HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Porphyromonas gingivalis (GCA_900157325.1)

Select a Genome:
BAKTA Annotations for GCA_900157325.1
Genome Selected: Porphyromonas gingivalis
ContigsBases CDSrRNA tmRNAtRNA
56 2343280 2002 3 1 47
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4129 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:3]    |    Number of Records Found: 4129 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1001 FUFC01000011.1 GCA900157325_01199 CDS open 14378-14731 _na     117_aa folB dihydroneopterin aldolase
1002 FUFC01000011.1 GCA900157325_01200 CDS open 14802-16061 _na     419_aa plug Type 9 secretion system plug protein N-terminal domain-containing protein
1003 FUFC01000011.1 GCA900157325_01201 CDS open 16475-20995 _na     1506_aa tamB DUF490 domain-containing protein
1004 FUFC01000011.1 GCA900157325_01202 CDS open 21444-23771 _na     775_aa bamA Bacterial surface antigen (D15) domain-containing protein
1005 FUFC01000011.1 GCA900157325_01203 CDS open 23779-28569 _na     1596_aa asmA AsmA domain-containing protein
1006 FUFC01000011.1 GCA900157325_01204 CDS open 28675-29616 _na     313_aa prs Ribose-phosphate pyrophosphokinase
1007 FUFC01000011.1 GCA900157325_01205 CDS open 29812-31086 _na     424_aa srmB ATP-dependent RNA helicase%2C DEAD/DEAH box family
1008 FUFC01000011.1 GCA900157325_01206 CDS open 31687-32661 _na     324_aa DUF3108 domain-containing protein
1009 FUFC01000011.1 GCA900157325_01207 CDS open 32835-34424 _na     529_aa T9SS type A sorting domain-containing protein
1010 FUFC01000011.1 GCA900157325_01208 CDS open 34905-35102 _na     65_aa hypothetical protein
1011 FUFC01000011.1 GCA900157325_01209 CDS open 35190-36812 _na     540_aa cTD-A Immunoreactive antigen PG91
1012 FUFC01000011.1 GCA900157325_01211 CDS open 37754-38314 _na     186_aa Lipoprotein
1013 FUFC01000011.1 GCA900157325_01212 CDS open 38515-39192 _na     225_aa porT Outer membrane protein beta-barrel domain-containing protein
1014 FUFC01000011.1 GCA900157325_01213 CDS open 39311-40423 _na     370_aa thiH 2-iminoacetate synthase ThiH
1015 FUFC01000011.1 GCA900157325_01214 CDS open 40436-41209 _na     257_aa thiG Thiazole synthase
1016 FUFC01000011.1 GCA900157325_01215 CDS open 41274-43217 _na     647_aa thiE thiamine phosphate synthase
1017 FUFC01000011.1 GCA900157325_01216 CDS open 43214-45043 _na     609_aa thiC phosphomethylpyrimidine synthase ThiC
1018 FUFC01000011.1 GCA900157325_01217 CDS open 45047-45247 _na     66_aa thiS sulfur carrier protein ThiS
1019 FUFC01000011.1 GCA900157325_01218 CDS open 45648-46388 _na     246_aa Outer membrane protein beta-barrel domain-containing protein
1020 FUFC01000011.1 GCA900157325_01219 CDS open 46647-47030 _na     127_aa hypothetical protein
1021 FUFC01000011.1 GCA900157325_01220 CDS open 47058-47702 _na     214_aa Secretion system C-terminal sorting domain-containing protein
1022 FUFC01000011.1 GCA900157325_01221 CDS open 48031-48300 _na     89_aa hypothetical protein
1023 FUFC01000011.1 GCA900157325_01222 CDS open 49127-49705 _na     192_aa rpsP 30S ribosomal protein S16
1024 FUFC01000011.1 GCA900157325_01224 CDS open 50490-51461 _na     323_aa mviM Lipopolysaccharide biosynthesis protein WbpB
1025 FUFC01000011.1 GCA900157325_01225 CDS open 51580-52389 _na     269_aa phnP Metallo-beta-lactamase superfamily protein
1026 FUFC01000011.1 GCA900157325_01226 CDS open 52442-53521 _na     359_aa ansA asparaginase
1027 FUFC01000011.1 GCA900157325_01227 CDS open 53533-53820 _na     95_aa Partial transposase in ISPg2
1028 FUFC01000011.1 GCA900157325_01228 CDS open 54121-55131 _na     336_aa gap type I glyceraldehyde-3-phosphate dehydrogenase
1029 FUFC01000011.1 GCA900157325_01229 CDS open 55271-56179 _na     302_aa araC Transcriptional regulator%2C AraC family
1030 FUFC01000011.1 GCA900157325_01230 CDS open 56330-57004 _na     224_aa yggS Pyridoxal phosphate homeostasis protein
1031 FUFC01000011.1 GCA900157325_01231 CDS open 57001-57444 _na     147_aa DUF4494 domain-containing protein
1032 FUFC01000011.1 GCA900157325_01232 CDS open 57995-58576 _na     193_aa DUF3575 domain-containing protein
1033 FUFC01000011.1 GCA900157325_01233 CDS open 58602-60074 _na     490_aa ompA Outer membrane protein
1034 FUFC01000011.1 GCA900157325_01234 CDS open 60125-61279 _na     384_aa fimA Major fimbrium subunit FimA type-2
1035 FUFC01000011.1 GCA900157325_01235 CDS open 61418-62329 _na     303_aa fimB Major fimbrium anchoring subunit FimB
1036 FUFC01000011.1 GCA900157325_01236 CDS open 62316-63713 _na     465_aa fimC Major fimbrium subunit FimC
1037 FUFC01000011.1 GCA900157325_01237 CDS open 63728-65740 _na     670_aa fimD Major fimbrium tip subunit FimD
1038 FUFC01000011.1 GCA900157325_01238 CDS open 65737-67389 _na     550_aa fimE Major fimbrium tip subunit FimE
1039 FUFC01000011.1 GCA900157325_01239 CDS open 67922-68473 _na     183_aa yceD DNA-binding protein
1040 FUFC01000011.1 GCA900157325_01240 CDS open 68480-68665 _na     61_aa rpmF 50S ribosomal protein L32
1041 FUFC01000011.1 GCA900157325_01241 CDS open 68845-69852 _na     335_aa fabH Beta-ketoacyl-[acyl-carrier-protein] synthase III
1042 FUFC01000011.1 GCA900157325_01242 CDS open 69931-70830 _na     299_aa era GTPase Era
1043 FUFC01000011.1 GCA900157325_01243 CDS open 70893-72206 _na     437_aa der ribosome biogenesis GTPase Der
1044 FUFC01000011.1 GCA900157325_01244 CDS open 72257-75556 _na     1099_aa DUF2723 domain-containing protein
1045 FUFC01000011.1 GCA900157325_01245 CDS open 75557-76204 _na     215_aa pgaB Polysaccharide deacetylase
1046 FUFC01000011.1 GCA900157325_01246 CDS open 76230-76916 _na     228_aa mnmC MnmC-like methyltransferase domain-containing protein
1047 FUFC01000011.1 GCA900157325_01247 CDS open 77115-77696 _na     193_aa xpt xanthine phosphoribosyltransferase
