BAKTAGenome Explorer: Actinomyces oris clade-144 (GCA_034648895.1)
Select a Genome:
|
BAKTA Annotations for GCA_034648895.1
|
Search & Sort all 5751 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1 | JAXBCZ010000001.1 | GCA034648895_00430 | gene | open | 475206-475574 | ssrA | ||
| 2 | JAXBCZ010000001.1 | GCA034648895_00430 | tmRNA | open | 475206-475574 | ssrA | transfer-messenger RNA%2C SsrA | |
| 3 | JAXBCZ010000001.1 | rep_origin | open | 1667065-1667661 | ||||
| 4 | JAXBCZ010000001.1 | GCA034648895_00290 | gene | open | 316209-316501 | 5_ureB_sRNA | ||
| 5 | JAXBCZ010000001.1 | GCA034648895_00384 | gene | open | 411619-413163 | rrs | ||
| 6 | JAXBCZ010000001.1 | GCA034648895_00385 | gene | open | 413574-416761 | rrl | ||
| 7 | JAXBCZ010000001.1 | GCA034648895_00386 | gene | open | 416948-417064 | rrf | ||
| 8 | JAXBCZ010000001.1 | GCA034648895_01035 | gene | open | 1185856-1186247 | RNaseP_bact_a | ||
| 9 | JAXBCZ010000001.1 | GCA034648895_01150 | gene | open | 1303887-1304003 | rrf | ||
| 10 | JAXBCZ010000001.1 | GCA034648895_01151 | gene | open | 1304192-1307380 | rrl | ||
| 11 | JAXBCZ010000001.1 | GCA034648895_01152 | gene | open | 1307798-1309342 | rrs | ||
| 12 | JAXBCZ010000001.1 | GCA034648895_01595 | gene | open | 1845312-1845421 | Actinomyces-1 | ||
| 13 | JAXBCZ010000001.1 | GCA034648895_01664 | gene | open | 1924962-1925056 | Bacteria_small_SRP | ||
| 14 | JAXBCZ010000001.1 | GCA034648895_01809 | gene | open | 2095309-2095419 | Actinomyces-1 | ||
| 15 | JAXBCZ010000001.1 | GCA034648895_01813 | gene | open | 2097875-2097984 | Actinomyces-1 | ||
| 16 | JAXBCZ010000001.1 | GCA034648895_00290 | ncRNA | open | 316209-316501 | 5' ureB small RNA | ||
| 17 | JAXBCZ010000001.1 | GCA034648895_01035 | ncRNA | open | 1185856-1186247 | Bacterial RNase P class A | ||
| 18 | JAXBCZ010000001.1 | GCA034648895_01595 | ncRNA | open | 1845312-1845421 | Actinomyces-1 RNA | ||
| 19 | JAXBCZ010000001.1 | GCA034648895_01664 | ncRNA | open | 1924962-1925056 | Bacterial small signal recognition particle RNA | ||
| 20 | JAXBCZ010000001.1 | GCA034648895_01809 | ncRNA | open | 2095309-2095419 | Actinomyces-1 RNA | ||
| 21 | JAXBCZ010000001.1 | GCA034648895_01813 | ncRNA | open | 2097875-2097984 | Actinomyces-1 RNA | ||
| 22 | JAXBCZ010000001.1 | regulatory_region | open | 320247-320332 | ZMP/ZTP riboswitch aptamer (pfl RNA motif) | |||
| 23 | JAXBCZ010000001.1 | regulatory_region | open | 722889-723018 | FMN riboswitch aptamer (RFN element) | |||
| 24 | JAXBCZ010000001.1 | regulatory_region | open | 832563-832651 | TPP riboswitch aptamer (THI element) | |||
| 25 | JAXBCZ010000001.1 | regulatory_region | open | 1018764-1018914 | FMN riboswitch aptamer (RFN element) | |||
| 26 | JAXBCZ010000001.1 | regulatory_region | open | 1341931-1342086 | c-di-AMP riboswitch aptamer (ydaO/yuaA leader) | |||
| 27 | JAXBCZ010000001.1 | regulatory_region | open | 1394890-1394948 | msiK RNA | |||
| 28 | JAXBCZ010000001.1 | GCA034648895_00384 | rRNA | open | 411619-413163 | rrs | 16S ribosomal RNA | |
| 29 | JAXBCZ010000001.1 | GCA034648895_00385 | rRNA | open | 413574-416761 | rrl | 23S ribosomal RNA | |
| 30 | JAXBCZ010000001.1 | GCA034648895_00386 | rRNA | open | 416948-417064 | rrf | 5S ribosomal RNA | |
| 31 | JAXBCZ010000001.1 | GCA034648895_01150 | rRNA | open | 1303887-1304003 | rrf | 5S ribosomal RNA | |
| 32 | JAXBCZ010000001.1 | GCA034648895_01151 | rRNA | open | 1304192-1307380 | rrl | 23S ribosomal RNA | |
| 33 | JAXBCZ010000001.1 | GCA034648895_01152 | rRNA | open | 1307798-1309342 | rrs | 16S ribosomal RNA | |
| 34 | JAXBCZ010000001.1 | repeat_region | open | 1630065-1630225 | CRISPR array with 3 repeats of length 30%2C consensus sequence GGCCTCTACCCCCGCGTGCGCGGGGCTGAC and spacer length 31 | |||
| 35 | JAXBCZ010000001.1 | repeat_region | open | 1769943-1770195 | CRISPR array with 4 repeats of length 36%2C consensus sequence GCTGGGAATCAGTCACCAGACCCCTTGATAGACTTC and spacer length 28 | |||
| 36 | JAXBCZ010000001.1 | repeat_region | open | 1772030-1772652 | CRISPR array with 10 repeats of length 36%2C consensus sequence GCTGGGAATCAGTCACCAGACCCCTTGATAGACTTC and spacer length 28 | |||
| 37 | JAXBCZ010000001.1 | repeat_region | open | 2299531-2300233 | CRISPR array with 10 repeats of length 37%2C consensus sequence GTCTTAATGCACCTTCTGGTGCTGGGTGCTTTCTGAC and spacer length 35 | |||
| 38 | JAXBCZ010000001.1 | repeat_region | open | 2300704-2301549 | CRISPR array with 12 repeats of length 37%2C consensus sequence GTCTTAATGCACCTTCTGGTGCTGGGTGCTTTCTGAC and spacer length 35 | |||
| 39 | JAXBCZ010000001.1 | repeat_region | open | 2314155-2314564 | CRISPR array with 6 repeats of length 37%2C consensus sequence GTCTTAATGCACCTTCTGGTGCTGGGTGCTTTCTGAC and spacer length 35 | |||
| 40 | JAXBCZ010000001.1 | repeat_region | open | 2314992-2315903 | CRISPR array with 13 repeats of length 32%2C consensus sequence GTCTTAATGCACCTTCTGGTGCTGGGTGCTTT and spacer length 40 | |||
| 41 | JAXBCZ010000001.1 | GCA034648895_00001 | CDS | open | 19-240 | _na 73_aa | hypothetical protein | |
| 42 | JAXBCZ010000001.1 | GCA034648895_00002 | CDS | open | 241-1227 | _na 328_aa | Oxidoreductase | |
| 43 | JAXBCZ010000001.1 | GCA034648895_00003 | CDS | open | 1448-1687 | _na 79_aa | hypothetical protein | |
| 44 | JAXBCZ010000001.1 | GCA034648895_00004 | CDS | open | 1689-2702 | _na 337_aa | panC | pantoate--beta-alanine ligase |
| 45 | JAXBCZ010000001.1 | GCA034648895_00005 | CDS | open | 3034-3465 | _na 143_aa | panD | aspartate 1-decarboxylase |
| 46 | JAXBCZ010000001.1 | GCA034648895_00006 | CDS | open | 3633-5372 | _na 579_aa | lysS | lysine--tRNA ligase |
| 47 | JAXBCZ010000001.1 | GCA034648895_00007 | CDS | open | 5586-6155 | _na 189_aa | Cell wall synthesis protein Wag31 | |
| 48 | JAXBCZ010000001.1 | GCA034648895_00008 | CDS | open | 6152-6889 | _na 245_aa | Pentapeptide repeat-containing protein | |
| 49 | JAXBCZ010000001.1 | GCA034648895_00009 | CDS | open | 6966-7145 | _na 59_aa | hypothetical protein | |
| 50 | JAXBCZ010000001.1 | GCA034648895_00010 | CDS | open | 7100-9313 | _na 737_aa | ABC transporter permease | |
| 51 | JAXBCZ010000001.1 | GCA034648895_00011 | CDS | open | 9310-10164 | _na 284_aa | ABC transporter ATP-binding protein | |
| 52 | JAXBCZ010000001.1 | GCA034648895_00012 | CDS | open | 10161-10685 | _na 174_aa | padR | Transcription regulator PadR N-terminal domain-containing protein |
| 53 | JAXBCZ010000001.1 | GCA034648895_00013 | CDS | open | 10955-11581 | _na 208_aa | hypothetical protein | |
| 54 | JAXBCZ010000001.1 | GCA034648895_00014 | CDS | open | 11565-13196 | _na 543_aa | pTR2 | Amino acid/peptide transporter |
| 55 | JAXBCZ010000001.1 | GCA034648895_00015 | CDS | open | 13508-14776 | _na 422_aa | lldD | FMN hydroxy acid dehydrogenase domain-containing protein |
| 56 | JAXBCZ010000001.1 | GCA034648895_00016 | CDS | open | 15010-16527 | _na 505_aa | Mannitol dehydrogenase | |
| 57 | JAXBCZ010000001.1 | GCA034648895_00017 | CDS | open | 16745-17395 | _na 216_aa | Lactate utilization protein C | |
| 58 | JAXBCZ010000001.1 | GCA034648895_00018 | CDS | open | 17395-19128 | _na 577_aa | lutB | LutB/LldF family L-lactate oxidation iron-sulfur protein |
| 59 | JAXBCZ010000001.1 | GCA034648895_00019 | CDS | open | 19125-19955 | _na 276_aa | glpC | Cysteine-rich domain-containing protein |
| 60 | JAXBCZ010000001.1 | GCA034648895_00020 | CDS | open | 20508-20807 | _na 99_aa | hypothetical protein | |
| 61 | JAXBCZ010000001.1 | GCA034648895_00021 | CDS | open | 21124-21267 | _na 47_aa | hypothetical protein | |
| 62 | JAXBCZ010000001.1 | GCA034648895_00022 | CDS | open | 21731-23440 | _na 569_aa | lldP | L-lactate permease |
| 63 | JAXBCZ010000001.1 | GCA034648895_00023 | CDS | open | 23718-25790 | _na 690_aa | Heavy metal translocating P-type ATPase | |
| 64 | JAXBCZ010000001.1 | GCA034648895_00024 | CDS | open | 26025-27572 | _na 515_aa | glpK | glycerol kinase GlpK |
| 65 | JAXBCZ010000001.1 | GCA034648895_00025 | CDS | open | 27634-28374 | _na 246_aa | glpF | Glycerol uptake facilitator protein |
| 66 | JAXBCZ010000001.1 | GCA034648895_00026 | CDS | open | 28546-30357 | _na 603_aa | glpA | Glycerol-3-phosphate dehydrogenase |
