA030586725_00009 CDS open 7867-9630 _na     587_aa Putative ABC transporter
2503 JASKOR010000010.1 GCA030586725_00010 CDS open 9620-11287 _na     555_aa Putative ABC transporter ATP-binding protein
2504 JASKOR010000010.1 GCA030586725_00011 CDS open 11288-11881 _na     197_aa Substrate-specific component of putative ECF transporter
2505 JASKOR010000010.1 GCA030586725_00012 CDS open 11878-12558 _na     226_aa Transmembrane component of energizing module of putative ECF transporter
2506 JASKOR010000010.1 GCA030586725_00013 CDS open 12519-13331 _na     270_aa ccmA heme ABC exporter ATP-binding protein CcmA
2507 JASKOR010000010.1 GCA030586725_00014 CDS open 13564-13953 _na     129_aa ATP-binding cassette domain-containing protein
2508 JASKOR010000010.1 GCA030586725_00015 CDS open 14371-15729 _na     452_aa DUF4832 domain-containing protein
2509 JASKOR010000010.1 GCA030586725_00016 CDS open 15999-16121 _na     40_aa hypothetical protein
2510 JASKOR010000010.1 GCA030586725_00017 CDS open 16236-17237 _na     333_aa galE UDP-glucose 4-epimerase GalE
2511 JASKOR010000010.1 GCA030586725_00018 CDS open 17566-18411 _na     281_aa Adenosyl-chloride synthase
2512 JASKOR010000010.1 GCA030586725_00019 CDS open 18423-18986 _na     187_aa ECF-type riboflavin transporter substrate-binding protein
2513 JASKOR010000010.1 GCA030586725_00020 CDS open 19827-20471 _na     214_aa fsa fructose-6-phosphate aldolase
2514 JASKOR010000010.1 GCA030586725_00021 CDS open 20749-20949 _na     66_aa potassium transporter
2515 JASKOR010000010.1 GCA030586725_00022 CDS open 20933-21130 _na     65_aa HTH cro/C1-type domain-containing protein
2516 JASKOR010000010.1 GCA030586725_00023 CDS open 21150-21644 _na     164_aa DUF6773 domain-containing protein
2517 JASKOR010000010.1 GCA030586725_00024 CDS open 21689-22165 _na     158_aa DUF6773 domain-containing protein
2518 JASKOR010000010.1 GCA030586725_00025 CDS open 22162-22839 _na     225_aa Membrane-bound protease%2C CAAX family
2519 JASKOR010000010.1 GCA030586725_00026 CDS open 22849-23337 _na     162_aa DUF6773 domain-containing protein
2520 JASKOR010000010.1 GCA030586725_00027 CDS open 23473-24459 _na     328_aa trhO rhodanese-related sulfurtransferase
2521 JASKOR010000010.1 GCA030586725_00028 CDS open 24625-25554 _na     309_aa Putative 4-oxalomesaconate hydratase
2522 JASKOR010000010.1 GCA030586725_00029 CDS open 25551-26213 _na     220_aa ABM domain-containing protein
2523 JASKOR010000010.1 GCA030586725_00030 CDS open 26577-27338 _na     253_aa Uridine phosphorylase
2524 JASKOR010000010.1 GCA030586725_00031 CDS open 27341-29029 _na     562_aa energy-coupling factor transporter ATPase
2525 JASKOR010000010.1 GCA030586725_00032 CDS open 29022-29858 _na     278_aa mtsC Transmembrane component MtsC of energizing module of methionine-regulated ECF transporter
2526 JASKOR010000010.1 GCA030586725_00033 CDS open 29949-30662 _na     237_aa rsmG 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG
2527 JASKOR010000010.1 GCA030586725_00034 CDS open 31189-32478 _na     429_aa Macrolide-efflux protein
2528 JASKOR010000010.1 GCA030586725_00035 CDS open 32491-33093 _na     200_aa tetR Transcriptional regulator%2C TetR family
2529 JASKOR010000010.1 GCA030586725_00036 CDS open 33247-33816 _na     189_aa LemA-like protein%2C putative
2530 JASKOR010000010.1 GCA030586725_00037 CDS open 33818-34711 _na     297_aa htpX zinc metalloprotease HtpX
2531 JASKOR010000010.1 GCA030586725_00038 CDS open 35089-35469 _na     126_aa hypothetical protein
2532 JASKOR010000010.1 GCA030586725_00039 CDS open 35456-35983 _na     175_aa Thiol-disulfide isomerase
2533 JASKOR010000010.1 GCA030586725_00040 CDS open 36030-37262 _na     410_aa Dsg protein involved in extracellular polysaccharide synthesis and transport
2534 JASKOR010000010.1 GCA030586725_00041 CDS open 37520-38053 _na     177_aa Cluster with ribosomal protein L32p%2C Firmicutes subfamily
2535 JASKOR010000010.1 GCA030586725_00042 CDS open 38267-39730 _na     487_aa Band 7 domain-containing protein
2536 JASKOR010000010.1 GCA030586725_00043 CDS open 39894-41318 _na     474_aa gndA NADP-dependent phosphogluconate dehydrogenase
2537 JASKOR010000010.1 GCA030586725_00044 CDS open 41328-42017 _na     229_aa DNA-binding response regulator
2538 JASKOR010000010.1 GCA030586725_00045 CDS open 42367-44553 _na     728_aa PTS system%2C maltose and glucose-specific IIC component
2539 JASKOR010000010.1 GCA030586725_00046 CDS open 44571-45386 _na     271_aa Endonuclease/exonuclease/phosphatase domain-containing protein
2540 JASKOR010000010.1 GCA030586725_00047 CDS open 45578-46234 _na     218_aa Acetoin utilization CBS domain-containing protein
2541 JASKOR010000010.1 GCA030586725_00048 CDS open 46271-47158 _na     295_aa DUF2179 domain-containing protein
2542 JASKOR010000010.1 GCA030586725_00049 CDS open 47341-47979 _na     212_aa tmk dTMP kinase
2543 JASKOR010000010.1 GCA030586725_00050 CDS open 47976-48869 _na     297_aa DNA polymerase III subunit delta'
2544 JASKOR010000010.1 GCA030586725_00051 CDS open 48888-49205 _na     105_aa yabA DNA replication initiation control protein YabA
2545 JASKOR010000010.1 GCA030586725_00052 CDS open 49208-50074 _na     288_aa rsmI 16S rRNA (cytidine(1402)-2'-O)-methyltransferase
2546 JASKOR010000010.1 GCA030586725_00053 CDS open 50187-51047 _na     286_aa Site-specific DNA-methyltransferase (adenine-specific)
2547 JASKOR010000010.1 GCA030586725_00054 CDS open 51076-51837 _na     253_aa dpnA Type II methyltransferase M2-DpnII
2548 JASKOR010000010.1 GCA030586725_00055 CDS open 51834-52457 _na     207_aa NERD domain-containing protein
2549 JASKOR010000010.1 GCA030586725_00056 CDS open 52460-53368 _na     302_aa type II restriction endonuclease