1048 FUFC01000011.1 GCA900157325_01248 CDS open 77815-79071 _na     418_aa hypothetical protein
1049 FUFC01000011.1 GCA900157325_01249 CDS open 79232-79903 _na     223_aa porT Outer membrane protein beta-barrel domain-containing protein
1050 FUFC01000011.1 GCA900157325_01250 CDS open 79963-81468 _na     501_aa sleL LysM domain-containing protein
1051 FUFC01000011.1 GCA900157325_01252 CDS open 82945-83130 _na     61_aa hypothetical protein
1052 FUFC01000011.1 GCA900157325_01253 CDS open 83157-84047 _na     296_aa traB TraB/GumN family protein
1053 FUFC01000011.1 GCA900157325_01254 CDS open 84084-84830 _na     248_aa rsmE 16S rRNA (uracil(1498)-N(3))-methyltransferase
1054 FUFC01000011.1 GCA900157325_01255 CDS open 85178-86179 _na     333_aa iap putative leucine aminopeptidase
1055 FUFC01000011.1 GCA900157325_01256 CDS open 86203-86628 _na     141_aa sufE Fe-S metabolism associated domain-containing protein
1056 FUFC01000011.1 GCA900157325_01257 CDS open 86632-88029 _na     465_aa hemG protoporphyrinogen oxidase
1057 FUFC01000011.1 GCA900157325_01184 gene open 108-278
1058 FUFC01000011.1 GCA900157325_01185 gene open 590-1762 arAAA
1059 FUFC01000011.1 GCA900157325_01186 gene open 2052-2528
1060 FUFC01000011.1 GCA900157325_01187 gene open 2540-3841 bioA
1061 FUFC01000011.1 GCA900157325_01188 gene open 3831-4823 bioB
1062 FUFC01000011.1 GCA900157325_01189 gene open 5005-6537
1063 FUFC01000011.1 GCA900157325_01190 gene open 6563-7654
1064 FUFC01000011.1 GCA900157325_01191 gene open 8252-8383
1065 FUFC01000011.1 GCA900157325_01192 gene open 8733-9716 trpS
1066 FUFC01000011.1 GCA900157325_01193 gene open 9771-10190
1067 FUFC01000011.1 GCA900157325_01194 gene open 10190-10663 rlmH
1068 FUFC01000011.1 GCA900157325_01195 gene open 10725-11783 msrB
1069 FUFC01000011.1 GCA900157325_01196 gene open 11840-13024
1070 FUFC01000011.1 GCA900157325_01198 gene open 13431-14339 fieF
1071 FUFC01000011.1 GCA900157325_01199 gene open 14378-14731 folB
1072 FUFC01000011.1 GCA900157325_01200 gene open 14802-16061 plug
1073 FUFC01000011.1 GCA900157325_01201 gene open 16475-20995 tamB
1074 FUFC01000011.1 GCA900157325_01202 gene open 21444-23771 bamA
1075 FUFC01000011.1 GCA900157325_01203 gene open 23779-28569 asmA
1076 FUFC01000011.1 GCA900157325_01204 gene open 28675-29616 prs
1077 FUFC01000011.1 GCA900157325_01205 gene open 29812-31086 srmB
1078 FUFC01000011.1 GCA900157325_01206 gene open 31687-32661
1079 FUFC01000011.1 GCA900157325_01207 gene open 32835-34424
1080 FUFC01000011.1 GCA900157325_01208 gene open 34905-35102
1081 FUFC01000011.1 GCA900157325_01209 gene open 35190-36812 cTD-A
1082 FUFC01000011.1 GCA900157325_01211 gene open 37754-38314
1083 FUFC01000011.1 GCA900157325_01212 gene open 38515-39192 porT
1084 FUFC01000011.1 GCA900157325_01213 gene open 39311-40423 thiH
1085 FUFC01000011.1 GCA900157325_01214 gene open 40436-41209 thiG
1086 FUFC01000011.1 GCA900157325_01215 gene open 41274-43217 thiE
1087 FUFC01000011.1 GCA900157325_01216 gene open 43214-45043 thiC
1088 FUFC01000011.1 GCA900157325_01217 gene open 45047-45247 thiS
1089 FUFC01000011.1 GCA900157325_01218 gene open 45648-46388
1090 FUFC01000011.1 GCA900157325_01219 gene open 46647-47030
1091 FUFC01000011.1 GCA900157325_01220 gene open 47058-47702
1092 FUFC01000011.1 GCA900157325_01221 gene open 48031-48300
1093 FUFC01000011.1 GCA900157325_01222 gene open 49127-49705 rpsP
1094 FUFC01000011.1 GCA900157325_01224 gene open 50490-51461 mviM
1095 FUFC01000011.1 GCA900157325_01225 gene open 51580-52389 phnP
1096 FUFC01000011.1 GCA900157325_01226 gene open 52442-53521 ansA
1097 FUFC01000011.1 GCA900157325_01227 gene open 53533-53820
1098 FUFC01000011.1 GCA900157325_01228 gene open 54121-55131 gap
1099 FUFC01000011.1 GCA900157325_01229 gene open 55271-56179 araC
1100 FUFC01000011.1 GCA900157325_01230 gene open 56330-57004 yggS
1101 FUFC01000011.1 GCA900157325_01231 gene open 57001-57444
1102 FUFC01000011.1 GCA900157325_01232 gene open 57995-58576
1103 FUFC01000011.1 GCA900157325_01233 gene open 58602-60074 ompA
1104 FUFC01000011.1 GCA900157325_01234 gene open 60125-61279 fimA
1105 FUFC01000011.1 GCA900157325_01235 gene open 61418-62329 fimB
1106 FUFC01000011.1 GCA900157325_01236 gene open 62316-63713 fimC
1107 FUFC01000011.1 GCA900157325_01237 gene open 63728-65740 fimD
1108 FUFC01000011.1 GCA900157325_01238 gene open 65737-67389 fimE
1109 FUFC01000011.1 GCA900157325_01239 gene open 67922-68473 yceD
1110 FUFC01000011.1 GCA900157325_01240 gene open 68480-68665 rpmF
1111 FUFC01000011.1 GCA900157325_01241 gene open 68845-69852 fabH
1112 FUFC01000011.1 GCA900157325_01242 gene open 69931-70830 era
1113 FUFC01000011.1 GCA900157325_01243 gene open 70893-72206 der
1114 FUFC01000011.1 GCA900157325_01244 gene open 72257-75556
1115 FUFC01000011.1 GCA900157325_01245 gene open 75557-76204 pgaB
1116 FUFC01000011.1 GCA900157325_01246 gene open 76230-76916 mnmC
1117 FUFC01000011.1 GCA900157325_01247 gene open 77115-77696 xpt
1118 FUFC01000011.1 GCA900157325_01248 gene open 77815-79071
1119 FUFC01000011.1 GCA900157325_01249 gene open 79232-79903 porT
1120 FUFC01000011.1 GCA900157325_01250 gene open 79963-81468 sleL
1121 FUFC01000011.1 GCA900157325_01252 gene open 82945-83130
1122 FUFC01000011.1 GCA900157325_01253 gene open 83157-84047 traB
1123 FUFC01000011.1 GCA900157325_01254 gene open 84084-84830 rsmE
1124 FUFC01000011.1 GCA900157325_01255 gene open 85178-86179 iap
1125 FUFC01000011.1 GCA900157325_01256 gene open 86203-86628 sufE
1126 FUFC01000011.1 GCA900157325_01257 gene open 86632-88029 hemG
1127 FUFC01000011.1 GCA900157325_01210 gene open 37458-37531 trnM
1128 FUFC01000011.1 GCA900157325_01251 gene open 82750-82822 trnP