| 67 | JAXBCZ010000001.1 | GCA034648895_00027 | CDS | open | 30750-31895 | _na 381_aa | Sugar-binding domain-containing protein | |
| 68 | JAXBCZ010000001.1 | GCA034648895_00028 | CDS | open | 32023-32655 | _na 210_aa | amino-acid N-acetyltransferase | |
| 69 | JAXBCZ010000001.1 | GCA034648895_00029 | CDS | open | 32795-33280 | _na 161_aa | SRPBCC family protein | |
| 70 | JAXBCZ010000001.1 | GCA034648895_00030 | CDS | open | 33403-34320 | _na 305_aa | Tat pathway signal sequence domain protein | |
| 71 | JAXBCZ010000001.1 | GCA034648895_00031 | CDS | open | 34766-34957 | _na 63_aa | ABC transporter permease | |
| 72 | JAXBCZ010000001.1 | GCA034648895_00032 | CDS | open | 35080-36075 | _na 331_aa | Adenine DNA glycosylase | |
| 73 | JAXBCZ010000001.1 | GCA034648895_00033 | CDS | open | 36287-37534 | _na 415_aa | DUF4232 domain-containing protein | |
| 74 | JAXBCZ010000001.1 | GCA034648895_00034 | CDS | open | 37593-38660 | _na 355_aa | disA | DNA integrity scanning diadenylate cyclase DisA |
| 75 | JAXBCZ010000001.1 | GCA034648895_00035 | CDS | open | 38986-40404 | _na 472_aa | radA | DNA repair protein RadA |
| 76 | JAXBCZ010000001.1 | GCA034648895_00036 | CDS | open | 40546-42636 | _na 696_aa | tkt | transketolase |
| 77 | JAXBCZ010000001.1 | GCA034648895_00037 | CDS | open | 42848-44230 | _na 460_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 78 | JAXBCZ010000001.1 | GCA034648895_00038 | CDS | open | 44424-45893 | _na 489_aa | yqiK | Band 7 domain-containing protein |
| 79 | JAXBCZ010000001.1 | GCA034648895_00039 | CDS | open | 45997-46500 | _na 167_aa | Nodulation efficiency protein D | |
| 80 | JAXBCZ010000001.1 | GCA034648895_00040 | CDS | open | 46606-48801 | _na 731_aa | DUF4439 domain-containing protein | |
| 81 | JAXBCZ010000001.1 | GCA034648895_00041 | CDS | open | 48975-50123 | _na 382_aa | dhaK | Dihydroxyacetone kinase%2C DhaK subunit |
| 82 | JAXBCZ010000001.1 | GCA034648895_00042 | CDS | open | 50191-50850 | _na 219_aa | dhaL | dihydroxyacetone kinase subunit DhaL |
| 83 | JAXBCZ010000001.1 | GCA034648895_00043 | CDS | open | 50847-51272 | _na 141_aa | phosphoenolpyruvate--glycerone phosphotransferase | |
| 84 | JAXBCZ010000001.1 | GCA034648895_00044 | CDS | open | 51318-51986 | _na 222_aa | trkA | RCK N-terminal domain-containing protein |
| 85 | JAXBCZ010000001.1 | GCA034648895_00045 | CDS | open | 52027-53622 | _na 531_aa | MFS transporter | |
| 86 | JAXBCZ010000001.1 | GCA034648895_00046 | CDS | open | 53685-54455 | _na 256_aa | acrR | HTH tetR-type domain-containing protein |
| 87 | JAXBCZ010000001.1 | GCA034648895_00047 | CDS | open | 54518-56131 | _na 537_aa | trkH | TrkH family potassium uptake protein |
| 88 | JAXBCZ010000001.1 | GCA034648895_00048 | CDS | open | 56418-56660 | _na 80_aa | Helix-turn-helix domain-containing protein | |
| 89 | JAXBCZ010000001.1 | GCA034648895_00049 | CDS | open | 56807-56905 | _na 32_aa | 30S ribosomal protein bS22 | |
| 90 | JAXBCZ010000001.1 | GCA034648895_00050 | CDS | open | 57096-58313 | _na 405_aa | UDP-N-acetylmuramate dehydrogenase | |
| 91 | JAXBCZ010000001.1 | GCA034648895_00051 | CDS | open | 58623-59708 | _na 361_aa | adenosine deaminase | |
| 92 | JAXBCZ010000001.1 | GCA034648895_00052 | CDS | open | 59891-60844 | _na 317_aa | DUF559 domain-containing protein | |
| 93 | JAXBCZ010000001.1 | GCA034648895_00053 | CDS | open | 61242-62453 | _na 403_aa | Aminoglycoside phosphotransferase domain-containing protein | |
| 94 | JAXBCZ010000001.1 | GCA034648895_00054 | CDS | open | 62545-63555 | _na 336_aa | Serine/arginine repetitive matrix protein 1 | |
| 95 | JAXBCZ010000001.1 | GCA034648895_00055 | CDS | open | 63784-64998 | _na 404_aa | aspB | Aminotransferase |
| 96 | JAXBCZ010000001.1 | GCA034648895_00057 | CDS | open | 65367-65603 | _na 78_aa | secE | preprotein translocase subunit SecE |
| 97 | JAXBCZ010000001.1 | GCA034648895_00058 | CDS | open | 65739-66587 | _na 282_aa | nusG | transcription termination/antitermination protein NusG |
| 98 | JAXBCZ010000001.1 | GCA034648895_00059 | CDS | open | 66847-67278 | _na 143_aa | rplK | 50S ribosomal protein L11 |
| 99 | JAXBCZ010000001.1 | GCA034648895_00060 | CDS | open | 67377-68066 | _na 229_aa | rplA | 50S ribosomal protein L1 |
| 100 | JAXBCZ010000001.1 | GCA034648895_00061 | CDS | open | 68368-70062 | _na 564_aa | ompA | OmpA family protein |
| 101 | JAXBCZ010000001.1 | GCA034648895_00062 | CDS | open | 70077-71543 | _na 488_aa | ompA | OmpA family protein |
| 102 | JAXBCZ010000001.1 | GCA034648895_00063 | CDS | open | 71776-72813 | _na 345_aa | IS630 family transposase | |
| 103 | JAXBCZ010000001.1 | GCA034648895_00064 | CDS | open | 73329-73943 | _na 204_aa | DUF4352 domain-containing protein | |
| 104 | JAXBCZ010000001.1 | GCA034648895_00065 | CDS | open | 74099-74623 | _na 174_aa | ompA | OmpA family protein |
| 105 | JAXBCZ010000001.1 | GCA034648895_00066 | CDS | open | 74643-74996 | _na 117_aa | hypothetical protein | |
| 106 | JAXBCZ010000001.1 | GCA034648895_00067 | CDS | open | 75158-75766 | _na 202_aa | Tat pathway signal sequence domain protein | |
| 107 | JAXBCZ010000001.1 | GCA034648895_00068 | CDS | open | 75763-76392 | _na 209_aa | lpqN | Lipoprotein LpqN |
| 108 | JAXBCZ010000001.1 | GCA034648895_00069 | CDS | open | 76437-77513 | _na 358_aa | MBG domain-containing protein | |
| 109 | JAXBCZ010000001.1 | GCA034648895_00070 | CDS | open | 78255-78500 | _na 81_aa | hypothetical protein | |
| 110 | JAXBCZ010000001.1 | GCA034648895_00071 | CDS | open | 78876-80372 | _na 498_aa | hypothetical protein | |
| 111 | JAXBCZ010000001.1 | GCA034648895_00072 | CDS | open | 80484-81167 | _na 227_aa | Putative Flp pilus-assembly TadG-like N-terminal domain-containing protein | |
| 112 | JAXBCZ010000001.1 | GCA034648895_00073 | CDS | open | 81176-82888 | _na 570_aa | OmpA-like domain-containing protein | |
| 113 | JAXBCZ010000001.1 | GCA034648895_00074 | CDS | open | 82992-83228 | _na 78_aa | Flp/Fap pilin component | |
| 114 | JAXBCZ010000001.1 | GCA034648895_00075 | CDS | open | 83344-83976 | _na 210_aa | Response regulator receiver domain protein | |
| 115 | JAXBCZ010000001.1 | GCA034648895_00076 | CDS | open | 83973-85076 | _na 367_aa | histidine kinase | |
| 116 | JAXBCZ010000001.1 | GCA034648895_00077 | CDS | open | 85207-86097 | _na 296_aa | Bacterial type II secretion system protein F domain protein | |
| 117 | JAXBCZ010000001.1 | GCA034648895_00078 | CDS | open | 86099-87025 | _na 308_aa | Bacterial type II secretion system protein F domain protein | |
| 118 | JAXBCZ010000001.1 | GCA034648895_00079 | CDS | open | 87022-88329 | _na 435_aa | Type II/IV secretion system protein | |
| 119 | JAXBCZ010000001.1 | GCA034648895_00080 | CDS | open | 88331-88747 | _na 138_aa | tadE | Pilus assembly protein TadE |
| 120 | JAXBCZ010000001.1 | GCA034648895_00081 | CDS | open | 88747-90285 | _na 512_aa | Response regulator receiver domain protein | |
| 121 | JAXBCZ010000001.1 | GCA034648895_00082 | CDS | open | 90285-91004 | _na 239_aa | cpaB | Flp pilus assembly protein CpaB |
| 122 | JAXBCZ010000001.1 | GCA034648895_00083 | CDS | open | 91001-91786 | _na 261_aa | hypothetical protein | |
| 123 | JAXBCZ010000001.1 | GCA034648895_00084 | CDS | open | 91991-92800 | _na 269_aa | Prepilin type IV endopeptidase peptidase domain-containing protein | |
| 124 | JAXBCZ010000001.1 | GCA034648895_00085 | CDS | open | 92812-93252 | _na 146_aa | DUF192 domain-containing protein | |
| 125 | JAXBCZ010000001.1 | GCA034648895_00086 | CDS | open | 93713-94087 | _na 124_aa | rpsL | 30S ribosomal protein S12 |
| 126 | JAXBCZ010000001.1 | GCA034648895_00087 | CDS | open | 94087-94557 | _na 156_aa | rpsG | 30S ribosomal protein S7 |
| 127 | JAXBCZ010000001.1 | GCA034648895_00088 | CDS | open | 94603-96744 | _na 713_aa | fusA | elongation factor G |
| 128 | JAXBCZ010000001.1 | GCA034648895_00089 | CDS | open | 96945-98135 | _na 396_aa | tuf | elongation factor Tu |
| 129 | JAXBCZ010000001.1 | GCA034648895_00090 | CDS | open | 98463-101333 | _na 956_aa | Fimbrial protein | |