2550 JASKOR010000010.1 GCA030586725_00057 CDS open 53550-54641 _na     363_aa serC 3-phosphoserine/phosphohydroxythreonine transaminase
2551 JASKOR010000010.1 GCA030586725_00058 CDS open 54654-55829 _na     391_aa D-3-phosphoglycerate dehydrogenase
2552 JASKOR010000010.1 GCA030586725_00059 CDS open 55826-56332 _na     168_aa Methylated-DNA--protein-cysteine methyltransferase
2553 JASKOR010000010.1 GCA030586725_00060 CDS open 56365-56718 _na     117_aa Arsenate reductase
2554 JASKOR010000010.1 GCA030586725_00061 CDS open 56816-57445 _na     209_aa nth endonuclease III
2555 JASKOR010000010.1 GCA030586725_00062 CDS open 57471-57860 _na     129_aa Transcriptional regulator%2C XRE family
2556 JASKOR010000010.1 GCA030586725_00063 CDS open 57930-58064 _na     44_aa helix-turn-helix transcriptional regulator
2557 JASKOR010000010.1 GCA030586725_00064 CDS open 58235-58621 _na     128_aa Bleomycin resistance protein
2558 JASKOR010000010.1 GCA030586725_00065 CDS open 58633-59460 _na     275_aa exoA exodeoxyribonuclease III
2559 JASKOR010000010.1 GCA030586725_00066 CDS open 59545-60216 _na     223_aa Isoprenylcysteine carboxyl methyltransferase
2560 JASKOR010000010.1 GCA030586725_00067 CDS open 60698-62701 _na     667_aa metG methionine--tRNA ligase
2561 JASKOR010000010.1 GCA030586725_00068 CDS open 62819-64840 _na     673_aa mcrB McrB family protein
2562 JASKOR010000010.1 GCA030586725_00069 CDS open 64815-66161 _na     448_aa McrBC 5-methylcytosine restriction system component
2563 JASKOR010000010.1 GCA030586725_00070 CDS open 66241-67446 _na     401_aa DUF2974 domain-containing protein
2564 JASKOR010000010.1 GCA030586725_00071 CDS open 67666-68352 _na     228_aa graR Response regulator protein GraR
2565 JASKOR010000010.1 GCA030586725_00072 CDS open 68336-69316 _na     326_aa histidine kinase
2566 JASKOR010000010.1 GCA030586725_00073 CDS open 69428-70186 _na     252_aa Beta-carotene 15%2C15'-monooxygenase
2567 JASKOR010000010.1 GCA030586725_00074 CDS open 70270-71049 _na     259_aa ABC transporter ATP-binding protein
2568 JASKOR010000010.1 GCA030586725_00075 CDS open 71030-73030 _na     666_aa ABC3 transporter permease C-terminal domain-containing protein
2569 JASKOR010000010.1 GCA030586725_00076 CDS open 73179-74045 _na     288_aa ABC transporter ATP-binding protein
2570 JASKOR010000010.1 GCA030586725_00077 CDS open 74046-74909 _na     287_aa Multidrug ABC transporter permease
2571 JASKOR010000010.1 GCA030586725_00078 CDS open 74930-75385 _na     151_aa lytR Sensory transduction protein LytR
2572 JASKOR010000010.1 GCA030586725_00079 CDS open 75396-75797 _na     133_aa Integral membrane protein
2573 JASKOR010000010.1 GCA030586725_00080 CDS open 75986-76552 _na     188_aa yvdT Putative HTH-type transcriptional regulator YvdT
2574 JASKOR010000010.1 GCA030586725_00081 CDS open 76685-77077 _na     130_aa Integral membrane protein
2575 JASKOR010000010.1 GCA030586725_00082 CDS open 77087-77434 _na     115_aa Putative NrdI-like protein
2576 JASKOR010000010.1 GCA030586725_00083 CDS open 77630-77761 _na     43_aa hypothetical protein
2577 JASKOR010000010.1 GCA030586725_00084 CDS open 78201-78968 _na     255_aa ABC transporter ATP-binding protein
2578 JASKOR010000010.1 GCA030586725_00085 CDS open 78961-80949 _na     662_aa ABC3 transporter permease C-terminal domain-containing protein
2579 JASKOR010000010.1 GCA030586725_00086 CDS open 81081-82481 _na     466_aa Cationic amino acid transporter-APC Superfamily
2580 JASKOR010000010.1 GCA030586725_00087 CDS open 82519-82788 _na     89_aa Gram-positive signal peptide protein%2C YSIRK family
2581 JASKOR010000010.1 GCA030586725_00088 CDS open 82855-83865 _na     336_aa ctpA Carboxy-terminal processing protease CtpA
2582 JASKOR010000010.1 GCA030586725_00001 gene open 87-848
2583 JASKOR010000010.1 GCA030586725_00002 gene open 895-1011
2584 JASKOR010000010.1 GCA030586725_00003 gene open 1152-2288 yxeP
2585 JASKOR010000010.1 GCA030586725_00004 gene open 2493-3326
2586 JASKOR010000010.1 GCA030586725_00005 gene open 3415-4278
2587 JASKOR010000010.1 GCA030586725_00006 gene open 4485-5861
2588 JASKOR010000010.1 GCA030586725_00007 gene open 5851-6915 metN
2589 JASKOR010000010.1 GCA030586725_00008 gene open 6917-7609
2590 JASKOR010000010.1 GCA030586725_00009 gene open 7867-9630
2591 JASKOR010000010.1 GCA030586725_00010 gene open 9620-11287
2592 JASKOR010000010.1 GCA030586725_00011 gene open 11288-11881
2593 JASKOR010000010.1 GCA030586725_00012 gene open 11878-12558
2594 JASKOR010000010.1 GCA030586725_00013 gene open 12519-13331 ccmA
2595 JASKOR010000010.1 GCA030586725_00014 gene open 13564-13953
2596 JASKOR010000010.1 GCA030586725_00015 gene open 14371-15729
2597 JASKOR010000010.1 GCA030586725_00016 gene open 15999-16121
2598 JASKOR010000010.1 GCA030586725_00017 gene open 16236-17237 galE
2599 JASKOR010000010.1 GCA030586725_00018 gene open 17566-18411
2600 JASKOR010000010.1 GCA030586725_00019 gene open 18423-18986
2601 JASKOR010000010.1 GCA030586725_00020 gene open 19827-20471 fsa
2602 JASKOR010000010.1 GCA030586725_00021 gene open 20749-20949
2603 JASKOR010000010.1 GCA030586725_00022 gene open 20933-21130
2604 JASKOR010000010.1 GCA030586725_00023 gene open 21150-21644
2605 JASKOR010000010.1 GCA030586725_00024 gene open 21689-22165
2606 JASKOR010000010.1 GCA030586725_00025 gene open 22162-22839
2607 JASKOR010000010.1 GCA030586725_00026 gene open 22849-23337
2608 JASKOR010000010.1 GCA030586725_00027 gene open 23473-24459 trhO
2609 JASKOR010000010.1 GCA030586725_00028 gene open 24625-25554
2610 JASKOR010000010.1 GCA030586725_00029 gene open 25551-26213
2611 JASKOR010000010.1 GCA030586725_00030 gene open 26577-27338
2612 JASKOR010000010.1 GCA030586725_00031 gene open 27341-29029
2613 JASKOR010000010.1 GCA030586725_00032 gene open 29022-29858 mtsC