1129 FUFC01000011.1 GCA900157325_01210 tRNA open 37458-37531 trnM tRNA-Met(cat)
1130 FUFC01000011.1 GCA900157325_01251 tRNA open 82750-82822 trnP tRNA-Pro(cgg)
1131 FUFC01000012.1 GCA900157325_00672 CDS open 357-4331 _na     1324_aa sSL2 site-specific DNA-methyltransferase (adenine-specific)
1132 FUFC01000012.1 GCA900157325_00673 CDS open 4341-5345 _na     334_aa Type II DNA modification methyltransferase
1133 FUFC01000012.1 GCA900157325_00674 CDS open 5547-6011 _na     154_aa hypothetical protein
1134 FUFC01000012.1 GCA900157325_00675 CDS open 6413-7507 _na     364_aa mltG Endolytic murein transglycosylase
1135 FUFC01000012.1 GCA900157325_00676 CDS open 7504-8253 _na     249_aa tcdA HesA/MoeB/ThiF family protein
1136 FUFC01000012.1 GCA900157325_00677 CDS open 8250-8909 _na     219_aa lolD Lipoprotein-releasing system ATP-binding protein LolD
1137 FUFC01000012.1 GCA900157325_00678 CDS open 8939-9643 _na     234_aa comEA Competence protein ComEA helix-hairpin-helix repeat region
1138 FUFC01000012.1 GCA900157325_00679 CDS open 9650-10312 _na     220_aa tsaC L-threonylcarbamoyladenylate synthase
1139 FUFC01000012.1 GCA900157325_00680 CDS open 10734-11204 _na     156_aa greA transcription elongation factor GreA
1140 FUFC01000012.1 GCA900157325_00681 CDS open 11220-11609 _na     129_aa hinT HIT family protein
1141 FUFC01000012.1 GCA900157325_00682 CDS open 11923-12183 _na     86_aa Sugar efflux transporter for intercellular exchange
1142 FUFC01000012.1 GCA900157325_00683 CDS open 12423-13103 _na     226_aa hypothetical protein
1143 FUFC01000012.1 GCA900157325_00684 CDS open 13252-13404 _na     50_aa hypothetical protein
1144 FUFC01000012.1 GCA900157325_00685 CDS open 13961-14437 _na     158_aa Outer membrane protein beta-barrel domain-containing protein
1145 FUFC01000012.1 GCA900157325_00686 CDS open 14434-15720 _na     428_aa Glycoside hydrolase family 57 N-terminal domain-containing protein
1146 FUFC01000012.1 GCA900157325_00687 CDS open 15717-16967 _na     416_aa rfaB Glycosyl transferase%2C group 1 family protein
1147 FUFC01000012.1 GCA900157325_00688 CDS open 16976-18952 _na     658_aa gDB1 Putative 4-alpha-glucanotransferase
1148 FUFC01000012.1 GCA900157325_00689 CDS open 19082-19228 _na     48_aa hypothetical protein
1149 FUFC01000012.1 GCA900157325_00690 CDS open 19439-20140 _na     233_aa Putative ATP-binding component of ABC transporter protein
1150 FUFC01000012.1 GCA900157325_00691 CDS open 20175-21647 _na     490_aa DUF5687 domain-containing protein
1151 FUFC01000012.1 GCA900157325_00692 CDS open 21766-23022 _na     418_aa pgk Phosphoglycerate kinase
1152 FUFC01000012.1 GCA900157325_00693 CDS open 23317-24924 _na     535_aa pckA phosphoenolpyruvate carboxykinase (ATP)
1153 FUFC01000012.1 GCA900157325_00694 CDS open 25115-25381 _na     88_aa putative partial hemagglutinin-related protein
1154 FUFC01000012.1 GCA900157325_00695 CDS open 25327-25689 _na     120_aa putative partial hemagglutinin-related protein
1155 FUFC01000012.1 GCA900157325_00672 gene open 357-4331 sSL2
1156 FUFC01000012.1 GCA900157325_00673 gene open 4341-5345
1157 FUFC01000012.1 GCA900157325_00674 gene open 5547-6011
1158 FUFC01000012.1 GCA900157325_00675 gene open 6413-7507 mltG
1159 FUFC01000012.1 GCA900157325_00676 gene open 7504-8253 tcdA
1160 FUFC01000012.1 GCA900157325_00677 gene open 8250-8909 lolD
1161 FUFC01000012.1 GCA900157325_00678 gene open 8939-9643 comEA
1162 FUFC01000012.1 GCA900157325_00679 gene open 9650-10312 tsaC
1163 FUFC01000012.1 GCA900157325_00680 gene open 10734-11204 greA
1164 FUFC01000012.1 GCA900157325_00681 gene open 11220-11609 hinT
1165 FUFC01000012.1 GCA900157325_00682 gene open 11923-12183
1166 FUFC01000012.1 GCA900157325_00683 gene open 12423-13103
1167 FUFC01000012.1 GCA900157325_00684 gene open 13252-13404
1168 FUFC01000012.1 GCA900157325_00685 gene open 13961-14437
1169 FUFC01000012.1 GCA900157325_00686 gene open 14434-15720
1170 FUFC01000012.1 GCA900157325_00687 gene open 15717-16967 rfaB
1171 FUFC01000012.1 GCA900157325_00688 gene open 16976-18952 gDB1
1172 FUFC01000012.1 GCA900157325_00689 gene open 19082-19228
1173 FUFC01000012.1 GCA900157325_00690 gene open 19439-20140
1174 FUFC01000012.1 GCA900157325_00691 gene open 20175-21647
1175 FUFC01000012.1 GCA900157325_00692 gene open 21766-23022 pgk
1176 FUFC01000012.1 GCA900157325_00693 gene open 23317-24924 pckA
1177 FUFC01000012.1 GCA900157325_00694 gene open 25115-25381
1178 FUFC01000012.1 GCA900157325_00695 gene open 25327-25689
1179 FUFC01000013.1 GCA900157325_00570 CDS open 276-716 _na     146_aa hypothetical protein
1180 FUFC01000013.1 GCA900157325_00571 CDS open 786-1184 _na     132_aa hypothetical protein
1181 FUFC01000013.1 GCA900157325_00572 CDS open 1635-2075 _na     146_aa hypothetical protein
1182 FUFC01000013.1 GCA900157325_00573 CDS open 2145-2543 _na     132_aa hypothetical protein
1183 FUFC01000013.1 GCA900157325_00574 CDS open 3988-4512 _na     174_aa hypothetical protein
1184 FUFC01000013.1 GCA900157325_00575 CDS open 4713-5945 _na     410_aa nupG Nucleoside permease NupG
1185 FUFC01000013.1 GCA900157325_00576 CDS open 6051-7385 _na     444_aa DUF4270 domain-containing protein
1186 FUFC01000013.1 GCA900157325_00577 CDS open 7521-8336 _na     271_aa glgA starch synthase
1187 FUFC01000013.1 GCA900157325_00578 CDS open 8964-11087 _na     707_aa recQ ATP-dependent DNA helicase RecQ
1188 FUFC01000013.1 GCA900157325_00579 CDS open 11555-13228 _na     557_aa fAA1 Long-chain-fatty-acid--CoA ligase%2C putative
1189 FUFC01000013.1 GCA900157325_00580 CDS open 13399-13611 _na     70_aa Lipoprotein
1190 FUFC01000013.1 GCA900157325_00581 CDS open 13830-14333 _na     167_aa rpoE RNA polymerase sigma-70 factor%2C ECF subfamily
1191 FUFC01000013.1 GCA900157325_00582 CDS open 14470-14889 _na     139_aa ykvA DUF1232 domain-containing protein