| 130 | JAXBCZ010000001.1 | GCA034648895_00091 | CDS | open | 101483-103090 | _na 535_aa | Fimbrial protein | |
| 131 | JAXBCZ010000001.1 | GCA034648895_00092 | CDS | open | 103712-106450 | _na 912_aa | Gram-positive cocci surface proteins LPxTG domain-containing protein | |
| 132 | JAXBCZ010000001.1 | GCA034648895_00093 | CDS | open | 106600-108207 | _na 535_aa | Fimbrial protein | |
| 133 | JAXBCZ010000001.1 | GCA034648895_00094 | CDS | open | 108443-109681 | _na 412_aa | Sortase | |
| 134 | JAXBCZ010000001.1 | GCA034648895_00095 | CDS | open | 109939-110247 | _na 102_aa | rpsJ | 30S ribosomal protein S10 |
| 135 | JAXBCZ010000001.1 | GCA034648895_00096 | CDS | open | 110256-110924 | _na 222_aa | rplC | 50S ribosomal protein L3 |
| 136 | JAXBCZ010000001.1 | GCA034648895_00097 | CDS | open | 110929-111573 | _na 214_aa | rplD | 50S ribosomal protein L4 |
| 137 | JAXBCZ010000001.1 | GCA034648895_00098 | CDS | open | 111570-111872 | _na 100_aa | rplW | 50S ribosomal protein L23 |
| 138 | JAXBCZ010000001.1 | GCA034648895_00099 | CDS | open | 111899-112735 | _na 278_aa | rplB | 50S ribosomal protein L2 |
| 139 | JAXBCZ010000001.1 | GCA034648895_00100 | CDS | open | 112750-113028 | _na 92_aa | rpsS | 30S ribosomal protein S19 |
| 140 | JAXBCZ010000001.1 | GCA034648895_00101 | CDS | open | 113060-113437 | _na 125_aa | rplV | 50S ribosomal protein L22 |
| 141 | JAXBCZ010000001.1 | GCA034648895_00102 | CDS | open | 113437-114258 | _na 273_aa | rpsC | 30S ribosomal protein S3 |
| 142 | JAXBCZ010000001.1 | GCA034648895_00103 | CDS | open | 114262-114681 | _na 139_aa | rplP | 50S ribosomal protein L16 |
| 143 | JAXBCZ010000001.1 | GCA034648895_00104 | CDS | open | 114681-114926 | _na 81_aa | rpmC | 50S ribosomal protein L29 |
| 144 | JAXBCZ010000001.1 | GCA034648895_00105 | CDS | open | 114923-115216 | _na 97_aa | rpsQ | 30S ribosomal protein S17 |
| 145 | JAXBCZ010000001.1 | GCA034648895_00106 | CDS | open | 116000-116368 | _na 122_aa | rplN | 50S ribosomal protein L14 |
| 146 | JAXBCZ010000001.1 | GCA034648895_00107 | CDS | open | 116371-116715 | _na 114_aa | rplX | 50S ribosomal protein L24 |
| 147 | JAXBCZ010000001.1 | GCA034648895_00108 | CDS | open | 116718-117275 | _na 185_aa | rplE | 50S ribosomal protein L5 |
| 148 | JAXBCZ010000001.1 | GCA034648895_00109 | CDS | open | 117277-117462 | _na 61_aa | rpsN | type Z 30S ribosomal protein S14 |
| 149 | JAXBCZ010000001.1 | GCA034648895_00110 | CDS | open | 117521-117919 | _na 132_aa | rpsH | 30S ribosomal protein S8 |
| 150 | JAXBCZ010000001.1 | GCA034648895_00111 | CDS | open | 117941-118480 | _na 179_aa | rplF | 50S ribosomal protein L6 |
| 151 | JAXBCZ010000001.1 | GCA034648895_00112 | CDS | open | 118483-118863 | _na 126_aa | rplR | 50S ribosomal protein L18 |
| 152 | JAXBCZ010000001.1 | GCA034648895_00113 | CDS | open | 118898-119605 | _na 235_aa | rpsE | 30S ribosomal protein S5 |
| 153 | JAXBCZ010000001.1 | GCA034648895_00114 | CDS | open | 119605-119811 | _na 68_aa | rpmD | 50S ribosomal protein L30 |
| 154 | JAXBCZ010000001.1 | GCA034648895_00115 | CDS | open | 119813-120289 | _na 158_aa | rplO | 50S ribosomal protein L15 |
| 155 | JAXBCZ010000001.1 | GCA034648895_00116 | CDS | open | 120641-121945 | _na 434_aa | secY | preprotein translocase subunit SecY |
| 156 | JAXBCZ010000001.1 | GCA034648895_00117 | CDS | open | 121942-122529 | _na 195_aa | adk | adenylate kinase |
| 157 | JAXBCZ010000001.1 | GCA034648895_00118 | CDS | open | 122671-123552 | _na 293_aa | map | type I methionyl aminopeptidase |
| 158 | JAXBCZ010000001.1 | GCA034648895_00119 | CDS | open | 123923-124144 | _na 73_aa | infA | translation initiation factor IF-1 |
| 159 | JAXBCZ010000001.1 | GCA034648895_00120 | CDS | open | 124178-124291 | _na 37_aa | rpmJ | 50S ribosomal protein L36 |
| 160 | JAXBCZ010000001.1 | GCA034648895_00121 | CDS | open | 124457-124831 | _na 124_aa | rpsM | 30S ribosomal protein S13 |
| 161 | JAXBCZ010000001.1 | GCA034648895_00122 | CDS | open | 124894-125295 | _na 133_aa | rpsK | 30S ribosomal protein S11 |
| 162 | JAXBCZ010000001.1 | GCA034648895_00123 | CDS | open | 125453-126454 | _na 333_aa | DNA-directed RNA polymerase subunit alpha | |
| 163 | JAXBCZ010000001.1 | GCA034648895_00124 | CDS | open | 126485-127231 | _na 248_aa | rplQ | 50S ribosomal protein L17 |
| 164 | JAXBCZ010000001.1 | GCA034648895_00125 | CDS | open | 127982-129103 | _na 373_aa | Tetratricopeptide repeat protein | |
| 165 | JAXBCZ010000001.1 | GCA034648895_00126 | CDS | open | 129239-131068 | _na 609_aa | Tetratricopeptide repeat protein | |
| 166 | JAXBCZ010000001.1 | GCA034648895_00127 | CDS | open | 131215-131943 | _na 242_aa | sapB | MgtC/SapB/SrpB/YhiD N-terminal domain-containing protein |
| 167 | JAXBCZ010000001.1 | GCA034648895_00128 | CDS | open | 132282-133757 | _na 491_aa | pntB | NAD(P) transhydrogenase subunit beta |
| 168 | JAXBCZ010000001.1 | GCA034648895_00129 | CDS | open | 133773-135323 | _na 516_aa | pntA | Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha |
| 169 | JAXBCZ010000001.1 | GCA034648895_00130 | CDS | open | 135512-136267 | _na 251_aa | nagC | ROK family protein |
| 170 | JAXBCZ010000001.1 | GCA034648895_00131 | CDS | open | 136308-137204 | _na 298_aa | truA | tRNA pseudouridine(38-40) synthase TruA |
| 171 | JAXBCZ010000001.1 | GCA034648895_00132 | CDS | open | 137463-137906 | _na 147_aa | rplM | 50S ribosomal protein L13 |
| 172 | JAXBCZ010000001.1 | GCA034648895_00133 | CDS | open | 137950-138444 | _na 164_aa | rpsI | 30S ribosomal protein S9 |
| 173 | JAXBCZ010000001.1 | GCA034648895_00134 | CDS | open | 138759-140120 | _na 453_aa | glmM | phosphoglucosamine mutase |
| 174 | JAXBCZ010000001.1 | GCA034648895_00135 | CDS | open | 140420-140881 | _na 153_aa | Tat pathway signal sequence domain protein | |
| 175 | JAXBCZ010000001.1 | GCA034648895_00136 | CDS | open | 140988-144185 | _na 1065_aa | Transcriptional regulator | |
| 176 | JAXBCZ010000001.1 | GCA034648895_00137 | CDS | open | 144202-145035 | _na 277_aa | Transport permease protein | |
| 177 | JAXBCZ010000001.1 | GCA034648895_00138 | CDS | open | 145032-146069 | _na 345_aa | rbbA | Daunorubicin/doxorubicin resistance ATP-binding protein DrrA |
| 178 | JAXBCZ010000001.1 | GCA034648895_00139 | CDS | open | 146128-146766 | _na 212_aa | hypothetical protein | |
| 179 | JAXBCZ010000001.1 | GCA034648895_00140 | CDS | open | 147448-147888 | _na 146_aa | XRE family transcriptional regulator | |
| 180 | JAXBCZ010000001.1 | GCA034648895_00141 | CDS | open | 147860-148981 | _na 373_aa | AB hydrolase-1 domain-containing protein | |
| 181 | JAXBCZ010000001.1 | GCA034648895_00142 | CDS | open | 148923-149138 | _na 71_aa | hypothetical protein | |
| 182 | JAXBCZ010000001.1 | GCA034648895_00143 | CDS | open | 149527-150510 | _na 327_aa | coaA | type I pantothenate kinase |
| 183 | JAXBCZ010000001.1 | GCA034648895_00144 | CDS | open | 150742-152577 | _na 611_aa | glmS | glutamine--fructose-6-phosphate transaminase (isomerizing) |
| 184 | JAXBCZ010000001.1 | GCA034648895_00145 | CDS | open | 152647-153072 | _na 141_aa | Holo-[acyl-carrier-protein] synthase | |
| 185 | JAXBCZ010000001.1 | GCA034648895_00146 | CDS | open | 153316-155250 | _na 644_aa | ADP-dependent (S)-NAD(P)H-hydrate dehydratase | |
| 186 | JAXBCZ010000001.1 | GCA034648895_00147 | CDS | open | 155359-156687 | _na 442_aa | alr | alanine racemase |
| 187 | JAXBCZ010000001.1 | GCA034648895_00148 | CDS | open | 156768-157403 | _na 211_aa | tsaE | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE |
| 188 | JAXBCZ010000001.1 | GCA034648895_00149 | CDS | open | 157400-158449 | _na 349_aa | Lipoprotein | |
| 189 | JAXBCZ010000001.1 | GCA034648895_00150 | CDS | open | 158459-159217 | _na 252_aa | tsaB | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB |
| 190 | JAXBCZ010000001.1 | GCA034648895_00151 | CDS | open | 159243-159833 | _na 196_aa | rimI | ribosomal protein S18-alanine N-acetyltransferase |
| 191 | JAXBCZ010000001.1 | GCA034648895_00152 | CDS | open | 160222-160974 | _na 250_aa | Succinate dehydrogenase cytochrome B subunit%2C b558 family | |