2614 JASKOR010000010.1 GCA030586725_00033 gene open 29949-30662 rsmG
2615 JASKOR010000010.1 GCA030586725_00034 gene open 31189-32478
2616 JASKOR010000010.1 GCA030586725_00035 gene open 32491-33093 tetR
2617 JASKOR010000010.1 GCA030586725_00036 gene open 33247-33816
2618 JASKOR010000010.1 GCA030586725_00037 gene open 33818-34711 htpX
2619 JASKOR010000010.1 GCA030586725_00038 gene open 35089-35469
2620 JASKOR010000010.1 GCA030586725_00039 gene open 35456-35983
2621 JASKOR010000010.1 GCA030586725_00040 gene open 36030-37262
2622 JASKOR010000010.1 GCA030586725_00041 gene open 37520-38053
2623 JASKOR010000010.1 GCA030586725_00042 gene open 38267-39730
2624 JASKOR010000010.1 GCA030586725_00043 gene open 39894-41318 gndA
2625 JASKOR010000010.1 GCA030586725_00044 gene open 41328-42017
2626 JASKOR010000010.1 GCA030586725_00045 gene open 42367-44553
2627 JASKOR010000010.1 GCA030586725_00046 gene open 44571-45386
2628 JASKOR010000010.1 GCA030586725_00047 gene open 45578-46234
2629 JASKOR010000010.1 GCA030586725_00048 gene open 46271-47158
2630 JASKOR010000010.1 GCA030586725_00049 gene open 47341-47979 tmk
2631 JASKOR010000010.1 GCA030586725_00050 gene open 47976-48869
2632 JASKOR010000010.1 GCA030586725_00051 gene open 48888-49205 yabA
2633 JASKOR010000010.1 GCA030586725_00052 gene open 49208-50074 rsmI
2634 JASKOR010000010.1 GCA030586725_00053 gene open 50187-51047
2635 JASKOR010000010.1 GCA030586725_00054 gene open 51076-51837 dpnA
2636 JASKOR010000010.1 GCA030586725_00055 gene open 51834-52457
2637 JASKOR010000010.1 GCA030586725_00056 gene open 52460-53368
2638 JASKOR010000010.1 GCA030586725_00057 gene open 53550-54641 serC
2639 JASKOR010000010.1 GCA030586725_00058 gene open 54654-55829
2640 JASKOR010000010.1 GCA030586725_00059 gene open 55826-56332
2641 JASKOR010000010.1 GCA030586725_00060 gene open 56365-56718
2642 JASKOR010000010.1 GCA030586725_00061 gene open 56816-57445 nth
2643 JASKOR010000010.1 GCA030586725_00062 gene open 57471-57860
2644 JASKOR010000010.1 GCA030586725_00063 gene open 57930-58064
2645 JASKOR010000010.1 GCA030586725_00064 gene open 58235-58621
2646 JASKOR010000010.1 GCA030586725_00065 gene open 58633-59460 exoA
2647 JASKOR010000010.1 GCA030586725_00066 gene open 59545-60216
2648 JASKOR010000010.1 GCA030586725_00067 gene open 60698-62701 metG
2649 JASKOR010000010.1 GCA030586725_00068 gene open 62819-64840 mcrB
2650 JASKOR010000010.1 GCA030586725_00069 gene open 64815-66161
2651 JASKOR010000010.1 GCA030586725_00070 gene open 66241-67446
2652 JASKOR010000010.1 GCA030586725_00071 gene open 67666-68352 graR
2653 JASKOR010000010.1 GCA030586725_00072 gene open 68336-69316
2654 JASKOR010000010.1 GCA030586725_00073 gene open 69428-70186
2655 JASKOR010000010.1 GCA030586725_00074 gene open 70270-71049
2656 JASKOR010000010.1 GCA030586725_00075 gene open 71030-73030
2657 JASKOR010000010.1 GCA030586725_00076 gene open 73179-74045
2658 JASKOR010000010.1 GCA030586725_00077 gene open 74046-74909
2659 JASKOR010000010.1 GCA030586725_00078 gene open 74930-75385 lytR
2660 JASKOR010000010.1 GCA030586725_00079 gene open 75396-75797
2661 JASKOR010000010.1 GCA030586725_00080 gene open 75986-76552 yvdT
2662 JASKOR010000010.1 GCA030586725_00081 gene open 76685-77077
2663 JASKOR010000010.1 GCA030586725_00082 gene open 77087-77434
2664 JASKOR010000010.1 GCA030586725_00083 gene open 77630-77761
2665 JASKOR010000010.1 GCA030586725_00084 gene open 78201-78968
2666 JASKOR010000010.1 GCA030586725_00085 gene open 78961-80949
2667 JASKOR010000010.1 GCA030586725_00086 gene open 81081-82481
2668 JASKOR010000010.1 GCA030586725_00087 gene open 82519-82788
2669 JASKOR010000010.1 GCA030586725_00088 gene open 82855-83865 ctpA
2670 JASKOR010000011.1 repeat_region open 22920-23185 CRISPR array with 4 repeats of length 38%2C consensus sequence GTTTCCATCCCCTCTCGAGGATTGGGGGGGTTCTAACA and spacer length 34
2671 JASKOR010000011.1 repeat_region open 34166-38176 CRISPR array with 61 repeats of length 32%2C consensus sequence ATTTCAATCCACGCTCCCGTGAAGGGAGCGAC and spacer length 34
2672 JASKOR010000011.1 GCA030586725_00089 CDS open 86-2500 _na     804_aa parC DNA topoisomerase IV subunit A
2673 JASKOR010000011.1 GCA030586725_00090 CDS open 2589-3323 _na     244_aa CPBP family intramembrane metalloprotease
2674 JASKOR010000011.1 GCA030586725_00091 CDS open 3304-4137 _na     277_aa aminoglycoside 6-adenylyltransferase
2675 JASKOR010000011.1 GCA030586725_00092 CDS open 4153-4689 _na     178_aa N-acetyltransferase domain-containing protein
2676 JASKOR010000011.1 GCA030586725_00093 CDS open 4719-5324 _na     201_aa fic protein adenylyltransferase Fic
2677 JASKOR010000011.1 GCA030586725_00094 CDS open 5343-5717 _na     124_aa GNAT-family acetyltransferase
2678 JASKOR010000011.1 GCA030586725_00095 CDS open 5781-6527 _na     248_aa DUF6261 domain-containing protein
2679 JASKOR010000011.1 GCA030586725_00096 CDS open 6723-7550 _na     275_aa hypothetical protein
2680 JASKOR010000011.1 GCA030586725_00097 CDS open 7570-9513 _na     647_aa parE DNA topoisomerase IV subunit B
2681 JASKOR010000011.1 GCA030586725_00098 CDS open 9737-10381 _na     214_aa plsY glycerol-3-phosphate 1-O-acyltransferase PlsY
2682 JASKOR010000011.1 GCA030586725_00099 CDS open 10562-12694 _na     710_aa nt5e cell surface ecto-5'-nucleotidase Nt5e
2683 JASKOR010000011.1 GCA030586725_00100 CDS open 12835-14103 _na     422_aa dihydroorotase
2684 JASKOR010000011.1 GCA030586725_00101 CDS open 14116-14580 _na     154_aa mutX 8-oxo-dGTP diphosphatase
2685 JASKOR010000011.1 GCA030586725_00102 CDS open 14589-15242 _na     217_aa ung uracil-DNA glycosylase
2686 JASKOR010000011.1 GCA030586725_00103 CDS open 15310-16839 _na     509_aa Membrane protein
2687 JASKOR010000011.1 GCA030586725_00104 CDS open 16953-17582 _na     209_aa pyrE Orotate phosphoribosyltransferase