1192 FUFC01000013.1 GCA900157325_00570 gene open 276-716
1193 FUFC01000013.1 GCA900157325_00571 gene open 786-1184
1194 FUFC01000013.1 GCA900157325_00572 gene open 1635-2075
1195 FUFC01000013.1 GCA900157325_00573 gene open 2145-2543
1196 FUFC01000013.1 GCA900157325_00574 gene open 3988-4512
1197 FUFC01000013.1 GCA900157325_00575 gene open 4713-5945 nupG
1198 FUFC01000013.1 GCA900157325_00576 gene open 6051-7385
1199 FUFC01000013.1 GCA900157325_00577 gene open 7521-8336 glgA
1200 FUFC01000013.1 GCA900157325_00578 gene open 8964-11087 recQ
1201 FUFC01000013.1 GCA900157325_00579 gene open 11555-13228 fAA1
1202 FUFC01000013.1 GCA900157325_00580 gene open 13399-13611
1203 FUFC01000013.1 GCA900157325_00581 gene open 13830-14333 rpoE
1204 FUFC01000013.1 GCA900157325_00582 gene open 14470-14889 ykvA
1205 FUFC01000014.1 regulatory_region open 25918-26154 Cobalamin riboswitch aptamer
1206 FUFC01000014.1 regulatory_region open 41577-41779 Cobalamin riboswitch aptamer
1207 FUFC01000014.1 GCA900157325_00532 CDS open 408-641 _na     77_aa hypothetical protein
1208 FUFC01000014.1 GCA900157325_00533 CDS open 782-2335 _na     517_aa Diguanylate cyclase
1209 FUFC01000014.1 GCA900157325_00534 CDS open 2618-3277 _na     219_aa lolD ABC transporter%2C ATP-binding protein
1210 FUFC01000014.1 GCA900157325_00535 CDS open 3370-5745 _na     791_aa salY ABC transporter%2C permease protein%2C putative
1211 FUFC01000014.1 GCA900157325_00536 CDS open 5772-8138 _na     788_aa lolE ABC transporter%2C permease protein%2C putative
1212 FUFC01000014.1 GCA900157325_00537 CDS open 8177-10528 _na     783_aa ABC transporter%2C permease protein%2C putative
1213 FUFC01000014.1 GCA900157325_00538 CDS open 10886-12139 _na     417_aa acrA Efflux transporter%2C MFP component%2C RND family
1214 FUFC01000014.1 GCA900157325_00539 CDS open 12179-13513 _na     444_aa tolC Outer membrane efflux protein
1215 FUFC01000014.1 GCA900157325_00540 CDS open 13716-14228 _na     170_aa pncA nicotinamidase
1216 FUFC01000014.1 GCA900157325_00541 CDS open 14261-15454 _na     397_aa lys9 Saccharopine dehydrogenase
1217 FUFC01000014.1 GCA900157325_00542 CDS open 15946-16707 _na     253_aa ydfG Oxidoreductase%2C short chain dehydrogenase/reductase family
1218 FUFC01000014.1 GCA900157325_00543 CDS open 16785-18392 _na     535_aa iorA Indolepyruvate oxidoreductase subunit IorA
1219 FUFC01000014.1 GCA900157325_00544 CDS open 18419-19012 _na     197_aa porG indolepyruvate oxidoreductase subunit beta
1220 FUFC01000014.1 GCA900157325_00545 CDS open 19411-20169 _na     252_aa fepC Putative iron compound ABC transporter ATP-binding protein
1221 FUFC01000014.1 GCA900157325_00546 CDS open 20213-21283 _na     356_aa fepD Iron compound ABC transporter%2C permease protein
1222 FUFC01000014.1 GCA900157325_00547 CDS open 21280-22419 _na     379_aa fepB Fe/B12 periplasmic-binding domain-containing protein
1223 FUFC01000014.1 GCA900157325_00548 CDS open 22537-23418 _na     293_aa cbiK Heme-binding protein FetB
1224 FUFC01000014.1 GCA900157325_00549 CDS open 23447-25720 _na     757_aa fepA TonB-dependent receptor
1225 FUFC01000014.1 GCA900157325_00550 CDS open 26832-27920 _na     362_aa Aminoglycoside phosphotransferase domain-containing protein
1226 FUFC01000014.1 GCA900157325_00551 CDS open 28003-31374 _na     1123_aa lacZ beta-galactosidase
1227 FUFC01000014.1 GCA900157325_00552 CDS open 31388-32875 _na     495_aa mviM Glycosyl hydrolase family 109 protein
1228 FUFC01000014.1 GCA900157325_00553 CDS open 33525-34079 _na     184_aa nfnB Nitroreductase family protein
1229 FUFC01000014.1 GCA900157325_00554 CDS open 34072-34884 _na     270_aa DUF2520 domain-containing protein
1230 FUFC01000014.1 GCA900157325_00555 CDS open 34901-35422 _na     173_aa kdsC putative hydrolase
1231 FUFC01000014.1 GCA900157325_00556 CDS open 35462-36061 _na     199_aa maf dTTP/UTP pyrophosphatase
1232 FUFC01000014.1 GCA900157325_00557 CDS open 36123-36275 _na     50_aa rpmH 50S ribosomal protein L34
1233 FUFC01000014.1 GCA900157325_00558 CDS open 36528-37700 _na     390_aa cTD-A Secretion system C-terminal sorting domain-containing protein
1234 FUFC01000014.1 GCA900157325_00559 CDS open 37759-39000 _na     413_aa serB protein-serine phosphatase SerB
1235 FUFC01000014.1 GCA900157325_00560 CDS open 39012-39314 _na     100_aa Stress-response A/B barrel domain-containing protein
1236 FUFC01000014.1 GCA900157325_00562 CDS open 39591-40142 _na     183_aa rnaY HD domain-containing protein
1237 FUFC01000014.1 GCA900157325_00563 CDS open 40249-40632 _na     127_aa DUF3276 domain-containing protein
1238 FUFC01000014.1 GCA900157325_00564 CDS open 40759-41343 _na     194_aa DUF3109 domain-containing protein
1239 FUFC01000014.1 GCA900157325_00565 CDS open 41807-43102 _na     431_aa fepB Fe/B12 periplasmic-binding domain-containing protein
1240 FUFC01000014.1 GCA900157325_00566 CDS open 43099-44133 _na     344_aa fepD Iron compound ABC transporter%2C permease protein
1241 FUFC01000014.1 GCA900157325_00567 CDS open 44141-45142 _na     333_aa fepC Putative iron compound ABC transporter ATP-binding protein
1242 FUFC01000014.1 GCA900157325_00568 CDS open 45166-46329 _na     387_aa cbiZ Adenosylcobinamide amidohydrolase
1243 FUFC01000014.1 GCA900157325_00569 CDS open 46343-48463 _na     706_aa TonB-linked receptor Tlr
1244 FUFC01000014.1 GCA900157325_00532 gene open 408-641
1245 FUFC01000014.1 GCA900157325_00533 gene open 782-2335
1246 FUFC01000014.1 GCA900157325_00534 gene open 2618-3277 lolD
1247 FUFC01000014.1 GCA900157325_00535 gene open 3370-5745 salY
1248 FUFC01000014.1 GCA900157325_00536 gene open 5772-8138 lolE
1249 FUFC01000014.1 GCA900157325_00537 gene open 8177-10528
1250 FUFC01000014.1 GCA900157325_00538 gene open 10886-12139 acrA