| 192 | JAXBCZ010000001.1 | GCA034648895_00153 | CDS | open | 160987-162987 | _na 666_aa | sdhA | Succinate dehydrogenase flavoprotein subunit |
| 193 | JAXBCZ010000001.1 | GCA034648895_00154 | CDS | open | 162984-163754 | _na 256_aa | sdhB | succinate dehydrogenase |
| 194 | JAXBCZ010000001.1 | GCA034648895_00155 | CDS | open | 163851-164087 | _na 78_aa | hypothetical protein | |
| 195 | JAXBCZ010000001.1 | GCA034648895_00156 | CDS | open | 164537-164791 | _na 84_aa | Transcriptional regulator%2C AbiEi antitoxin%2C Type IV TA system | |
| 196 | JAXBCZ010000001.1 | GCA034648895_00157 | CDS | open | 164989-165675 | _na 228_aa | Haloacid dehalogenase | |
| 197 | JAXBCZ010000001.1 | GCA034648895_00158 | CDS | open | 165766-166383 | _na 205_aa | tag | DNA-3-methyladenine glycosylase I |
| 198 | JAXBCZ010000001.1 | GCA034648895_00159 | CDS | open | 166547-167593 | _na 348_aa | tsaD | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD |
| 199 | JAXBCZ010000001.1 | GCA034648895_00160 | CDS | open | 167644-168372 | _na 242_aa | acrR | Tetracyclin repressor%2C C-terminal all-alpha domain protein |
| 200 | JAXBCZ010000001.1 | GCA034648895_00161 | CDS | open | 168493-172326 | _na 1277_aa | cydD | thiol reductant ABC exporter subunit CydD |
| 201 | JAXBCZ010000001.1 | GCA034648895_00162 | CDS | open | 172456-172770 | _na 104_aa | hypothetical protein | |
| 202 | JAXBCZ010000001.1 | GCA034648895_00163 | CDS | open | 173899-174042 | _na 47_aa | hypothetical protein | |
| 203 | JAXBCZ010000001.1 | GCA034648895_00164 | CDS | open | 174280-175512 | _na 410_aa | ybdK | glutamate--cysteine ligase |
| 204 | JAXBCZ010000001.1 | GCA034648895_00165 | CDS | open | 175593-176861 | _na 422_aa | trmN6 | Class I SAM-dependent methyltransferase |
| 205 | JAXBCZ010000001.1 | GCA034648895_00166 | CDS | open | 177068-177871 | _na 267_aa | DUF218 domain-containing protein | |
| 206 | JAXBCZ010000001.1 | GCA034648895_00167 | CDS | open | 178122-178418 | _na 98_aa | groES | co-chaperone GroES |
| 207 | JAXBCZ010000001.1 | GCA034648895_00168 | CDS | open | 178596-178898 | _na 100_aa | whiB | Transcriptional regulator WhiB |
| 208 | JAXBCZ010000001.1 | GCA034648895_00169 | CDS | open | 179281-180885 | _na 534_aa | guaB | IMP dehydrogenase |
| 209 | JAXBCZ010000001.1 | GCA034648895_00170 | CDS | open | 181020-181802 | _na 260_aa | DNA polymerase III subunit epsilon | |
| 210 | JAXBCZ010000001.1 | GCA034648895_00171 | CDS | open | 182162-183286 | _na 374_aa | guaB3 | GuaB3 family IMP dehydrogenase-related protein |
| 211 | JAXBCZ010000001.1 | GCA034648895_00172 | CDS | open | 183453-183719 | _na 88_aa | ptsH | PTS family fructose porter%2C IIA/HPr component |
| 212 | JAXBCZ010000001.1 | GCA034648895_00173 | CDS | open | 183878-184567 | _na 229_aa | DUF6891 domain-containing protein | |
| 213 | JAXBCZ010000001.1 | GCA034648895_00174 | CDS | open | 184746-184976 | _na 76_aa | LPXTG-motif protein cell wall anchor domain protein | |
| 214 | JAXBCZ010000001.1 | GCA034648895_00175 | CDS | open | 185007-186749 | _na 580_aa | putP | Na+/galactose cotransporter |
| 215 | JAXBCZ010000001.1 | GCA034648895_00176 | CDS | open | 186886-187452 | _na 188_aa | Ribonuclease H | |
| 216 | JAXBCZ010000001.1 | GCA034648895_00177 | CDS | open | 187563-188033 | _na 156_aa | gtrA | GtrA family protein |
| 217 | JAXBCZ010000001.1 | GCA034648895_00178 | CDS | open | 188052-188801 | _na 249_aa | DNA-binding response regulator | |
| 218 | JAXBCZ010000001.1 | GCA034648895_00179 | CDS | open | 188798-190123 | _na 441_aa | histidine kinase | |
| 219 | JAXBCZ010000001.1 | GCA034648895_00180 | CDS | open | 190120-191010 | _na 296_aa | ABC transporter permease | |
| 220 | JAXBCZ010000001.1 | GCA034648895_00181 | CDS | open | 191007-191930 | _na 307_aa | mutG | MutG family lantibiotic protection ABC transporter permease subunit |
| 221 | JAXBCZ010000001.1 | GCA034648895_00182 | CDS | open | 191927-193030 | _na 367_aa | ABC transporter domain-containing protein | |
| 222 | JAXBCZ010000001.1 | GCA034648895_00183 | CDS | open | 193415-194599 | _na 394_aa | ackA | Acetate kinase |
| 223 | JAXBCZ010000001.1 | GCA034648895_00184 | CDS | open | 194717-196771 | _na 684_aa | pta | phosphate acetyltransferase |
| 224 | JAXBCZ010000001.1 | GCA034648895_00185 | CDS | open | 196936-197991 | _na 351_aa | PepSY domain-containing protein | |
| 225 | JAXBCZ010000001.1 | GCA034648895_00186 | CDS | open | 198001-198402 | _na 133_aa | MFS transporter | |
| 226 | JAXBCZ010000001.1 | GCA034648895_00187 | CDS | open | 198570-199343 | _na 257_aa | putative membrane transporter protein | |
| 227 | JAXBCZ010000001.1 | GCA034648895_00188 | CDS | open | 199478-200476 | _na 332_aa | ycjR | Xylose isomerase-like TIM barrel domain-containing protein |
| 228 | JAXBCZ010000001.1 | GCA034648895_00189 | CDS | open | 200566-201792 | _na 408_aa | mviM | Gfo/Idh/MocA-like oxidoreductase N-terminal domain-containing protein |
| 229 | JAXBCZ010000001.1 | GCA034648895_00190 | CDS | open | 202751-203782 | _na 343_aa | lacI | LacI family transcriptional regulator |
| 230 | JAXBCZ010000001.1 | GCA034648895_00191 | CDS | open | 204934-205251 | _na 105_aa | hypothetical protein | |
| 231 | JAXBCZ010000001.1 | GCA034648895_00192 | CDS | open | 205466-206392 | _na 308_aa | iolE | myo-inosose-2 dehydratase |
| 232 | JAXBCZ010000001.1 | GCA034648895_00193 | CDS | open | 206636-208291 | _na 551_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 233 | JAXBCZ010000001.1 | GCA034648895_00194 | CDS | open | 208387-209583 | _na 398_aa | mviM | Gfo/Idh/MocA-like oxidoreductase N-terminal domain-containing protein |
| 234 | JAXBCZ010000001.1 | GCA034648895_00195 | CDS | open | 209861-210940 | _na 359_aa | lacI | LacI family transcriptional regulator |
| 235 | JAXBCZ010000001.1 | GCA034648895_00196 | CDS | open | 211021-211983 | _na 320_aa | galM | aldose-1-epimerase |
| 236 | JAXBCZ010000001.1 | GCA034648895_00197 | CDS | open | 212768-213757 | _na 329_aa | iolG | inositol 2-dehydrogenase |
| 237 | JAXBCZ010000001.1 | GCA034648895_00198 | CDS | open | 213947-215023 | _na 358_aa | talA | Transaldolase |
| 238 | JAXBCZ010000001.1 | GCA034648895_00199 | CDS | open | 215176-215928 | _na 250_aa | mngR | HTH gntR-type domain-containing protein |
| 239 | JAXBCZ010000001.1 | GCA034648895_00200 | CDS | open | 216181-217218 | _na 345_aa | rbsK | Carbohydrate kinase PfkB domain-containing protein |
| 240 | JAXBCZ010000001.1 | GCA034648895_00201 | CDS | open | 217229-218143 | _na 304_aa | fbaB | Cgl0159-like domain-containing protein |
| 241 | JAXBCZ010000001.1 | GCA034648895_00202 | CDS | open | 218269-219183 | _na 304_aa | iolB | 5-deoxy-glucuronate isomerase |
| 242 | JAXBCZ010000001.1 | GCA034648895_00203 | CDS | open | 219237-221144 | _na 635_aa | iolD | 3D-(3%2C5/4)-trihydroxycyclohexane-1%2C2-dione acylhydrolase (decyclizing) |
| 243 | JAXBCZ010000001.1 | GCA034648895_00204 | CDS | open | 221503-222996 | _na 497_aa | adhE | Methylmalonate-semialdehyde dehydrogenase (Acylating) |
| 244 | JAXBCZ010000001.1 | GCA034648895_00205 | CDS | open | 223118-223687 | _na 189_aa | hypothetical protein | |
| 245 | JAXBCZ010000001.1 | GCA034648895_00206 | CDS | open | 224446-225375 | _na 309_aa | ycjR | Inosose dehydratase |
| 246 | JAXBCZ010000001.1 | GCA034648895_00207 | CDS | open | 225437-226447 | _na 336_aa | Inositol 2-dehydrogenase | |
| 247 | JAXBCZ010000001.1 | GCA034648895_00208 | CDS | open | 226744-227613 | _na 289_aa | ycjR | Xylose isomerase-like TIM barrel domain-containing protein |
| 248 | JAXBCZ010000001.1 | GCA034648895_00209 | CDS | open | 227772-229388 | _na 538_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 249 | JAXBCZ010000001.1 | GCA034648895_00210 | CDS | open | 229570-230847 | _na 425_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 250 | JAXBCZ010000001.1 | GCA034648895_00211 | CDS | open | 231004-232170 | _na 388_aa | frmA | Enoyl reductase (ER) domain-containing protein |
| 251 | JAXBCZ010000001.1 | GCA034648895_00212 | CDS | open | 232732-233001 | _na 89_aa | Mandelate racemase | |
| 252 | JAXBCZ010000001.1 | GCA034648895_00213 | CDS | open | 233450-235036 | _na 528_aa | guaA | glutamine-hydrolyzing GMP synthase |