2688 JASKOR010000011.1 GCA030586725_00105 CDS open 17658-18350 _na     230_aa pyrF orotidine-5'-phosphate decarboxylase
2689 JASKOR010000011.1 GCA030586725_00106 CDS open 18556-19494 _na     312_aa dihydroorotate dehydrogenase
2690 JASKOR010000011.1 GCA030586725_00107 CDS open 19507-20313 _na     268_aa dihydroorotate dehydrogenase electron transfer subunit
2691 JASKOR010000011.1 GCA030586725_00108 CDS open 20500-21408 _na     302_aa lysR HTH lysR-type domain-containing protein
2692 JASKOR010000011.1 GCA030586725_00109 CDS open 21519-22253 _na     244_aa cas6 CRISPR-associated endoribonuclease Cas6
2693 JASKOR010000011.1 GCA030586725_00110 CDS open 23282-23608 _na     108_aa cas2 CRISPR-associated endonuclease Cas2
2694 JASKOR010000011.1 GCA030586725_00111 CDS open 23595-24530 _na     311_aa cas1 CRISPR-associated endonuclease Cas1
2695 JASKOR010000011.1 GCA030586725_00112 CDS open 24662-25399 _na     245_aa NAD-dependent protein deacylase
2696 JASKOR010000011.1 GCA030586725_00113 CDS open 25392-26168 _na     258_aa Csm6 HEPN domain-containing protein
2697 JASKOR010000011.1 GCA030586725_00114 CDS open 26171-26878 _na     235_aa deoD purine-nucleoside phosphorylase
2698 JASKOR010000011.1 GCA030586725_00115 CDS open 27308-28120 _na     270_aa purine-nucleoside phosphorylase
2699 JASKOR010000011.1 GCA030586725_00116 CDS open 28150-29361 _na     403_aa deoB phosphopentomutase
2700 JASKOR010000011.1 GCA030586725_00117 CDS open 29375-30052 _na     225_aa rpiA ribose-5-phosphate isomerase RpiA
2701 JASKOR010000011.1 GCA030586725_00118 CDS open 30251-31624 _na     457_aa mnmE tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE
2702 JASKOR010000011.1 GCA030586725_00119 CDS open 31626-31811 _na     61_aa Phage protein
2703 JASKOR010000011.1 GCA030586725_00120 CDS open 31919-32584 _na     221_aa hrtA Putative hemin import ATP-binding protein HrtA
2704 JASKOR010000011.1 GCA030586725_00121 CDS open 32585-33646 _na     353_aa hrtB Putative hemin transport system permease protein HrtB
2705 JASKOR010000011.1 GCA030586725_00122 CDS open 38313-38606 _na     97_aa cas2 CRISPR-associated endonuclease Cas2
2706 JASKOR010000011.1 GCA030586725_00123 CDS open 38617-39642 _na     341_aa cas1c type I-C CRISPR-associated endonuclease Cas1c
2707 JASKOR010000011.1 GCA030586725_00124 CDS open 39639-40310 _na     223_aa cas4 CRISPR-associated protein Cas4
2708 JASKOR010000011.1 GCA030586725_00125 CDS open 40312-41160 _na     282_aa cas7c type I-C CRISPR-associated protein Cas7/Csd2
2709 JASKOR010000011.1 GCA030586725_00126 CDS open 41164-43053 _na     629_aa cas8c type I-C CRISPR-associated protein Cas8c/Csd1
2710 JASKOR010000011.1 GCA030586725_00127 CDS open 43053-43781 _na     242_aa cas5c type I-C CRISPR-associated protein Cas5c
2711 JASKOR010000011.1 GCA030586725_00128 CDS open 44027-46429 _na     800_aa Helicase Cas3
2712 JASKOR010000011.1 GCA030586725_00130 CDS open 47365-47712 _na     115_aa rplS 50S ribosomal protein L19
2713 JASKOR010000011.1 GCA030586725_00131 CDS open 47832-48158 _na     108_aa crcB fluoride efflux transporter CrcB
2714 JASKOR010000011.1 GCA030586725_00132 CDS open 48155-48529 _na     124_aa crcB fluoride efflux transporter CrcB
2715 JASKOR010000011.1 GCA030586725_00133 CDS open 48526-48792 _na     88_aa Chorismate mutase I
2716 JASKOR010000011.1 GCA030586725_00134 CDS open 49262-50644 _na     460_aa sufB Fe-S cluster assembly protein SufB
2717 JASKOR010000011.1 GCA030586725_00135 CDS open 50769-51209 _na     146_aa flavodoxin
2718 JASKOR010000011.1 GCA030586725_00136 CDS open 51315-52250 _na     311_aa nrnA bifunctional oligoribonuclease/PAP phosphatase NrnA
2719 JASKOR010000011.1 GCA030586725_00137 CDS open 52356-52598 _na     80_aa rpmE2 type B 50S ribosomal protein L31
2720 JASKOR010000011.1 GCA030586725_00138 CDS open 52828-53610 _na     260_aa ldcB LD-carboxypeptidase LdcB/DacB
2721 JASKOR010000011.1 GCA030586725_00139 CDS open 53614-55335 _na     573_aa tcaA TcaA second domain-containing protein
2722 JASKOR010000011.1 GCA030586725_00140 CDS open 55361-56497 _na     378_aa yjbE YjbE family integral membrane protein
2723 JASKOR010000011.1 GCA030586725_00141 CDS open 56822-57406 _na     194_aa Dephospho-CoA kinase/protein folding accessory domain-containing protein
2724 JASKOR010000011.1 GCA030586725_00142 CDS open 57482-58219 _na     245_aa DUF3307 domain-containing protein
2725 JASKOR010000011.1 GCA030586725_00143 CDS open 58216-58881 _na     221_aa DNA-binding protein
2726 JASKOR010000011.1 GCA030586725_00144 CDS open 58973-59290 _na     105_aa tfoX TfoX N-terminal domain-containing protein
2727 JASKOR010000011.1 GCA030586725_00145 CDS open 59439-60959 _na     506_aa ABC-type choline transporter%2C membrane-spanning permease%2C putative
2728 JASKOR010000011.1 GCA030586725_00146 CDS open 60952-61680 _na     242_aa ABC superfamily ATP binding cassette transporter%2C ABC protein
2729 JASKOR010000011.1 GCA030586725_00147 CDS open 61673-62533 _na     286_aa NmrA-like domain-containing protein
2730 JASKOR010000011.1 GCA030586725_00148 CDS open 62545-62994 _na     149_aa slyA Transcriptional regulator SlyA
2731 JASKOR010000011.1 GCA030586725_00149 CDS open 63063-63815 _na     250_aa protein-ADP-ribose hydrolase
2732 JASKOR010000011.1 GCA030586725_00150 CDS open 63803-64615 _na     270_aa NAD-dependent protein deacetylase of SIR2 family
2733 JASKOR010000011.1 GCA030586725_00151 CDS open 64803-65582 _na     259_aa YrdC-like domain-containing protein
2734 JASKOR010000011.1 GCA030586725_00152 CDS open 65682-66272 _na     196_aa leuD 3-isopropylmalate dehydratase small subunit
2735 JASKOR010000011.1 GCA030586725_00153 CDS open 66282-67664 _na     460_aa leuC 3-isopropylmalate dehydratase large subunit