1251 FUFC01000014.1 GCA900157325_00539 gene open 12179-13513 tolC
1252 FUFC01000014.1 GCA900157325_00540 gene open 13716-14228 pncA
1253 FUFC01000014.1 GCA900157325_00541 gene open 14261-15454 lys9
1254 FUFC01000014.1 GCA900157325_00542 gene open 15946-16707 ydfG
1255 FUFC01000014.1 GCA900157325_00543 gene open 16785-18392 iorA
1256 FUFC01000014.1 GCA900157325_00544 gene open 18419-19012 porG
1257 FUFC01000014.1 GCA900157325_00545 gene open 19411-20169 fepC
1258 FUFC01000014.1 GCA900157325_00546 gene open 20213-21283 fepD
1259 FUFC01000014.1 GCA900157325_00547 gene open 21280-22419 fepB
1260 FUFC01000014.1 GCA900157325_00548 gene open 22537-23418 cbiK
1261 FUFC01000014.1 GCA900157325_00549 gene open 23447-25720 fepA
1262 FUFC01000014.1 GCA900157325_00550 gene open 26832-27920
1263 FUFC01000014.1 GCA900157325_00551 gene open 28003-31374 lacZ
1264 FUFC01000014.1 GCA900157325_00552 gene open 31388-32875 mviM
1265 FUFC01000014.1 GCA900157325_00553 gene open 33525-34079 nfnB
1266 FUFC01000014.1 GCA900157325_00554 gene open 34072-34884
1267 FUFC01000014.1 GCA900157325_00555 gene open 34901-35422 kdsC
1268 FUFC01000014.1 GCA900157325_00556 gene open 35462-36061 maf
1269 FUFC01000014.1 GCA900157325_00557 gene open 36123-36275 rpmH
1270 FUFC01000014.1 GCA900157325_00558 gene open 36528-37700 cTD-A
1271 FUFC01000014.1 GCA900157325_00559 gene open 37759-39000 serB
1272 FUFC01000014.1 GCA900157325_00560 gene open 39012-39314
1273 FUFC01000014.1 GCA900157325_00562 gene open 39591-40142 rnaY
1274 FUFC01000014.1 GCA900157325_00563 gene open 40249-40632
1275 FUFC01000014.1 GCA900157325_00564 gene open 40759-41343
1276 FUFC01000014.1 GCA900157325_00565 gene open 41807-43102 fepB
1277 FUFC01000014.1 GCA900157325_00566 gene open 43099-44133 fepD
1278 FUFC01000014.1 GCA900157325_00567 gene open 44141-45142 fepC
1279 FUFC01000014.1 GCA900157325_00568 gene open 45166-46329 cbiZ
1280 FUFC01000014.1 GCA900157325_00569 gene open 46343-48463
1281 FUFC01000014.1 GCA900157325_00561 gene open 39481-39564 trnL
1282 FUFC01000014.1 GCA900157325_00561 tRNA open 39481-39564 trnL tRNA-Leu(caa)
1283 FUFC01000015.1 GCA900157325_01640 CDS open 225-1523 _na     432_aa dinP UmuC protein
1284 FUFC01000015.1 GCA900157325_01641 CDS open 1531-1956 _na     141_aa lexA Translesion error-prone DNA polymerase V autoproteolytic subunit
1285 FUFC01000015.1 GCA900157325_01642 CDS open 2019-2204 _na     61_aa hypothetical protein
1286 FUFC01000015.1 GCA900157325_01643 CDS open 2268-2441 _na     57_aa hypothetical protein
1287 FUFC01000015.1 GCA900157325_01644 CDS open 2923-3387 _na     154_aa ybbJ Membrane protein%2C putative
1288 FUFC01000015.1 GCA900157325_01645 CDS open 3415-4395 _na     326_aa hflC Band 7/Mec-2 family protein
1289 FUFC01000015.1 GCA900157325_01646 CDS open 4392-5591 _na     399_aa lipid A deacylase
1290 FUFC01000015.1 GCA900157325_01647 CDS open 5737-7728 _na     663_aa pntB Re/Si-specific NAD(P)(+) transhydrogenase subunit beta
1291 FUFC01000015.1 GCA900157325_01648 CDS open 7725-8039 _na     104_aa pntA proton-translocating NAD(P)(+) transhydrogenase
1292 FUFC01000015.1 GCA900157325_01649 CDS open 8149-9306 _na     385_aa pntA proton-translocating NAD(P)(+) transhydrogenase
1293 FUFC01000015.1 GCA900157325_01650 CDS open 9685-10104 _na     139_aa mscL large-conductance mechanosensitive channel protein MscL
1294 FUFC01000015.1 GCA900157325_01651 CDS open 10870-13026 _na     718_aa patZN Acetyltransferase
1295 FUFC01000015.1 GCA900157325_01652 CDS open 13069-14379 _na     436_aa aspB Aminotransferase class I/classII large domain-containing protein
1296 FUFC01000015.1 GCA900157325_01653 CDS open 14508-15617 _na     369_aa cTD-A Cleaved adhesin domain-containing protein
1297 FUFC01000015.1 GCA900157325_01654 CDS open 15838-16146 _na     102_aa DUF4286 domain-containing protein
1298 FUFC01000015.1 GCA900157325_01655 CDS open 16154-16723 _na     189_aa ruvC crossover junction endodeoxyribonuclease RuvC
1299 FUFC01000015.1 GCA900157325_01656 CDS open 16771-18105 _na     444_aa ylaK PhoH family protein
1300 FUFC01000015.1 GCA900157325_01657 CDS open 18262-19929 _na     555_aa fhs formate--tetrahydrofolate ligase
1301 FUFC01000015.1 GCA900157325_01658 CDS open 20147-20782 _na     211_aa ISPg1%2C transposase%2C internal deletion
1302 FUFC01000015.1 GCA900157325_01659 CDS open 21783-22388 _na     201_aa rpoE RNA polymerase sigma factor
1303 FUFC01000015.1 GCA900157325_01660 CDS open 22436-22846 _na     136_aa hypothetical protein
1304 FUFC01000015.1 GCA900157325_01661 CDS open 22819-23349 _na     176_aa Periplasmic heavy metal sensor
1305 FUFC01000015.1 GCA900157325_01662 CDS open 23424-23972 _na     182_aa slpA Peptidyl-prolyl cis-trans isomerase
1306 FUFC01000015.1 GCA900157325_01663 CDS open 24122-25228 _na     368_aa aroC chorismate synthase
1307 FUFC01000015.1 GCA900157325_01665 CDS open 25601-27259 _na     552_aa pepD Dipeptidase
1308 FUFC01000015.1 GCA900157325_01640 gene open 225-1523 dinP
1309 FUFC01000015.1 GCA900157325_01641 gene open 1531-1956 lexA
1310 FUFC01000015.1 GCA900157325_01642 gene open 2019-2204
1311 FUFC01000015.1 GCA900157325_01643 gene open 2268-2441
1312 FUFC01000015.1 GCA900157325_01644 gene open 2923-3387 ybbJ
1313 FUFC01000015.1 GCA900157325_01645 gene open 3415-4395 hflC
1314 FUFC01000015.1 GCA900157325_01646 gene open 4392-5591
1315 FUFC01000015.1 GCA900157325_01647 gene open 5737-7728 pntB
1316 FUFC01000015.1 GCA900157325_01648 gene open 7725-8039 pntA
1317 FUFC01000015.1 GCA900157325_01649 gene open 8149-9306 pntA
1318 FUFC01000015.1 GCA900157325_01650 gene open 9685-10104 mscL
1319 FUFC01000015.1 GCA900157325_01651 gene open 10870-13026 patZN
1320 FUFC01000015.1 GCA900157325_01652 gene open 13069-14379 aspB