| 253 | JAXBCZ010000001.1 | GCA034648895_00214 | CDS | open | 236179-236592 | _na 137_aa | SHOCT domain-containing protein | |
| 254 | JAXBCZ010000001.1 | GCA034648895_00215 | CDS | open | 237303-238169 | _na 288_aa | DUF4352 domain-containing protein | |
| 255 | JAXBCZ010000001.1 | GCA034648895_00216 | CDS | open | 238263-239447 | _na 394_aa | ABC transporter permease | |
| 256 | JAXBCZ010000001.1 | GCA034648895_00217 | CDS | open | 239434-240576 | _na 380_aa | ABC transporter permease | |
| 257 | JAXBCZ010000001.1 | GCA034648895_00218 | CDS | open | 240578-241561 | _na 327_aa | ABC transporter%2C ATP-binding protein | |
| 258 | JAXBCZ010000001.1 | GCA034648895_00219 | CDS | open | 241765-242901 | _na 378_aa | histidine kinase | |
| 259 | JAXBCZ010000001.1 | GCA034648895_00220 | CDS | open | 242898-243578 | _na 226_aa | DNA-binding response regulator | |
| 260 | JAXBCZ010000001.1 | GCA034648895_00221 | CDS | open | 243702-243941 | _na 79_aa | Toxin | |
| 261 | JAXBCZ010000001.1 | GCA034648895_00222 | CDS | open | 243938-244171 | _na 77_aa | copG | Ribbon-helix-helix protein CopG domain-containing protein |
| 262 | JAXBCZ010000001.1 | GCA034648895_00223 | CDS | open | 244359-245054 | _na 231_aa | Prolyl oligopeptidase family serine peptidase | |
| 263 | JAXBCZ010000001.1 | GCA034648895_00224 | CDS | open | 245044-245688 | _na 214_aa | Flavodoxin | |
| 264 | JAXBCZ010000001.1 | GCA034648895_00225 | CDS | open | 245744-246364 | _na 206_aa | NAD(P)H-binding protein | |
| 265 | JAXBCZ010000001.1 | GCA034648895_00226 | CDS | open | 246562-247263 | _na 233_aa | hypothetical protein | |
| 266 | JAXBCZ010000001.1 | GCA034648895_00227 | CDS | open | 247309-247584 | _na 91_aa | hypothetical protein | |
| 267 | JAXBCZ010000001.1 | GCA034648895_00228 | CDS | open | 247669-247824 | _na 51_aa | response regulator transcription factor | |
| 268 | JAXBCZ010000001.1 | GCA034648895_00229 | CDS | open | 247943-248128 | _na 61_aa | hypothetical protein | |
| 269 | JAXBCZ010000001.1 | GCA034648895_00230 | CDS | open | 248149-249465 | _na 438_aa | DUF4143 domain-containing protein | |
| 270 | JAXBCZ010000001.1 | GCA034648895_00231 | CDS | open | 249686-250138 | _na 150_aa | HTH cro/C1-type domain-containing protein | |
| 271 | JAXBCZ010000001.1 | GCA034648895_00232 | CDS | open | 250187-251155 | _na 322_aa | Cell filamentation protein Fic | |
| 272 | JAXBCZ010000001.1 | GCA034648895_00233 | CDS | open | 251269-252273 | _na 334_aa | Alpha/beta hydrolase fold-3 domain-containing protein | |
| 273 | JAXBCZ010000001.1 | GCA034648895_00234 | CDS | open | 252406-253461 | _na 351_aa | DUF6199 domain-containing protein | |
| 274 | JAXBCZ010000001.1 | GCA034648895_00235 | CDS | open | 253509-256019 | _na 836_aa | Beta-1%2C3-N-acetylglucosaminyltransferase | |
| 275 | JAXBCZ010000001.1 | GCA034648895_00236 | CDS | open | 256187-256963 | _na 258_aa | Gluconate 5-dehydrogenase | |
| 276 | JAXBCZ010000001.1 | GCA034648895_00237 | CDS | open | 257074-257853 | _na 259_aa | yurZ | Carboxymuconolactone decarboxylase-like domain-containing protein |
| 277 | JAXBCZ010000001.1 | GCA034648895_00238 | CDS | open | 257902-258309 | _na 135_aa | hxlR | Transcriptional regulator%2C HxlR family |
| 278 | JAXBCZ010000001.1 | GCA034648895_00239 | CDS | open | 258423-259448 | _na 341_aa | qor | NADP-dependent oxidoreductase |
| 279 | JAXBCZ010000001.1 | GCA034648895_00240 | CDS | open | 259441-260319 | _na 292_aa | menH | Alpha/beta hydrolase family protein |
| 280 | JAXBCZ010000001.1 | GCA034648895_00241 | CDS | open | 260417-261199 | _na 260_aa | dAP2 | Non-haem bromoperoxidase BPO-A2 |
| 281 | JAXBCZ010000001.1 | GCA034648895_00242 | CDS | open | 261307-262164 | _na 285_aa | TIGR00027 family methyltransferase | |
| 282 | JAXBCZ010000001.1 | GCA034648895_00243 | CDS | open | 262014-262448 | _na 144_aa | Death-on-curing family protein | |
| 283 | JAXBCZ010000001.1 | GCA034648895_00244 | CDS | open | 262459-262656 | _na 65_aa | copG | CopG family transcriptional regulator |
| 284 | JAXBCZ010000001.1 | GCA034648895_00245 | CDS | open | 262775-264232 | _na 485_aa | AAA+ ATPase domain-containing protein | |
| 285 | JAXBCZ010000001.1 | GCA034648895_00246 | CDS | open | 264229-265344 | _na 371_aa | mcrC | 5-methylcytosine-specific restriction enzyme subunit McrC |
| 286 | JAXBCZ010000001.1 | GCA034648895_00247 | CDS | open | 266501-268033 | _na 510_aa | amyA | alpha-amylase |
| 287 | JAXBCZ010000001.1 | GCA034648895_00248 | CDS | open | 268144-268737 | _na 197_aa | yajL | DJ-1 family glyoxalase III |
| 288 | JAXBCZ010000001.1 | GCA034648895_00249 | CDS | open | 268806-269168 | _na 120_aa | SdpI/YhfL family protein | |
| 289 | JAXBCZ010000001.1 | GCA034648895_00250 | CDS | open | 269347-269844 | _na 165_aa | LPXTG-motif protein cell wall anchor domain protein | |
| 290 | JAXBCZ010000001.1 | GCA034648895_00251 | CDS | open | 269925-272009 | _na 694_aa | pspC | PspC domain-containing protein |
| 291 | JAXBCZ010000001.1 | GCA034648895_00252 | CDS | open | 272108-273502 | _na 464_aa | pspC | PspC domain-containing protein |
| 292 | JAXBCZ010000001.1 | GCA034648895_00253 | CDS | open | 273579-274289 | _na 236_aa | narL | Putative nitrate/nitrite response regulator protein NarL |
| 293 | JAXBCZ010000001.1 | GCA034648895_00254 | CDS | open | 274440-275195 | _na 251_aa | L-threonylcarbamoyladenylate synthase | |
| 294 | JAXBCZ010000001.1 | GCA034648895_00255 | CDS | open | 275192-276442 | _na 416_aa | rfe | Glycosyltransferase%2C group 4 family |
| 295 | JAXBCZ010000001.1 | GCA034648895_00256 | CDS | open | 276439-276900 | _na 153_aa | Pseudouridine synthase | |
| 296 | JAXBCZ010000001.1 | GCA034648895_00257 | CDS | open | 277161-277994 | _na 277_aa | atpB | F0F1 ATP synthase subunit A |
| 297 | JAXBCZ010000001.1 | GCA034648895_00258 | CDS | open | 278071-278277 | _na 68_aa | atpE | ATP synthase F0 subunit C |
| 298 | JAXBCZ010000001.1 | GCA034648895_00259 | CDS | open | 278277-278867 | _na 196_aa | F0F1 ATP synthase subunit B | |
| 299 | JAXBCZ010000001.1 | GCA034648895_00260 | CDS | open | 278864-279679 | _na 271_aa | ATP synthase subunit delta | |
| 300 | JAXBCZ010000001.1 | GCA034648895_00261 | CDS | open | 279785-281416 | _na 543_aa | atpA | F0F1 ATP synthase subunit alpha |
| 301 | JAXBCZ010000001.1 | GCA034648895_00262 | CDS | open | 281418-282365 | _na 315_aa | atpG | F0F1 ATP synthase subunit gamma |
| 302 | JAXBCZ010000001.1 | GCA034648895_00263 | CDS | open | 282459-283895 | _na 478_aa | atpD | F0F1 ATP synthase subunit beta |
| 303 | JAXBCZ010000001.1 | GCA034648895_00264 | CDS | open | 283948-284214 | _na 88_aa | atpC | F0F1 ATP synthase subunit epsilon |
| 304 | JAXBCZ010000001.1 | GCA034648895_00265 | CDS | open | 284218-284634 | _na 138_aa | DUF2550 domain-containing protein | |
| 305 | JAXBCZ010000001.1 | GCA034648895_00266 | CDS | open | 285041-285736 | _na 231_aa | nucS | endonuclease NucS |
| 306 | JAXBCZ010000001.1 | GCA034648895_00267 | CDS | open | 285747-287003 | _na 418_aa | Winged helix DNA-binding domain-containing protein | |
| 307 | JAXBCZ010000001.1 | GCA034648895_00268 | CDS | open | 287113-288348 | _na 411_aa | nagA | Amidohydrolase-related domain-containing protein |
| 308 | JAXBCZ010000001.1 | GCA034648895_00269 | CDS | open | 288470-288994 | _na 174_aa | DinB-like domain-containing protein | |
| 309 | JAXBCZ010000001.1 | GCA034648895_00270 | CDS | open | 289237-289506 | _na 89_aa | hypothetical protein | |
| 310 | JAXBCZ010000001.1 | GCA034648895_00271 | CDS | open | 289642-289974 | _na 110_aa | transposase | |
| 311 | JAXBCZ010000001.1 | GCA034648895_00272 | CDS | open | 290076-290336 | _na 86_aa | hypothetical protein | |
| 312 | JAXBCZ010000001.1 | GCA034648895_00273 | CDS | open | 290547-300044 | _na 3165_aa | KR domain-containing protein | |
| 313 | JAXBCZ010000001.1 | GCA034648895_00274 | CDS | open | 300123-301739 | _na 538_aa | Ketosynthase family 3 (KS3) domain-containing protein | |
| 314 | JAXBCZ010000001.1 | GCA034648895_00275 | CDS | open | 301752-302597 | _na 281_aa | 3-hydroxyacyl-CoA dehydrogenase family protein | |