2736 JASKOR010000011.1 GCA030586725_00154 CDS open 67666-67932 _na     88_aa DUF1294 domain-containing protein
2737 JASKOR010000011.1 GCA030586725_00155 CDS open 67929-68966 _na     345_aa leuB 3-isopropylmalate dehydrogenase
2738 JASKOR010000011.1 GCA030586725_00156 CDS open 68979-70544 _na     521_aa 2-isopropylmalate synthase
2739 JASKOR010000011.1 GCA030586725_00157 CDS open 70990-71667 _na     225_aa DUF1275 domain-containing protein
2740 JASKOR010000011.1 GCA030586725_00158 CDS open 71705-72340 _na     211_aa udk uridine kinase
2741 JASKOR010000011.1 GCA030586725_00159 CDS open 72445-73425 _na     326_aa ycjS Putative oxidoreductase YcjS
2742 JASKOR010000011.1 GCA030586725_00160 CDS open 73418-74506 _na     362_aa cshA DEAD-box ATP-dependent RNA helicase CshA
2743 JASKOR010000011.1 GCA030586725_00089 gene open 86-2500 parC
2744 JASKOR010000011.1 GCA030586725_00090 gene open 2589-3323
2745 JASKOR010000011.1 GCA030586725_00091 gene open 3304-4137
2746 JASKOR010000011.1 GCA030586725_00092 gene open 4153-4689
2747 JASKOR010000011.1 GCA030586725_00093 gene open 4719-5324 fic
2748 JASKOR010000011.1 GCA030586725_00094 gene open 5343-5717
2749 JASKOR010000011.1 GCA030586725_00095 gene open 5781-6527
2750 JASKOR010000011.1 GCA030586725_00096 gene open 6723-7550
2751 JASKOR010000011.1 GCA030586725_00097 gene open 7570-9513 parE
2752 JASKOR010000011.1 GCA030586725_00098 gene open 9737-10381 plsY
2753 JASKOR010000011.1 GCA030586725_00099 gene open 10562-12694 nt5e
2754 JASKOR010000011.1 GCA030586725_00100 gene open 12835-14103
2755 JASKOR010000011.1 GCA030586725_00101 gene open 14116-14580 mutX
2756 JASKOR010000011.1 GCA030586725_00102 gene open 14589-15242 ung
2757 JASKOR010000011.1 GCA030586725_00103 gene open 15310-16839
2758 JASKOR010000011.1 GCA030586725_00104 gene open 16953-17582 pyrE
2759 JASKOR010000011.1 GCA030586725_00105 gene open 17658-18350 pyrF
2760 JASKOR010000011.1 GCA030586725_00106 gene open 18556-19494
2761 JASKOR010000011.1 GCA030586725_00107 gene open 19507-20313
2762 JASKOR010000011.1 GCA030586725_00108 gene open 20500-21408 lysR
2763 JASKOR010000011.1 GCA030586725_00109 gene open 21519-22253 cas6
2764 JASKOR010000011.1 GCA030586725_00110 gene open 23282-23608 cas2
2765 JASKOR010000011.1 GCA030586725_00111 gene open 23595-24530 cas1
2766 JASKOR010000011.1 GCA030586725_00112 gene open 24662-25399
2767 JASKOR010000011.1 GCA030586725_00113 gene open 25392-26168
2768 JASKOR010000011.1 GCA030586725_00114 gene open 26171-26878 deoD
2769 JASKOR010000011.1 GCA030586725_00115 gene open 27308-28120
2770 JASKOR010000011.1 GCA030586725_00116 gene open 28150-29361 deoB
2771 JASKOR010000011.1 GCA030586725_00117 gene open 29375-30052 rpiA
2772 JASKOR010000011.1 GCA030586725_00118 gene open 30251-31624 mnmE
2773 JASKOR010000011.1 GCA030586725_00119 gene open 31626-31811
2774 JASKOR010000011.1 GCA030586725_00120 gene open 31919-32584 hrtA
2775 JASKOR010000011.1 GCA030586725_00121 gene open 32585-33646 hrtB
2776 JASKOR010000011.1 GCA030586725_00122 gene open 38313-38606 cas2
2777 JASKOR010000011.1 GCA030586725_00123 gene open 38617-39642 cas1c
2778 JASKOR010000011.1 GCA030586725_00124 gene open 39639-40310 cas4
2779 JASKOR010000011.1 GCA030586725_00125 gene open 40312-41160 cas7c
2780 JASKOR010000011.1 GCA030586725_00126 gene open 41164-43053 cas8c
2781 JASKOR010000011.1 GCA030586725_00127 gene open 43053-43781 cas5c
2782 JASKOR010000011.1 GCA030586725_00128 gene open 44027-46429
2783 JASKOR010000011.1 GCA030586725_00130 gene open 47365-47712 rplS
2784 JASKOR010000011.1 GCA030586725_00131 gene open 47832-48158 crcB
2785 JASKOR010000011.1 GCA030586725_00132 gene open 48155-48529 crcB
2786 JASKOR010000011.1 GCA030586725_00133 gene open 48526-48792
2787 JASKOR010000011.1 GCA030586725_00134 gene open 49262-50644 sufB
2788 JASKOR010000011.1 GCA030586725_00135 gene open 50769-51209
2789 JASKOR010000011.1 GCA030586725_00136 gene open 51315-52250 nrnA
2790 JASKOR010000011.1 GCA030586725_00137 gene open 52356-52598 rpmE2
2791 JASKOR010000011.1 GCA030586725_00138 gene open 52828-53610 ldcB
2792 JASKOR010000011.1 GCA030586725_00139 gene open 53614-55335 tcaA
2793 JASKOR010000011.1 GCA030586725_00140 gene open 55361-56497 yjbE
2794 JASKOR010000011.1 GCA030586725_00141 gene open 56822-57406
2795 JASKOR010000011.1 GCA030586725_00142 gene open 57482-58219
2796 JASKOR010000011.1 GCA030586725_00143 gene open 58216-58881
2797 JASKOR010000011.1 GCA030586725_00144 gene open 58973-59290 tfoX
2798 JASKOR010000011.1 GCA030586725_00145 gene open 59439-60959
2799 JASKOR010000011.1 GCA030586725_00146 gene open 60952-61680
2800 JASKOR010000011.1 GCA030586725_00147 gene open 61673-62533
2801 JASKOR010000011.1 GCA030586725_00148 gene open 62545-62994 slyA
2802 JASKOR010000011.1 GCA030586725_00149 gene open 63063-63815
2803 JASKOR010000011.1 GCA030586725_00150 gene open 63803-64615
2804 JASKOR010000011.1 GCA030586725_00151 gene open 64803-65582
2805 JASKOR010000011.1 GCA030586725_00152 gene open 65682-66272 leuD
2806 JASKOR010000011.1 GCA030586725_00153 gene open 66282-67664 leuC
2807 JASKOR010000011.1 GCA030586725_00154 gene open 67666-67932
2808 JASKOR010000011.1 GCA030586725_00155 gene open 67929-68966 leuB
2809 JASKOR010000011.1 GCA030586725_00156 gene open 68979-70544
2810 JASKOR010000011.1 GCA030586725_00157 gene open 70990-71667
2811 JASKOR010000011.1 GCA030586725_00158 gene open 71705-72340 udk
2812 JASKOR010000011.1 GCA030586725_00159 gene open 72445-73425 ycjS
2813 JASKOR010000011.1 GCA030586725_00160 gene open 73418-74506 cshA
2814 JASKOR010000011.1 GCA030586725_00129 gene open 47253-47324 trnR
2815 JASKOR010000011.1 GCA030586725_00129 tRNA open 47253-47324 trnR tRNA-Arg(cct)
2816 JASKOR010000012.1 GCA030586725_00161 CDS open 241-2601 _na     786_aa recD2 ATP-dependent RecD2 DNA helicase