1321 FUFC01000015.1 GCA900157325_01653 gene open 14508-15617 cTD-A
1322 FUFC01000015.1 GCA900157325_01654 gene open 15838-16146
1323 FUFC01000015.1 GCA900157325_01655 gene open 16154-16723 ruvC
1324 FUFC01000015.1 GCA900157325_01656 gene open 16771-18105 ylaK
1325 FUFC01000015.1 GCA900157325_01657 gene open 18262-19929 fhs
1326 FUFC01000015.1 GCA900157325_01658 gene open 20147-20782
1327 FUFC01000015.1 GCA900157325_01659 gene open 21783-22388 rpoE
1328 FUFC01000015.1 GCA900157325_01660 gene open 22436-22846
1329 FUFC01000015.1 GCA900157325_01661 gene open 22819-23349
1330 FUFC01000015.1 GCA900157325_01662 gene open 23424-23972 slpA
1331 FUFC01000015.1 GCA900157325_01663 gene open 24122-25228 aroC
1332 FUFC01000015.1 GCA900157325_01665 gene open 25601-27259 pepD
1333 FUFC01000015.1 GCA900157325_01664 gene open 25454-25528 trnR
1334 FUFC01000015.1 GCA900157325_01664 tRNA open 25454-25528 trnR tRNA-Arg(cct)
1335 FUFC01000016.1 GCA900157325_00583 CDS open 13-102 _na     29_aa hypothetical protein
1336 FUFC01000016.1 GCA900157325_00584 CDS open 184-3408 _na     1074_aa DNA 3'-5' helicase
1337 FUFC01000016.1 GCA900157325_00585 CDS open 3405-4265 _na     286_aa alr0228 Putative acyltransferase ACT14924-like acyltransferase domain-containing protein
1338 FUFC01000016.1 GCA900157325_00586 CDS open 4310-5236 _na     308_aa pgsA CDP-alcohol phosphatidyltransferase
1339 FUFC01000016.1 GCA900157325_00587 CDS open 5248-5979 _na     243_aa fabG Oxidoreductase%2C short chain dehydrogenase/reductase family
1340 FUFC01000016.1 GCA900157325_00588 CDS open 5985-6443 _na     152_aa tagD Glycerol-3-phosphate cytidylyltransferase
1341 FUFC01000016.1 GCA900157325_00589 CDS open 6465-7562 _na     365_aa pdxA 4-hydroxythreonine-4-phosphate dehydrogenase PdxA
1342 FUFC01000016.1 GCA900157325_00590 CDS open 7606-8661 _na     351_aa Lipoprotein
1343 FUFC01000016.1 GCA900157325_00591 CDS open 8752-9765 _na     337_aa rlmN 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN
1344 FUFC01000016.1 GCA900157325_00592 CDS open 10440-11777 _na     445_aa hisS histidine--tRNA ligase
1345 FUFC01000016.1 GCA900157325_00593 CDS open 11865-12353 _na     162_aa folA Dihydrofolate reductase
1346 FUFC01000016.1 GCA900157325_00594 CDS open 12399-13193 _na     264_aa thyA thymidylate synthase
1347 FUFC01000016.1 GCA900157325_00595 CDS open 13426-14223 _na     265_aa Peptidase M48 family protein
1348 FUFC01000016.1 GCA900157325_00596 CDS open 14432-15313 _na     293_aa Peptidase
1349 FUFC01000016.1 GCA900157325_00597 CDS open 15555-17492 _na     645_aa abc-f ribosomal protection-like ABC-F family protein
1350 FUFC01000016.1 GCA900157325_00598 CDS open 17489-19576 _na     695_aa pilF TPR domain protein
1351 FUFC01000016.1 GCA900157325_00599 CDS open 19612-20289 _na     225_aa def peptide deformylase
1352 FUFC01000016.1 GCA900157325_00600 CDS open 20286-20924 _na     212_aa ruvX Holliday junction resolvase RuvX
1353 FUFC01000016.1 GCA900157325_00601 CDS open 21204-26927 _na     1907_aa yfaS Alpha-2-macroglobulin domain-containing protein
1354 FUFC01000016.1 GCA900157325_00602 CDS open 26941-27885 _na     314_aa panE 2-dehydropantoate 2-reductase
1355 FUFC01000016.1 GCA900157325_00603 CDS open 28021-29637 _na     538_aa uup ABC transporter%2C ATP-binding protein
1356 FUFC01000016.1 GCA900157325_00604 CDS open 29913-30932 _na     339_aa wcaG 3-beta hydroxysteroid dehydrogenase/isomerase domain-containing protein
1357 FUFC01000016.1 GCA900157325_00605 CDS open 31180-31434 _na     84_aa Major facilitator superfamily (MFS) profile domain-containing protein
1358 FUFC01000016.1 GCA900157325_00606 CDS open 31458-34316 _na     952_aa uvrA excinuclease ABC subunit UvrA
1359 FUFC01000016.1 GCA900157325_00610 CDS open 35353-35535 _na     60_aa nirB Bacterioferritin-associated ferredoxin
1360 FUFC01000016.1 GCA900157325_00611 CDS open 35769-35966 _na     65_aa hypothetical protein
1361 FUFC01000016.1 GCA900157325_00583 gene open 13-102
1362 FUFC01000016.1 GCA900157325_00584 gene open 184-3408
1363 FUFC01000016.1 GCA900157325_00585 gene open 3405-4265 alr0228
1364 FUFC01000016.1 GCA900157325_00586 gene open 4310-5236 pgsA
1365 FUFC01000016.1 GCA900157325_00587 gene open 5248-5979 fabG
1366 FUFC01000016.1 GCA900157325_00588 gene open 5985-6443 tagD
1367 FUFC01000016.1 GCA900157325_00589 gene open 6465-7562 pdxA
1368 FUFC01000016.1 GCA900157325_00590 gene open 7606-8661
1369 FUFC01000016.1 GCA900157325_00591 gene open 8752-9765 rlmN
1370 FUFC01000016.1 GCA900157325_00592 gene open 10440-11777 hisS
1371 FUFC01000016.1 GCA900157325_00593 gene open 11865-12353 folA
1372 FUFC01000016.1 GCA900157325_00594 gene open 12399-13193 thyA
1373 FUFC01000016.1 GCA900157325_00595 gene open 13426-14223
1374 FUFC01000016.1 GCA900157325_00596 gene open 14432-15313
1375 FUFC01000016.1 GCA900157325_00597 gene open 15555-17492 abc-f
1376 FUFC01000016.1 GCA900157325_00598 gene open 17489-19576 pilF
1377 FUFC01000016.1 GCA900157325_00599 gene open 19612-20289 def
1378 FUFC01000016.1 GCA900157325_00600 gene open 20286-20924 ruvX
1379 FUFC01000016.1 GCA900157325_00601 gene open 21204-26927 yfaS
1380 FUFC01000016.1 GCA900157325_00602 gene open 26941-27885 panE
1381 FUFC01000016.1 GCA900157325_00603 gene open 28021-29637 uup
1382 FUFC01000016.1 GCA900157325_00604 gene open 29913-30932 wcaG
1383 FUFC01000016.1 GCA900157325_00605 gene open 31180-31434
1384 FUFC01000016.1 GCA900157325_00606 gene open 31458-34316 uvrA
1385 FUFC01000016.1 GCA900157325_00610 gene open 35353-35535 nirB
1386 FUFC01000016.1 GCA900157325_00611 gene open 35769-35966
1387 FUFC01000016.1 GCA900157325_00607 gene open 34439-34522 trnL
1388 FUFC01000016.1 GCA900157325_00608 gene open 34557-34639 trnL
1389 FUFC01000016.1 GCA900157325_00609 gene open 34727-34802 trnG