| 315 | JAXBCZ010000001.1 | GCA034648895_00276 | CDS | open | 302676-302951 | _na 91_aa | Acyl carrier protein | |
| 316 | JAXBCZ010000001.1 | GCA034648895_00277 | CDS | open | 302948-304111 | _na 387_aa | Acyl-CoA dehydrogenase family protein | |
| 317 | JAXBCZ010000001.1 | GCA034648895_00278 | CDS | open | 304150-305205 | _na 351_aa | HAD-IIIC family phosphatase | |
| 318 | JAXBCZ010000001.1 | GCA034648895_00279 | CDS | open | 305691-306044 | _na 117_aa | hypothetical protein | |
| 319 | JAXBCZ010000001.1 | GCA034648895_00280 | CDS | open | 306041-306766 | _na 241_aa | 4'-phosphopantetheinyl transferase superfamily protein | |
| 320 | JAXBCZ010000001.1 | GCA034648895_00281 | CDS | open | 306821-308578 | _na 585_aa | AMP-binding protein | |
| 321 | JAXBCZ010000001.1 | GCA034648895_00282 | CDS | open | 308590-310179 | _na 529_aa | MFS transporter | |
| 322 | JAXBCZ010000001.1 | GCA034648895_00283 | CDS | open | 310295-311167 | _na 290_aa | purU | formyltetrahydrofolate deformylase |
| 323 | JAXBCZ010000001.1 | GCA034648895_00284 | CDS | open | 311172-312107 | _na 311_aa | utp | Urea transporter |
| 324 | JAXBCZ010000001.1 | GCA034648895_00285 | CDS | open | 312171-312986 | _na 271_aa | ureD | Urease accessory protein UreD |
| 325 | JAXBCZ010000001.1 | GCA034648895_00286 | CDS | open | 312983-313660 | _na 225_aa | ureG | urease accessory protein UreG |
| 326 | JAXBCZ010000001.1 | GCA034648895_00287 | CDS | open | 313695-314447 | _na 250_aa | ureF | Urease accessory protein UreF |
| 327 | JAXBCZ010000001.1 | GCA034648895_00288 | CDS | open | 314428-314919 | _na 163_aa | ureE | urease accessory protein UreE |
| 328 | JAXBCZ010000001.1 | GCA034648895_00289 | CDS | open | 314941-316653 | _na 570_aa | ureC | urease subunit alpha |
| 329 | JAXBCZ010000001.1 | GCA034648895_00291 | CDS | open | 316671-316982 | _na 103_aa | ureB | urease subunit beta |
| 330 | JAXBCZ010000001.1 | GCA034648895_00292 | CDS | open | 316979-317293 | _na 104_aa | ureA | urease subunit gamma |
| 331 | JAXBCZ010000001.1 | GCA034648895_00293 | CDS | open | 317578-317700 | _na 40_aa | ykgO | type B 50S ribosomal protein L36 |
| 332 | JAXBCZ010000001.1 | GCA034648895_00294 | CDS | open | 317780-318031 | _na 83_aa | rpmE | type B 50S ribosomal protein L31 |
| 333 | JAXBCZ010000001.1 | GCA034648895_00295 | CDS | open | 318168-318473 | _na 101_aa | rpsN | 30S ribosomal protein S14 |
| 334 | JAXBCZ010000001.1 | GCA034648895_00296 | CDS | open | 318473-318646 | _na 57_aa | rpmG | 50S ribosomal protein L33 |
| 335 | JAXBCZ010000001.1 | GCA034648895_00297 | CDS | open | 318643-318891 | _na 82_aa | rpmB | 50S ribosomal protein L28 |
| 336 | JAXBCZ010000001.1 | GCA034648895_00298 | CDS | open | 318938-320143 | _na 401_aa | cobW | CobW C-terminal domain-containing protein |
| 337 | JAXBCZ010000001.1 | GCA034648895_00299 | CDS | open | 320398-321708 | _na 436_aa | glyA | Serine hydroxymethyltransferase |
| 338 | JAXBCZ010000001.1 | GCA034648895_00300 | CDS | open | 321705-322601 | _na 298_aa | folD | bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase |
| 339 | JAXBCZ010000001.1 | GCA034648895_00301 | CDS | open | 322644-324386 | _na 580_aa | Fructan beta-fructosidase | |
| 340 | JAXBCZ010000001.1 | GCA034648895_00302 | CDS | open | 324493-326391 | _na 632_aa | Levansucrase | |
| 341 | JAXBCZ010000001.1 | GCA034648895_00303 | CDS | open | 326725-327918 | _na 397_aa | Choice-of-anchor L domain-containing protein | |
| 342 | JAXBCZ010000001.1 | GCA034648895_00304 | CDS | open | 328013-328237 | _na 74_aa | DUF2933 domain-containing protein | |
| 343 | JAXBCZ010000001.1 | GCA034648895_00305 | CDS | open | 328251-328556 | _na 101_aa | acylphosphatase | |
| 344 | JAXBCZ010000001.1 | GCA034648895_00306 | CDS | open | 328603-329436 | _na 277_aa | xthA | exodeoxyribonuclease III |
| 345 | JAXBCZ010000001.1 | GCA034648895_00307 | CDS | open | 329743-331182 | _na 479_aa | ABC3 transporter permease protein domain-containing protein | |
| 346 | JAXBCZ010000001.1 | GCA034648895_00308 | CDS | open | 331179-331967 | _na 262_aa | lolD | ABC transporter domain-containing protein |
| 347 | JAXBCZ010000001.1 | GCA034648895_00309 | CDS | open | 331964-333019 | _na 351_aa | Biotin-requiring enzyme | |
| 348 | JAXBCZ010000001.1 | GCA034648895_00310 | CDS | open | 333214-334491 | _na 425_aa | galK | galactokinase |
| 349 | JAXBCZ010000001.1 | GCA034648895_00311 | CDS | open | 334567-335415 | _na 282_aa | Cytochrome C | |
| 350 | JAXBCZ010000001.1 | GCA034648895_00312 | CDS | open | 335677-336330 | _na 217_aa | 2'-5' RNA ligase | |
| 351 | JAXBCZ010000001.1 | GCA034648895_00313 | CDS | open | 336327-337349 | _na 340_aa | brkB | YihY/virulence factor BrkB family protein |
| 352 | JAXBCZ010000001.1 | GCA034648895_00314 | CDS | open | 337491-337736 | _na 81_aa | hypothetical protein | |
| 353 | JAXBCZ010000001.1 | GCA034648895_00315 | CDS | open | 337842-338606 | _na 254_aa | hypothetical protein | |
| 354 | JAXBCZ010000001.1 | GCA034648895_00316 | CDS | open | 339204-340103 | _na 299_aa | gacK | Acarbose-7-kinase GacK |
| 355 | JAXBCZ010000001.1 | GCA034648895_00317 | CDS | open | 340182-340331 | _na 49_aa | Integrase | |
| 356 | JAXBCZ010000001.1 | GCA034648895_00318 | CDS | open | 340345-340899 | _na 184_aa | IS3 family transposase | |
| 357 | JAXBCZ010000001.1 | GCA034648895_00319 | CDS | open | 341760-342029 | _na 89_aa | Transposase | |
| 358 | JAXBCZ010000001.1 | GCA034648895_00320 | CDS | open | 342356-343366 | _na 336_aa | IS1634 family transposase | |
| 359 | JAXBCZ010000001.1 | GCA034648895_00321 | CDS | open | 343467-343652 | _na 61_aa | Transposase | |
| 360 | JAXBCZ010000001.1 | GCA034648895_00322 | CDS | open | 343903-344352 | _na 149_aa | Excisionase family DNA-binding protein | |
| 361 | JAXBCZ010000001.1 | GCA034648895_00323 | CDS | open | 344518-345777 | _na 419_aa | Mannose-1-phosphate guanylyltransferase | |
| 362 | JAXBCZ010000001.1 | GCA034648895_00324 | CDS | open | 346151-347251 | _na 366_aa | med | ABC transporter substrate-binding protein PnrA-like domain-containing protein |
| 363 | JAXBCZ010000001.1 | GCA034648895_00325 | CDS | open | 347309-348838 | _na 509_aa | nupO | ABC transporter domain-containing protein |
| 364 | JAXBCZ010000001.1 | GCA034648895_00326 | CDS | open | 348835-350178 | _na 447_aa | nupP | ABC transporter permease |
| 365 | JAXBCZ010000001.1 | GCA034648895_00327 | CDS | open | 350182-351474 | _na 430_aa | ABC transporter permease | |
| 366 | JAXBCZ010000001.1 | GCA034648895_00328 | CDS | open | 351471-351926 | _na 151_aa | cytidine deaminase | |
| 367 | JAXBCZ010000001.1 | GCA034648895_00329 | CDS | open | 351964-353310 | _na 448_aa | deoA | thymidine phosphorylase |
| 368 | JAXBCZ010000001.1 | GCA034648895_00330 | CDS | open | 353307-354110 | _na 267_aa | Peptidase C39-like domain-containing protein | |
| 369 | JAXBCZ010000001.1 | GCA034648895_00331 | CDS | open | 354210-354440 | _na 76_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 370 | JAXBCZ010000001.1 | GCA034648895_00332 | CDS | open | 354488-355141 | _na 217_aa | deoC | deoxyribose-phosphate aldolase |
| 371 | JAXBCZ010000001.1 | GCA034648895_00333 | CDS | open | 355277-356479 | _na 400_aa | znuA | Zinc ABC transporter substrate-binding protein |
| 372 | JAXBCZ010000001.1 | GCA034648895_00334 | CDS | open | 356488-357306 | _na 272_aa | znuC | ABC transporter domain-containing protein |
| 373 | JAXBCZ010000001.1 | GCA034648895_00335 | CDS | open | 357303-358361 | _na 352_aa | Zinc ABC transporter permease | |
| 374 | JAXBCZ010000001.1 | GCA034648895_00336 | CDS | open | 358358-359248 | _na 296_aa | ABC 3 transport family protein | |
| 375 | JAXBCZ010000001.1 | GCA034648895_00337 | CDS | open | 359319-361037 | _na 572_aa | manB | Phosphomannomutase |
| 376 | JAXBCZ010000001.1 | GCA034648895_00338 | CDS | open | 361359-362114 | _na 251_aa | Cytokinin riboside 5'-monophosphate phosphoribohydrolase | |
| 377 | JAXBCZ010000001.1 | GCA034648895_00339 | CDS | open | 362220-362387 | _na 55_aa | DUF3117 domain-containing protein | |
| 378 | JAXBCZ010000001.1 | GCA034648895_00340 | CDS | open | 362528-363163 | _na 211_aa | trmR | Methyltransferase domain-containing protein |