2817 JASKOR010000012.1 GCA030586725_00162 CDS open 2679-3311 _na     210_aa lepB signal peptidase I
2818 JASKOR010000012.1 GCA030586725_00163 CDS open 3315-4199 _na     294_aa rnhC ribonuclease HIII
2819 JASKOR010000012.1 GCA030586725_00164 CDS open 4340-4630 _na     96_aa Seryl-tRNA synthetase
2820 JASKOR010000012.1 GCA030586725_00165 CDS open 4641-5192 _na     183_aa Colicin V production protein
2821 JASKOR010000012.1 GCA030586725_00166 CDS open 5253-7586 _na     777_aa mutS2 endonuclease MutS2
2822 JASKOR010000012.1 GCA030586725_00167 CDS open 7597-8241 _na     214_aa Acetyltransferase%2C GNAT family
2823 JASKOR010000012.1 GCA030586725_00168 CDS open 8342-9760 _na     472_aa C69 family dipeptidase
2824 JASKOR010000012.1 GCA030586725_00169 CDS open 9845-10159 _na     104_aa trxA thioredoxin
2825 JASKOR010000012.1 GCA030586725_00170 CDS open 10242-10607 _na     121_aa Acetyltransferase%2C GNAT family
2826 JASKOR010000012.1 GCA030586725_00171 CDS open 10784-11458 _na     224_aa Integral membrane protein
2827 JASKOR010000012.1 GCA030586725_00172 CDS open 11477-12421 _na     314_aa HTH cro/C1-type domain-containing protein
2828 JASKOR010000012.1 GCA030586725_00173 CDS open 12544-15375 _na     943_aa uvrA excinuclease ABC subunit UvrA
2829 JASKOR010000012.1 GCA030586725_00174 CDS open 15530-16591 _na     353_aa X-Pro aminopeptidase
2830 JASKOR010000012.1 GCA030586725_00175 CDS open 16653-17213 _na     186_aa efp elongation factor P
2831 JASKOR010000012.1 GCA030586725_00176 CDS open 17244-17633 _na     129_aa Asp23/Gls24 family envelope stress response protein
2832 JASKOR010000012.1 GCA030586725_00177 CDS open 17626-18051 _na     141_aa nusB transcription antitermination factor NusB
2833 JASKOR010000012.1 GCA030586725_00178 CDS open 18770-18982 _na     70_aa ISSth4%2C transposase%2C IS30 family
2834 JASKOR010000012.1 GCA030586725_00179 CDS open 19344-23027 _na     1227_aa pullulanase
2835 JASKOR010000012.1 GCA030586725_00180 CDS open 23172-24137 _na     321_aa lacI Lactose operon transcriptional repressor%2C LacI family%2C putative
2836 JASKOR010000012.1 GCA030586725_00181 CDS open 24118-25572 _na     484_aa Sucrose-6-phosphate hydrolase
2837 JASKOR010000012.1 GCA030586725_00182 CDS open 25767-27653 _na     628_aa PTS system sucrose-specific EIIBCA component includes: sucrose-specific phosphotransferase enzyme IIB component sucrose permease IIC component sucrose-specific phosphotransferase enzyme IIA compon
2838 JASKOR010000012.1 GCA030586725_00183 CDS open 27814-28713 _na     299_aa scrK fructokinase ScrK
2839 JASKOR010000012.1 GCA030586725_00184 CDS open 28763-29173 _na     136_aa peptide deformylase
2840 JASKOR010000012.1 GCA030586725_00185 CDS open 29203-29748 _na     181_aa hypothetical protein
2841 JASKOR010000012.1 GCA030586725_00186 CDS open 29989-30447 _na     152_aa marR Transcriptional regulator%2C MarR family
2842 JASKOR010000012.1 GCA030586725_00187 CDS open 30440-32206 _na     588_aa Multidrug ABC transporter ATPase/permease
2843 JASKOR010000012.1 GCA030586725_00188 CDS open 32196-33953 _na     585_aa Multidrug ABC transporter ATPase/permease
2844 JASKOR010000012.1 GCA030586725_00189 CDS open 34144-35295 _na     383_aa DUF4352 domain-containing protein
2845 JASKOR010000012.1 GCA030586725_00190 CDS open 35682-35822 _na     46_aa msbA Lipid A export ATP-binding/permease protein MsbA
2846 JASKOR010000012.1 GCA030586725_00191 CDS open 36157-36657 _na     166_aa Phosphatidylglycerophosphatase B
2847 JASKOR010000012.1 GCA030586725_00192 CDS open 36824-37513 _na     229_aa gpmB1 putative phosphoglycerate mutase GpmB1
2848 JASKOR010000012.1 GCA030586725_00193 CDS open 37510-38247 _na     245_aa D-alanyl-D-alanine carboxypeptidase
2849 JASKOR010000012.1 GCA030586725_00194 CDS open 38321-39667 _na     448_aa gdhA NADP-specific glutamate dehydrogenase
2850 JASKOR010000012.1 GCA030586725_00195 CDS open 39900-40841 _na     313_aa dihydroorotate oxidase
2851 JASKOR010000012.1 GCA030586725_00196 CDS open 40984-41919 _na     311_aa Multifunctional fusion protein
2852 JASKOR010000012.1 GCA030586725_00197 CDS open 42003-42683 _na     226_aa Lipoprotein
2853 JASKOR010000012.1 GCA030586725_00198 CDS open 42774-44045 _na     423_aa TRZ/ATZ family protein
2854 JASKOR010000012.1 GCA030586725_00199 CDS open 44315-46234 _na     639_aa PTS system%2C beta-glucoside-specific IIB component
2855 JASKOR010000012.1 GCA030586725_00200 CDS open 46339-47607 _na     422_aa capA Capsule synthesis protein CapA domain-containing protein
2856 JASKOR010000012.1 GCA030586725_00201 CDS open 47790-48662 _na     290_aa tetD Transposon Tn10 TetD protein
2857 JASKOR010000012.1 GCA030586725_00202 CDS open 48774-50213 _na     479_aa bglH Aryl-phospho-beta-D-glucosidase BglH
2858 JASKOR010000012.1 GCA030586725_00203 CDS open 50203-50589 _na     128_aa Putative glyoxylase family protein (Lactoylglutathione lyase)
2859 JASKOR010000012.1 GCA030586725_00204 CDS open 50993-51820 _na     275_aa Hydrolase in cluster with beta-lactamase (HAD superfamily)
2860 JASKOR010000012.1 GCA030586725_00205 CDS open 51821-52453 _na     210_aa N-Acetylneuraminate cytidylyltransferase
2861 JASKOR010000012.1 GCA030586725_00206 CDS open 52675-53139 _na     154_aa tnp IS200/IS605 family ISStin10 transposase
2862 JASKOR010000012.1 GCA030586725_00207 CDS open 53304-53741 _na     145_aa Acetyltransferase
2863 JASKOR010000012.1 GCA030586725_00208 CDS open 54088-55863 _na     591_aa spxB pyruvate oxidase
2864 JASKOR010000012.1 GCA030586725_00209 CDS open 56008-56922 _na     304_aa araC AraC family transcriptional regulator
2865 JASKOR010000012.1 GCA030586725_00210 CDS open 57075-58361 _na     428_aa DUF4038 domain-containing protein