1390 FUFC01000016.1 GCA900157325_00607 tRNA open 34439-34522 trnL tRNA-Leu(gag)
1391 FUFC01000016.1 GCA900157325_00608 tRNA open 34557-34639 trnL tRNA-Leu(cag)
1392 FUFC01000016.1 GCA900157325_00609 tRNA open 34727-34802 trnG tRNA-Gly(gcc)
1393 FUFC01000017.1 repeat_region open 32738-33156 CRISPR array with 6 repeats of length 37%2C consensus sequence CTCACTATACATACACAGTCCGTAAGGCTATTAAGAC and spacer length 37
1394 FUFC01000017.1 GCA900157325_00702 CDS open 782-2530 _na     582_aa manB Phosphomannomutase
1395 FUFC01000017.1 GCA900157325_00703 CDS open 2603-3340 _na     245_aa recO DNA repair protein RecO
1396 FUFC01000017.1 GCA900157325_00704 CDS open 3910-6411 _na     833_aa fepA TonB-dependent receptor%2C putative
1397 FUFC01000017.1 GCA900157325_00705 CDS open 6708-7067 _na     119_aa hypothetical protein
1398 FUFC01000017.1 GCA900157325_00706 CDS open 7576-8568 _na     330_aa yeiH UPF0324 membrane protein PG_2004
1399 FUFC01000017.1 GCA900157325_00707 CDS open 8718-10055 _na     445_aa dgt Deoxyguanosinetriphosphate triphosphohydrolase
1400 FUFC01000017.1 GCA900157325_00708 CDS open 10116-10832 _na     238_aa dapB 4-hydroxy-tetrahydrodipicolinate reductase
1401 FUFC01000017.1 GCA900157325_00709 CDS open 10848-12245 _na     465_aa lepB signal peptidase I
1402 FUFC01000017.1 GCA900157325_00710 CDS open 12235-12861 _na     208_aa lepB signal peptidase I
1403 FUFC01000017.1 GCA900157325_00711 CDS open 12882-13520 _na     212_aa WbqC-like protein
1404 FUFC01000017.1 GCA900157325_00712 CDS open 13578-14552 _na     324_aa ispA Polyprenyl synthetase
1405 FUFC01000017.1 GCA900157325_00713 CDS open 14661-14822 _na     53_aa hypothetical protein
1406 FUFC01000017.1 GCA900157325_00714 CDS open 14863-15711 _na     282_aa deoC deoxyribose-phosphate aldolase
1407 FUFC01000017.1 GCA900157325_00715 CDS open 15719-16069 _na     116_aa mazG NTP pyrophosphohydrolase MazG-like domain-containing protein
1408 FUFC01000017.1 GCA900157325_00716 CDS open 16074-16526 _na     150_aa dtd D-aminoacyl-tRNA deacylase
1409 FUFC01000017.1 GCA900157325_00717 CDS open 16533-18335 _na     600_aa uvrC excinuclease ABC subunit UvrC
1410 FUFC01000017.1 GCA900157325_00718 CDS open 18366-20243 _na     625_aa mnmG tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG
1411 FUFC01000017.1 GCA900157325_00719 CDS open 20981-22564 _na     527_aa CorA-like Mg2+ transporter protein
1412 FUFC01000017.1 GCA900157325_00720 CDS open 22566-22802 _na     78_aa hypothetical protein
1413 FUFC01000017.1 GCA900157325_00721 CDS open 22815-24113 _na     432_aa CRISPR-associated protein
1414 FUFC01000017.1 GCA900157325_00722 CDS open 24113-25720 _na     535_aa cas10 type III-B CRISPR-associated protein Cas10/Cmr2
1415 FUFC01000017.1 GCA900157325_00723 CDS open 25722-26936 _na     404_aa cmr3 type III-B CRISPR module-associated protein Cmr3
1416 FUFC01000017.1 GCA900157325_00724 CDS open 26950-27675 _na     241_aa cmr4 type III-B CRISPR module RAMP protein Cmr4
1417 FUFC01000017.1 GCA900157325_00725 CDS open 27672-28112 _na     146_aa CRISPR type III-B/RAMP module-associated protein Cmr5
1418 FUFC01000017.1 GCA900157325_00726 CDS open 28109-28870 _na     253_aa cmr6 type III-B CRISPR module RAMP protein Cmr6
1419 FUFC01000017.1 GCA900157325_00727 CDS open 28932-32027 _na     1031_aa cas1 CRISPR-associated endonuclease Cas1
1420 FUFC01000017.1 GCA900157325_00728 CDS open 32047-32337 _na     96_aa cas2 CRISPR-associated endonuclease Cas2
1421 FUFC01000017.1 GCA900157325_00729 CDS open 34213-36219 _na     668_aa DNA-binding protein
1422 FUFC01000017.1 GCA900157325_00730 CDS open 36585-37640 _na     351_aa hagC HagC hemagglutinin protein
1423 FUFC01000017.1 GCA900157325_00731 CDS open 37919-38944 _na     341_aa Lipoprotein
1424 FUFC01000017.1 GCA900157325_00732 CDS open 38956-39591 _na     211_aa Outer membrane protein beta-barrel domain-containing protein
1425 FUFC01000017.1 GCA900157325_00733 CDS open 39735-40787 _na     350_aa hagC HagC hemagglutinin protein
1426 FUFC01000017.1 GCA900157325_00734 CDS open 41340-42296 _na     318_aa cTD-A Secretion system C-terminal sorting domain-containing protein
1427 FUFC01000017.1 GCA900157325_00735 CDS open 42389-43276 _na     295_aa bepA TPR domain protein
1428 FUFC01000017.1 GCA900157325_00736 CDS open 43378-44376 _na     332_aa mscS Mechanosensitive ion channel protein MscS
1429 FUFC01000017.1 GCA900157325_00737 CDS open 44337-46133 _na     598_aa Chloride channel protein
1430 FUFC01000017.1 GCA900157325_00738 CDS open 46130-47536 _na     468_aa wcaJ Galactose-1-phosphate transferase
1431 FUFC01000017.1 GCA900157325_00739 CDS open 47533-48108 _na     191_aa tsaC L-threonylcarbamoyladenylate synthase
1432 FUFC01000017.1 GCA900157325_00740 CDS open 48234-49646 _na     470_aa Fic family protein
1433 FUFC01000017.1 GCA900157325_00741 CDS open 49942-50553 _na     203_aa HU domain-containing protein
1434 FUFC01000017.1 GCA900157325_00742 CDS open 50750-53017 _na     755_aa pitA Phosphate transporter
1435 FUFC01000017.1 GCA900157325_00743 CDS open 53240-53479 _na     79_aa rpmB 50S ribosomal protein L28
1436 FUFC01000017.1 GCA900157325_00744 CDS open 53499-53687 _na     62_aa rpmG 50S ribosomal protein L33
1437 FUFC01000017.1 GCA900157325_00745 CDS open 53706-53855 _na     49_aa DUF4295 domain-containing protein
1438 FUFC01000017.1 GCA900157325_00746 CDS open 53975-54112 _na     45_aa hypothetical protein
1439 FUFC01000017.1 GCA900157325_00747 CDS open 54254-54349 _na     31_aa hypothetical protein
1440 FUFC01000017.1 GCA900157325_00748 CDS open 54394-55689 _na     431_aa aCH1 4-hydroxybutyrate CoA-transferase
1441 FUFC01000017.1 GCA900157325_00749 CDS open 55834-55935 _na     33_aa hypothetical protein