| 379 | JAXBCZ010000001.1 | GCA034648895_00341 | CDS | open | 363323-364237 | _na 304_aa | tatB | Sec-independent protein translocase protein TatB |
| 380 | JAXBCZ010000001.1 | GCA034648895_00342 | CDS | open | 364269-365411 | _na 380_aa | paaD | Iron-sulfur cluster carrier protein |
| 381 | JAXBCZ010000001.1 | GCA034648895_00343 | CDS | open | 365482-366054 | _na 190_aa | DUF1003 domain-containing protein | |
| 382 | JAXBCZ010000001.1 | GCA034648895_00344 | CDS | open | 366047-367339 | _na 430_aa | mgtE | CBS domain-containing protein |
| 383 | JAXBCZ010000001.1 | GCA034648895_00345 | CDS | open | 367378-368226 | _na 282_aa | General stress protein 17M-like domain-containing protein | |
| 384 | JAXBCZ010000001.1 | GCA034648895_00346 | CDS | open | 368256-369104 | _na 282_aa | ycjR | Xylose isomerase-like TIM barrel domain-containing protein |
| 385 | JAXBCZ010000001.1 | GCA034648895_00347 | CDS | open | 369111-370085 | _na 324_aa | czcD | Cation efflux protein cytoplasmic domain-containing protein |
| 386 | JAXBCZ010000001.1 | GCA034648895_00348 | CDS | open | 370082-370447 | _na 121_aa | metalloregulator ArsR/SmtB family transcription factor | |
| 387 | JAXBCZ010000001.1 | GCA034648895_00349 | CDS | open | 370504-372147 | _na 547_aa | pepP | Xaa-Pro aminopeptidase |
| 388 | JAXBCZ010000001.1 | GCA034648895_00350 | CDS | open | 372213-373313 | _na 366_aa | Gfo/Idh/MocA family oxidoreductase | |
| 389 | JAXBCZ010000001.1 | GCA034648895_00351 | CDS | open | 373339-374217 | _na 292_aa | PHP domain protein | |
| 390 | JAXBCZ010000001.1 | GCA034648895_00352 | CDS | open | 374275-374904 | _na 209_aa | marC | UPF0056 membrane protein |
| 391 | JAXBCZ010000001.1 | GCA034648895_00353 | CDS | open | 374972-376627 | _na 551_aa | srmB | RNA helicase |
| 392 | JAXBCZ010000001.1 | GCA034648895_00354 | CDS | open | 377194-377871 | _na 225_aa | tRNA 2-methylthio-N6-isopentenyl adenosine(37) hydroxylase MiaE-like protein | |
| 393 | JAXBCZ010000001.1 | GCA034648895_00355 | CDS | open | 378039-378695 | _na 218_aa | Peptidase | |
| 394 | JAXBCZ010000001.1 | GCA034648895_00356 | CDS | open | 378734-379936 | _na 400_aa | Chromosome condensation regulator RCC1 | |
| 395 | JAXBCZ010000001.1 | GCA034648895_00357 | CDS | open | 380011-380199 | _na 62_aa | yjbJ | CsbD-like domain-containing protein |
| 396 | JAXBCZ010000001.1 | GCA034648895_00358 | CDS | open | 380463-381911 | _na 482_aa | codB | Allantoin permease |
| 397 | JAXBCZ010000001.1 | GCA034648895_00359 | CDS | open | 381908-382168 | _na 86_aa | hypothetical protein | |
| 398 | JAXBCZ010000001.1 | GCA034648895_00360 | CDS | open | 382673-384109 | _na 478_aa | fumC | class II fumarate hydratase |
| 399 | JAXBCZ010000001.1 | GCA034648895_00361 | CDS | open | 384344-386173 | _na 609_aa | subtype A tannase | |
| 400 | JAXBCZ010000001.1 | GCA034648895_00362 | CDS | open | 386276-386662 | _na 128_aa | DUF1304 domain-containing protein | |
| 401 | JAXBCZ010000001.1 | GCA034648895_00363 | CDS | open | 386929-387822 | _na 297_aa | ABC transporter domain-containing protein | |
| 402 | JAXBCZ010000001.1 | GCA034648895_00364 | CDS | open | 387819-388523 | _na 234_aa | ABC transporter permease subunit | |
| 403 | JAXBCZ010000001.1 | GCA034648895_00365 | CDS | open | 388520-389200 | _na 226_aa | ABC transmembrane type-1 domain-containing protein | |
| 404 | JAXBCZ010000001.1 | GCA034648895_00366 | CDS | open | 389197-390183 | _na 328_aa | osmF | ABC-type glycine betaine transport system substrate-binding domain-containing protein |
| 405 | JAXBCZ010000001.1 | GCA034648895_00367 | CDS | open | 390342-390965 | _na 207_aa | Pyrroline-5-carboxylate reductase catalytic N-terminal domain-containing protein | |
| 406 | JAXBCZ010000001.1 | GCA034648895_00368 | CDS | open | 391091-391498 | _na 135_aa | hxlR | HTH hxlR-type domain-containing protein |
| 407 | JAXBCZ010000001.1 | GCA034648895_00369 | CDS | open | 391539-392129 | _na 196_aa | folA | dihydrofolate reductase |
| 408 | JAXBCZ010000001.1 | GCA034648895_00370 | CDS | open | 392126-393019 | _na 297_aa | thymidylate synthase | |
| 409 | JAXBCZ010000001.1 | GCA034648895_00371 | CDS | open | 393016-393714 | _na 232_aa | ecsC | EcsC family protein |
| 410 | JAXBCZ010000001.1 | GCA034648895_00372 | CDS | open | 393791-394231 | _na 146_aa | yhfA | OsmC-like protein |
| 411 | JAXBCZ010000001.1 | GCA034648895_00373 | CDS | open | 394388-394894 | _na 168_aa | DUF2505 domain-containing protein | |
| 412 | JAXBCZ010000001.1 | GCA034648895_00374 | CDS | open | 395073-396548 | _na 491_aa | histidine kinase | |
| 413 | JAXBCZ010000001.1 | GCA034648895_00375 | CDS | open | 396647-396895 | _na 82_aa | whiB | Transcriptional regulator WhiB |
| 414 | JAXBCZ010000001.1 | GCA034648895_00376 | CDS | open | 397102-400710 | _na 1202_aa | ftsK | Cell division protein FtsK |
| 415 | JAXBCZ010000001.1 | GCA034648895_00377 | CDS | open | 400852-403308 | _na 818_aa | ligA | NAD-dependent DNA ligase LigA |
| 416 | JAXBCZ010000001.1 | GCA034648895_00378 | CDS | open | 403410-405251 | _na 613_aa | L%2CD-TPase catalytic domain-containing protein | |
| 417 | JAXBCZ010000001.1 | GCA034648895_00379 | CDS | open | 405666-405971 | _na 101_aa | Aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C | |
| 418 | JAXBCZ010000001.1 | GCA034648895_00380 | CDS | open | 405968-407509 | _na 513_aa | gatA | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA |
| 419 | JAXBCZ010000001.1 | GCA034648895_00381 | CDS | open | 407506-409002 | _na 498_aa | gatB | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB |
| 420 | JAXBCZ010000001.1 | GCA034648895_00382 | CDS | open | 409331-410719 | _na 462_aa | sfcA | NADP-dependent malic enzyme |
| 421 | JAXBCZ010000001.1 | GCA034648895_00383 | CDS | open | 410793-411032 | _na 79_aa | hypothetical protein | |
| 422 | JAXBCZ010000001.1 | GCA034648895_00387 | CDS | open | 417308-418621 | _na 437_aa | yjjB | Threonine/serine exporter family protein |
| 423 | JAXBCZ010000001.1 | GCA034648895_00388 | CDS | open | 418726-420498 | _na 590_aa | RCK C-terminal domain-containing protein | |
| 424 | JAXBCZ010000001.1 | GCA034648895_00389 | CDS | open | 420785-422569 | _na 594_aa | ilvB | acetolactate synthase large subunit |
| 425 | JAXBCZ010000001.1 | GCA034648895_00390 | CDS | open | 422575-423087 | _na 170_aa | ilvN | acetolactate synthase small subunit |
| 426 | JAXBCZ010000001.1 | GCA034648895_00391 | CDS | open | 423097-424128 | _na 343_aa | ilvC | ketol-acid reductoisomerase |
| 427 | JAXBCZ010000001.1 | GCA034648895_00392 | CDS | open | 424271-425659 | _na 462_aa | AAA family ATPase | |
| 428 | JAXBCZ010000001.1 | GCA034648895_00393 | CDS | open | 426346-427614 | _na 422_aa | MFS transporter | |
| 429 | JAXBCZ010000001.1 | GCA034648895_00394 | CDS | open | 427611-428231 | _na 206_aa | HTH tetR-type domain-containing protein | |
| 430 | JAXBCZ010000001.1 | GCA034648895_00395 | CDS | open | 428348-429415 | _na 355_aa | leuB | 3-isopropylmalate dehydrogenase |
| 431 | JAXBCZ010000001.1 | GCA034648895_00396 | CDS | open | 429483-430199 | _na 238_aa | Mucin-associated surface protein | |
| 432 | JAXBCZ010000001.1 | GCA034648895_00397 | CDS | open | 430210-430818 | _na 202_aa | Gametogenetin | |
| 433 | JAXBCZ010000001.1 | GCA034648895_00398 | CDS | open | 431112-432308 | _na 398_aa | ilvE | branched-chain amino acid aminotransferase |
| 434 | JAXBCZ010000001.1 | GCA034648895_00399 | CDS | open | 432488-433624 | _na 378_aa | Cell envelope-related transcriptional attenuator domain-containing protein | |
| 435 | JAXBCZ010000001.1 | GCA034648895_00400 | CDS | open | 433702-434985 | _na 427_aa | wecC | UDP-N-acetyl-D-mannosamine dehydrogenase |
| 436 | JAXBCZ010000001.1 | GCA034648895_00401 | CDS | open | 434992-438189 | _na 1065_aa | Glycosyl transferase | |
| 437 | JAXBCZ010000001.1 | GCA034648895_00402 | CDS | open | 438454-438846 | _na 130_aa | tagD | glycerol-3-phosphate cytidylyltransferase |
| 438 | JAXBCZ010000001.1 | GCA034648895_00403 | CDS | open | 438993-442985 | _na 1330_aa | CDP-glycerol glycerophosphotransferase family protein | |