2866 JASKOR010000012.1 GCA030586725_00211 CDS open 58382-59740 _na     452_aa PTS transporter subunit EIIC
2867 JASKOR010000012.1 GCA030586725_00212 CDS open 59807-60067 _na     86_aa SemiSWEET family transporter
2868 JASKOR010000012.1 GCA030586725_00213 CDS open 60395-60655 _na     86_aa MtN3/saliva family protein
2869 JASKOR010000012.1 GCA030586725_00214 CDS open 60910-62349 _na     479_aa Glycoside hydrolase family 1
2870 JASKOR010000012.1 GCA030586725_00215 CDS open 62587-63033 _na     148_aa transposase
2871 JASKOR010000012.1 GCA030586725_00161 gene open 241-2601 recD2
2872 JASKOR010000012.1 GCA030586725_00162 gene open 2679-3311 lepB
2873 JASKOR010000012.1 GCA030586725_00163 gene open 3315-4199 rnhC
2874 JASKOR010000012.1 GCA030586725_00164 gene open 4340-4630
2875 JASKOR010000012.1 GCA030586725_00165 gene open 4641-5192
2876 JASKOR010000012.1 GCA030586725_00166 gene open 5253-7586 mutS2
2877 JASKOR010000012.1 GCA030586725_00167 gene open 7597-8241
2878 JASKOR010000012.1 GCA030586725_00168 gene open 8342-9760
2879 JASKOR010000012.1 GCA030586725_00169 gene open 9845-10159 trxA
2880 JASKOR010000012.1 GCA030586725_00170 gene open 10242-10607
2881 JASKOR010000012.1 GCA030586725_00171 gene open 10784-11458
2882 JASKOR010000012.1 GCA030586725_00172 gene open 11477-12421
2883 JASKOR010000012.1 GCA030586725_00173 gene open 12544-15375 uvrA
2884 JASKOR010000012.1 GCA030586725_00174 gene open 15530-16591
2885 JASKOR010000012.1 GCA030586725_00175 gene open 16653-17213 efp
2886 JASKOR010000012.1 GCA030586725_00176 gene open 17244-17633
2887 JASKOR010000012.1 GCA030586725_00177 gene open 17626-18051 nusB
2888 JASKOR010000012.1 GCA030586725_00178 gene open 18770-18982
2889 JASKOR010000012.1 GCA030586725_00179 gene open 19344-23027
2890 JASKOR010000012.1 GCA030586725_00180 gene open 23172-24137 lacI
2891 JASKOR010000012.1 GCA030586725_00181 gene open 24118-25572
2892 JASKOR010000012.1 GCA030586725_00182 gene open 25767-27653
2893 JASKOR010000012.1 GCA030586725_00183 gene open 27814-28713 scrK
2894 JASKOR010000012.1 GCA030586725_00184 gene open 28763-29173
2895 JASKOR010000012.1 GCA030586725_00185 gene open 29203-29748
2896 JASKOR010000012.1 GCA030586725_00186 gene open 29989-30447 marR
2897 JASKOR010000012.1 GCA030586725_00187 gene open 30440-32206
2898 JASKOR010000012.1 GCA030586725_00188 gene open 32196-33953
2899 JASKOR010000012.1 GCA030586725_00189 gene open 34144-35295
2900 JASKOR010000012.1 GCA030586725_00190 gene open 35682-35822 msbA
2901 JASKOR010000012.1 GCA030586725_00191 gene open 36157-36657
2902 JASKOR010000012.1 GCA030586725_00192 gene open 36824-37513 gpmB1
2903 JASKOR010000012.1 GCA030586725_00193 gene open 37510-38247
2904 JASKOR010000012.1 GCA030586725_00194 gene open 38321-39667 gdhA
2905 JASKOR010000012.1 GCA030586725_00195 gene open 39900-40841
2906 JASKOR010000012.1 GCA030586725_00196 gene open 40984-41919
2907 JASKOR010000012.1 GCA030586725_00197 gene open 42003-42683
2908 JASKOR010000012.1 GCA030586725_00198 gene open 42774-44045
2909 JASKOR010000012.1 GCA030586725_00199 gene open 44315-46234
2910 JASKOR010000012.1 GCA030586725_00200 gene open 46339-47607 capA
2911 JASKOR010000012.1 GCA030586725_00201 gene open 47790-48662 tetD
2912 JASKOR010000012.1 GCA030586725_00202 gene open 48774-50213 bglH
2913 JASKOR010000012.1 GCA030586725_00203 gene open 50203-50589
2914 JASKOR010000012.1 GCA030586725_00204 gene open 50993-51820
2915 JASKOR010000012.1 GCA030586725_00205 gene open 51821-52453
2916 JASKOR010000012.1 GCA030586725_00206 gene open 52675-53139 tnp
2917 JASKOR010000012.1 GCA030586725_00207 gene open 53304-53741
2918 JASKOR010000012.1 GCA030586725_00208 gene open 54088-55863 spxB
2919 JASKOR010000012.1 GCA030586725_00209 gene open 56008-56922 araC
2920 JASKOR010000012.1 GCA030586725_00210 gene open 57075-58361
2921 JASKOR010000012.1 GCA030586725_00211 gene open 58382-59740
2922 JASKOR010000012.1 GCA030586725_00212 gene open 59807-60067
2923 JASKOR010000012.1 GCA030586725_00213 gene open 60395-60655
2924 JASKOR010000012.1 GCA030586725_00214 gene open 60910-62349
2925 JASKOR010000012.1 GCA030586725_00215 gene open 62587-63033
2926 JASKOR010000013.1 regulatory_region open 21921-22073 M-box riboswitch aptamer (ykoK leader)
2927 JASKOR010000013.1 GCA030586725_00216 CDS open 448-1542 _na     364_aa cystathionine gamma-synthase
2928 JASKOR010000013.1 GCA030586725_00217 CDS open 1544-2710 _na     388_aa cysteine-S-conjugate beta-lyase
2929 JASKOR010000013.1 GCA030586725_00218 CDS open 3223-3675 _na     150_aa HicB-like antitoxin of toxin-antitoxin system domain-containing protein
2930 JASKOR010000013.1 GCA030586725_00219 CDS open 3713-4144 _na     143_aa hypothetical protein
2931 JASKOR010000013.1 GCA030586725_00220 CDS open 4193-4555 _na     120_aa Transposase family protein
2932 JASKOR010000013.1 GCA030586725_00221 CDS open 4552-5148 _na     198_aa Integrase catalytic domain-containing protein
2933 JASKOR010000013.1 GCA030586725_00222 CDS open 5563-9930 _na     1455_aa ATP-binding protein
2934 JASKOR010000013.1 GCA030586725_00223 CDS open 9947-11470 _na     507_aa AAA-like domain-containing protein
2935 JASKOR010000013.1 GCA030586725_00224 CDS open 11601-11885 _na     94_aa hypothetical protein
2936 JASKOR010000013.1 GCA030586725_00225 CDS open 12189-12773 _na     194_aa DNA recombination protein
2937 JASKOR010000013.1 GCA030586725_00226 CDS open 12869-13105 _na     78_aa Methionine--tRNA ligase
2938 JASKOR010000013.1 GCA030586725_00227 CDS open 13098-13796 _na     232_aa 3-oxoacyl-ACP reductase
2939 JASKOR010000013.1 GCA030586725_00228 CDS open 14133-15512 _na     459_aa glmU bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU
2940 JASKOR010000013.1 GCA030586725_00229 CDS open 15521-16075 _na     184_aa ADP-ribose pyrophosphatase