1442 FUFC01000017.1 GCA900157325_00750 CDS open 56279-57298 _na     339_aa wcaG Putative NAD dependent epimerase
1443 FUFC01000017.1 GCA900157325_00751 CDS open 57302-58237 _na     311_aa yitT YitT family protein
1444 FUFC01000017.1 GCA900157325_00752 CDS open 58295-58942 _na     215_aa dedA DedA family protein
1445 FUFC01000017.1 GCA900157325_00753 CDS open 58970-60670 _na     566_aa glnS glutamine--tRNA ligase/YqeY domain fusion protein
1446 FUFC01000017.1 GCA900157325_00754 CDS open 61052-62212 _na     386_aa perM Membrane protein%2C putative
1447 FUFC01000017.1 GCA900157325_00755 CDS open 62674-63678 _na     334_aa mdh Malate dehydrogenase
1448 FUFC01000017.1 GCA900157325_00756 CDS open 63954-65375 _na     473_aa pldB Serine aminopeptidase S33 domain-containing protein
1449 FUFC01000017.1 GCA900157325_00757 CDS open 65400-68882 _na     1160_aa porW Por secretion system protein porW/sprE
1450 FUFC01000017.1 GCA900157325_00758 CDS open 68875-69681 _na     268_aa znuB ABC 3 transporter family protein
1451 FUFC01000017.1 GCA900157325_00759 CDS open 69674-70117 _na     147_aa With phospholipase A2
1452 FUFC01000017.1 GCA900157325_00760 CDS open 70139-71446 _na     435_aa aroA 3-phosphoshikimate 1-carboxyvinyltransferase
1453 FUFC01000017.1 GCA900157325_00761 CDS open 71604-72890 _na     428_aa DUF3667 domain-containing protein
1454 FUFC01000017.1 GCA900157325_00762 CDS open 72806-73165 _na     119_aa hypothetical protein
1455 FUFC01000017.1 GCA900157325_00763 CDS open 73484-73888 _na     134_aa rpsL 30S ribosomal protein S12
1456 FUFC01000017.1 GCA900157325_00764 CDS open 74124-74600 _na     158_aa rpsG 30S ribosomal protein S7
1457 FUFC01000017.1 GCA900157325_00765 CDS open 74613-76736 _na     707_aa fusA elongation factor G
1458 FUFC01000017.1 GCA900157325_00766 CDS open 76752-77057 _na     101_aa rpsJ 30S ribosomal protein S10
1459 FUFC01000017.1 GCA900157325_00767 CDS open 77080-77697 _na     205_aa rplC 50S ribosomal protein L3
1460 FUFC01000017.1 GCA900157325_00768 CDS open 77697-78326 _na     209_aa rplD 50S ribosomal protein L4
1461 FUFC01000017.1 GCA900157325_00769 CDS open 78341-78634 _na     97_aa rplW 50S ribosomal protein L23
1462 FUFC01000017.1 GCA900157325_00770 CDS open 78641-79465 _na     274_aa rplB 50S ribosomal protein L2
1463 FUFC01000017.1 GCA900157325_00771 CDS open 79488-79757 _na     89_aa rpsS 30S ribosomal protein S19
1464 FUFC01000017.1 GCA900157325_00772 CDS open 79812-80216 _na     134_aa rplV 50S ribosomal protein L22
1465 FUFC01000017.1 GCA900157325_00773 CDS open 80223-80963 _na     246_aa rpsC 30S ribosomal protein S3
1466 FUFC01000017.1 GCA900157325_00774 CDS open 80984-81418 _na     144_aa rplP 50S ribosomal protein L16
1467 FUFC01000017.1 GCA900157325_00775 CDS open 81424-81618 _na     64_aa rpmC 50S ribosomal protein L29
1468 FUFC01000017.1 GCA900157325_00776 CDS open 81632-81886 _na     84_aa rpsQ 30S ribosomal protein S17
1469 FUFC01000017.1 GCA900157325_00777 CDS open 81888-82253 _na     121_aa rplN 50S ribosomal protein L14
1470 FUFC01000017.1 GCA900157325_00778 CDS open 82312-82596 _na     94_aa rplX 50S ribosomal protein L24
1471 FUFC01000017.1 GCA900157325_00779 CDS open 82596-83156 _na     186_aa rplE 50S ribosomal protein L5
1472 FUFC01000017.1 GCA900157325_00780 CDS open 83158-83427 _na     89_aa rpsN 30S ribosomal protein S14
1473 FUFC01000017.1 GCA900157325_00781 CDS open 83478-83873 _na     131_aa rpsH 30S ribosomal protein S8
1474 FUFC01000017.1 GCA900157325_00782 CDS open 83892-84443 _na     183_aa rplF 50S ribosomal protein L6
1475 FUFC01000017.1 GCA900157325_00783 CDS open 84462-84806 _na     114_aa rplR 50S ribosomal protein L18
1476 FUFC01000017.1 GCA900157325_00784 CDS open 84812-85330 _na     172_aa rpsE 30S ribosomal protein S5
1477 FUFC01000017.1 GCA900157325_00785 CDS open 85552-85998 _na     148_aa rplO 50S ribosomal protein L15
1478 FUFC01000017.1 GCA900157325_00786 CDS open 86003-87343 _na     446_aa secY preprotein translocase subunit SecY
1479 FUFC01000017.1 GCA900157325_00787 CDS open 87343-88128 _na     261_aa map type I methionyl aminopeptidase
1480 FUFC01000017.1 GCA900157325_00788 CDS open 88131-88349 _na     72_aa infA translation initiation factor IF-1
1481 FUFC01000017.1 GCA900157325_00789 CDS open 88366-88482 _na     38_aa ykgO type B 50S ribosomal protein L36
1482 FUFC01000017.1 GCA900157325_00790 CDS open 88515-88895 _na     126_aa rpsM 30S ribosomal protein S13
1483 FUFC01000017.1 GCA900157325_00791 CDS open 88907-89293 _na     128_aa rpsK 30S ribosomal protein S11
1484 FUFC01000017.1 GCA900157325_00792 CDS open 89453-90058 _na     201_aa rpsD 30S ribosomal protein S4
1485 FUFC01000017.1 GCA900157325_00793 CDS open 90071-91063 _na     330_aa rpoA DNA-directed RNA polymerase subunit alpha
1486 FUFC01000017.1 GCA900157325_00794 CDS open 91069-91551 _na     160_aa rplQ 50S ribosomal protein L17
1487 FUFC01000017.1 GCA900157325_00795 CDS open 91838-92074 _na     78_aa transposase
1488 FUFC01000017.1 GCA900157325_00702 gene open 782-2530 manB
1489 FUFC01000017.1 GCA900157325_00703 gene open 2603-3340 recO
1490 FUFC01000017.1 GCA900157325_00704 gene open 3910-6411 fepA
1491 FUFC01000017.1 GCA900157325_00705 gene open 6708-7067
1492 FUFC01000017.1 GCA900157325_00706 gene open 7576-8568 yeiH
1493 FUFC01000017.1 GCA900157325_00707 gene open 8718-10055 dgt
1494 FUFC01000017.1 GCA900157325_00708 gene open 10116-10832 dapB
1495 FUFC01000017.1 GCA900157325_00709 gene open 10848-12245 lepB
1496 FUFC01000017.1 GCA900157325_00710 gene open 12235-12861 lepB
1497 FUFC01000017.1 GCA900157325_00711 gene open 12882-13520
1498 FUFC01000017.1 GCA900157325_00712 gene open 13578-14552 ispA
1499 FUFC01000017.1 GCA900157325_00713 gene open 14661-14822
1500 FUFC01000017.1 GCA900157325_00714 gene open 14863-15711 deoC