| 439 | JAXBCZ010000001.1 | GCA034648895_00404 | CDS | open | 442982-444826 | _na 614_aa | Glycosyltransferase 61 catalytic domain-containing protein | |
| 440 | JAXBCZ010000001.1 | GCA034648895_00405 | CDS | open | 444811-446748 | _na 645_aa | Glycosyltransferase | |
| 441 | JAXBCZ010000001.1 | GCA034648895_00406 | CDS | open | 446745-449141 | _na 798_aa | Glycosyl transferase | |
| 442 | JAXBCZ010000001.1 | GCA034648895_00407 | CDS | open | 449141-450385 | _na 414_aa | Glycosyltransferase%2C group 2 family protein | |
| 443 | JAXBCZ010000001.1 | GCA034648895_00408 | CDS | open | 450435-451211 | _na 258_aa | SGNH/GDSL hydrolase family protein | |
| 444 | JAXBCZ010000001.1 | GCA034648895_00409 | CDS | open | 451214-452251 | _na 345_aa | ABC transporter domain-containing protein | |
| 445 | JAXBCZ010000001.1 | GCA034648895_00410 | CDS | open | 452238-453152 | _na 304_aa | ABC-2 type transporter transmembrane domain-containing protein | |
| 446 | JAXBCZ010000001.1 | GCA034648895_00411 | CDS | open | 453149-454867 | _na 572_aa | Glycosyltransferase subfamily 4-like N-terminal domain-containing protein | |
| 447 | JAXBCZ010000001.1 | GCA034648895_00412 | CDS | open | 454860-456134 | _na 424_aa | wbuB | Glycosyltransferase WbuB |
| 448 | JAXBCZ010000001.1 | GCA034648895_00413 | CDS | open | 456139-457179 | _na 346_aa | Glycosyltransferase%2C group 4 family | |
| 449 | JAXBCZ010000001.1 | GCA034648895_00414 | CDS | open | 457176-457658 | _na 160_aa | Dolichyl-phosphate beta-D-mannosyltransferase | |
| 450 | JAXBCZ010000001.1 | GCA034648895_00415 | CDS | open | 458132-458551 | _na 139_aa | tagD | glycerol-3-phosphate cytidylyltransferase |
| 451 | JAXBCZ010000001.1 | GCA034648895_00416 | CDS | open | 458559-459401 | _na 280_aa | NodB-like y domain-containing protein | |
| 452 | JAXBCZ010000001.1 | GCA034648895_00418 | CDS | open | 459801-460511 | _na 236_aa | orn | oligoribonuclease |
| 453 | JAXBCZ010000001.1 | GCA034648895_00419 | CDS | open | 460596-463109 | _na 837_aa | non-specific serine/threonine protein kinase | |
| 454 | JAXBCZ010000001.1 | GCA034648895_00420 | CDS | open | 463208-465898 | _na 896_aa | fHA | ABC transporter domain-containing protein |
| 455 | JAXBCZ010000001.1 | GCA034648895_00422 | CDS | open | 466677-468278 | _na 533_aa | G domain-containing protein | |
| 456 | JAXBCZ010000001.1 | GCA034648895_00423 | CDS | open | 468275-469774 | _na 499_aa | G domain-containing protein | |
| 457 | JAXBCZ010000001.1 | GCA034648895_00424 | CDS | open | 469943-470638 | _na 231_aa | Single-stranded DNA-binding protein | |
| 458 | JAXBCZ010000001.1 | GCA034648895_00425 | CDS | open | 470631-471191 | _na 186_aa | TY-Chap N-terminal domain-containing protein | |
| 459 | JAXBCZ010000001.1 | GCA034648895_00426 | CDS | open | 471359-472096 | _na 245_aa | ftsE | cell division ATP-binding protein FtsE |
| 460 | JAXBCZ010000001.1 | GCA034648895_00427 | CDS | open | 472109-473026 | _na 305_aa | ftsX | permease-like cell division protein FtsX |
| 461 | JAXBCZ010000001.1 | GCA034648895_00428 | CDS | open | 473033-474349 | _na 438_aa | Peptidase M23 | |
| 462 | JAXBCZ010000001.1 | GCA034648895_00429 | CDS | open | 474505-475041 | _na 178_aa | smpB | SsrA-binding protein SmpB |
| 463 | JAXBCZ010000001.1 | GCA034648895_00431 | CDS | open | 475746-476465 | _na 239_aa | gntR | GntR family transcriptional regulator |
| 464 | JAXBCZ010000001.1 | GCA034648895_00432 | CDS | open | 476673-477761 | _na 362_aa | Alpha/beta hydrolase fold-3 domain-containing protein | |
| 465 | JAXBCZ010000001.1 | GCA034648895_00433 | CDS | open | 477745-478575 | _na 276_aa | gntR | GntR family transcriptional regulator |
| 466 | JAXBCZ010000001.1 | GCA034648895_00434 | CDS | open | 478767-480353 | _na 528_aa | ABC transporter substrate-binding protein | |
| 467 | JAXBCZ010000001.1 | GCA034648895_00435 | CDS | open | 480562-481527 | _na 321_aa | ABC transporter permease | |
| 468 | JAXBCZ010000001.1 | GCA034648895_00436 | CDS | open | 481527-483686 | _na 719_aa | dppC | ABC transporter |
| 469 | JAXBCZ010000001.1 | GCA034648895_00437 | CDS | open | 483686-484513 | _na 275_aa | dppD | ABC transporter domain-containing protein |
| 470 | JAXBCZ010000001.1 | GCA034648895_00438 | CDS | open | 484714-485634 | _na 306_aa | dapA | Dihydrodipicolinate synthase |
| 471 | JAXBCZ010000001.1 | GCA034648895_00439 | CDS | open | 485806-486846 | _na 346_aa | Glucokinase | |
| 472 | JAXBCZ010000001.1 | GCA034648895_00440 | CDS | open | 486883-487632 | _na 249_aa | nanE | Putative N-acetylmannosamine-6-phosphate 2-epimerase |
| 473 | JAXBCZ010000001.1 | GCA034648895_00441 | CDS | open | 487835-488116 | _na 93_aa | hupA | DNA-binding protein HB1 |
| 474 | JAXBCZ010000001.1 | GCA034648895_00442 | CDS | open | 488298-489170 | _na 290_aa | ABC transporter domain-containing protein | |
| 475 | JAXBCZ010000001.1 | GCA034648895_00443 | CDS | open | 489146-490870 | _na 574_aa | Transporter | |
| 476 | JAXBCZ010000001.1 | GCA034648895_00444 | CDS | open | 491011-491751 | _na 246_aa | nagB | glucosamine-6-phosphate deaminase |
| 477 | JAXBCZ010000001.1 | GCA034648895_00445 | CDS | open | 491844-492209 | _na 121_aa | DUF3039 domain-containing protein | |
| 478 | JAXBCZ010000001.1 | GCA034648895_00446 | CDS | open | 492206-494029 | _na 607_aa | sSL2 | Helicase ATP-binding domain-containing protein |
| 479 | JAXBCZ010000001.1 | GCA034648895_00447 | CDS | open | 494083-495495 | _na 470_aa | pncB | nicotinate phosphoribosyltransferase |
| 480 | JAXBCZ010000001.1 | GCA034648895_00448 | CDS | open | 495534-495869 | _na 111_aa | clpS | ATP-dependent Clp protease adapter ClpS |
| 481 | JAXBCZ010000001.1 | GCA034648895_00449 | CDS | open | 495869-496555 | _na 228_aa | DUF2017 domain-containing protein | |
| 482 | JAXBCZ010000001.1 | GCA034648895_00450 | CDS | open | 496586-497443 | _na 285_aa | murI | glutamate racemase |
| 483 | JAXBCZ010000001.1 | GCA034648895_00451 | CDS | open | 497440-498237 | _na 265_aa | elaC | Metallo-beta-lactamase domain-containing protein |
| 484 | JAXBCZ010000001.1 | GCA034648895_00452 | CDS | open | 498234-498764 | _na 176_aa | DUF3054 domain-containing protein | |
| 485 | JAXBCZ010000001.1 | GCA034648895_00453 | CDS | open | 498850-500289 | _na 479_aa | Peptidase | |
| 486 | JAXBCZ010000001.1 | GCA034648895_00454 | CDS | open | 500306-501013 | _na 235_aa | rdgB | RdgB/HAM1 family non-canonical purine NTP pyrophosphatase |
| 487 | JAXBCZ010000001.1 | GCA034648895_00455 | CDS | open | 501017-501823 | _na 268_aa | rph | ribonuclease PH |
| 488 | JAXBCZ010000001.1 | GCA034648895_00456 | CDS | open | 501976-502269 | _na 97_aa | hmoA | Antibiotic biosynthesis monooxygenase |
| 489 | JAXBCZ010000001.1 | GCA034648895_00457 | CDS | open | 502328-502984 | _na 218_aa | SIMPL domain-containing protein | |
| 490 | JAXBCZ010000001.1 | GCA034648895_00458 | CDS | open | 503198-503815 | _na 205_aa | PH domain-containing protein | |
| 491 | JAXBCZ010000001.1 | GCA034648895_00459 | CDS | open | 503898-505250 | _na 450_aa | SMI1/KNR4 family protein | |
| 492 | JAXBCZ010000001.1 | GCA034648895_00460 | CDS | open | 505580-505849 | _na 89_aa | Helix-turn-helix domain-containing protein | |
| 493 | JAXBCZ010000001.1 | GCA034648895_00461 | CDS | open | 505875-506063 | _na 62_aa | hypothetical protein | |
| 494 | JAXBCZ010000001.1 | GCA034648895_00462 | CDS | open | 506245-506970 | _na 241_aa | NPCBM/NEW2 domain-containing protein | |
| 495 | JAXBCZ010000001.1 | GCA034648895_00463 | CDS | open | 508308-509768 | _na 486_aa | AAA family ATPase | |
| 496 | JAXBCZ010000001.1 | GCA034648895_00464 | CDS | open | 510048-510419 | _na 123_aa | hypothetical protein | |
| 497 | JAXBCZ010000001.1 | GCA034648895_00465 | CDS | open | 510760-511413 | _na 217_aa | hypothetical protein | |
| 498 | JAXBCZ010000001.1 | GCA034648895_00466 | CDS | open | 511520-511762 | _na 80_aa | HTH cro/C1-type domain-containing protein | |
| 499 | JAXBCZ010000001.1 | GCA034648895_00467 | CDS | open | 511901-513055 | _na 384_aa | Tat pathway signal sequence domain protein | |
| 500 | JAXBCZ010000001.1 | GCA034648895_00468 | CDS | open | 513299-514915 | _na 538_aa | AAA family ATPase |