2941 JASKOR010000013.1 GCA030586725_00230 CDS open 16088-16399 _na     103_aa macP cell wall synthase accessory phosphoprotein MacP
2942 JASKOR010000013.1 GCA030586725_00231 CDS open 16457-17149 _na     230_aa 5'-methylthioadenosine/adenosylhomocysteine nucleosidase
2943 JASKOR010000013.1 GCA030586725_00232 CDS open 17163-17471 _na     102_aa DUF898 domain-containing protein
2944 JASKOR010000013.1 GCA030586725_00233 CDS open 17583-19124 _na     513_aa abc-f ribosomal protection-like ABC-F family protein
2945 JASKOR010000013.1 GCA030586725_00234 CDS open 19601-20410 _na     269_aa Peptidyl-prolyl cis-trans isomerase
2946 JASKOR010000013.1 GCA030586725_00235 CDS open 20466-20885 _na     139_aa Nudix hydrolase family protein
2947 JASKOR010000013.1 GCA030586725_00236 CDS open 21044-21352 _na     102_aa hypothetical protein
2948 JASKOR010000013.1 GCA030586725_00237 CDS open 21303-21542 _na     79_aa DUF2798 domain-containing protein
2949 JASKOR010000013.1 GCA030586725_00238 CDS open 21624-21806 _na     60_aa pspC DNA-binding transcriptional activator PspC
2950 JASKOR010000013.1 GCA030586725_00239 CDS open 22351-25011 _na     886_aa mgtA magnesium-translocating P-type ATPase
2951 JASKOR010000013.1 GCA030586725_00240 CDS open 25109-25738 _na     209_aa upp uracil phosphoribosyltransferase
2952 JASKOR010000013.1 GCA030586725_00241 CDS open 25846-26436 _na     196_aa clpP ATP-dependent Clp protease proteolytic subunit
2953 JASKOR010000013.1 GCA030586725_00242 CDS open 26537-26806 _na     89_aa DUF2129 domain-containing protein
2954 JASKOR010000013.1 GCA030586725_00243 CDS open 26896-28056 _na     386_aa Branched-chain amino acid ABC transporter substrate-binding protein
2955 JASKOR010000013.1 GCA030586725_00244 CDS open 28196-29077 _na     293_aa livH Putative high-affinity branched-chain amino acid ABC transporter%2C permease protein LivH
2956 JASKOR010000013.1 GCA030586725_00245 CDS open 29081-30034 _na     317_aa Branched-chain amino acid ABC transporter permease
2957 JASKOR010000013.1 GCA030586725_00246 CDS open 30034-30798 _na     254_aa Branched-chain amino acid ABC superfamily ATP binding cassette transporter%2C ABC protein
2958 JASKOR010000013.1 GCA030586725_00247 CDS open 30798-31508 _na     236_aa livF ABC transporter%2C ATP-binding protein
2959 JASKOR010000013.1 GCA030586725_00248 CDS open 32133-32975 _na     280_aa ADP-dependent (S)-NAD(P)H-hydrate dehydratase
2960 JASKOR010000013.1 GCA030586725_00249 CDS open 33151-34491 _na     446_aa xseA exodeoxyribonuclease VII large subunit
2961 JASKOR010000013.1 GCA030586725_00250 CDS open 34469-34681 _na     70_aa exodeoxyribonuclease VII small subunit
2962 JASKOR010000013.1 GCA030586725_00251 CDS open 34678-35553 _na     291_aa Octaprenyl-diphosphate synthase
2963 JASKOR010000013.1 GCA030586725_00252 CDS open 35546-36370 _na     274_aa Ribosomal RNA large subunit methyltransferase J
2964 JASKOR010000013.1 GCA030586725_00253 CDS open 36354-36785 _na     143_aa Arginine repressor
2965 JASKOR010000013.1 GCA030586725_00254 CDS open 36794-38452 _na     552_aa recN DNA repair protein RecN
2966 JASKOR010000013.1 GCA030586725_00255 CDS open 38505-39233 _na     242_aa Serine/threonine protein phosphatase
2967 JASKOR010000013.1 GCA030586725_00256 CDS open 39594-40436 _na     280_aa Lyzozyme M1 (1%2C4-beta-N-acetylmuramidase)
2968 JASKOR010000013.1 GCA030586725_00257 CDS open 40657-41871 _na     404_aa ftsW putative peptidoglycan glycosyltransferase FtsW
2969 JASKOR010000013.1 GCA030586725_00258 CDS open 41939-44785 _na     948_aa ppc phosphoenolpyruvate carboxylase
2970 JASKOR010000013.1 GCA030586725_00259 CDS open 44947-45417 _na     156_aa sigW ECF family DNA-directed RNA polymerase sigma subunit SigW
2971 JASKOR010000013.1 GCA030586725_00260 CDS open 45404-46411 _na     335_aa Sigma factor regulator C-terminal domain-containing protein
2972 JASKOR010000013.1 GCA030586725_00261 CDS open 46534-47730 _na     398_aa tuf elongation factor Tu
2973 JASKOR010000013.1 GCA030586725_00216 gene open 448-1542
2974 JASKOR010000013.1 GCA030586725_00217 gene open 1544-2710
2975 JASKOR010000013.1 GCA030586725_00218 gene open 3223-3675
2976 JASKOR010000013.1 GCA030586725_00219 gene open 3713-4144
2977 JASKOR010000013.1 GCA030586725_00220 gene open 4193-4555
2978 JASKOR010000013.1 GCA030586725_00221 gene open 4552-5148
2979 JASKOR010000013.1 GCA030586725_00222 gene open 5563-9930
2980 JASKOR010000013.1 GCA030586725_00223 gene open 9947-11470
2981 JASKOR010000013.1 GCA030586725_00224 gene open 11601-11885
2982 JASKOR010000013.1 GCA030586725_00225 gene open 12189-12773
2983 JASKOR010000013.1 GCA030586725_00226 gene open 12869-13105
2984 JASKOR010000013.1 GCA030586725_00227 gene open 13098-13796
2985 JASKOR010000013.1 GCA030586725_00228 gene open 14133-15512 glmU
2986 JASKOR010000013.1 GCA030586725_00229 gene open 15521-16075
2987 JASKOR010000013.1 GCA030586725_00230 gene open 16088-16399 macP
2988 JASKOR010000013.1 GCA030586725_00231 gene open 16457-17149
2989 JASKOR010000013.1 GCA030586725_00232 gene open 17163-17471
2990 JASKOR010000013.1 GCA030586725_00233 gene open 17583-19124 abc-f
2991 JASKOR010000013.1 GCA030586725_00234 gene open 19601-20410
2992 JASKOR010000013.1 GCA030586725_00235 gene open 20466-20885
2993 JASKOR010000013.1 GCA030586725_00236 gene open 21044-21352
2994 JASKOR010000013.1 GCA030586725_00237 gene open 21303-21542
2995 JASKOR010000013.1 GCA030586725_00238 gene open 21624-21806 pspC
2996 JASKOR010000013.1 GCA030586725_00239 gene open 22351-25011 mgtA
2997 JASKOR010000013.1 GCA030586725_00240 gene open 25109-25738 upp
2998 JASKOR010000013.1 GCA030586725_00241 gene open 25846-26436 clpP
2999 JASKOR010000013.1 GCA030586725_00242 gene open 26537-26806
3000 JASKOR010000013.1 GCA030586725_00243 gene open 26896-28056